Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2021 May 26;11(6):298. doi: 10.1007/s13205-021-02764-1

Delayed hydrolysis of Raffinose Family Oligosaccharides (RFO) affects critical germination of chickpeas

V Kalaivani 1, Raje Nikarika 1, Naskar Shoma 1, Rex Arunraj 1,✉
PMCID: PMC8155159  PMID: 34194891

Abstract

Seed raffinose family oligosaccharides (RFOs) are converted into sucrose and galactose by α-galactosidase during germination. Seed osmopriming with a low concentration of potassium nitrate (KNO3) induces early and synchronized germination by activating hydrolases. Here, we report the effect of osmopriming on the germination indices of chickpea, its effects on α-galactosidase, and the fate of total RFOs. Chickpea seeds primed with 100 µM KNO3 show early and synchronized germination but with reduced vigour after 48 h after imbibition (HAI) due to excess sucrose accumulation. The KNO3 suppressed the activity of α-galactosidase during the imbibition stage that was later derepressed after 24 HAI, hence decreased the RFO levels accumulating high levels of sucrose after 48 HAI. The accumulated sucrose imposed a negative effect on the germination characteristics, particularly on seed vigour. Our results suggested that the sugar release and utilization were highly regulated and crucial during imbibition and germination; the enzyme α-galactosidase regulates sugar release from seed RFO reserve.

Keywords: RFO, KNO3, α-galactosidase, Osmopriming

Introduction

Germination involves complex physiological and biochemical processes determined by the underlying endogenous hormonal crosstalk and various micro-environmental cues (Li et al. 2019). The critical stage in seed germination is the phase II stage called the lag phase, a metabolically active stage marked by the activation of hydrolytic enzymes and processes essential for embryo development (Mirza et al. 2015). It is also known that seed priming revives the seed's metabolic activity during germination (Hameed et al. 2014). During this active physiological stage, GA induces amylases to hydrolyze seed starch reserve (Ma et al. 2017), sucrose synthase enables reversible conversion of sucrose and UDP (Hirose et al. 2008), endoxylanases breakdown arabinoxylan (De Backer et al. 2010), and phytases hydrolyze phytate (Raboy 2003) to mobilizes sugars, phosphate, and minerals to the growing embryo. Barley endo-β-mannanase encoded by HvMAN1 (Fernandez et al. 2020) and rice mannase genes (OsMAN1, OsMAN2, and OsMAN6) (Ren et al. 2008) are highly expressed at 48 h of germination and before radicle emergence, respectively. Similarly, alpha-galactosidases breakdown seed raffinose family oligosaccharide (RFO) during germination in chickpea (Arunraj et al. 2020).

Seed priming increases germination rate and crop establishment reduces mean germination time (Noorhosseini et al. 2018), uniform emergence (Toklu et al. 2015) and improves field performance (Hussian et al. 2013). Potassium (K) is one of the major nutrients that control many physiological and biochemical processes in the plant, such as enzyme activation, cell osmotic potential regulation, and cell pH stabilization; critical in acid-induced cell wall loosening, osmoregulation, cell wall synthesis, and deposition (Oosterhuis et al. 2014). The role of K in activating hydrolases, including amylases, sucrose synthase (Berg et al. 2009), and invertase has been established. Similarly, nitrates have been shown to activate α-amylase in dry direct-seeded rice (Zheng et al. 2016) and nitric oxides activate β-amylase in wheat seeds (Zhang et al. 2005) during the early stages of germination. Nitrates either exogenously or produced by the mother plant relieve dormancy, induce germination (Alboresi et al. 2005), and increase the rate of germination (Ahmadvand et al. 2012). Seed priming with nitrates has been shown to trigger changes in the transcriptome, including hydrolytic enzymes (Finch-Savage et al. 2007) and antioxidant enzymes (Ali et al. 2021).

Since seed priming with KNO3 has been implicated in the activation of hydrolytic enzymes and cell wall loosening, we investigated potassium nitrate’s effect on hydrolase α-galactosidase, which breakdown raffinose family oligosaccharides (RFO) during seed germination in chickpea. Raffinose Family Oligosaccharides (RFOs) are derivatives of the α-galactosyl form of sucrose, hydrolyzed by α-galactosidase to produce sucrose and galactose. Here, we report the effect of controlled hydration of KNO3 on seed germination indices, RFO and sucrose accumulation, the activity of α-galactosidase, and expression profile of α-galactosidase isogenes in the early stages of imbibition and germination.

Methods

Seeds were sterilized using 1% sodium hypochlorite followed by three washes in sterile water. Later, the seeds were imbibed for 16 h in 20 ml of appropriate concentrations of KNO3 (100 µM, 500 µM, and one mM). The primed seeds were transferred to Petri dishes with moist tissue (tissue moistened using the same solution used for imbibition) for germination. Germination indices, germination percentage (GI), mean germination time (MGT), mean germination rate (MGR), the uncertainty of germination (U), synchronization index (Z), coefficient of variation of germination time (CVt), and coefficient of the velocity of germination (CVG), were computed (Al-Ansari and Ksiksi 2016). The rooting index was calculated using the given formula.

Rooting index=length on the 1st day/1+length on the 2nd day/2+…(length on thenth day/n).

Seed vigour is a critical measure that indicates the seed's potential for germination; it was calculated as the product of germination percentage and the seedling length (Abdul-Baki and Anderson 1973).

GV=Germination%×seedling length.

The samples’ carbohydrate was extracted using 100 mg of chickpea seed powder with 10 ml of 50% ethanol (ethanol: water 1:1) (Peterbauer et al. 2001). The soluble sugars were extracted overnight at 37 °C in a shaker incubator. The tubes were centrifuged at 10,000 rpm for 20 min, and the supernatant was transferred to a fresh tube. The pellet was re-extracted with 5 ml of 50% ethanol until all soluble sugars were extracted. The extracts were pooled and evaporated at 40 °C to get a fine powder of soluble sugars. The powder was dissolved in 2 ml sterile water; the solution was filter-sterilized using a 0.44 μ filter before analysis. The total RFO and sucrose were estimated using the DNS acid method (Arunraj et al. 2020). The concentration of sucrose and RFOs were estimated by inverting the sugar using invertase (0.003 Units) and sequential breakdown using α-gal (0.05 Units) and invertase (0.003 Units), respectively. The α-galactosidase enzyme was extracted by homogenizing 1 g of seed with 10 ml of ice-cold McIlvaine buffer (pH 5.4). The homogenate was centrifuged at 10,000 rpm at 4 °C for 30 min; the supernatant was re-centrifuged until a clear enzyme solution was obtained (Arunraj et al. 2020). Enzyme activity was assayed using the substrate p-nitrophenyl α-d-galactopyranoside (2 mM) in a reaction volume of 200 µl at 40 °C for 30 min, following which the reaction was terminated with 1 ml of 1 M sodium carbonate. According to the given formula, the enzyme activity was computed using the optical density measured at 405 nm (Borooah et al. 1961). The α-galactosidase activity was expressed in Gal units per milligram of protein.

EA=A405×Reaction volume dilution factorExtinction coefficient×time×enzyme volume.

High-quality DNA-free RNA was isolated from the seed samples described by Meng and Feldman (2010). According to the manufacturer’s protocol, complementary DNA was synthesized using ProtoScript® First Strand cDNA Synthesis Kit (New England Biolabs). Quantitative PCR was performed for α-galactosidase isogenes (AG1, AG2, and AG3) (Table 1) using 2X (FastStart DNA Green Master- Roche) SYBR Green Master Mix, 50 ng of cDNA, and 2.5 pmol each of forward and reverse primers on a Roche LC 480 system with actin as reference (Arunraj and Samuel 2017). The plant germination experiments were performed in biological and technical replications (number of seeds per replicate was 20). The data was analyzed using One-way ANOVA and Tukey’s honestly significant difference multiple comparison test in Graphpad 8.0. Correlation estimates were computed to determine the relationship between sucrose, RFOs, and α-galactosidase using Pearson’s correlation coefficient.

Table1.

Alpha-galactosidase isogenes and primer used for qPCR analysis

Target gene Oligo sequences used for QPCR (Forward/Reverse)
Actin GAGGGACATGAAGGAGAAGTTG/TGGACACCTAAAACGCTCAG
AG1 (LOC101502309) TGATTTGGAGGTTTGGGCAG/CTGTTGCTTTCGATGAACTCC
AG2 (LOC101502744) CTCACTTGGAGTTCAGGGAAG/TTGAGCATCGATTCCACAGAG
AG3 (LOC101503035) CATCTTATGCTGGACCTGGAG/AATGGGCACGATATTCCTCTG
Open in a new tab

Results and discussion

The onset of germination involves physical, physiological, biochemical, and molecular events that disrupt dormancy and commits to germination. Plant growth promoters, including nitrates, have been used to induce germination in crop plants. Early and synchronized germination is an essential aspect of mechanized farming. The germination indices MGR, MGT, CVG, CVt, U, Z, rooting index, and seed vigour were computed to account for the germination's temporal variations. Seeds primed with 100 µM KNO3 germinated 100 percent compared to 80% in the control seeds after 24 HAI; however, all the control seeds germinated after 48 HAI. The germination percentage was affected by a higher concentration of KNO3 (Fig. 1a). Similarly, mean germination time (MGT), the average length of time required for the maximum germination, mean germination rate (MGR), the frequency of germination were promising in100 µM KNO3 treatment than the control seeds (Fig. 1b, c). The seeds primed with 100 µM KNO3 had a lower coefficient of variation of germination time (CVt) and higher coefficient of the velocity of germination (CVG), indicating early and rapid germinability of primed seeds, but, increase in KNO3 concentration delayed germination in chickpea (Fig. 1d, e). The seeds primed with 100 µM KNO3 exhibited more synchronized germination (Z), less uncertainty of germination (U), and root index compared to control and other treatments (Fig. 1f–h). Seed vigour, a measure of the potential for rapid germination, decreased with an increase in KNO3 and post-imbibition germination; after 24 HAI, the vigour was 65.0, 39.0, and 11.025 in the 100 µM, 500 µM, and one mM KNO3 primed seeds, respectively (Fig. 1i). Seed vigour in the control seeds was only 40.05 after 24 HAI; however, after 48 HAI, the vigour increased to 327 in the control seeds, the vigour in the KNO3 primed seeds (100 µM, 500 µM, and one mM) was severely affected after 48 HAI (270, 179.2, and 59.8 respectively).

Fig. 1.

Fig. 1

Open in a new tab

Germination indices of control seeds and primed with 100 µM (K1), 500 µM (K2), and 1 mM (K3) of KNO3. All data represents mean of experiments performed in triplicates with n = 20 in each replicate and standard deviation as error bars. The germination indices computed include germination percentage (a), mean germination time (MGT), the average length of time taken for maximum germination (b), mean germination rate (MGR), the frequency of germination (c), coefficient of variation of germination time (CVt), variation in the time taken for germination (d), coefficient of velocity of germination (CVG) (e), synchronization index (Z), the uniformity in germination (f), uncertainty in germination (U) (g), rooting index, the root growth computed for 48HAI (h), and seed vigour, the indicator of the seed germination potential (i)

Seed priming with KNO3 (2.5% and 5%) improved seedling emergence, seedling growth, biochemical attributes, and antioxidant activities of rice (Ali et al. 2021), significantly increased the final emergence (%), mean emergence time, and physiological characteristics of tomato at 0.75% KNO3 (Moaaz Ali et al. 2020), synchronized seedling growth of Sorbus pohuashanensis treated with KNO3 (Lei et al. 2013), and soybean (Mohammadi et al. 2009). The growth indices indicate that the germination response to KNO3 is concentration-dependent; low concentration positively affects the germination indices after 24 HAI. We found a lower concentration of KNO3 (100 µM) exhibited early, rapid, and synchronized germination, but the vigour was reduced after 48 HAI; the germination indicators (after 48 HAI) did not correlate with the seed vigour obtained after 24 HAI. Higher concentrations of KNO3 had a negative impact on the germination indices, similar to the delayed germination observed in rice (Ruttanaruangboworn et al. 2017) and wheat (Abnavi and Ghobadi 2012).

In chickpea, seed germination exhibits a tight temporal regulation on the release and utilization of sugars (reducing sugars, sucrose, and RFOs), especially during the mid-stages (24–48 h) of germination post imbibition when the seed commits to germination. Any adverse influence during this critical period adversely affects the germination process (Arunraj et al. 2020). The germination phase II has been identified as the metabolically active stage before radicle emergence when the seed's respiratory activity increases. In the present study, we noticed that the accumulation of sucrose (Fig. 2a) and RFOs breakdown (Fig. 2b) was regulated to maintain a constant supply of reducing sugars as an energy source during germination in the control seeds. Contrary to the control, continuous hydrolysis of RFO drastically increased the sucrose levels in the KNO3 primed seeds after 48 HAI. It is noteworthy that the level of reducing sugar was constant without any significant changes both in primed and control seeds (Figs. 2c, 3a), implying tight regulation of sugar metabolism that was previously reported (Arunraj et al. 2020).

Fig. 2.

Fig. 2

Open in a new tab

Analysis of sucrose, RFOs, reducing sugar and enzyme alpha-galactosidase in primed [100 µM (K1), 500 µM (K2), and 1 mM (K3)] and control seeds are shown. All data represents mean of experiments performed in triplicates, standard deviation as error bars and significance with p value. The levels of sucrose (a), RFOs (b), reducing sugars (c), and enzyme activity (d) were estimated in control and primed seeds during different stages of germination, after 16 h after imbibition (16HAI), 24 h after imbibition (24HAI), and 48 h after imbibition (48HAI). The sugar levels are expressed in mg/g (dry weight) and enzyme activity in Gal Units/mg of protein

Fig. 3.

Fig. 3

Open in a new tab

The constant level of reducing sugars during various stages of germination (a), the rapid depletion of RFOs in primed seeds (b), drastic rise in the accumulation of sucrose (c), and the effect of rapid cleavage of RFOs and increase in sucrose levels on seed vigour (d) are presented. The sugar levels are expressed in mg/g dry weight

If sugars are utilized for germination and RFOs contribute to the sugar pool in the seed for germination, then the levels of RFOs should decrease as germination progresses. We found that the RFO levels (α-galactoside) in the control seeds decreased after 48 HAI with a corresponding increase in the α-galactosidase activity (Fig. 2d), the critical stage of germination as indicated by the rapid increase in the seed vigour. However, in the primed seeds, the level of RFO’s drastically decreased after 24 HAI (p < 0.05) and continued to deplete even after 48 HAI (p < 0.005), accumulating excess levels of sucrose after 48 HAI (p < 0.0002) (Fig. 3b, c). The sucrose accumulation adversely affected the seed vigour in the primed seeds after 48 HAI (Fig. 3d). While lower sucrose (29 mM) and glucose (55 mM) were found to increase the growth of Arabidopsis thaliana, a high concentration inhibited the growth severely (Schofield et al. 2009). High levels of sugars, mainly sucrose (Franco-zorrilla et al. 2005) or glucose (Bi et al. 2005), inhibited Arabidopsis seedling growth. The high concentration of metabolizable sugar glucose delay seed germination but did not prevent germination in rice (Zhu et al. 2009), delayed germination even at 1% glucose (Zhu et al. 2009; Dekkers et al. 2004), and 27.8 mM glucose in Arabidopsis (Price et al. 2003).

Since nitrate and carbon metabolism are tightly linked, plant growth response is highly regulated during germination (Osuna et al. 2015). Beyond being an energy source, sucrose acts as a signal for plant growth and development; GATA, a nitrate inducible transcriptional factor mutant, reveals significant down-regulation of sugar transporter (-like) genes, disaccharide metabolism (galatosidase), and polysaccharide metabolism genes and subsequent sensitivity to glucose (Bi et al. 2005). Additionally, SUT4/Cyb5-2 mediated signaling in Arabidopsis thaliana inhibits seedling establishment under higher sucrose levels (Li et al. 2012), and STP13, a hexose transporter, has been implicated in the sensitivity of arabidopsis to both glucose and sucrose (Schofield et al. 2009). At high concentrations, sugars can induce meristem quiescence, as observed in the arrest of the development of seedlings germinated on high sugar levels. The regulation of seedling growth at elevated levels of sugar may be mediated by hexose kinase (Cho et al. 2010; Kang et al. 2010) and by ABI genes (Wind et al. 2013) in SnRK1 dependent manner (Cho et al. 2012).

The depletion of RFO and subsequent accumulation of sucrose coincides with the burst of enzyme activity in the primed seeds after 24 HAI, confirming the inducing effect of KNO3 on hydrolytic enzymes. A variety of internal and external factors may affect hydrolytic enzymes (Adeogun et al. 2019); for example, potassium induces hydrolytic enzymes, especially amylases (Berg et al. 2009), sucrose synthase (Berg et al. 2009), and invertase. Surprisingly, α-galactosidase activity was temporarily suppressed during imbibition, indicating a potential role of KNO3 in the higher-order regulation of hydrolases during the physiological process of germination. To study if the KNO3 induced repression was at the transcript level, we investigated the expression levels of alpha-galactosidase isogenes after imbibition. We found that three isogene family members were significantly down-regulated after 16 h of imbibition (Fig. 4). It indicates the critical role of α-galactosidase during phase 2 (24–48 h) of germination in chickpea.

Fig. 4.

Fig. 4

Open in a new tab

The fold change in the expression of alpha-galactosidase isogenes treated with different concentration of KNO3 after 16 h of imbibition is presented. Data represents mean of three replicates with standard deviation as error bars, fold change significant at p < 0.0001

To conclude, seed priming with KNO3 for desirable germination characteristics in chickpea is dependent on the concentration and priming duration. Early and synchronized germination was observed when chickpea seeds were primed with KNO3 at a lower concentration (100 µM). KNO3 suppressed the enzyme α-galactosidase and its isogenes during the early imbibition stage (16 h), which was relieved after 24 HAI, catalyzing rapid cleavage of RFOs accumulating high levels of sucrose. The accumulated sucrose showed a negative effect on the germination indices, particularly vigour after 48 HAI.

Acknowledgements

We acknowledge the facilities and support extended by SRM IST in carrying out the work.

Author contributions

KV and NR performed the experiments, SN performed enzyme and qPCR analysis, and RA designed the experiments, analysed the data, performed statistical analysis, and wrote the manuscript.

Declarations

Conflict of interest

The authors declare that there is no conflict of interest.

References

  1. Abdul Baki AA, Anderson JD. Vigor determination in soybean seed by multiple criteria. Crop Sci. 1973;13:630–633. [Google Scholar]
  2. Abnavi MS, Ghobadi M. The effects of source of priming and post-priming storage duration on seed germination and seedling growth characteristics in wheat (Triticum aestivem L.) J Agric Sci. 2012;4:256–268. [Google Scholar]
  3. Adeogun AI, Agboola BE, Idowu MA. ZnCl2 enhanced acid hydrolysis of pretreated corncob for glucose production: kinetics, thermodynamics and optimization studies. J Bioresour Bioprod. 2019;4:149–158. [Google Scholar]
  4. Ahmadvand G, Soleimani F, Saadatian B, Pouya M. Effect of seed priming with potassium nitrate on germination and emergence traits of two soybean cultivars under salinity stress conditions. Am Eur J Agric Environ Sci. 2012 doi: 10.5829/idosi.aejaes.2012.12.06.1755. [DOI] [Google Scholar]
  5. Al-Ansari F, Ksiksi T. A quantitative assessment of germination parameters: the case of Crotalaria persica and Tephrosia apollinea. Open Ecol J. 2016;9:13–21. [Google Scholar]
  6. Alboresi A, Gestin C, Leydecker MT, Bedu M, Meyer C, Truong HN. Nitrate, a signal relieving seed dormancy in Arabidopsis. Plant Cell Environ. 2005;28:500–512. doi: 10.1111/j.1365-3040.2005.01292.x. [DOI] [PubMed] [Google Scholar]
  7. Ali LG, Nulit R, Ibrahim MH, Yien C. Efficacy of KNO3, SiO2 and SA priming for improving emergence, seedling growth and antioxidant enzymes of rice (Oryza sativa), under drought. Sci Rep. 2021;11(1):3864. doi: 10.1038/s41598-021-83434-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Arunraj R, Samuel MA. Integration of amplification efficiency in qPCR analysis allows precise and relative quantification of transcript abundance of genes from large gene families using RNA isolated from difficult tissues. Brief Funct Genomics. 2018;17(3):147–150. doi: 10.1093/bfgp/elx022. [DOI] [PubMed] [Google Scholar]
  9. Arunraj R, Skori L, Kumar A, Hickerson NMN, Shoma N, Vairamani M, Samuel MA. Spatial regulation of alpha-galactosidase activity and its influence on raffinose family oligosaccharides during seed maturation and germination in Cicer arietinum. Plant Signal Behav. 2020 doi: 10.1080/15592324.2019.1709707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Berg WK, Cunningham SM, Brouder SM, Joern BC, Johnson KD, Volenec JJ. Influence of phosphorus and potassium on alfalfa yield, taproot C and N pools, and transcript levels of key genes after defoliation. Crop Sci. 2009;49:974–982. [Google Scholar]
  11. Bi YM, Zhang Y, Signorelli T, Zhao R, Zhu T, Steven R. Genetic analysis of Arabidopsis GATA transcription factor gene family reveals a nitrate-inducible member important for chlorophyll synthesis and glucose sensitivity. Plant J. 2005;44:680–692. doi: 10.1111/j.1365-313X.2005.02568.x. [DOI] [PubMed] [Google Scholar]
  12. Borooah J, Leaback DH, Walker PG. Studies on glucosaminidase 2 substrates for N-acetyl-β-glucosaminidase. Biochem J. 1961;78:106–110. doi: 10.1042/bj0780106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Cho YH, Sheen J, Yoo SD. Low glucose uncouples hexokinase1-dependent sugar signaling from stress and defense hormone abscisic acid and C2H4 responses in Arabidopsis. Plant Physiol. 2010;152:1180–1182. doi: 10.1104/pp.109.148957. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Cho YH, Hong JW, Kim EC, Yoo SD. Regulatory functions of SnRK1 in stress-responsive gene expression and in plant growth and development. Plant Physiol. 2012;158:1955–1964. doi: 10.1104/pp.111.189829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. De Backer E, Gebruers K, Van den Ende W, Courtin CM, Delcour JA. Post-translational processing of β-d-xylanases and changes in extractability of arabinoxylans during wheat germination. Plant Physiol Biochem. 2010;48:90–97. doi: 10.1016/j.plaphy.2009.10.008. [DOI] [PubMed] [Google Scholar]
  16. Dekkers BJW, Schuurmans JAMJ, Smeekens SCM. Glucose delays seed germination in Arabidopsis thaliana. Planta. 2004;218:579–588. doi: 10.1007/s00425-003-1154-9. [DOI] [PubMed] [Google Scholar]
  17. Fernandez IR, Pastor-Mora E, Vicente-Carbajosa J, Carbonero P. A possible role of the aleurone expressed gene hvman1 in the hydrolysis of the cell wall mannans of the starchy endosperm in germinating Hordeum vulgare L. Seeds Front Plant Sci. 2020;10:1706. doi: 10.3389/fpls.2019.01706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Finch-Savage WE, Cadman CSC, Toorop PE, Lynn JR, Hilhorst HWM. Seed dormancy release in Arabidopsis Cvi by dry after-ripening, low temperature, nitrate and light shows common quantitative patterns of gene expression directed by environmentally specific sensing. Plant J. 2007;51:60–78. doi: 10.1111/j.1365-313X.2007.03118.x. [DOI] [PubMed] [Google Scholar]
  19. Francozorrilla JM, Martin AC, Leyva A, Pazares J. Interaction between phosphate-starvation, sugar, and cytokinin signaling in Arabidopsis and the roles of cytokinin receptors CRE1/AHK4 and AHK3. Plant Physiol. 2005;138:847–857. doi: 10.1104/pp.105.060517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hameed A, Sheikh MA, Farooq T, Basra SMA, Jamil A. Chitosan seed priming improves seed germination and seedling growth in wheat (Triticum aestivum L.) under osmotic stress induced by polyethylene glycol. Philipp Agric Sci. 2014;97:294–299. [Google Scholar]
  21. Hirose T, Scofield GN, Terao T. An expression analysis profile for the entire sucrose synthase gene family in rice. Plant Sci. 2008;174:534–543. [Google Scholar]
  22. Hussian I, Ahmad R, Farooq M, Wahid A. Seed priming improves the performance of poor quality wheat seed. Int J Agric Biol. 2013;15:1343–1348. [Google Scholar]
  23. Kang SG, Price J, Lin PC, Hong JC, Jang JC. The Arabidopsis bZIP1 transcription factor is involved in sugar signaling, protein networking and DNA binding. Mol Plant. 2010;3:361–373. doi: 10.1093/mp/ssp115. [DOI] [PubMed] [Google Scholar]
  24. Lei B, Ling Y, Jian-an W, Hai-long S. Effects of KNO3 pretreatment and temperature on seed germination of Sorbus pohuashanensis. J For Res. 2013;24(2):309–316. [Google Scholar]
  25. Leon P, Gregorio J, Cordoba E. ABI4 and its role in chloroplast retrograde communication. Front Plant Sci. 2012;3:304. doi: 10.3389/fpls.2012.00304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Li Y, Li LL, Fan RC, Peng CC, Sun HL, Zhu SY, Wang XF, Zhang LY, Zhang DP. Arabidopsis sucrose transporter SUT4 interacts with cytochrome b5–2 to regulate seed germination in response to sucrose and glucose. Mol Plant. 2012;5:1029–1041. doi: 10.1093/mp/sss001. [DOI] [PubMed] [Google Scholar]
  27. Li Z, Pei X, Yin S, Lang X, Zhao X, Qu GZ. Plant hormone treatments to alleviate the effects of salt stress on germination of Betula platyphylla seeds. J For Res. 2019;30(3):779–787. [Google Scholar]
  28. Ma Z, Bykova NV, Igamberdiev AU. Cell signaling mechanisms and metabolic regulation of germination and dormancy in barley seeds. Crop J. 2017;5:459–477. [Google Scholar]
  29. Meng L, Feldman L. A rapid TRIzol-based two-step method for DNA-free RNA extraction from Arabidopsis siliques and dry seeds. Biotechnol J. 2010;5:183–186. doi: 10.1002/biot.200900211. [DOI] [PubMed] [Google Scholar]
  30. Mirza SR, Ilyas N, Batool N. Seed priming enhanced seed germination traits of wheat under water, salt and heat stress. Pure Appl Biol. 2015;4:650–658. [Google Scholar]
  31. Moaaz Ali M, Javed T, Mauro RP, Shabbir R, Afzal I, Yousef AF. Effect of seed priming with potassium nitrate on the performance of tomato. Agriculture. 2020;10(11):498. [Google Scholar]
  32. Mohammadi GR. The effect of seed priming on plant traits of late-spring seeded soybean (Glycine max L.) Am Eur J Agric Environ Sci. 2009;5:322–326. [Google Scholar]
  33. Noorhosseini SA, Jokar NK, Damalas CA. Improving seed germination and early growth of garden cress (Lepidium sativum) and basil (Ocimum basilicum) with hydro-priming. J Plant Growth Regul. 2018;37:323–334. [Google Scholar]
  34. Oosterhuis D, Loka D, Kawakami E, Pettigrew W. The physiology of potassium in crop production. Adv Agron. 2014;126:203–234. [Google Scholar]
  35. Osuna D, Prieto P, Aguilar M. Control of seed germination and plant development by carbon and nitrogen availability. Front Plant Sci. 2015;6:1023. doi: 10.3389/fpls.2015.01023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Peterbauer T, Richter A. Biochemistry and physiology of raffinose family oligosaccharides and galactosyl cyclitols in seeds. Seed Sci Res. 2001;11:185–197. [Google Scholar]
  37. Price J, Li TC, Kang SG, Na JK, Jang JC. Mechanisms of glucose signaling during germination of Arabidopsis. Plant Physiol. 2003;132:1424–1438. doi: 10.1104/pp.103.020347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Raboy V. Myo-Inositol-1,2,3,4,5,6-hexakisphosphate. Phytochemistry. 2003;64:1033–1043. doi: 10.1016/s0031-9422(03)00446-1. [DOI] [PubMed] [Google Scholar]
  39. Ren YF, Bewley JD, Wang XF. Protein and gene expression patterns of endo-ß-mannanase following germination of rice. Seed Sci Res. 2008;8:139–149. [Google Scholar]
  40. Ruttanaruangboworn A, Chanprasert W, Tobunluepop P, Onwimol W. Effect of seed priming with different concentrations of potassium nitrate on the pattern of seed imbibition and germination of rice (Oryza sativa L.) J Integr Agric. 2017;16(3):605–613. [Google Scholar]
  41. Schofield RA, Bi YM, Kant S, Rothstein SJ. Over-expression of STP13, a hexose transporter, improves plant growth and nitrogen use in Arabidopsis thaliana seedlings. Plant Cell Environ. 2009;32:271–285. doi: 10.1111/j.1365-3040.2008.01919.x. [DOI] [PubMed] [Google Scholar]
  42. Toklu F, Baloch FS, Karakoy T, Ozkan H. Effects of different priming applications on seed germination and some agromorphological characteristics of bread wheat (Triticum aestivum L.) Turk J Agric For. 2015;39:1005–1013. [Google Scholar]
  43. Wind JJ, Peviani A, Snel B, Hanson J, Smeekens SC. ABI4: versatile activator and repressor. Trends Plant Sci. 2013;18:125–132. doi: 10.1016/j.tplants.2012.10.004. [DOI] [PubMed] [Google Scholar]
  44. Zhang H, Shen WB, Zhang W, Xu LL. A rapid response of amylase to nitric oxide but not gibberellin in wheat seeds during the early stage of germination. Planta. 2005;220:708–716. doi: 10.1007/s00425-004-1390-7. [DOI] [PubMed] [Google Scholar]
  45. Zheng M, Tao Y, Hussain S, Jiang Q, Peng S, Huang J, Cui K, Nie L. Seed priming in dry direct-seeded rice: consequences for emergence, seedling growth and associated metabolic events under drought stress. Plant Growth Regul. 2016;78:167–178. [Google Scholar]
  46. Zhu G, Ye N, Zhang J. Glucose-induced delay of seed germination in rice is mediated by the suppression of ABA catabolism rather than an enhancement of ABA biosynthesis. Plant Cell Physiol. 2009;50:644–651. doi: 10.1093/pcp/pcp022. [DOI] [PubMed] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES