Abstract
A therapeutic potential of the TRPA1 channel agonist cinnamaldehyde for use in inflammatory bowel disease is emerging, but the mechanisms are unclear. Semi-quantitative qPCR of various parts of the porcine gastrointestinal tract showed that mRNA for TRPA1 was highest in the colonic mucosa. In Ussing chambers, 1 mmol·L−1 cinnamaldehyde induced increases in short circuit current (ΔIsc) and conductance (ΔGt) across the colon that were higher than those across the jejunum or after 1 mmol·L−1 thymol. Lidocaine, amiloride or bumetanide did not change the response. The application of 1 mmol·L−1 quinidine or the bilateral replacement of 120 Na+, 120 Cl− or 25 HCO3− reduced ΔGt, while the removal of Ca2+ enhanced ΔGt with ΔIsc numerically higher. ΔIsc decreased after 0.5 NPPB, 0.01 indometacin and the bilateral replacement of 120 Na+ or 25 HCO3−. The removal of 120 Cl− had no effect. Cinnamaldehyde also activates TRPV3, but comparative measurements involving patch clamp experiments on overexpressing cells demonstrated that much higher concentrations are required. We suggest that cinnamaldehyde stimulates the secretion of HCO3− via apical CFTR and basolateral Na+-HCO3− cotransport, preventing acidosis and damage to the epithelium and the colonic microbiome. Signaling may involve the opening of TRPA1, depolarization of the epithelium and a rise in PGE2 following a lower uptake of prostaglandins via OATP2A1.
Keywords: cinnamaldehyde, colon, colonic buffering, epithelial transport, essential oils, intestine, patch clamp, pig, prostaglandin, TRPA1, TRPV3, Ussing chamber
1. Introduction
The transient receptor potential ankyrin channel (TRPA1) is a non-selective member of the large family of transient receptor potential (TRP) channels that is expressed by sensory neurons, epithelia and a wide variety of other cells, where it plays a key role as a sensor of multiple external and internal stimuli. In comparison to most other members of the TRP channel family, TRPA1 has a fairly high permeability to Ca2+, with P(Na+)/P(Ca2+) ~ 6, a value that can rise to about nine when the channel is opened by an agonist [1]. The selectivity for monovalent cations follows an Eisenman XI sequence with Na+ > K+ [2,3], with permeation dropping when Ca2+ or other divalent cations are present [4].
The name of the channel reflects the presence of 14–18 ankyrin repeats at its very long cytosolic NH2 terminus, a distinct feature that is thought to be relevant for its promiscuous interaction with a very large number of dramatically different stimuli [1,2]. TRPA1 opens not only in response to intensive cold, but also to pungent compounds contained in certain plants, such as allyl isothiocyanate (AITC, contained in mustard oil), cinnamaldehyde and thymol. Furthermore, TRPA1 is a sensor for hyper- and hypoxia, various reactive oxygen species (ROS), H2S, certain prostaglandins and an immense number of other chemical species and endogenous signals, many of which are associated with cell damage, and are released in acute and chronic pain and inflammation. Accordingly, TRPA1 is involved in the pathophysiology of multiple organs [1,2].
A dominant role in the sensation pain is confirmed by the major symptom in the only TRPA1 channelopathy known at this point [5]. In what is known as Familial Episodic Pain Syndrome (FEPS), a gain of function mutation of TRPA1 causes episodes of severe pain localized principally to the upper body that are triggered by cold, fasting or physical stress. Interestingly, the baseline pain thresholds are not impaired. Furthermore, it has emerged that hyperalgesia can involve the direct action of mediators of oxidative stress on TRPA1 channels in addition to the classical receptor-mediated cascades [6,7,8].
The debate is ongoing concerning the function of TRPA1 in the intestinal tract. TRPA1 is expressed by sensory extrinsic and intrinsic afferent neurons that innervate the viscera [9,10,11], by intestinal myenteric and motor neurons which control motility [1,12,13], and by endocrine and transporting cells of the epithelial mucosa [14,15,16]. Although visceral symptoms have not been reported in gain of function mutations of TRPA1 [5], there is a clear association with visceral hypersensitivity which can be purely functional or associated with diseases such as colitis ulcerosa or Crohn’s disease [10,17]. Apart from direct activation by prostaglandin and its metabolites [6,7,8], TRPA1 can also be activated by immunostimulatory cues such as the lipopolysaccharides (LPS) or outer wall glycolipids that are released by gram-negative bacteria after lysis [18]. Accordingly, in mouse models, tail-flick hyperalgesia and a fall in blood pressure is observed within a minute of LPS injection, which is clearly the result of the activation of neuronal afferents long before the production of immunomodulators such as TNF-α sets in [9,18].
Somewhat curiously and in contrast to their aversive role in signalling cellular damage in pain and inflammation, TRPA1 agonists in the form of spices have played an important role in the culinary arts for millenia [1]. Furthermore, grazers are known to show a preference for certain herbal compounds which activate TRPA1 and other TRP channels, but the reasons for this are unclear [19]. Having evolved to protect plants from bacteria, fungi and viruses, TRP channel modulators clearly have a multi-target antimicrobial potential [20]. However, the amounts that are voluntarily consumed by humans and animals are far lower than those required to achieve significant antibacterial effects.
In humans, the activation of TRPA1 has been suggested to lead to feelings of satiety after the ingestion of fragrant compounds found in spices such as cinnamaldehyde [21,22], allicin [23], menthol [24], or thymol [25], all of which directly activate the channel in vitro. Furthermore, these TRPA1 agonists were found to facilitate the secretion of cholecystokinin (CCK) and 5-HT from enteroendocrine cells (EEC), and thus to enhance the digestive response [26,27]. In addition, a growing body of literature suggests that TRPA1 agonists have anti-inflammatory effects with therapeutic potential in bowel diseases [20,28]. Thus, cinnamaldehyde was found to attenuate experimental colitis induced by 2,4,6-trinitrobenzene sulfonic or acetic acid in rat models of the human disease, with the reduction both of the symptoms and various markers of inflammation, such as TNF-α, myeloperoxidase and IL-6 [29,30]. While various signalling cascades are being discussed, it is striking that cinnamaldehyde activates TRPA1 with a specificity that surpasses that of the classical TRPA1 agonist AITC [1].
In farm animals, modulators of TRP channels in general and of TRPA1 in particular are increasingly being added to the feed of livestock as an alternative to antibiotic growth enhancers [31,32]. This is particularly important during weaning, during which young animals that have previously obtained readily digestible milk from their mothers are switched to diets rich in plant fiber. Because the structural carbohydrates contained in plants cannot be broken down by the mammalian enzymes found in the small intestine, after weaning, large quantities of undigested material suddenly begin to enter the caecum and the colon. Here, a growing community of bacteria and fungi break up previously undigested material, producing energy-rich short chain fatty acids that can then be absorbed and utilized by the young animal to produce glucose and other energy-rich carbohydrates within the liver [33,34]. However, in the process, large quantities of protons are set free and have to be buffered in the hindgut lumen or within the cytosol to prevent epithelial damage. While the bacterial colonization of the hindgut is thus central for the survival and growth of the young animal, the transition can be harsh and many piglets develop inflammatory responses with severe or even lethal diarrhea [35,36].
Given the importance of the pig both in food production and as a model species for research on humans, it was the purpose of this study to compare the expression of TRPA1 in the various segments of the gastrointestinal tract via qPCR, and to identify segments with high expression. In order to assess the functional importance of TRPA1 in the segment with the highest level of expression, Ussing chamber experiments were performed on colonic epithelia using cinnamaldehyde, a classical agonist of TRPA1 with possible therapeutic potential [1,2,29,30]. Using the whole cell configuration of the patch clamp technique on HEK-293 cells overexpressing TRPV3, we investigated a potential additional contribution of TRPV3 to the cinnamaldehyde response [37]. A more detailed understanding of the mechanisms of action of this phytogenic substance could be useful for a better understanding of colonic function, but also for finding new therapy options for the rising number of individuals suffering from inflammatory bowel disease worldwide [38].
2. Results
2.1. PCR
RT-qPCR was used to investigate the relative amounts of mRNA encoding for TRPA1 in the gastrointestinal tissues of stomach (fundus and cardia), duodenum, jejunum, ileum, caecum, and colon of four pigs. The expression was analyzed in the mucosa and tunica muscularis; normalized to the reference genes ACTB, GAPDH, and YWHAZ; and scaled to the mean value of all of the samples. Messenger RNA encoding for TRPA1 could be detected in all of the gastrointestinal epithelia investigated except for the ileum. The expression of TRPA1 by the colonic epithelium varied strongly depending on the animal, and was significantly higher than that of all other epithelia, except for the duodenum and caecum. In contrast, any expression of TRPA1 by the muscular layers was under the limit of detection (Figure 1).
Figure 1.
Relative mRNA expression of TRPA1 in the mucosa of the stomach (fundus and cardia), duodenum, jejunum, ileum, caecum and colon, and associated muscle layers of four young pigs from a controlled in-house study. Normalization was performed to the reference genes ACTB, GAPDH and YWHAZ, with scaling to the mean values of all of the samples. The letters above the bars indicate statistically significant differences between those bars that do not share a letter (p < 0.05) (n.d. = not detected).
2.2. Ussing Chamber Studies
2.2.1. Effect of Cinnamaldehyde
Cinnamaldehyde is known as a classical agonist of TRPA1 with high specificity [1,2]. The functional expression of TRPA1 was tested via the response to the bilateral application of 100 µmol·L−1 or 1 mmol·L−1 cinnamaldehyde in the colon of two pigs with a total of five tissues in a first set of experiments. After an incubation period of 15 min, washout was performed. The addition of 100 µmol·L−1 cinnamaldehyde showed no effect on the short circuit current Isc and tissue conductance Gt (p > 0.1) (Figure 2). Before the addition of cinnamaldehyde, the Isc remained relatively constant with 0.69 ± 0.15 µeq·cm−2·h−1 immediately before addition, reaching a peak value of 0.66 ± 0.13 µeq·cm−2·h−1 within the 15 min period after the addition (p > 0.1). The conductance also essentially remained constant, with a value of 21.2 ± 4.14 mS·cm−2 before and 20.2 ± 3.57 mS·cm−2 15 min after the addition of cinnamaldehyde (p > 0.1). Visible and statistically significant effects on Isc and Gt were observed after the addition of cinnamaldehyde in a higher concentration. Within the 15 min period after the application of cinnamaldehyde in a concentration of 1 mmol·L−1, the Isc increased from 1.10 ± 0.29 µeq·cm−2·h−1 to a peak value of 2.66 ± 0.49 µeq·cm−2·h−1, after which, in some tissues, a decline could be observed. The conductance rose continuously in all of the tissues from 23.1 ± 4.20 mS·cm−2 to 28.4 ± 5.42 mS·cm−2 at the end of the 15 min period (both p < 0.05). After the washout, Isc returned to 1.31 ± 0.33 µeq·cm−2·h−1 and the conductance returned to 26.9 ± 6.60 mS·cm−2, values that were not significantly different from the baseline at the start of the experiment (p > 0.1). We also performed similar experiments in the jejunum, in which 1 mmol·L−1 cinnamaldehyde again led to significant rises in Isc (ΔIsc, p = 0.029) and a trend for a rise in Gt (∆Gt, p = 0.079). Interestingly, the effects tended to be smaller than those observed in the colon (p = 0.015 for ΔIsc and p = 0.063 for ∆Gt) (see Supplementary Materials Figure S1).
Figure 2.
Effect of the TRPA1 agonist cinnamaldehyde at a concentration of 100 µmol·L−1 (a,c) and 1 mmol·L−1 (b,d) on Isc and Gt in the Ussing chamber using the colonic tissue of young pigs (controlled in-house study). While the smaller concentration of 100 µmol·L−1 was insufficient, after the addition of 1 mmol·L−1, a significant increase of the Isc and Gt could be observed. After washout, the values dropped again. N/n = the number of animals/number of tissues, which was identical for Gt and Isc.
In the next set of screening experiments, we examined the response to 1 mmol·L−1 cinnamaldehyde after the mucosal, serosal, or bilateral addition in the colon of five pigs with a total of nine or ten tissues per group (Figure 3). As in the previous series of experiments, we observed a rapid increase in Isc from 0.59 ± 0.50 µeq·cm−2·h−1 to peak values of 1.39 ± 0.71 µeq·cm−2·h−1 (p = 0.016) within a 15 min period after the bilateral application of cinnamaldehyde, with a slightly slower increase in Gt from 24.8 ± 3.21 mS·cm−2 to 28.0 ± 2.83 mS·cm−2 (p = 0.006) at the end of the 15 min period. The same effect was also observed after the mucosal application, in which Isc increased from 0.47 ± 0.23 µeq·cm−2·h−1 to 1.09 ± 0.46 µeq·cm−2·h−1 (p = 0.012) and Gt from 19.2 ± 1.81 mS·cm−2 to 21.8 ± 1.87 mS·cm−2 (p = 0.007). No effect on Isc was observed after serosal application, which changed only slightly from 0.34 ± 0.24 µeq·cm−2·h−1 to 0.34 ± 0.25 µeq·cm−2·h−1 in the 15 min period (p = 0.85). Gt dropped from 23.2 ± 1.80 mS·cm−2 to 21.5 ± 1.46 mS·cm−2 during the same period (p = 0.013). However, the slope of the curve did not change after the application of cinnamaldehyde, so that this most likely reflects a baseline drift. Again, the response in the jejunum was different from that in the colon, where we observed increases in Isc not only after mucosal and bilateral addition, but also after the serosal addition. Conversely, any effects of cinnamaldehyde on the Gt of the jejunum were subtle (see Supplementary Materials Figure S2).
Figure 3.
Effect of the TRPA1 agonist cinnamaldehyde (CIN) at a concentration of 1 mmol·L−1 after the mucosal (a,d), serosal (b,e) or bilateral addition (c,f) to Isc and Gt in the Ussing chamber using the colonic tissue of pigs. After mucosal and bilateral addition, a significant increase in Isc and Gt was observed, although the effects were absent after the serosal addition (details see text). In this figure, some tissues were obtained from older, larger pigs from a commercial slaughterhouse (blue lines), which showed a strong, sustained increase, while the black lines reflect the frequently biphasic responses that were seen in younger and smaller pigs slaughtered within a controlled study, as in the rest of the manuscript.
Finally, it should be mentioned that the tissues from three animals from a commercial slaughterhouse showed no response to cinnamaldehyde despite a positive reaction to theophylline (data not included). In these cases, there was a delay in the removal of the tissue from the carcass. It appears possible that cells from the absorptive surface epithelium (most exposed to gastrointestinal toxins and the major locus of TRPA1 expression [39]) were damaged more severely than the cells found within the crypts, where theophylline-induced secretion occurs. The subsequent experiments were therefore performed with tissues rapidly removed from piglets euthanized within a controlled study.
2.2.2. Effect of Blockers on the Cinnamaldehyde Response
In order to study the effect of cinnamaldehyde in a little more detail, we treated colonic tissues with different blockers 15 min before the addition of cinnamaldehyde to assess the response after the corresponding pretreatment. For each treatment, control tissues from the same animals were given the corresponding amount of solvent and served as a comparison. Delivery to the epithelium even in situations with the ample formation of mucus was ensured via bilateral application of cinnamaldehyde. The baseline parameters before and after the pretreatment are given in Table 1, while the data from before and after the cinnamaldehyde application are given in Table 2. The control values in the tables are the means of all of the control tissues used. The difference in the values before and after cinnamaldehyde application (ΔIsc and ΔGt) are given in the text, along with the respective control values. Because the animals in the different data sets showed individual variability, ΔIsc and ΔGt are also given as a percentage of the control value for each data set from the same group of animals in Figure 4.
Table 1.
Baseline Isc (µeq·cm−2·h−1) and Gt (mS·cm−2) in colonic tissue from young pigs (controlled in-house study) (baseline) and the peak value in the 15 min interval after the addition of blockers or ion replacement (treatment). For the concentrations and solutions, see Results and Supplementary Materials.
| Treatment | N/n 1 | Isc Baseline | Isc Treatment | p-Value | Gt Baseline | Gt Treatment | p-Value |
|---|---|---|---|---|---|---|---|
| Control (all) | 12/70 | 0.38 ± 0.056 | 0.37 ± 0.056 | 0.094 | 20.5 ± 0.62 | 20.3 ± 0.61 | <0.001 |
| Quinidine | 4/21 | 0.39 ± 0.088 | 0.23 ± 0.085 | <0.001 | 22.5 ± 1.02 | 19.9 ± 0.83 | <0.001 |
| Lidocaine | 3/12 | 0.41 ± 0.070 | 0.27 ± 0.069 | <0.001 | 23.6 ± 1.37 | 22.8 ± 1.10 | 0.151 |
| Amiloride | 3/15 | 0.55 ± 0.16 | 0.29 ± 0.15 | <0.001 | 23.0 ± 1.65 | 21.3 ± 1.69 | <0.001 |
| Na+ free bilat 2 | 3/17 | 0.42 ± 0.066 | −0.40 ± 0.052 | <0.001 | 18.2 ± 1.58 | 8.9 ± 0.53 | <0.001 |
| Na+ free muc 3 | 5/28 | 0.34 ± 0.044 | −0.69 ± 0.062 | <0.001 | 17.6 ± 0.95 | 12.2 ± 0.39 | <0.001 |
| EGTA muc 2 | 4/17 | 0.77 ± 0.16 | 0.95 ± 0.21 | 0.01 | 23.8 ± 1.38 | 28.5 ± 1.86 | <0.001 |
| Ca2+ free bilat 3 | 5/14 | 0.98 ± 0.068 | 0.99 ± 0.065 | 0.819 | 19.3 ± 0.96 | 20.3 ± 0.86 | 0.011 |
| Bumetanide | 3/15 | 0.30 ± 0.11 | 0.19 ± 0.10 | <0.001 | 20.1 ± 0.94 | 20.2 ± 0.90 | 0.528 |
| NPPB | 5/21 | 0.46 ± 0.10 | 0.26 ± 0.083 | <0.001 | 21.9 ± 1.45 | 22.8 ± 1.53 | 0.008 |
| Indometacin | 3/9 | 0.24 ± 0.049 | 0.16 ± 0.036 | 0.04 | 22.6 ± 1.29 | 22.9 ± 1.39 | 0.212 |
| Cl− low 4 | 5/30 | 0.29 ± 0.089 | 0.52 ± 0.071 | 0.050 | 21.5 ± 1.08 | 12.7 ± 0.99 | <0.001 |
| HCO3− free 4 | 5/24 | 0.29 ± 0.089 | 0.59 ± 0.073 | 0.014 | 21.5 ± 1.08 | 14.1 ± 0.61 | <0.001 |
| HC-030031 | 3/7 | 0.33 ± 0.038 | 0.27 ± 0.028 | 0.028 | 17.7 ± 1.02 | 17.9 ± 1.15 | 0.813 |
1 number of animals/number of tissues; 2 bilat = bilateral; 3 muc = mucosal; 4 test vs. control tissue.
Table 2.
Cinnamaldehyde response in the colonic tissue from young pigs (controlled in-house study). The tissues were pretreated as indicated in the first column, yielding the values “Isc treatment” (µeq·cm−2·h−1) and “Gt treatment” (mS·cm−2) from Table 1. Subsequently, 1 mmol·L−1 cinnamaldehyde was added. The columns “Isc cinn.” (µeq·cm−2·h−1) and “Gt cinn.” (mS·cm−2) designate the peak value of the responses within a 15 min interval after the application of cinnamaldehyde.
| Treatment | N/n 1 | Isc Treatment | Isc Cinn. | p-Value | Gt Treatment | Gt Cinn. | p-Value |
|---|---|---|---|---|---|---|---|
| Control (all) | 12/70 | 0.38 ± 0.056 | 1.01 ± 0.10 | <0.001 | 20.3 ± 0.61 | 24.4 ± 0.79 | <0.001 |
| Quinidine | 4/21 | 0.23 ± 0.085 | 1.19 ± 0.21 | <0.001 | 19.9 ± 0.83 | 21.7 ± 0.92 | <0.001 |
| Lidocaine | 3/12 | 0.27 ± 0.069 | 1.05 ± 0.22 | <0.001 | 22.8 ± 1.10 | 29.2 ± 1.44 | <0.001 |
| Amiloride | 3/15 | 0.29 ± 0.15 | 1.29 ± 0.28 | <0.001 | 21.3 ± 1.69 | 25.0 ± 1.96 | <0.001 |
| Na+ free bilat 2 | 3/17 | −0.40 ± 0.052 | −0.26 ± 0.060 | 0.002 | 8.90 ± 0.53 | 10.1 ± 0.58 | <0.001 |
| Na+ free muc 3 | 5/28 | −0.69 ± 0.062 | −0.19 ± 0.083 | <0.001 | 12.2 ± 0.39 | 13.3 ± 0.43 | <0.001 |
| EGTA muc 2 | 4/17 | 0.95 ± 0.21 | 2.13 ± 0.26 | <0.001 | 28.5 ± 1.86 | 40.8 ± 3.36 | <0.001 |
| Ca2+ free bilat 3 | 5/14 | 0.99 ± 0.065 | 1.78 ± 0.084 | <0.001 | 20.3 ± 0.86 | 26.7 ± 1.56 | <0.001 |
| Bumetanide | 3/15 | 0.19 ± 0.10 | 1.16 ± 0.27 | <0.001 | 20.2 ± 0.90 | 25.2 ± 1.29 | <0.001 |
| NPPB | 5/21 | 0.26 ± 0.083 | 0.71 ± 0.12 | <0.001 | 22.8 ± 1.53 | 28.6 ± 2.19 | <0.001 |
| Indometacin | 3/9 | 0.16 ± 0.036 | 0.54 ± 0.099 | 0.004 | 22.9 ± 1.39 | 30.6 ± 2.05 | <0.001 |
| Cl− low 3 | 5/30 | 0.52 ± 0.071 | 0.78 ± 0.10 | <0.001 | 12.7 ± 0.99 | 16.1 ± 1.28 | <0.001 |
| HCO3− free 3 | 5/24 | 0.59 ± 0.073 | 0.70 ± 0.11 | 0.054 | 14.1 ± 0.61 | 17.1 ± 0.61 | <0.001 |
| HC-030031 | 3/7 | 0.27 ± 0.028 | 0.91 ± 0.16 | 0.004 | 17.9 ± 1.15 | 22.3 ± 2.15 | 0.007 |
1 number of animals/number of tissues; 2 bilat = bilateral; 3 muc = mucosal.
Figure 4.
Comparison of the effect of cinnamaldehyde (1 mmol·L−1) on the short circuit current (ΔIsc) and the conductance (ΔGt) of the colonic mucosa from young pigs (controlled in-house study) in Ussing chambers after preincubation with different blockers, or after the ion replacement. In order to allow a comparison of the data from different sets of experiments, the differences (deltas) were calculated by subtracting the peak value of the cinnamaldehyde response in the 15 min period after addition of cinnamaldehyde from the baseline value before addition. The delta values of the control tissues of each animal were set to 100%, and the deltas of the treated tissues were calculated as a percentage of the control tissues of the animal in question. Significant differences versus the control group are marked as *, †, or ‡ (p < 0.05, p < 0.01 or p < 0.001). For the concentrations of the blockers and the composition of the solutions used, see the results and the Supplementary Materials. N/n = number of animals/number of tissues, which were identical for Gt and Isc; muc = mucosal; bilat = bilateral.
Neuronal involvement was tested in a first set of tissues (N/n = 3/12; number of animals/number of tissues), which were preincubated with serosal lidocaine (1 mmol·L−1) before the bilateral addition of cinnamaldehyde (1 mmol−1). The addition of lidocaine visibly decreased the baseline Isc by ΔIsc = −0.14 ± 0.021 µeq·cm−2·h−1 (p < 0.001), with little change in Gt (which numerically shifted by ΔGt = −0.87 ± 0.50 mS·cm−2; p = 0.15) (Table 1). No response was seen in the control group (N/n = 3/12). After the addition of cinnamaldehyde, an identical increase in Isc and Gt could be observed in both groups (p > 0.1). In the lidocaine group, Isc increased by ΔIsc = 0.78 ± 0.18 µeq·cm−2·h−1 (or 78.6 ± 18.3% of the response of the control group, which was set to 100%), while the change in conductance (ΔGt) was 6.41 ± 0.87 mS·cm−2 (or 125.0 ± 17.0% of the control; N/n = 3/12).
In a second set of tissues, preincubation with 1 mmol·L−1 mucosal quinidine was used (N/n = 4/21) as a blocker of non-selective cation channels. The addition of quinidine resulted in a significant decrease in the baseline Isc by ΔIsc = −0.17 ± 0.022 µeq·cm−2·h−1, and of Gt by ΔGt = −2.52 ± 0.35 mS·cm−2 (both p < 0.001). After the subsequent addition of cinnamaldehyde, a ΔIsc response of 0.96 ± 0.17 µeq·cm−2·h−1 was observed, which remained at 122.4 ± 22.1% of the control (N/n = 4/23, p > 0.1). However, the ΔGt response of 1.74 ± 0.34 mS·cm−2 (42.6 ± 8.3% of the control) was reduced strongly by more than half (p < 0.001).
Another set of epithelia was treated with 1 mmol·L−1 mucosal amiloride (N/n = 3/15), which decreased the baseline Isc by ΔIsc = −0.26 ± 0.055 µeq·cm−2·h−1 and Gt by ΔGt = −1.77 ± 0.38 mS·cm−2 (both p < 0.05), most likely reflecting a block of the epithelial sodium channel ENaC (SCNN1). After cinnamaldehyde addition, ΔIsc was 1.00 ± 0.21 µeq·cm−2·h−1 (170.8 ± 35.1% of the control, N/n = 3/8) and ΔGt was 3.70 ± 0.45 mS·cm−2 (99.2 ± 12.2% of the control), both of which were not different from the control tissues (p > 0.1).
In order to selectively inhibit TRPA1, we used the antagonist HC-030031 with a concentration of 100 µmol·L−1 on both sides (N/n = 3/7). In rat colon, this concentration of HC-030031 blocked the cinnamaldehyde response [39]. Again, we observed a small but significant decrease in the baseline Isc of ΔIsc = −0.063 ± 0.022 µeq·cm−2·h−1 after the preincubation period (p = 0.028), with the baseline Gt remaining unchanged (p > 0.1). The application of cinnamaldehyde (1 mmol·L−1) resulted in a numerically smaller ΔIsc of 0.63 ± 0.14 µeq·cm−2·h−1 (or 61.8 ± 13.5% of the control, N/n = 3/18), but the effects did not show significance (p = 0.138). The ΔGt remained at 4.41 ± 1.10 mS·cm−2 (81.0 ± 20.1% of the control).
An increase in Isc may reflect either cation absorption or anion secretion, with the latter being classically driven by the Na+-K+-2Cl− cotransporter 1 (NKCC1) in the colon. Since NKCC1 is blocked by bumetanide, 1 mmol·L−1 were added to the serosal side (N/n = 3/15), which decreased the baseline Isc by ΔIsc = −0.10 ± 0.023 µeq·cm−2·h−1 (p < 0.001). The baseline Gt was unchanged (ΔGt = 0.035 ± 0.23 mS·cm−2, p > 0.1). After the addition of cinnamaldehyde, Isc increased by ΔIsc = 0.96 ± 0.20 µeq·cm−2·h−1 and Gt by ΔGt = 5.07 ± 0.53 mS·cm−2, values that were not different from the corresponding control (163.7 ± 34.4% and 135.9 ± 19.2%, respectively; p > 0.1, N/n = 3/8).
Further tissues were treated with the anion channel blocker NPPB at a concentration of 0.5 mmol·L−1 on the mucosal side (N/n = 5/21), which decreased the baseline Isc by ΔIsc = −0.20 ± 0.047 µeq·cm−2·h−1 (p < 0.001) and the baseline Gt by ΔGt = −0.95 ± 0.32 mS·cm−2 (p < 0.008). After the subsequent addition of cinnamaldehyde, a significantly smaller ΔIsc was observed: 0.45 ± 0.07 µeq·cm−2·h−1 (or 53.1 ± 7.87% of the control, p = 0.06). However, the ΔGt response remained unchanged at 5.73 ± 0.86 mS·cm−2 (127.5 ± 19.2% of the control, N/n = 5/29).
In order to investigate whether the cinnamaldehyde response involves prostaglandin signalling, 10 µmol·L−1 indometacin was added to both sides to inhibit cyclooxygenases (N/n = 3/9). A slight decrease in the baseline Isc level was observed by ΔIsc = −0.079 ± 0.032 µeq·cm−2·h−1 (p = 0.04), with no effect on Gt. In response to cinnamaldehyde, a significantly smaller ΔIsc of only 0.39 ± 0.10 µeq·cm−2·h−1 or 37.5 ± 9.3% of the control was observed (p = 0.003, N/n = 3/18), while the ΔGt of 7.63 ± 1.17 mS·cm−2 (140.1 ± 21.5% of the control) was not significantly changed by indometacin.
2.2.3. Effect of Ion Replacement on the Cinnamaldehyde Response
In a second experimental section, we replaced certain ions in the solutions in order to evaluate the effect of cations and anions on the cinnamaldehyde response (see Suplementary Materials Table S1). In the control tissues, a sham solution change was performed. Again, all of the results are summarized in Table 1 and Table 2, and in Figure 4.
First, we switched to a Na+-free solution 15 min before the addition of cinnamaldehyde on both sides (N/n = 3/17), replacing sodium with equivalent amounts of NMDG+. This led to a sharp drop of Isc by ΔIsc = −0.81 ± 0.063 µeq·cm−2·h−1 (or from 0.42 ± 0.066 to −0.40 ± 0.052 µeq·cm−2·h−1), while the Gt dropped by about half (ΔGt = −9.30 ± 1.17 mS·cm−2, from 18.2 ± 1.58 to 8.9 ± 0.53 mS·cm−2, both p < 0.001). However, even in the bilateral absence of Na+, an increase in Isc and Gt could still be observed after the application of cinnamaldehyde of ΔIsc = 0.14 ± 0.039 µeq·cm−2·h−1 (p = 0.002) and ΔGt = 1.16 ± 0.10 mS·cm−2 (p < 0.001), respectively. However, the magnitude of the response to cinnamaldehyde was strongly reduced, with ΔIsc at 13.8 ± 3.8% of the control (N/n = 3/18) and ΔGt at only 21.2 ± 1.84% of the control (both p < 0.001).
The replacement of Na+ on the mucosal side only (N/n = 5/28) decreased the basal Isc by ΔIsc = −1.03 ± 0.076 µeq·cm−2·h−1 (or from 0.34 ± 0.044 to −0.69 ± 0.062 µeq·cm−2·h−1) and the basal Gt by ΔGt = −5.41 ± 0.77 mS·cm−2 (or from 17.6 ± 0.95 to 12.2 ± 0.39 mS·cm−2) (both p < 0.001). After the addition of cinnamaldehyde, a Gt response occurred with a ΔGt of 1.15 ± 0.17 mS·cm−2 (p < 0.001), which corresponded to 25.3 ± 3.67% of the control response (N/n = 5/29, p < 0.001). This response was identical to that observed after the bilateral removal of Na+ (p = 0.96). In marked contrast, ΔIsc was not affected, but remained at 0.51 ± 0.089 µeq·cm−2·h−1, or 102.8 ± 18.2% of the control (p > 0.1).
In the next step, we wanted to investigate the involvement of the divalent cation Ca2+. For this purpose, a set of epithelia was changed mucosally to a calcium-free solution with EGTA (N/n = 4/17). Otherwise, the composition of the NaCl solution remained identical on both sides. The basal level Isc increased by ΔIsc = 0.18 ± 0.060 µeq·cm−2·h−1 (p = 0.01), reflecting the stimulation of a transcellular transport mechanism. The conductance Gt increased by ΔGt = 4.70 ± 0.85 mS·cm−2 (p < 0.001). The subsequent application of cinnamaldehyde induced a ΔIsc of 1.18 ± 0.20 µeq·cm−2·h−1 or 150.0 ± 25.1% of the control tissues from the pigs of the series (N/n = 4/17). When tested against all of the control tissues investigated (N/n = 12/70), this difference tested for significance (p = 0.022). The Gt response to cinnamaldehyde rose dramatically after the removal of calcium, with ΔGt at 12.3 ± 1.92 mS·cm−2 or 301.8 ± 47.2% of the control (p < 0.001).
In a second similar set of experiments, we removed Ca2+ on both sides (N/n = 5/14). In order to prevent damage to the epithelium, the solution did not contain EGTA. No increase in the baseline Isc was observed as a result of this pretreatment, although Gt increased by 1.05 ± 0.35 mS·cm−2 (p = 0.011). This suggests that here, too, the rate of transcellular transport must have increased to compensate for paracellular leak currents. The response to cinnamaldehyde did not change and ΔIsc remained at 0.79 ± 0.072 µeq·cm−2·h−1 (or 92.8 ± 8.37% of the control), although ΔGt increased by 6.40 ± 0.87 mS·cm−2 (142.3 ± 19.4% of the control, p = 0.042).
The involvement of anions in the cinnamaldehyde response was tested by incubating the epithelia in a solution with a low Cl− concentration (10.3 instead of 130.3 mmol·L−1) or in a HCO3−-free solution (buffered only with HEPES). Because these epithelia were incubated with the test solution from the beginning of the experiment, the baseline Isc and Gt levels were compared to the control tissues.
Interestingly, the tissues in the low Cl− solution (N/n = 5/30) had a higher mean baseline Isc level of 0.52 ± 0.071 µeq·cm−2·h−1 compared to the controls in a standard Ringer solution (0.29 ± 0.089 µeq·cm−2·h−1) (N/n = 5/29; p = 0.05), and an expectedly lower Gt, which was 12.7 ± 0.99 mS·cm−2 rather than 21.5 ± 1.08 mS·cm−2 (p < 0.01). After cinnamaldehyde addition, a ΔIsc response was observed that was numerically smaller than that of the control (0.26 ± 0.056 µeq·cm−2·h−1 or 53.8 ± 11.5% of the control). The Gt increased by ΔGt = 3.42 ± 0.38 mS·cm−2, a value that was at 75.5 ± 8.3% of the control (p = 0.037).
The tissues that were incubated in parallel in the HCO3−-free solution (N/n = 5/24) had a baseline Isc of 0.59 ± 0.073 µeq·cm−2·h−1, which was again significantly higher than that of the controls mentioned above (p = 0.014). Gt was reduced to 14.1 ± 0.61 mS·cm−2 (p < 0.01). The response to cinnamaldehyde was strongly reduced, with ΔIsc at 0.11 ± 0.046 µeq·cm−2·h−1 in this group, or 22.3 ± 9.3% of the control (p < 0.001, N/n = 5/29). The ΔGt of 2.90 ± 0.25 mS·cm−2 was at 64.2 ± 5.53% of the control (p = 0.005).
It is interesting to rank the effects of the removal of the ions on the cinnamaldehyde response in comparison to the effect in a standard Ringer solution using values from all of the controls studied (N/n = 12/70). The values of ΔIsc increased in the order HCO3−-free < Na+-free < low Cl− < standard Ringer < EGTA, with mean values of 0.11 ± 0.046a, 0.14 ± 0.039ab, 0.26 ± 0.056b, 0.63 ± 0.067c and 1.18 ± 0.20d µeq·cm−2·h−1, respectively, in which the values that do not share a superscript are significantly different. The values of ΔGt ranked in the order Na+-free < HCO3−-free < low Cl− < standard Ringer < EGTA and were 1.16 ± 0.10a, 2.90 ± 0.25b, 3.42 ± 0.38bc, 4.11 ± 0.31c, 12.3 ± 1.92d mS·cm−2.
2.2.4. Effect of Thymol
In further experiments, the response to the herbal diterpene thymol was investigated. Thymol is known as an agonist of TRPM8, TRPV3 and TRPA1. A first set of screening experiments revealed that, as with cinnamaldehyde, thymol only showed effects after the mucosal or bilateral application in the colon, but not after the serosal application (all N/n = 2/4) (see Supplementary Materials Figure S3).
The response to the bilateral application of thymol was studied more rigorously in colonic tissues from 10 pigs. As before, a robust rise in Gt could be observed in all of the tissues studied (Figure 5, p < 0.001 colon). The effects of thymol on the short circuit current Isc were quite variable. In colonic tissues from three pigs, Isc went up; in six other pigs, Isc went down; in one pig, the responses depended on the individual tissue (three down, one up). The means of the tissues that responded to thymol with a pronounced increase in Isc (“up”) are shown in Figure 5a (p = 0.016, N/n = 4/7), while the means of the tissues in which Isc dropped (“down”) are shown in Figure 5b (p < 0.001, N/n = 7/11).
Figure 5.
Effect of a bilateral application of thymol on the Isc and Gt of the colon of ten young pigs (controlled in-house study). The data are given as means ± SEM. In some of the tissues, an increase (“up“) in Isc could be observed after the addition of thymol (a), whereas in other tissues a decrease or no effect (“down“) was observed (b). An increase in Gt was observed in all of the tissues after the addition of thymol, ruling out barrier effects for increases in Isc (c,d). The significance bars within graphs compare values taken immediately prior to addition of the agonist and after an incubation of 10 min. The significance bars between graphs indicate that in the colon, there was no difference between the “up” and the “down” groups before thymol was added. Significant differences are marked as *, †, or ‡ (p < 0.05, p < 0.01 or p < 0.001).
Similar effects were observed in the jejunum (see Supplementary Materials, Figure S4, N/n = 10/18) and in the caecum (data not shown, N/n = 2/4).
2.3. Patch Clamp Studies
The effects of cinnamaldehyde on TRPA1 in overexpressing cells are extremely well documented [1,2]. However, one study has described the fact that cinnamaldehyde can activate TRPV3 in addition to TRPA1 [37], raising questions concerning its specificity. Accordingly, the effect of cinnamaldehyde on TRPV3 was studied using HEK-293 cells transfected with the human variant of TRPV3. As control cells, cells were transfected with the empty vector, essentially as described previously [40,41]. Cells were also treated with thymol, so that a subsequent comparison of the relative response of the TRPV3 expressing cells and the colonic tissues to cinnamaldehyde and thymol was possible.
The successful transfection of the cells was detected in a first step by the immunohistochemical staining of TRPV3 in the transfected HEK-293 cells. The transfected hTRPV3 cells showed green staining of the cytosol, reflecting co-expression of green fluorescent protein (GFP) as well as a red staining of the cell membrane, demonstrating the successful expression of the TRPV3 channel protein (Figure 6a). The control cells only showed green cytosolic staining (not shown). The transfected hTRPV3 and control cells were then examined with patch-clamp experiments under whole-cell conditions.
Figure 6.
(a) Immunohistochemical staining of HEK-293 cells transfected with a vector for the simultaneous overexpression of human TRPV3 and green fluorescent protein (GFP, green), stained with a specific antibody against TRPV3 (red). The cell nuclei were stained with DAPI (blue). (b) An original recording of a patch clamp measurement of an hTRPV3 HEK-293 cell at 23 °C. No visible response was seen after the addition of 5 mmol·L−1 cinnamaldehyde (CIN), whereas 1 mmol·L−1 thymol (THY) elicited a clear response. (c) A patch clamp measurement of an hTRPV3 HEK-293 cell at 37 °C. The concentration of cinnamaldehyde had to be elevated to 5 mmol·L−1 before a small response could be observed. In contrast, at 1 mmol·L−1, the effects of the thymol were very strong. (d) A boxplot of patch clamp data from hTRPV3 HEK-293 cells at 37 °C and 23 °C, and from control cells transfected with the empty vector (MT, 37 °C) at +100 mV and −120 mV. Within a group, significant differences after the addition of cinnamaldehyde or thymol and the subsequent washouts (NaCl(2) and NaCl(3)) are indicated via different letters above the bars. Comparisons between the groups are given in the main text (e) Data from Ussing chamber experiments from a subset of seven young pigs from Figure 5 (controlled in-house study), treated in parallel with either thymol (N/n = 7/13) or cinnamaldehyde (N/n = 7/14). In the native colonic tissues, 1 mmol·L−1 of cinnamaldehyde was sufficient to induce a clear change in the short circuit current and the conductance, which rose by ΔIsc and ΔGt, respectively. For comparison, the data for thymol (1 mmol·L−1) are also shown. Here, the Isc responses were clearly smaller, but diverse, with some tissues showing an increase in Isc (“up”, N/n = 4/7) and others a decrease (“down”, N/n = 4/6). Bars that do not share a letter are significantly different.
In a first series of experiments, cinnamaldehyde was applied to the cells in the concentration used in the Ussing chamber experiments (1 mmol·L−1), which did not yield significant effects. In a second series, a higher concentration of 5 mmol·L−1 cinnamaldehyde was added to the cells, followed by a washout. At the end of the experiment, the addition of 1 mmol·L−1 thymol, which is a strong agonist of TRPV3, served as a control reaction. No response to 5 mmol·L−1 cinnamaldehyde was observed in hTRPV3 cells at 23 °C, although these cells reacted strongly to 1 mmol·L−1 thymol (Figure 6b). At 37 °C, a slowly increasing current was measured after the addition of cinnamaldehyde (5 mmol·L−1), which decreased again after the washout. However, the response was discrete when compared to the response to 1 mmol·L−1 thymol (Figure 6c). In contrast, the control cells (also measured at 37 °C) showed no effect from either of the two agonists.
Under the baseline conditions, the three groups of cells (hTRPV3 at 23 °C (N = 8), hTRPV3 at 37 °C (N = 14) and the control at 37 °C (N = 8)) did not show different currents at +100 mV and −120 mV pipette potential, respectively (Figure 6d). No effect was observed in the control group at 37 °C or in the hTRPV3 group at 23 °C. In hTRPV3 at 37 °C, the addition of cinnamaldehyde induced a significant increase in the Na+ efflux from the pipette into the bath solution at +100 mV, which rose from 60 ± 35 pA·pF−1 to 284 ± 181 pA·pF−1 (p < 0.001 vs. the baseline and p = 0.015 vs. 23 °C), as well as an increase in the Na+ influx from the bath solution into the pipette at −120 mV (from −27 ± 11 pA·pF−1 to −268 ± 217 pA·pF−1, p = 0.009 vs. the baseline and p = 0.052 vs. 23 °C). After the washout, the currents in the hTRPV3 37 °C group decreased numerically at 100 mV (to 100 ± 31 pA·pF−1) and at −120 mV (to −113 ± 54 pA·pF−1), but they were still significantly higher than they were initially. In contrast to the 5 mmol·L−1 required to induce a response to cinnamaldehyde, a concentration of 1 mmol·L−1 thymol caused significant increases in the currents at 100 mV and −120 mV in both hTRPV3 groups, although the current increase was significantly greater in the 37 °C cells (p < 0.001 and p = 0.002). This difference makes sense because the TRPV3 is activated at warm temperatures (≥32 °C) [42,43,44].
For comparison, the Ussing chamber data of the colonic epithelia from a subset of seven pigs that were treated in parallel in separate chambers with either thymol or with cinnamaldehyde were used. The epithelia that responded to thymol (1 mmol·L−1) with an increase in current (N/n = 4/7) were compared to the data from the same pigs treated with cinnamaldehyde (1 mmol·L−1) (N/n = 7/14) (Figure 6e). The responsive tissues with a “down” response (N/n = 4/6) to thymol are included in the graph, but they were even smaller.
In summary, the maximal ∆Isc after the addition of cinnamaldehyde (1.08 ± 0.22 µeq·cm−2·h−1) was significantly higher than after the thymol addition (0.20 ± 0.046 µeq·cm−2·h−1) (p = 0.002). The ∆Gt, which reflects both the secretion of K+ and the absorption of Na+ and Ca2+, was similar (2.36 ± 0.74 mS·cm−2 for 1 mmol·L−1 thymol and 3.94 ± 0.75 mS·cm−2 for 1 mmol·L−1 cinnamaldehyde). In contrast, in the patch clamp experiments on TRPV3 expressing cells, a five-fold higher concentration of 5 mmol·L−1 cinnamaldehyde was required to observe a significant response. This response was small and much lower than the response to 1 mmol·L−1 thymol. It thus appears that TRPV3 only plays a marginal role, if any, in the response of the colonic epithelium to 1 mmol·L−1 cinnamaldehyde.
3. Discussion
As outlined in the introduction, TRPA1 agonists are emerging as promising pharmacological tools in the modulation of intestinal function in health and disease [20,32]. Despite this, only a handful of studies have systematically investigated the interaction of TPRA1 agonists with native gastrointestinal epithelia [14,16,39,45].
Because systematic quantitative studies of TRPA1 expression by the gastrointestinal tract seem to be lacking, we wished to find out more about the relative expression of TRPA1 along the porcine gastrointestinal tract via semiquantitative qPCR. In the second part, we studied the electrophysiological effects of the classical and therapeutically promising TRPA1 agonist cinnamaldehyde on epithelia in Ussing chambers. Although some of the experiments were performed on tissues from the porcine jejunum, the primary focus was on the colon as a major locus of fermentation and of inflammatory bowel disease, which also happened to be the tissue with the highest expression of mRNA for TRPA1. Finally, some patch clamp experiments were performed on overexpressing cells in order to assess a possible contribution of TRPV3 to the cinnamaldehyde response [37].
3.1. Expression of mRNA for TRPA1 by the Tissues of the Porcine Gastrointestinal Tract
In a first step, semiquantitative PCR was used to investigate the distribution of TRPA1 in various segments of the gastrointestinal tract, namely the fundus and cardia of the stomach, duodenum, jejunum, ileum, caecum, and (middle) colon (Figure 1). The signals for TRPA1 in the muscular layers were below the detection level. With the curious exception of the ileum, the mucosa of all of the sections showed a clear expression of TRPA1, with the expression rising in the distal segments and highest in the colon. This finding is in agreement with immunohistochemical data showing that TRPA1 is expressed along the entire gastrointestinal tract of various species [11,27,39,46].
3.2. Effect of Blockers on Isc and Gt in Ringer
Evidence for the functional expression of TRPA1 by the colon was obtained by applying various blockers to colonic epithelia in Ussing chambers. (Table 1). Quinidine is a highly potent, although unspecific, blocker of numerous cation channels, while HC-030031 is considered to be specific for TRPA1. Both blockers significantly reduced the baseline Isc and Gt (Table 1 and Figure 7a). Conversely, the removal of Ca2+ can be expected to enhance the permeation of monovalent cations through TRP channels such as TRPA1 and TRPV3 [4]. In line with this, the mucosal replacement of Ca2+ with EGTA induced a highly significant increase of baseline Gt and Isc (Table 1). Because the experiments were carried out in symmetrical solutions with no chemical gradient present, the rise in Isc clearly reflects transcellular transport, most likely energized by the basolateral Na+/K+-ATPase. In addition, the removal of Ca2+ is known to enhance the permeability of the paracellular pathway by the decoupling of tight junction proteins [47,48], which may explain part of the rise in Gt.
Figure 7.
Model of the effects of cinnamaldehyde on the colon, based on the present study and the current literature. (a) Cinnamaldehyde opens apical, non-selective TRPA1 channels in the colonic mucosa near the lumen (
). The selectivity filter of the channel allows both the influx of Na+ and Ca2+, and a smaller efflux of K+, so that the effects on Isc are small. However, the cell is depolarised and a significant increase in conductance ΔGt is observed, which is reduced by quinidine and enhanced by the removal of divalent cations. The effects of cinnamaldehyde on TRPV3 (➀), which favors efflux of K+ over influx of Na+ and Ca2+, are discrete. Thymol opens both channels. (b) Prostanoids such as PGE2 are anions that are synthesized from membrane phospholipids via cyclooxygenase-mediated pathways and secreted into the extracellular space via pathways that are being explored (➁). For prostanoid signalling to end, the anionic prostaglandin has to be taken up into the cytosol via an electrogenic anion exchanger, OATP2A1 (SLCOA1) (➂), after which the prostaglandin is degraded by cytosolic enzymes. Due to the electrogenic nature of the cotransporter, the depolarization of the cellular membrane, as occurs after the opening of TRPA1 channels via cinnamaldehyde (
), decreases the uptake of prostaglandins and thus increases the extracellular prostaglandin concentration. (c) After the binding of the PGE2 to EP4 receptors (➃) expressed by the colonic mucosa, adenylyl cyclase is stimulated, resulting in rising levels of cAMP that open apical CFTR channels (➄). Other anion channels may contribute to the secretion of HCO3−, which is driven by the uptake of Na+ via basolateral NBCn1 (Slc4a7), NBCe1 (SLC4A4), or NBCe2 (Slc4a5) at a ratio of 1, 2 or 3 HCO3− for each Na+ (➅). Most of the NPPB-sensitive rise in Isc that is observed after the activation of TRPA1 via cinnamaldehyde can be explained by this mechanism. The secretion of HCO3− is important for the buffering of protons formed in the fermentational process (➆), and for the unfolding of mucines in the mucus layer, thus protecting the epithelium. Energy-rich short chain fatty acid anions (SCFA−) are absorbed via various transport proteins (➇) without challenging cytosolic pH homeostasis. In physiological concentrations, prostaglandins are also thought to have barrier-enhancing properties through interaction with tight junction proteins (➈). Possibly, the secretion of HCO3− is highest in cells near the surface, while in the crypts, the expression of NKCC1 (SLC12A2) (➉) predominates. The latter pathway leads to the secretion of Cl− via CFTR, which can result in diarrhea when cAMP levels are pathologically high. Because the gradients favor a unilateral efflux of anions, the opening of CFTR will have higher effects on ΔIsc than those after the opening of TRPA1.
The effects of the other treatments in Table 1 can be understood with textbook models of colonic transport [49]. The functional expression of ENaC (SCNN1) emerges from the amiloride response, while the effects of bumetanide point toward the basolateral expression of NKCC1, which drives the influx of Cl− for secretion via NPPB-sensitive apical Cl− channels (Figure 7c). These channels close when cAMP production is reduced after the application of the cyclooxygenase inhibitor indometacin, all of which is classically established [49].
3.3. Mucosal Cinnamaldehyde Induces an Increase in Isc and Gt
In a second step, the effect of cinnamaldehyde on stripped epithelium from the jejunum and the colon was investigated in Ussing chambers (Figure 2 and Supplementary Material Figure S1).
Unlike in previous studies of rat colon [16,39] or porcine jejunum [45], the application of cinnamaldehyde in a concentration of 100 µmol·L−1 did not result in significant changes in the electrophysiological parameters. This may reflect the particularly thick mucus layer protecting the porcine colon, in conjunction with a partial degradation of cinnamaldehyde by the resident microbials. However, when applied at 1 mmol·L−1, significant increases in Isc could be observed in both the colonic (Figure 2) and jejunal epithelia (Supplementary Materials Figure S1). Because, in our study, the colonic and jejunal responses from the same animals were monitored in parallel, they could be directly compared, and it emerged that the responses of the jejunum to cinnamaldehyde were significantly smaller in both ΔGt and ΔIsc. It is an attractive hypothesis that this reflects the lower expression of TRPA1 in this segment (Figure 1).
The jejunum responded not only to mucosal or bilateral application but also to the serosal application of cinnamaldehyde. In a previous study of porcine jejunum, the cinnamaldehyde response was inhibited by hexamethonium, but not by TTX. Conversely, the effects of thymol could be completely blocked by TTX [45]. It appears that an interplay of neuronal and epithelial TRP channels regulate the electrophysiological response of the jejunum in a complex manner that we did not attempt to unravel in the present study.
In the colon, the effects were more straightforward because the serosal application of cinnamaldehyde showed no effect (Figure 3). While the serosal application of lidocaine as a blocker of neuronal Na+ channels changed the baseline Isc and Gt of the colonic epithelium (Table 1), underlining the importance of neuronal signalling for the regulation of transport function, the subsequent response of the tissue to cinnamaldehyde was not altered by pretreatment with lidocaine (Figure 4 and Table 2). Likewise, in previous investigations of rat and human colon, agonists of TRPA1 were most effective when given mucosally, while preincubation with tetrodotoxin did not affect the response of the tissues to AITC, to cinnamaldehyde or to thymol [14,16,39]. In conjunction, these results suggest that the response of the colon to cinnamaldehyde involves mucosal receptors, with TRPA1 channels, as expressed by the apical membrane of human or rat colonocytes [39] being likely candidates.
3.4. Does Cinnamaldehyde Activate TRPV3?
Although it is generally considered to be specific for TRPA1, one study has suggested that cinnamaldehyde also opens TRPV3 channels [37]. TRPV3 is expressed by the apical membrane of colonocytes not only in rats and humans [50], but also in the pig (Manneck et al., submitted). Because commercially available specific agonists or inhibitors of TRPV3 are still in the process of being developed [51], we compared the responses of thymol (which strongly activates TRPV3 [25,41]) to those to cinnamaldehyde using Ussing chamber experiments on native epithelia and patch clamp experiments with overexpressing cells.
Previous studies of the thymol response in rat colon have shown a strong rise in Isc and Gt, resembling the response to cinnamaldehyde, although the signalling differed [14,39]. In porcine colon, the responses to thymol were highly variable, with both increases in Isc and decreases observed, in marked contrast to the uniform responses observed in parallel in tissues from the same pigs after the application of cinnamaldehyde. While changes in the barrier function may have contributed, the selectivity of TRPV3 to Ca2+ is poor, and it follows an Eisenman sequence IV with P(K+) > P(Na+) [4,40], while TRPA1 follows an Eisenman XI sequence with P(Na+) > P(K+) [1,2]. Accordingly, and depending on the gradients present, the opening of TRPV3 by thymol may lead to a secretion of K+ with the hyperpolarization of the apical membrane and a drop in Isc. Conversely, the opening of TRPA1 should lead to an increase in Isc, as observed with cinnamaldehyde. The different relative expression of TRPA1 or TRPV3 may thus explain the variability of the response to thymol.
In patch clamp experiments overexpressing hTRPV3, as in a previous study of the bovine homologue [41], 1 mmol·L−1 thymol elicited the expected large response. However, despite numerous attempts, at 1 mmol·L−1, no effect after the application of cinnamaldehyde could be observed. Small effects of cinnamaldehyde were only detectable at 5 mmol·L−1 and after the elevation of the bath temperature to 37 °C.
It thus appears that contributions of TRPV3 to the cinnamaldehyde response are possible, but most likely small.
3.5. Gt Is Sensitive to Quinidine
Further experiments were conducted in order to assess the contribution of cation absorption and/or anion secretion to the current. The lack of an effect of amiloride on the cinnamaldehyde response suggests that ENaC was not involved (Figure 4 and Table 2). Quinidine, a blocker of non-selective cation channels, had a strikingly negative impact on the increase in Gt observed after the application of cinnamaldehyde, with ΔGt dropping by more than half (Figure 4), although ΔIsc was not altered. Possibly, the quinidine effects were caused by a previously unknown negative interaction of quinidine with tight junction proteins. However, a more likely hypothesis is that quinidine blocked both the influx of Na+ and the efflux of K+ through TRP channels such as TRPV3 and TRPA1 by roughly equal amounts (Figure 7a), so that as a net effect, the Isc level remained roughly the same, while the Gt dropped to about 40%.
In three different studies of rat colon, the response to AITC, cinnamaldehyde or thymol (100 µmol⋅L−1) was significantly reduced by an equivalent concentration of HC-030031 [14,16,39]. On the other hand, the knockout of TRPA1 only partially reduced the AITC response, highlighting the possibility that TRPA1 may not be the only channel involved [16]. In our study, the TRPA1 blocker HC-030031 reduced the cinnamaldehyde response numerically, but the effects did not pass testing for significance (Figure 4 and Table 2). The most likely explanation is that 100 µmol⋅L−1 of HC-030031 was insufficient to block the activity of the 1 mmol⋅l−1 cinnamaldehyde used in this study.
3.6. Isc and ΔGt Can Be Inhibited by Indometacin
The effects of the anion channel blocker NPPB suggest that the cinnamaldehyde-induced rise in Isc is at least partially caused by the opening of an apical anion channel [49] (Figure 7c). Indometacin, which leads to reduced levels of cAMP, had identical effects, pointing towards an involvement of CFTR, although additional anion channels may participate. In our study, neither drug had a significant impact on ΔGt. In contrast, in studies of the rat colon, the COX-inhibitor piroxicam reduced both ΔGt and ΔIsc in response to AITC [39].
In the study by Kaji et al. [39], the application of PGE2 induced increases in Isc that could not be further enhanced by the subsequent application of AITC, suggesting that all of the CFTR channels were already at the maximal open probability. Furthermore, in both human and rat colon, the response to AITC could be strongly inhibited by ONO-AE3-208, a specific blocker which prevents the binding of PGE2 to the EP4 receptor.
3.7. Bicarbonate Is a Bigger Player Than Chloride in ΔIsc and ΔGt
As mentioned above, the basolateral uptake of Cl− classically occurs via NKCC1 (SLC12A2). The responses of the rat and human colon to either thymol or AITC were partially blocked by bumetanide in two previous studies [14,39]. All of the responses could also be significantly reduced by the removal of Cl−, with smaller effects after the removal of bicarbonate. Conversely, the cinnamaldehyde response of the pig jejunum was sensitive to the removal of HCO3−, but insensitive to either chloride removal or bumetanide [45].
In this study, the response of pig colon to cinnamaldehyde resembles the previous findings in pig jejunum [45]. The blocking of NKCC1 by bumetanide did not interfere with the cinnamaldehyde response, showing no significant effect on either ΔIsc or ΔGt. Furthermore, the bilateral reduction of Cl− (from 130.3 to 10.3 mmol·L−1) had no significant effect on ΔIsc, although ΔGt was significantly reduced by about half. Instead, dramatic effects were observed after the removal of only 25 mmol·L−1 bicarbonate from the solution via replacement with HEPES and gluconate (Supplementary Materials Table S1). Despite the continued presence of 130.3 mmol·L−1 Cl−, the cinnamaldehyde-induced ΔIsc dropped to less than a third of the control response, while ΔGt dropped by about 40%. It thus appears that despite having a much lower concentration and only 60% of the mobility (see mobility listings in JPCalcWin 1.01, [52]) HCO3− contributes more to the cinnamaldehyde-induced ΔIsc and ΔGt than Cl−.
These results are understandable if one assumes that NKCC1 does not contribute much to the cinnamaldehyde response. The basolateral uptake of HCO3− most likely occurs via basolateral cotransporters such as NBCe1 (SLC4A4), NBCe2 (Slc4a5) or NBCn1 (Slc4a7), which mediate the cotransport of Na+ and HCO3−, and are amply expressed by the hindgut [53,54,55]. The apical efflux of HCO3− should be possible through apical Cl− channels such as CFTR [49,56,57], which, like practically all of the anion channels known to date, are notoriously promiscuous. Either signalling complexes between the NBCs and CFTR or differential expression by distinct cell types may explain the preferential transport of HCO3− over Cl−. In contrast to the secretion of chloride, the secretion of HCO3− should be useful to help with the buffering of short chain fatty acids fermentationally produced from fiber within the colonic lumen [33,34]. This may be of particular importance in pigs, which typically obtain about 30% of their energy from hindgut fermentation [34].
3.8. Gt Requires the Presence of Mucosal Na+
At this point, some deliberations concerning the ΔGt induced by cinnamaldehyde are possible. Given the low selectivity of anion channels, it is very hard to envision a paracellular tight junction protein with a high selectivity for HCO3− over Cl−. It thus appears that the HCO3− dependent fraction, or about 40%, reflect changes in the transcellular passage of HCO3−. Experiments in low chloride Ringer suggest that 25% of ΔGt reflects the para- or transcellular flux of Cl−. In conjunction with the quinidine data, it appears that, in total, roughly half of ΔGt is caused by anions. Despite this, the removal of bilateral Na+ had dramatic effects on the cinnamaldehyde response, with ΔIsc and ΔGt at a mere ~ 15 and 20% of the response in the control tissues, respectively. The collapse in ΔIsc is clearly due to the lack of serosal Na+ as a driving force for Na+-HCO3− cotransport. However, if paracellular transport is assumed to be responsible for changes in conductance, the collapse in ΔGt greatly exceeds reasonable expectations. Furthermore, ΔGt collapsed by precisely the same amount when Na+ was replaced on the mucosal side only. This observation is not compatible with the assumption of a paracellular flux of Na+, because in this case, ΔGt should have been much higher after the unilateral Na+ removal than after the bilateral Na+ removal. It appears that while a large part of the ΔGt response reflects the passage of anions, the signalling to induce the response occurs via a quinidine-sensitive pathway and requires the presence of mucosal Na+. The entry of Na+ through TRPA1 is the most likely option.
While the mucosal removal of Na+ dramatically reduced ΔGt, it had absolutely no effect on the cinnamaldehyde-induced ΔIsc. A possible reason for this is that the removal of mucosal Na+ decreased the cytosolic Na+, thus stimulating the basolateral influx of HCO3− via Na+-HCO3− cotransport and the influx of Cl− via NKCC1, with a subsequent increase in the apical secretion of anions. Another possibility is that the influx of Ca2+ was sufficient for the response.
3.9. Removal of Ca2+ Enhances ΔGt
An attractive hypothesis is to assume that the cinnamaldehyde induced increase in Isc is calcium dependent. Rising levels of cytosolic Ca2+ typically activate the apical Cl− channels of the colonic epithelium both directly (in the case of calcium-dependent Cl− channels) and indirectly (via calcium-dependent adenylyl cyclases with the production of cAMP) [49,58]. Thus, in rat colon, the thymol-induced ΔIsc was reduced in bilateral Ca2+-free Ringer, although notably, the ΔGt remained the same [14]. In contrast, Ca2+ removal did not affect the AITC response of rat colon in a study by the same authors [39].
In the current study of porcine colon, bilateral nominally Ca2+-free solution did not lead to a reduction in the cinnamaldehyde-induced ΔIsc. Instead, the cinnamaldehyde-induced ΔGt rose to almost twice the size observed in controls from the same animals. When Ca2+ was replaced by EGTA on the mucosal side only, ΔGt rose even further to a striking 300% of the controls (p < 0.001). Simultaneously, ΔIsc rose numerically to 150% of the controls from the same animals, a result that tested for significance when compared to the entire set of the controls. It thus appears that Ca2+ is very clearly not necessary for the response of the tissues to cinnamaldehyde.
3.10. Does the Opening of TRPA1 Inhibit the Uptake and Degradation of Prostaglandins?
While further work is clearly necessary, some speculation is possible. The synthesis of PGE2 by the colon is well-documented, and the effects of the inhibition of prostaglandin synthesis were significant and seen not only in this study, but also in two separate studies of rat colon using AITC as a TRPA1 agonist [16,39]. Prostanoids such as PGE2 are anions that are synthesized from membrane phospholipids via cyclooxygenase-mediated pathways. After secretion into the extracellular space, prostanoids are bound to specific prostanoid receptors [59,60]. For prostanoid signalling to end, the anionic prostaglandin has to be taken up into the cytosol where it is degraded. This uptake occurs via an electrogenic anion exchanger, OATP2A1 (SLCO2A1), with the efflux of two lactate anions driving the influx of one prostaglandin anion. Accordingly, the depolarization of the cellular membrane decreases the uptake of PGE2 [59,60,61]. The events are thus as follows: PGE2 is continuously produced by the colonic epithelium and taken back up into the cell via OATP2A1. If TRPA1 is opened via cinnamaldehyde or AITC, the entry of Na+ and Ca2+ will exceed the efflux of K+, depolarizing the cell. This reduces the reuptake of PGE2 via OATP2A1. There is thus more PGE2 to bind to EP4, leading to the activation of adenyl cyclase, the production of cAMP, the opening of CFTR and, finally, the secretion of HCO3− and Cl−. In conjunction, a rise in the current (ΔIsc) and a rise in conductance (ΔGt) are observed.
3.11. Barrier Effects
As outlined above, we do not think that an opening of the paracellular pathway can explain the major part of the cinnamaldehyde-induced ΔGt response. From this study and others, there is considerable evidence to suggest that the activation of TRPA1 induces the secretion of PGE2 [16,39]. PGE2 has direct barrier-enhancing properties [62,63]. Thus, in cell culture models of colonic epithelia, prostaglandin-mediated signalling via the EP2 receptor prevented the proteosomal degradation of Claudin-4 [64]. The colon of EP4 deficient mice showed increased rates of apoptotic cells, as well as a defective mucosal barrier with signs of inflammation [65]. Furthermore, PGE2 was found to stimulate the recovery of the barrier function in porcine ischemia-injured ileal mucosa [66]. In addition, lower levels of PGE2 and other prostaglandins are thought to be involved in the classical gastrointestinal side-effects of cyclooxygenase inhibitors [67]. However, it is important to bear in mind that the pharmacology of PGE2 is notoriously complex, with numerous pro- and anti-inflammatory effects that are probably related to local concentrations of PGE2 and the expression patterns of its various receptors [62].
3.12. Cinnamaldehyde, Bicarbonate and the Buffering of Fermentational Acids in the Colon
More work is clearly necessary to understand the interaction of essential oils in general and of cinnamaldehyde in particular with colonic epithelia, but a picture is slowly emerging (Figure 7). In humans and in animals, the function of the colon is to serve as a fermentation chamber in which microbials can degrade the structural carbohydrates that are resistant to enzymatic digestion of the small intestine [33,34]. Anaerobic fermentation produces large quantities of short-chain fatty acids (Figure 7c). Large quantities of protons are released via dissociation and have to be removed, since low values of pH produce shifts in the colonic microbiome towards species that produce lactic acid. This is an occurrence associated with a further drop in colonic pH and subsequent damage to the epithelium [38,68,69]. The secretion of bicarbonate with the subsequent formation of CO2 is a highly appropriate and well-established buffering mechanism [53,54,57]. While protons are removed via the formation of CO2, the anions of short-chain fatty acids can then be transported across the epithelium without impairing the cellular pH homeostasis via various pathways that have been discussed elsewhere [33]. In a further twist, the secretion of HCO3− enhances the unfolding of the mucines that protect the epithelium from the bacterial invasion and inflammation seen in inflammatory bowel disease [38,70].
The current study suggests that the ingestion of plants rich in terpenes—such as those contained in the bark of the Cinnamomum verum tree—may help to stimulate HCO3− secretion. After the degradation of plant structures by microbials in the colon, cinnamaldehyde is released and binds to TRPA1, preventing the cellular uptake and degradation of PGE2 (Figure 7a,b). The rising levels of cAMP will then stimulate the secretion of HCO3− (Figure 7c). The removal of protons should certainly help to prevent damage to the epithelial cells, and may explain part of the anti-inflammatory action of essential oils such as cinnamaldehyde. Of course, the amounts consumed must not be too high, because otherwise the secretion of chloride might lead to diarrhea and other disagreeable or even toxic effects. It appears possible that humans and animals alike will use their outstanding ability to detect the smallest quantities of essential oils via their sense of smell to precisely assess just how much is needed to make the food tasty, but not too spicy [71].
4. Materials and Methods
4.1. Gastrointestinal Tissue
The porcine gastrointestinal tissues were obtained according to the guidelines of the German Animal Welfare Law under oversight by the local authority of the “Landesamt für Gesundheit und Soziales Berlin” (LaGeSo Reg. Nr. T0264/15 and T0297/17). The pigs were a cross between the Danbred x Piétrain breeds, weighing ~25 kg and aged about 10 weeks, and were fed a normal diet. The animals were killed by prior sedation with ketamine (Ursotamin®, Serumwerk Bernburg AG, Bernburg, Germany) and azaperone (Stresnil®, Jansen-Cilag, Neuss, Germany) by intramuscular injection, followed by an intracardiac injection of tetracaine hydrochloride, mebezonium iodide and embutramide (T61®, Intervet Deutschland GmbH, Unterschleissheim, Germany). In a few experiments, older pigs from a commercial slaughterhouse were used, which is indicated where applicable. After death, the gastrointestinal tissue was immediately removed.
4.2. Molecular Detection of the TRPA1 Channel in the Gastrointestinal Tissue
For the molecular investigations, the removed gastrointestinal tissue (the fundus and cardia of the stomach, duodenum, mid-jejunum, ileum, caecum and mid-colon) was thoroughly rinsed with PBS, and small pieces of 1 cm3 of the tunica muscularis or the mucosa were transferred into tubes containing 1 mL of RNAlater® (Sigma-Aldrich, Taufkirchen, Germany). These were cooled at 4 °C overnight and then stored at −80 °C. For the RNA isolation, a Nucleospin RNA II kit (Macherey-Nagel, Dueren, Germany) was used, and the RNA integrity numbers (RIN) were determined using an RNA 600 Nano kit (Agilent, Waldbronn, Germany). The samples from 4 pigs (out of 6) with the best RIN values (RIN > 6.8 for the ileal epithelium and RIN > 7.3 for all of the other tissues) were subsequently processed. For the reverse transcription into cDNA, an iScript® cDNA synthesis kit (Bio-Rad Laboratories, Munich, Germany) was used according to the manufacturer’s instructions, whereby 1 µg RNA was transcribed per sample and then diluted 1:10.
Afterwards, an exon spanning FAM/BHQ1 labelled primer-probe combination was designed according to the predicted sequence of the porcine TRPA1 channel, and the corresponding reference genes were established (Table 3), which were synthesized by Eurofins (Eurofins Genomics Germany GmbH, Ebersberg, Germany). In order to ensure that the correct target was bound, the amplification product was sequenced and compared to the target sequence (Eurofins Genomics Germany GmbH, Ebersberg, Germany). Primer–probe combinations were also used for the three selected reference genes: ACTB (FAM/BHQ1), GAPDH [72] and YWHAZ (FAM/TAMRA). For the semi-quantitative analysis by qPCR, a 40-cycle 2-step protocol (1 s 95 °C, 20 s 60 °C) was performed on a thermocycler (ViiA 7, Applied Biosystems/Life Technologies, Waltham, MA, USA). The reactions were performed in triplicates with 3.7 µL cDNA and iTaq® Universal Probes Supermix (Bio-Rad Laboratories GmbH, Feldkirchen, Germany) with a total volume of 10 µL. Negative controls (no template controls) were routinely included. The quantification cycles (Cq) were calculated automatically by the cycler software. The dilution series-based gene-specific amplification efficiencies for the primer pairs were determined and the reference genes were tested for their expression stability (qbasePLUS, Biogazelle NV, Zwijnaarde, Belgium). The Cq values of the target gene TRPA1 were normalized using ACTB, GAPDH, and YWHAZ, and were scaled to the sample means. Subsequently, the values were exported as calibrated normalized relative quantity (CNRQ) values using qbasePLUS.
Table 3.
Primer sequences and the amplicon length of the genes used.
| Gene | Length (bp) | Primer | Gene Acession No. |
|---|---|---|---|
| TRPA1 fwd | 192 | ACAGGAAAGTCAGCCCTCTC | XM_001926115.4 |
| TRPA1 rev | TATCCTGGCTGCCCGAATAG | ||
| TRPA1 probe | TTTGCGGCCACCCAGGGAGC | ||
| ACTB fwd | 127 | GACATCAAGGAGAAGCTGTG | XM_003124280.5 |
| ACTB rev | CGTTGCCGATGGTGATG | ||
| ACTB probe | CTGGACTTCGAGCAGGAGATGGCC | ||
| YWHAZ fwd | 113 | AAGAGTCATACAAAGACAGCAC | XM_021088756.1 |
| YWHAZ rev | ATTTTCCCCTCCTTCTCCTG | ||
| YWHAZ probe | ATCGGATACCCAAGGAGATGAAGCTGAA | ||
| GAPDH fwd | 117 | CAAGAAGGTGGTGAAGCAG | NM_001206359.1 |
| GAPDH rev | GCATCAAAAGTGGAAGAGTGAG | ||
| GAPDH probe | TGAGGACCAGGTTGTGTCCTGTGACTTCAA |
Attempts to find a suitable antibody against TRPA1 were unfortunately unsuccessful. Five commercial antibodies were tested, but yielded multiple or no bands in immunoblots of porcine tissues (sc-166469 and sc-376495, Santa Cruz Biotechnology Inc, Dallas, TX, USA; ACC-037, Alomone, Jerusalem, Israel; TA338564, OriGene, Herford, Germany and AG1346, Abgent, San Diego, CA, USA).
4.3. Ussing Chamber Studies
For the electrophysiological studies using a Ussing chamber, the tissue was washed with transport buffer after the removal. The tunica muscularis was stripped, and the tissue was transported with ice-cooled gassed (95% O2/5% CO2) transport buffer (in mmol·L−1: 115 NaCl, 0.4 NaH2PO4, 2.4 Na2HPO4, 5 KCl, 25 NaHCO3, 5 glucose, 10 HEPES, 1.2 CaCl2, 1.2 MgCl2). The tissue was then mounted in 0.95 cm2 classical, custom-built Ussing chambers with perfusion maintained via a gas-lift system [73,74], which were filled with 10 mL Ringer’s solution (in mmol·L−1: 120 NaCl, 25 NaHCO3, 0.32 NaH2PO4, 1 MgSO4, 6.3 KCl, 2 CaCl2) per side, unless otherwise declared. In order to exclude a glucose-induced sodium current, 16 mmol·L−1 glucose was added to the serosal side and 16 mmol·L−1 mannitol was added to the mucosal side. The final osmolality of the solutions was adjusted to 300 mosmol·kg−1 with mannitol. During the experiment, the tissue was kept permanently at 37 °C and gassed with 95% O2 and 5% CO2, whereas the solutions without HCO3− were gassed with oxygen. After the tissue mounting, the measurements were performed in short-circuit mode and the current (Isc) was recorded, with positive values reflecting the transport of cations from the mucosal to the serosal side. Throughout, the Isc represents the molar flux (in µeq·cm−2·h−1), which can be calculated from the current Φt (in µA·cm−2) according to Isc = Φt/F·3600s·h−1 = Φt/26.80 µeq·cm−2·h−1, where F is the Faraday constant. Using a 100 µA current pulse and the corresponding potential response, the conductance (Gt, in mS·cm−2) was continuously recorded (Mussler Scientific Instruments, Aachen, Germany).
Measurements commenced after the Isc and Gt values had stabilized, or after a maximum of 45 min. All of the agonists were added directly via a pipette to the bath solution in a ratio of 1:1000 to yield the target concentration, with the substances dissolved in either water (amiloride), ethanol (cinnamaldehyde, thymol, lidocaine, bumetanide, indometacin) or dimethyl sulfoxide (DMSO) (quinidine, 5-nitro-2-(3-phenylpropyl-amino) benzoic acid (NPPB), HC-030031). Cinnamaldehyde (1 mmol⋅L−1) was added 15 min later. In the other experiments, the solution changes occurred 15 min before the addition of cinnamaldehyde. The composition of the solutions used can be found in the Supplementary Materials Table S1.
4.4. Patch Clamp Studies
A human construct of TRPV3 (hTRPV3) was used for the patch-clamp experiments, essentially as in [40,41]. The sequence (GeneArt, Thermo Fisher Scientific, Regensburg, Germany) was tagged with hemagglutinin (HA) and streptavidin (Strep). This construct was subsequently subcloned into pIRES2-AcGFP1 (Takara BioEurope, Saing-Germain-en-Laye, France). HEK-293 cells were used for transient transfection (DSMZ, Braunschweig, Germany). The cells were cultured using Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and 100 units·mL−1 of penicillin and streptomycin (Biochrom, Berlin, Germany). Approximately 24 h before the start of the experiment, the cells were transfected with polyethyleneimine and the HA-Strep-hTRPV3-pIRES-AcGFP1 construct or the empty pIRES-AcGFP1 vector (control). Accordingly, the successfully transfected hTRPV3 cells should show green fluorescence. Furthermore, the cells were stained with a mouse TRPV3 antibody (ABIN863127, antibodies-online GmbH, Aachen, Germany) at a 1:1000 dilution, as in [40].
The whole-cell experiments were performed at room temperature (adjusted to 23 °C with an airconditioning system) and at 37 °C, using an inline solution heater to adjust the temperature (PH01 (S/N 1007), Multichannel Systems). Patchmaster software (HEKA Electronic) automatically performed the generation of pulses, data collection, filtering with a 2.9 kHz Bessel filter, and correction for capacity and series resistance. A low sampling rate (100 Hz) pulse protocol was used for the recording in order to assess the solution changes. This automatically switched to a classical step protocol with a high sampling rate (5 kHz) to assess the channel kinetics, as in previous studies [40,41]. After the measuring the osmolality, the solutions were adjusted to 300 mosmol·kg−1 with mannitol and buffered to a pH of 7.4. The pipette solution contained (in mmol·L1): 5 CsCl, 6.63 NaCl, 127.36 Na-gluconate, 10 EGTA, 10 HEPES, 1.91 CaCl2, 2.27 MgCl2, 1 Mg-ATP. The extracellular solution contained (in mmol·L−1): 5 KCl, 1 NaH2PO4, 137 NaCl, 10 HEPES, 1.7 CaCl2, 0.9 MgCl2, 5 glucose. In the experiment, the effect of 1 and 5 mmol·L−1 cinnamaldehyde was studied at 37 °C and 23 °C, with 1 mmol·L−1 thymol serving as a control reaction at the end of the experiment.
4.5. Data and Statistics
The statistical analysis was performed with the program SigmaPlot 11.0 (Systat Software, Erkrath, Germany), with the data being tested for normal distribution (Shapiro-Wilk) and homogeneity of variances (Brown-Forsythe). Subsequently, data were tested using a parametric test (Student’s t-test or ANOVA (Student-Newman-Keuls or Dunn’s method)) or a non-parametric test (Mann-Whitney U test or ANOVA on ranks (Kruskal-Wallis method)), as appropriate. Statistical significance was assumed at p < 0.05. The data are presented as the mean values ± SEM. The number of experiments with pigs is expressed as N/n, where N is the number of animals and n is the number of tissues. The Ussing chamber data were binomially smoothed using Igor Pro 6.37 (WaveMetrics Inc., Lake Oswego, OR, USA). The statistical analysis of the qPCR data was performed using the calculated CNRQ data (qbasePLUS, Biogazelle NV, Zwijnaarde, Belgium). In the barplots, different letters were placed above the bars to designate significant differences. Bars that do not share a letter are significantly different (p < 0.05). Conversely, bars that share at least one letter are not different (p > 0.05).
Acknowledgments
We would like to thank Martin Grunau, Julius Dahl and Katharina Söllig for their great technical support.
Supplementary Materials
The following are available online at https://www.mdpi.com/article/10.3390/ijms22105198/s1, Figure S1: Concentration effects of cinnamaldehyde in the jejunum; Figure S2: Effect of cinnamaldehyde after the mucosal, serosal and bilateral addition in the jejunum; Figure S3: Effect of thymol after the mucosal, serosal and bilateral addition in the colon; Figure S4: Effect of the bilateral addition of thymol in the jejunum; Table S1: Ussing chamber solutions.
Author Contributions
Conceptualization, F.S., and D.M.; methodology, F.S., H.-S.B., G.M. and D.M.; software, F.S.; validation, D.M., and H.-S.B.; formal analysis, D.M. and F.S.; investigation, D.M. and G.M.; resources, F.S., J.R.; data curation, D.M. and F.S.; writing—original draft preparation, D.M. and F.S.; writing—review and editing, D.M., F.S., G.M., J.R. and H.-S.B.; visualization, D.M.; supervision, F.S.; project administration, F.S. All authors have read and agreed to the published version of the manuscript.
Funding
Funding for David Manneck was provided by “Akademie für Tiergesundheit (AfT)”. The hTRPV3 vector and a few laboratory supplies were obtained in the course of a project funded by Deutsche Forschungsgemeinschaft (DFG STU 258/7-1). The porcine epithelia were obtained from an unrelated study. We acknowledge support by the Open Access Publication Fund of the Freie Universität Berlin.
Institutional Review Board Statement
The study was conducted according to German animal welfare and approved by the “Landesamt für Gesundheit und Soziales Berlin” (LaGeSo Reg Nr. T0264/15 and T0297/17).
Data Availability Statement
Data available on request.
Conflicts of Interest
D.M., G.M. and F.S. declare no conflict of interests. At the time of the study, H.-S.B. and J.R. were employees of PerformaNat GmbH. There was no influence on the results during the evaluation and interpretation.
Footnotes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Talavera K., Startek J.B., Alvarez-Collazo J., Boonen B., Alpizar Y.A., Sanchez A., Naert R., Nilius B. Mammalian Transient Receptor Potential TRPA1 Channels: From Structure to Disease. Physiol. Rev. 2020;100:725–803. doi: 10.1152/physrev.00005.2019. [DOI] [PubMed] [Google Scholar]
- 2.Nilius B., Appendino G., Owsianik G. The Transient Receptor Potential Channel TRPA1: From Gene to Pathophysiology. Pflugers. Arch. 2012;464:425–458. doi: 10.1007/s00424-012-1158-z. [DOI] [PubMed] [Google Scholar]
- 3.Bobkov Y.V., Corey E.A., Ache B.W. The pore properties of human nociceptor channel TRPA1 evaluated in single channel recordings. Biochim. Biophys. Acta. 2011;1808:1120–1128. doi: 10.1016/j.bbamem.2010.12.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Owsianik G., Talavera K., Voets T., Nilius B. Permeation and selectivity of TRP channels. Annu. Rev. Physiol. 2006;68:685–717. doi: 10.1146/annurev.physiol.68.040204.101406. [DOI] [PubMed] [Google Scholar]
- 5.Kremeyer B., Lopera F., Cox J.J., Momin A., Rugiero F., Marsh S., Woods C.G., Jones N.G., Paterson K.J., Fricker F.R., et al. A gain-of-function mutation in TRPA1 causes familial episodic pain syndrome. Neuron. 2010;66:671–680. doi: 10.1016/j.neuron.2010.04.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Taylor-Clark T.E., Undem B.J., Macglashan D.W., Jr., Ghatta S., Carr M.J., McAlexander M.A. Prostaglandin-induced activation of nociceptive neurons via direct interaction with transient receptor potential A1 (TRPA1) Mol. Pharmacol. 2008;73:274–281. doi: 10.1124/mol.107.040832. [DOI] [PubMed] [Google Scholar]
- 7.Cruz-Orengo L., Dhaka A., Heuermann R.J., Young T.J., Montana M.C., Cavanaugh E.J., Kim D., Story G.M. Cutaneous nociception evoked by 15-delta PGJ2 via activation of ion channel TRPA1. Mol. Pain. 2008;4:30. doi: 10.1186/1744-8069-4-30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Andersson D.A., Gentry C., Moss S., Bevan S. Transient receptor potential A1 is a sensory receptor for multiple products of oxidative stress. J. Neurosci. 2008;28:2485–2494. doi: 10.1523/JNEUROSCI.5369-07.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Yilmaz M.S., Goktalay G., Millington W.R., Myer B.S., Cutrera R.A., Feleder C. Lipopolysaccharide-induced hypotension is mediated by a neural pathway involving the vagus nerve, the nucleus tractus solitarius and alpha-adrenergic receptors in the preoptic anterior hypothalamic area. J. Neuroimmunol. 2008;203:39–49. doi: 10.1016/j.jneuroim.2008.06.023. [DOI] [PubMed] [Google Scholar]
- 10.Alaimo A., Rubert J. The Pivotal Role of TRP Channels in Homeostasis and Diseases throughout the Gastrointestinal Tract. Int. J. Mol. Sci. 2019;20:5277. doi: 10.3390/ijms20215277. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Holzer P. Transient receptor potential (TRP) channels as drug targets for diseases of the digestive system. Pharmacol. Ther. 2011;131:142–170. doi: 10.1016/j.pharmthera.2011.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Yang Y., Wang S., Kobayashi K., Hao Y., Kanda H., Kondo T., Kogure Y., Yamanaka H., Yamamoto S., Li J., et al. TRPA1-expressing lamina propria mesenchymal cells regulate colonic motility. JCI Insight. 2019;4 doi: 10.1172/jci.insight.122402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Brierley S.M., Hughes P.A., Page A.J., Kwan K.Y., Martin C.M., O’Donnell T.A., Cooper N.J., Harrington A.M., Adam B., Liebregts T., et al. The ion channel TRPA1 is required for normal mechanosensation and is modulated by algesic stimuli. Gastroenterology. 2009;137:2084–2095 e2083. doi: 10.1053/j.gastro.2009.07.048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Kaji I., Karaki S., Kuwahara A. Effects of luminal thymol on epithelial transport in human and rat colon. Am. J. Physiol. Gastrointest. Liver Physiol. 2011;300:G1132–G1143. doi: 10.1152/ajpgi.00503.2010. [DOI] [PubMed] [Google Scholar]
- 15.Kun J., Szitter I., Kemeny A., Perkecz A., Kereskai L., Pohoczky K., Vincze A., Godi S., Szabo I., Szolcsanyi J., et al. Upregulation of the transient receptor potential ankyrin 1 ion channel in the inflamed human and mouse colon and its protective roles. PLoS ONE. 2014;9:e108164. doi: 10.1371/journal.pone.0108164. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Fothergill L.J., Callaghan B., Rivera L.R., Lieu T., Poole D.P., Cho H.J., Bravo D.M., Furness J.B. Effects of Food Components That Activate TRPA1 Receptors on Mucosal Ion Transport in the Mouse Intestine. Nutrients. 2016;8:623. doi: 10.3390/nu8100623. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Balemans D., Boeckxstaens G.E., Talavera K., Wouters M.M. Transient receptor potential ion channel function in sensory transduction and cellular signaling cascades underlying visceral hypersensitivity. Am. J. Physiol. Gastrointest. Liver Physiol. 2017;312:G635–G648. doi: 10.1152/ajpgi.00401.2016. [DOI] [PubMed] [Google Scholar]
- 18.Meseguer V., Alpizar Y.A., Luis E., Tajada S., Denlinger B., Fajardo O., Manenschijn J.A., Fernandez-Pena C., Talavera A., Kichko T., et al. TRPA1 channels mediate acute neurogenic inflammation and pain produced by bacterial endotoxins. Nat. Commun. 2014;5:3125. doi: 10.1038/ncomms4125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Startek J.B., Voets T., Talavera K. To flourish or perish: Evolutionary TRiPs into the sensory biology of plant-herbivore interactions. Pflugers Arch. 2019;471:213–236. doi: 10.1007/s00424-018-2205-1. [DOI] [PubMed] [Google Scholar]
- 20.Spisni E., Petrocelli G., Imbesi V., Spigarelli R., Azzinnari D., Donati Sarti M., Campieri M., Valerii M.C. Antioxidant, Anti-Inflammatory, and Microbial-Modulating Activities of Essential Oils: Implications in Colonic Pathophysiology. Int. J. Mol. Sci. 2020;21:4152. doi: 10.3390/ijms21114152. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Bandell M., Story G.M., Hwang S.W., Viswanath V., Eid S.R., Petrus M.J., Earley T.J., Patapoutian A. Noxious cold ion channel TRPA1 is activated by pungent compounds and bradykinin. Neuron. 2004;41:849–857. doi: 10.1016/S0896-6273(04)00150-3. [DOI] [PubMed] [Google Scholar]
- 22.Macpherson L.J., Dubin A.E., Evans M.J., Marr F., Schultz P.G., Cravatt B.F., Patapoutian A. Noxious compounds activate TRPA1 ion channels through covalent modification of cysteines. Nature. 2007;445:541–545. doi: 10.1038/nature05544. [DOI] [PubMed] [Google Scholar]
- 23.Macpherson L.J., Geierstanger B.H., Viswanath V., Bandell M., Eid S.R., Hwang S., Patapoutian A. The Pungency of Garlic: Activation of TRPA1 and TRPV1 in Response to Allicin. Curr. Biol. 2005;15:929–934. doi: 10.1016/j.cub.2005.04.018. [DOI] [PubMed] [Google Scholar]
- 24.Karashima Y., Damann N., Prenen J., Talavera K., Segal A., Voets T., Nilius B. Bimodal action of menthol on the transient receptor potential channel TRPA1. J. Neurosci. 2007;27:9874–9884. doi: 10.1523/JNEUROSCI.2221-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Ortar G., Morera L., Moriello A.S., Morera E., Nalli M., Di Marzo V., De Petrocellis L. Modulation of thermo-transient receptor potential (thermo-TRP) channels by thymol-based compounds. Bioorg. Med. Chem. Lett. 2012;22:3535–3539. doi: 10.1016/j.bmcl.2012.03.055. [DOI] [PubMed] [Google Scholar]
- 26.Cho H.J., Callaghan B., Bron R., Bravo D.M., Furness J.B. Identification of enteroendocrine cells that express TRPA1 channels in the mouse intestine. Cell Tissue Res. 2014;356:77–82. doi: 10.1007/s00441-013-1780-x. [DOI] [PubMed] [Google Scholar]
- 27.Purhonen A.K., Louhivuori L.M., Kiehne K., Kerman K.E., Herzig K.H. TRPA1 channel activation induces cholecystokinin release via extracellular calcium. FEBS Lett. 2008;582:229–232. doi: 10.1016/j.febslet.2007.12.005. [DOI] [PubMed] [Google Scholar]
- 28.Qu S., Shen Y., Wang M., Wang X., Yang Y. Suppression of miR-21 and miR-155 of macrophage by cinnamaldehyde ameliorates ulcerative colitis. Int. Immunopharmacol. 2019;67:22–34. doi: 10.1016/j.intimp.2018.11.045. [DOI] [PubMed] [Google Scholar]
- 29.Momtaz S., Navabakhsh M., Bakouee N., Dehnamaki M., Rahimifard M., Baeeri M., Abdollahi A., Abdollahi M., Farzaei M.H., Abdolghaffari A.H. Cinnamaldehyde targets TLR-4 and inflammatory mediators in acetic-acid induced ulcerative colitis model. Biologia. 2021 doi: 10.1007/s11756-021-00725-w. [DOI] [Google Scholar]
- 30.Elhennawy M.G., Abdelaleem E.A., Zaki A.A., Mohamed W.R. Cinnamaldehyde and hesperetin attenuate TNBS-induced ulcerative colitis in rats through modulation of the JAk2/STAT3/SOCS3 pathway. J. Biochem. Mol. Toxicol. 2021:e22730. doi: 10.1002/jbt.22730. [DOI] [PubMed] [Google Scholar]
- 31.Jimenez M.J., Berrios R., Stelzhammer S., Bracarense A. Ingestion of organic acids and cinnamaldehyde improves tissue homeostasis of piglets exposed to enterotoxic Escherichia coli (ETEC) J. Anim. Sci. 2020;98 doi: 10.1093/jas/skaa012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Bosetti G.E., Griebler L., Aniecevski E., Facchi C.S., Baggio C., Rossatto G., Leite F., Valentini F.D.A., Santo A.D., Pagnussatt H., et al. Microencapsulated carvacrol and cinnamaldehyde replace growth-promoting antibiotics: Effect on performance and meat quality in broiler chickens. An. Acad. Bras. Cienc. 2020;92:e20200343. doi: 10.1590/0001-3765202020200343. [DOI] [PubMed] [Google Scholar]
- 33.Stumpff F. A look at the smelly side of physiology: Transport of short chain fatty acids. Pflugers. Arch. 2018;470:571–598. doi: 10.1007/s00424-017-2105-9. [DOI] [PubMed] [Google Scholar]
- 34.Bergman E.N. Energy contributions of volatile fatty acids from the gastrointestinal tract in various species. Physiol. Rev. 1990;70:567–590. doi: 10.1152/physrev.1990.70.2.567. [DOI] [PubMed] [Google Scholar]
- 35.Heo J.M., Opapeju F.O., Pluske J.R., Kim J.C., Hampson D.J., Nyachoti C.M. Gastrointestinal health and function in weaned pigs: A review of feeding strategies to control post-weaning diarrhoea without using in-feed antimicrobial compounds. J. Anim. Physiol. Anim. Nutr. (Berl.) 2013;97:207–237. doi: 10.1111/j.1439-0396.2012.01284.x. [DOI] [PubMed] [Google Scholar]
- 36.Gresse R., Chaucheyras-Durand F., Fleury M.A., Van de Wiele T., Forano E., Blanquet-Diot S. Gut Microbiota Dysbiosis in Postweaning Piglets: Understanding the Keys to Health. Trends Microbiol. 2017;25:851–873. doi: 10.1016/j.tim.2017.05.004. [DOI] [PubMed] [Google Scholar]
- 37.Macpherson L.J., Hwang S.W., Miyamoto T., Dubin A.E., Patapoutian A., Story G.M. More than cool: Promiscuous relationships of menthol and other sensory compounds. Mol. Cell Neurosci. 2006;32:335–343. doi: 10.1016/j.mcn.2006.05.005. [DOI] [PubMed] [Google Scholar]
- 38.Stange E.F., Schroeder B.O. Microbiota and mucosal defense in IBD: An update. Expert Rev. Gastroenterol. Hepatol. 2019;13:963–976. doi: 10.1080/17474124.2019.1671822. [DOI] [PubMed] [Google Scholar]
- 39.Kaji I., Yasuoka Y., Karaki S., Kuwahara A. Activation of TRPA1 by luminal stimuli induces EP4-mediated anion secretion in human and rat colon. Am. J. Physiol. Gastrointest. Liver Physiol. 2012;302:G690–G701. doi: 10.1152/ajpgi.00289.2011. [DOI] [PubMed] [Google Scholar]
- 40.Liebe F., Liebe H., Kaessmeyer S., Sponder G., Stumpff F. The TRPV3 channel of the bovine rumen: Localization and functional characterization of a protein relevant for ruminal ammonia transport. Pflugers Arch. 2020;472:693–710. doi: 10.1007/s00424-020-02393-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Schrapers K.T., Sponder G., Liebe F., Liebe H., Stumpff F. The bovine TRPV3 as a pathway for the uptake of Na+, Ca2+, and NH4+ PLoS ONE. 2018;13:e0193519. doi: 10.1371/journal.pone.0193519. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Peier A.M., Reeve A.J., Andersson D.A., Moqrich A., Earley T.J., Hergarden A.C., Story G.M., Colley S., Hogenesch J.B., McIntyre P., et al. A Heat—Sensitive TRP channel expressed in keratinocytes. Science. 2002;296:2046–2049. doi: 10.1126/science.1073140. [DOI] [PubMed] [Google Scholar]
- 43.Xu H., Ramsey I.S., Kotecha S.A., Moran M.M., Chong J.A., Lawson D., Ge P., Lilly J., Silos-Santiago I., Xie Y., et al. TRPV3 is a calcium-permeable temperature-sensitive cation channel. Nature. 2002;418:181–186. doi: 10.1038/nature00882. [DOI] [PubMed] [Google Scholar]
- 44.Smith G.D., Gunthorpe M.J., Kelsell R.E., Hayes P.D., Reilly P., Facer P., Wright J.E., Jerman J.C., Walhin J.P., Ooi L., et al. TRPV3 is a temperature-sensitive vanilloid receptor-like protein. Nature. 2002;418:186–190. doi: 10.1038/nature00894. [DOI] [PubMed] [Google Scholar]
- 45.Boudry G., Perrier C. Thyme and cinnamon extracts induce anion secretion in piglet small intestine via cholinergic pathways. J. Physiol. Pharmacol. 2008;59:543–552. [PubMed] [Google Scholar]
- 46.Van Liefferinge E., Van Noten N., Degroote J., Vrolix G., Van Poucke M., Peelman L., Van Ginneken C., Roura E., Michiels J. Expression of Transient Receptor Potential Ankyrin 1 and Transient Receptor Potential Vanilloid 1 in the Gut of the Peri-Weaning Pig Is Strongly Dependent on Age and Intestinal Site. Animals. 2020;10:2417. doi: 10.3390/ani10122417. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Gonzalez-Mariscal L., Contreras R.G., Bolivar J.J., Ponce A., Chavez De Ramirez B., Cereijido M. Role of calcium in tight junction formation between epithelial cells. Am. J. Physiol. 1990;259:C978–C986. doi: 10.1152/ajpcell.1990.259.6.C978. [DOI] [PubMed] [Google Scholar]
- 48.Meoli L., Gunzel D. Channel functions of claudins in the organization of biological systems. Biochim. Biophys. Acta Biomembr. 2020;1862:183344. doi: 10.1016/j.bbamem.2020.183344. [DOI] [PubMed] [Google Scholar]
- 49.Barrett K.E., Keely S.J. Chloride secretion by the intestinal epithelium: Molecular basis and regulatory aspects. Annu. Rev. Physiol. 2000;62:535–572. doi: 10.1146/annurev.physiol.62.1.535. [DOI] [PubMed] [Google Scholar]
- 50.Ueda T., Yamada T., Ugawa S., Ishida Y., Shimada S. TRPV3, A thermosensitive channel is expressed in mouse distal colon epithelium. Biochem. Biophys. Res. Commun. 2009;383:130–134. doi: 10.1016/j.bbrc.2009.03.143. [DOI] [PubMed] [Google Scholar]
- 51.Bischof M., Olthoff S., Glas C., Thorn-Seshold O., Schaefer M., Hill K. TRPV3 endogenously expressed in murine colonic epithelial cells is inhibited by the novel TRPV3 blocker 26E01. Cell Calcium. 2020;92:102310. doi: 10.1016/j.ceca.2020.102310. [DOI] [PubMed] [Google Scholar]
- 52.Barry P.H., Lynch J.W. Liquid junction potentials and small cell effects in patch-clamp analysis. J. Membr. Biol. 1991;121:101–117. doi: 10.1007/BF01870526. [DOI] [PubMed] [Google Scholar]
- 53.May O., Yu H., Riederer B., Manns M.P., Seidler U., Bachmann O. Short-term regulation of murine colonic NBCe1-B (electrogenic Na+/HCO3(-) cotransporter) membrane expression and activity by protein kinase C. PLoS ONE. 2014;9:e92275. doi: 10.1371/journal.pone.0092275. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Bachmann O., Juric M., Seidler U., Manns M.P., Yu H. Basolateral ion transporters involved in colonic epithelial electrolyte absorption, anion secretion and cellular homeostasis. Acta Physiol. 2011;201:33–46. doi: 10.1111/j.1748-1716.2010.02153.x. [DOI] [PubMed] [Google Scholar]
- 55.Ballout J., Diener M. The role of HCO3(-) in propionate-induced anion secretion across rat caecal epithelium. Pflugers Arch. 2021 doi: 10.1007/s00424-021-02565-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Tang L., Fatehi M., Linsdell P. Mechanism of direct bicarbonate transport by the CFTR anion channel. J. Cyst. Fibros. 2009;8:115–121. doi: 10.1016/j.jcf.2008.10.004. [DOI] [PubMed] [Google Scholar]
- 57.Seidler U., Blumenstein I., Kretz A., Viellard-Baron D., Rossmann H., Colledge W.H., Evans M., Ratcliff R., Gregor M. A functional CFTR protein is required for mouse intestinal cAMP-, cGMP- and Ca(2+)-dependent HCO3- secretion. Pt. 2J. Physiol. 1997;505:411–423. doi: 10.1111/j.1469-7793.1997.411bb.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Johnstone T.B., Agarwal S.R., Harvey R.D., Ostrom R.S. cAMP Signaling Compartmentation: Adenylyl Cyclases as Anchors of Dynamic Signaling Complexes. Mol. Pharmacol. 2018;93:270–276. doi: 10.1124/mol.117.110825. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59.Nakanishi T., Tamai I. Roles of Organic Anion Transporting Polypeptide 2A1 (OATP2A1/SLCO2A1) in Regulating the Pathophysiological Actions of Prostaglandins. AAPS J. 2017;20:13. doi: 10.1208/s12248-017-0163-8. [DOI] [PubMed] [Google Scholar]
- 60.Nakanishi T., Nakamura Y., Umeno J. Recent advances in studies of SLCO2A1 as a key regulator of the delivery of prostaglandins to their sites of action. Pharmacol. Ther. 2021;223:107803. doi: 10.1016/j.pharmthera.2021.107803. [DOI] [PubMed] [Google Scholar]
- 61.Chan B.S., Satriano J.A., Pucci M., Schuster V.L. Mechanism of prostaglandin E2 transport across the plasma membrane of HeLa cells and Xenopus oocytes expressing the prostaglandin transporter “PGT”. J. Biol. Chem. 1998;273:6689–6697. doi: 10.1074/jbc.273.12.6689. [DOI] [PubMed] [Google Scholar]
- 62.Konya V., Marsche G., Schuligoi R., Heinemann A. E-type prostanoid receptor 4 (EP4) in disease and therapy. Pharmacol. Ther. 2013;138:485–502. doi: 10.1016/j.pharmthera.2013.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Takafuji V., Cosme R., Lublin D., Lynch K., Roche J.K. Prostanoid receptors in intestinal epithelium: Selective expression, function, and change with inflammation. Prostaglandins Leukot. Essent. Fatty Acids. 2000;63:223–235. doi: 10.1054/plef.2000.0144. [DOI] [PubMed] [Google Scholar]
- 64.Lejeune M., Moreau F., Chadee K. Loss of EP2 receptor subtype in colonic cells compromise epithelial barrier integrity by altering claudin-4. PLoS ONE. 2014;9:e113270. doi: 10.1371/journal.pone.0113270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Matsumoto Y., Nakanishi Y., Yoshioka T., Yamaga Y., Masuda T., Fukunaga Y., Sono M., Yoshikawa T., Nagao M., Araki O., et al. Epithelial EP4 plays an essential role in maintaining homeostasis in colon. Sci. Rep. 2019;9:15244. doi: 10.1038/s41598-019-51639-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Blikslager A.T., Pell S.M., Young K.M. PGE2 triggers recovery of transmucosal resistance via EP receptor cross talk in porcine ischemia-injured ileum. Am. J. Physiol. Gastrointest. Liver Physiol. 2001;281:G375–G381. doi: 10.1152/ajpgi.2001.281.2.G375. [DOI] [PubMed] [Google Scholar]
- 67.Bjarnason I., Scarpignato C., Holmgren E., Olszewski M., Rainsford K.D., Lanas A. Mechanisms of Damage to the Gastrointestinal Tract from Nonsteroidal Anti-Inflammatory Drugs. Gastroenterology. 2018;154:500–514. doi: 10.1053/j.gastro.2017.10.049. [DOI] [PubMed] [Google Scholar]
- 68.Ilhan Z.E., Marcus A.K., Kang D.W., Rittmann B.E., Krajmalnik-Brown R. pH-Mediated Microbial and Metabolic Interactions in Fecal Enrichment Cultures. mSphere. 2017;2 doi: 10.1128/mSphere.00047-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Louis P., Scott K.P., Duncan S.H., Flint H.J. Understanding the effects of diet on bacterial metabolism in the large intestine. J. Appl. Microbiol. 2007;102:1197–1208. doi: 10.1111/j.1365-2672.2007.03322.x. [DOI] [PubMed] [Google Scholar]
- 70.Garcia M.A., Yang N., Quinton P.M. Normal mouse intestinal mucus release requires cystic fibrosis transmembrane regulator-dependent bicarbonate secretion. J. Clin. Investig. 2009;119:2613–2622. doi: 10.1172/JCI38662. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Nilius B., Appendino G. Tasty and healthy TR(i)Ps. The human quest for culinary pungency. EMBO Rep. 2011;12:1094–1101. doi: 10.1038/embor.2011.200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Braun H.-S., Sponder G., Pieper R., Aschenbach J.R., Deiner C. GABA selectively increases mucin-1 expression in isolated pig jejunum. Genes Nutr. 2015;10:47. doi: 10.1007/s12263-015-0497-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Rosendahl J., Braun H.S., Schrapers K.T., Martens H., Stumpff F. Evidence for the functional involvement of members of the TRP channel family in the uptake of Na(+) and NH4 (+) by the ruminal epithelium. Pflugers. Arch. 2016;468:1333–1352. doi: 10.1007/s00424-016-1835-4. [DOI] [PubMed] [Google Scholar]
- 74.Abdoun K., Stumpff F., Wolf K., Martens H. Modulation of electroneutral Na transport in sheep rumen epithelium by luminal ammonia. Am. J. Physiol. Gastrointest. Liver Physiol. 2005;289:G508–G520. doi: 10.1152/ajpgi.00436.2004. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Data available on request.







