Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Jul 1.
Published in final edited form as: Comp Biochem Physiol A Mol Integr Physiol. 2021 Apr 13;257:110959. doi: 10.1016/j.cbpa.2021.110959

Suppressed expression of oxidoreductin-like protein, Oxidor, increases follicle degeneration and decreases survival during the overwintering diapause of the mosquito Culex pipiens

Bryan King 1, Arinze Ikenga 1, Mazie Larsen 1, Cheolho Sim 1,*
PMCID: PMC8169630  NIHMSID: NIHMS1698638  PMID: 33862219

Abstract

Throughout diapause in mosquitoes, stress resistance and subsequent prolonged lifespan are a few important features of diapause that are crucial for overwintering success. In the mosquito Culex pipiens, we suggest that oxidoreductin-like protein is involved with these diapause characteristics for overwintering survival. Expression of oxidor was more than two-fold higher in early stage diapausing females compared to their non-diapausing counterparts. Suppression of the gene that encodes oxidoreductin-like protein by RNAi significantly increased the proportion of degenerating follicles in early-stage adult diapausing females. Inhibition of oxidor also significantly reduced the survivability of diapausing females which indicates that this protein plays a key role in protecting multiple tissues during early diapause.

Keywords: Culex pipiens, Cx. Pipiens, Mosquito, Diapause, RNAi, Dsi-RNA, Oxidoreductin-like protein, qRT-PCR, Oxidative stress

1. Introduction

Organismal lifespan is a complex process that relies on the combination of environmental and genetic factors. In the nematode Caenorhabditis elegans and the fly Drosophila melanogaster, genetic screens identified the insulin/forkhead transcription factor as a critical signaling pathway that regulates their lifespans. Interestingly, many of the genes found in the screening for extended lifespan are the same as those identified in studies of diapause (Yamamoto and Tatar, 2011; Lee et al., 2001). In several ways, diapause is a considerable extension of an organism’s lifespan (Sim and Denlinger, 2008). Studies throughout the years have well documented data on distinct adult diapause in Cx. pipiens (Mitchell, 1983; Mitchell and Briegel, 1989; Sanburg and Larsen, 1972; Sim et al., 2015; Kang et al., 2021). Diapause plays an important role in helping this mosquito survive the cold winter months. Other subspecies such as Culex p. quinquefaciatus do not have the characteristics of overwintering diapause, so Cx. p. quinquefaciatus cannot survive in areas with cold winters. In addition, only females can overwinter through diapause in the mosquito Culex. p. pipiens (hereafter Cx. pipiens). Therefore, the number of mosquitoes that transmit the diseases such as West Nile virus during the winter decreases most significantly during the year. Currently, genetic manipulation through the rapidly advanced CRISPR/Cas9 technology is actively being studied in this mosquito (Feng et al., 2021; Anderson et al., 2019). If we know which genes play an important role in the winter survival of the mosquito Cx. pipiens, it is expected that this method can be applied to population control that inhibit the overwintering diapause mechanism.

Recent studies on the molecular regulation of diapause in Cx. pipiens show the importance of insulin and forkhead transcription factor (FOXO) as crucial elements in the signaling pathway that leads to the diapause phenotype. In short, the insulin signaling pathway is not activated in diapausing adult females, therefore lifting the suppression of FOXO. Upon this expression of FOXO, the induction of target genes associated with diapause, including enhanced stress tolerance, extended lifespan, and accumulation of fat reserves are then observed (Sim and Denlinger, 2009, 2011; Sim et al., 2015). This mechanism of diapause is conserved in some species, as shown from results with the nematode C. elegans and the fly D. melanogaster (Giannakou and Partridge, 2007; Lee et al., 2001). Enhanced stress tolerance is one of the hallmarks of diapause (Denlinger, 2002), and several genes encoding stress-related proteins were revealed in the ChIP-seq analysis as being under the control of FOXO. One is an oxidor, the gene encoding oxidoreductin-like protein, a protein likely involved in reducing oxidative stress during mosquito diapause. Catalase and superoxide dismutase, enzymes involved in the detoxification of reactive oxygen species (ROS), are also activated in early diapause (Sim and Denlinger, 2011), which further underscore the importance of the stress response during diapause and suggest that diapausing mosquitoes effectively avoid oxidative damage that can accumulate over winter. Thus, oxidor is possibly link to the increased lifespan of diapausing mosquitoes.

Oxidor is homologous to the ERO1 protein in other model organisms, and in previous studies, oxidoreductin-like protein shows enzyme activity that catalyzes the transfer of electrons from one molecule to another by catalysis of an oxidation-reduction reaction where a sulfur-containing group acts as a hydrogen or electron donor and reduces disulfide (Seo et al., 2015; Kim et al., 2012). This suggests that oxidoreductin-like protein metabolizes reactive oxygen species and induces proper protein folding, and if suppressed, inhibition of this stress response occurs. In this study, we propose that this antioxidant enzyme contributes considerably to the extended lifespan and increased stress tolerance of the diapausing mosquito, Cx. pipiens. This gene was cloned from Cx. pipiens and RNA interference was used to evaluate the function compared between diapausing females and their non-diapausing counterparts.

2. Materials and methods

2.1. Mosquito rearing

The Culex pipiens pipiens colony was established in September 2000 from larvae collected in Columbus, OH, and additional field-collected mosquitoes were added to the laboratory colony in 2009. The colony was reared at 25°C and 75% relative humidity (RH) under a 12:12 Light-Dark (LD) photoperiod, as previously described (Robich and Denlinger, 2005). When larvae reach their first or second instar stage, rearing containers were placed under one of two environmental conditions: nondiapausing adults were reared at 18 °C, 75% RH, and 15 L:9D h (ND), and to induce diapause, mosquitoes were reared at 18°C, 75% RH, and 9 L:15D h(D). To confirm diapause status, primary follicle and germarium lengths were measured, and the stage of ovarian development was determined according to methods previously described (Christophers, 1911). Larvae were reared in dechlorinated tap water and fed Tetramin fish food (Tetra Holding Inc., Blacksburg, VA). Adults were maintained on honey-filled vials with soaked wicks and kept in 33.5 cm × 30 cm × 30 cm screened cages.

2.2. Indentification and bioinformatics anaylsis of mosquito oxidoreductin-like protein

Cx. pipiens gene encoding oxidoreductin-like protein (oxidor) was utilized in discontinuous MEGA–BLAST searches on trace archives of genome data from the NCBI database (http://www.ncbi.nlm.nih.gov/blast/tracemb.shtml), and identification of the retrieved other mosquito oxidoreductin-like proteins were confirmed by blasting against the VectorBase (http://cpipiens.vectorbase.org/Tools/BLAST/). The evolutionary history was inferred using the maximum likelihood (ML) method (Guindon and Olivier Gascuel, 2003; Guindon et al., 2005). The bootstrap consensus tree inferred from 500 replicates was taken to represent the evolutionary history of the mosquito oxidoreductin-like proteins analyzed (Fig. 1). The percentage of replicate trees in which the associated oxidoreductin-like proteins clustered together in the bootstrap test (500 replicates) is shown next to the branches. The tree was drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree.

Fig. 1.

Fig. 1.

Open in a new tab

(A) Phylogenetic tree of mosquito oxidoreductase-like-protein (Oxidor) generated with the maximum likelihood method and bootstrap analysis. Bootstrap values are shown at the base of the branches and represent the percentage of times that grouping was supported. Cx-Oxidor, Culex pipiens, CPIJ004301. Ae-Oxidor, Aedes aegypti, AAEL002102. Ada-Oxidor, Anopheles darlingi, ADAC006477. Aab-Oxidor, Anopheles albimanus, AALB008901. Aep-Oxidor, Anopheles epiroticus, AEPI001005. Amel-Oxidor, Anopheles melas, AMEC006245. Ach-Oxidor, Anopheles christyi, ACHR008565. Aar-Oxidor, Anopheles arabiensis, AARA004638. Aco-Oxidor, Anopheles coluzzii, ACOM037629. Ag-Oxidor, Anopheles gambiae, AGAP002816. Amer-Oxidor, Anopheles merus, AMEM002911. Aqu-Oxidor, Anopheles quadriannulatus, AQUA009382. Acu-Oxidor, Anopheles culicifacies, ACUA005265. Afu-Oxidor, Anopheles funestus, AFUN007955. Ast-Oxidor, Anopheles stephensi, ASTE002083. Ama-Oxidor, Anopheles maculatus, AMAM018691. Ami-Oxidor, Anopheles minimus, AMIN003658. Afa-Oxidor, Anopheles farauti, AFAF012442. Atr-Oxidor, Anopheles atroparvus, AATE006712. Adi-Oxidor, Anopheles dirus, ADIR003499. Asi-Oxidor, Anopheles sinensis, ASIS004002. (B) Alignment of the oxidoreductase-like proteins from Culex pipiens (Cx-Oxidor), An. gambiae (Aga-Oxidor), Ae. aegypti (Ae-Oxidor) and An. funestus (Afu-Oxidor). A potential oxidoreductase domain is located alignment region 79–480 a.a.. The black and gray shades indicate similar amino acids, respectively.

The deduced amino acid sequence of Culex oxidor gene was assembled, analyzed, and aligned with a.a sequences of oxidor homologues of the mosquitoes Anopheles gambiae, Anopheles funestus and Aedes aegypti and (accession numbers AGAP002816 for oxidor of An. gambiae, AFUN007955 for An. funestus, AAEL012847 for Ae. aegypti). Multiple sequence alignment of the four a.a sequences was performed using the CLUSTALW2 program (https://www.ebi.ac.uk/Tools/msa/muscle/). Protein domains were identified by searching the pfam database (http://pfam.xfam.org).

2.3. Synthetic dicer-substrate siRNA injection into adult female mosquitos

Targeting genes that encoding oxidoreductin-like protein (oxidor, CPIJ004301) was performed as previously described (Sim and Denlinger, 2008). Dsi-oxidor corresponds to target sequences on exon 1. The sequences of chosen siRNA duplexes are confirmed through BLAST searches and have no significant homology to Cx. pipiens genes other than for oxidor, which are as follows: dsi-oxidor: 5′-rCrArUrGrArArUrArCrUrUrGrUrUrGrArUrArGrUrCrCrUrUrCrCrA-3′/5′-rGrGrArArGrArCrUrArUrCrArArCr ArArGrUrArUrUrCrATG-3′. A scrambled negative control dsiRNA, an dsi-control duplexes lacking significant sequence homology to any genes in the Cx. pipiens genome, is used for control experiments, dsi-control: 5′rGrArArGrArGrCrArCr UrGrArUrArGrArUrGrUrUrArGrCGT-3′/5′rArCrGrCrUrArArCrArUrCrUrArUrCrArGr UrGrCrUrCrUrUrCrCrG-3′. None of the phenotypes reported are observed in control-injected females, which are not significantly different than wild type females for any of the phenotypes assessed.

2.4. RNAi efficiency evaluation using qRT-PCR

We carried out qRT-PCR of the dsi-RNA-injected mosquitoes as previously described (King et al., 2019). Briefly, total RNA samples were extracted with TRIzol (Invitrogen) from three batches of 15 adult female mosquitoes on various days after dsi-RNA injection. To remove genomic DNA contamination, RNA samples were treated with DNase I following the manufacturer’s instructions (50–375 units/μl; Invitrogen). For reverse transcription, 5 μg of total RNA was reverse-transcribed with SuperScript III RNase H-reverse transcriptase (Invitrogen). All reactions were performed in triplicate in a total volume of 20 μl containing 10 μl SYBR Green PCR Master Mix (Bio-Rad, Hercules, CA) and 300 nmol of each primer at the following conditions: 95 °C for 10 min followed by 45 cycles of denaturation at 95 °C for 15 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s. The following qRT-PCR primers were used: q-oxidor, CATTCGCAGCTGAACTACAA and TGGCTACGTGCCAAAATAGA; q-rpl19, CGCTTTGTTTGATCGTGTGT and CCAATCCAGGAGTGCTTTTG. The ribosomal protein large subunit 19 gene (rpl19) was used as a loading control. Expression data were normalized to the geometric mean of housekeeping gene rpl19 to control the variability in expression levels and were analyzed using the 2−ΔΔCT method (Livak and Schmittgen, 2001). Then, the statistical significance of differences in transcript levels were determined using a Student’s t-test between the relative transcript values of dsi-oxidor injected vs. control samples (dsicontrol injected), using three biologically independent replicates for each gene. A P-value less than 0.05 was considered as a significant transcript-level change.

2.5. Follicle degeneration following Dsi-oxidor injection

Within a day after eclosion, diapause-destined females were injected in the thorax with dsi-oxidor or dsi-control. Each treated cohort was kept in a 24 cm × 24 cm × 24 cm cage. A week later, ovaries were dissected in mosquito saline and dipped in Acridine Orange (Cayman Chemical Company, Ann Arbor, MI; 50 μmol/ml in mosquito saline) and Neutral Red (Sigma N2880–25G) at pH 6 for 1 min to assist visualization of the follicles, and they are then immediately examined using fluorescent filters. The number of follicles per female containing condensed nuclei was recorded, and if more than 5 follicles per female exhibit condensed nuclei as shown by staining with Acridine Orange, the female is considered to be in the process of follicle degeneration as described previously (Sim and Denlinger, 2011).

2.6. Survival analysis

To evaluate the knockdown effect of oxidor on the survival rate, a total of 135 mosquitoes per cohort were intrathoracically injected with ~0.5 μl of dsi-oxidor or dsi-control. Mosquitoes were held at 18 °C, 75% relative humidity, and 9:15 L:D cycle, with access to sugar, and survival is assessed every five days. Survival curves were fitted and analyzed using Cox proportional hazards model (R version 4.0.4, “survival”, “survminer” packages) (R Core Team, 2014). Univariate Cox regression and Wald test were used for testing the statistical significance of the differences between the dsi-oxidor and dsi-control injected mosquitoes (Cox, 1972). Individuals who did not die by 35 d after dsi-control injections were censored (0 = death event did not occur; 1 = death event occurred). The individual females with dsi-oxidor injections were not censored, because the experiment finished with the death of all dsi-oxidor injected females.

3. Results

3.1. Phylogenetic analysis of Culex pipiens oxidor

We identified other mosquito oxidors from Cx. pipiens by performing BLAST searches on the non-redundant genomic database using sequences of Cx. pipiens oxidoreductin-like genes. The sequences of Cx. pipiens oxidor shared the highest identities, 85% with oxidor from a closely related mosquito, Aedes albopictus. The 1470-bp mRNA fragment of Cx. pipiens oxidor shared 84% identity with oxidor from Aedes aegypti and 82% identity to oxidor sequences from Anopheles gambiae. The deduced amino acid sequences oxidor, based on a pfam search, belong to an oxidoreductin-1 family (Ero1) which is an essential oxidoreductase that oxidizes proteins in the endoplasmic reticulum to produce disulfide bonds (Frand et al., 2000). The activity of Ero1 is regulated by Pdi1, which is a protein disulfide isomerase. This regulation of Ero1 through reduction and oxidation of regulatory bonds within Ero1 is essential for maintaining the proper balance in the ER (Kim et al., 2012; Baker et al., 2008). A phylogenetic analysis of known mosquito oxidors was performed to infer relationships of the Culex oxidor with those identified in Ae. aegypti and An. gambiae mosquitoes (Fig. 1). Oxidor is fairly conserved between Cx. pipiens and Ae. aegypti, but based on phylogenetic analysis, Anopheles mosquitoes are evolutionarily more distant, a result which is consistent with reported speciation patterns within the family Culicidae (Krzywinski et al., 2006).

3.2. Transcript levels of oxidor from diapausing and nondiapausing females of Cx. pipiens and RNAi efficiency evaluation using qRT-PCR

The transcript levels of the oxidor gene in nondiapausing and diapausing Cx. pipiens were obtained using qRT-PCR. The expression patterns of oxidor showed that it was up-regulated in diapausing mosquitoes one week after eclosion but were down-regulated in nondiapausing mosquitoes reared at long-day (LD) conditions (Fig. 2A). In non-diapausing females, oxidor levels are relatively low in comparison to diapausing females. Increased expression of the oxidor gene in mosquitoes in response to short daylength (destined to diapause) suggested the possibility that this gene may be involved in regulating oxidative stress during early diapause period.

Fig. 2.

Fig. 2.

Open in a new tab

(A) Quantitative Real-Time PCR showing expression of the gene encoding oxidoreductase-like protein (oxidor) in diapausing (D) and nondiapausing (ND) Cx. pipiens females 7–10 d post eclosion (dpe). ND (gray bar) = programmed by long daylength for nondiapause, D (black bar) = programmed by short daylength for diapause. Both groups were maintained at 18 °C. (B) RNA interference efficiency targeting oxidoreductin-like protein (dsi-Oxidor) in Cx. pipiens. Transcript levels of the gene encoding oxidoreductin-like protein in females injected with dsi-oxidor (white bar) were compared with the dsi-control (black bars). Expression levels were measured by qRT-PCR at 7 days after dsi-RNA injection. qRT-PCR data were normalized using a ribosomal protein large subunit 19 (rpl19) as a loading control. Bars (mean ± s.e., n = 3 groups of 10 individuals each) with asterisks (*) indicate significant differences at P < 0.05, t-test.

In addition, RNAi efficiency was assessed by qRT-PCR. In contrast to the relatively high induction of oxidor in dsi-control injected mosquitoes, more than 50% reduction of oxidor transcript was observed in dsi-oxidor injected, diapausing mosquitoes, using qRT PCR and primers corresponding to the oxidor gene (Fig. 2B). This result shows that the injection of dsi-oxidor successfully inhibited the activity of the oxidor gene in diapausing females. It was also shown that the level of suppressed expression of this gene was similar to that of the non-diapausing counterparts. Ribosomal protein L19 (RpL19), the loading control used to normalize transcript levels, showed no difference in expression 7 days post-injection (Fig. 2B), thus indicating that the low expression levels observed for the oxidor gene were related to the knockdown effect of dsi-oxidor injections rather than variation in sample loading.

3.3. Dicer-substrate RNAi-oxidor (dsi-oxidor) increases degeneration of follicles in diapausing females

Three days after injection of dsi-oxidor or dsi-control, no significant differences were observed in the ovarian follicle degeneration in both treatments. However, after 7 days post dsi-RNAs injection, ovaries were examined again, and degeneration rate of the follicles was signifcantly higher in dsi-oxidor treated females compared to those of control cohorts. Degenerating follicles, which were detected by staining with Neutral Red, were observed in dsi-oxidor injected mosquitoes, and Acridine Orange staining of the same ovaries revealed condensed nuclear chromatin (Fig. 3 and Table 1). One of the important characteristics of mosquito wintering diapause is a mechanism that effectively suppresses the damage caused by reactive oxygen species in follicle cells where the normal development process is halted. The experimental results that inhibit the function of the oxidor gene suggest that this gene product effectively protects against follicle cell damage caused by a reactive oxygen species. (See Fig. 4.)

Fig. 3.

Fig. 3.

Open in a new tab

Primary follicles from ND and D females, prepared with neutral red and acridine orange post adult eclosion under white light (top) and GFP filter (bottom). (A, B) Primary follicles of ND females 7–10 dpe and with dsi-control injection. (C, D) Primary follicles of D females 7–10 dpe and with dsi-control injection. (E, F) Primary follicles of D females 7–10 dpe and with dsi-oxidor injection. The triangles indicate the condensed nuclei which are in the process of apoptosis. Scale bar = 50 μm.

Table 1.

Proportion of diapausing Cx. pipiens with ovarian follicles in a state of degeneration following an injection of dsi-Oxidor.

Programmed for diapause N Females with degenerating follicles (%)
Dsi-control day 3 36 13.29
Dsi-oxidor day 3 36 19.17
Dsi-control day 7 36 15.62
Dsi-oxidor day 7 36 62.38*
Open in a new tab
*

Indicates significant differences from untreated controls (X2- goodness of fit test at P < 0.05 and d.f. = 1).

Fig. 4.

Fig. 4.

Open in a new tab

The survival probability of female mosquitoes after injection of dsi-RNAs targeting against the gene encoding oxidoreductin-like protein (dsi-oxidor) and control (dsi-control). Survival curves were fitted and analyzed using Cox proportional hazards model. N = 135 individuals per each group.

3.4. Reduced survival of diapausing Cx. pipiens in response to dsi-oxidor injection

Survival analysis using the Cox’s Proportional Hazards model showed a higher death risk (hazard ratio; HR) for dsi-oxidor injected females. Hazard ratio estimate of exp.(coef) = 19.71 with 95% CI (11.98, 32.44). This result suggests that, at least with early diapause, the reduction of expression of oxidor significantly decreases mortality of diapausing Cx. pipiens, due to possible consequences of reduced antioxidant activity.

4. Discussion

In Cx. pipiens, oxidor (oxidoreductin-like protein) is homologous to oxidoreductin-like protein ERO1 in other organisms. Oxidoreductin-like proteins are found in the endoplasmic reticulum and interact with protein disulfide isomerases (PDI) for protein folding. Oxidoreductin-like proteins reoxidize and in turn reactivate PDI for new rounds of oxidative protein folding (Zito, 2015). ERO1 activate this process by transferring electrons from molecular oxygen with the use of ERO1’s cofactor FAD1, and in turn creates H2O2 (Tu and Weissman, 2002). In yeast, ERO1-1 mutants have been shown to be non-viable when grown in non-permissive temperatures, and slower growth rates at permissive temperatures compared to wild type yeasts (Araki and Nagata, 2011; Frand and Kaiser, 1998). In the presence of DTT to stimulate reducing effects in the cell, ERO1 knockouts are completely unviable (Pollard et al., 1998), and another study shows that double mutants ERO1 and FAD1 have completely unviable cell cultures as well (Tu and Weissman, 2002). Oxidative stress responses such as catalase, detoxify H2O2 into H2O and O2 (Sim and Denlinger, 2011), and with the formation of O2, gets recycled to be used by ERO1 for protein folding. In Bombyx mori, expression of bEro1 mRNA was markedly increased during endoplasmic reticulum (ER) stress by H2O2, Monecin, dithiothreitol and tunicamycin (Seo et al., 2015), which coincides with increases in oxidative stress. In Saccharomyces cerevisiae, disulfide bonds are formed by thiol-disulfide transfer mechanisms with the oxidized Pdi1p (Kim et al., 2012). ERO1 is important for protein folding so signaling pathways to occur, and if protein folding does not occur, mutations and eventual cell death can occur from an extended unfolded protein response (Haynes et al., 2004).

In dauer stage Caenorhabditis elegans, notch receptor LIN-12 co-operates with the insulin signaling pathway to signal recovery from dauer stage, and if LIN-12 is compromised, dauer stage C. elegans are unable to recover out of this phenotype (Ouellet et al., 2008). In Drosophila, Notch protein is important for cell signaling, which is folded in the ER by ERO1, and if folding does not occur, defects in lateral inhibition and inductive signaling occur (Tien et al., 2008). Notch is also important for many signaling pathways including tissue organization and chromatin organization, and defects can occur if Notch is not folded properly to carry out cellular communication (Bray, 2016). In Aedes mosquitoes, when AaNotch is knocked down with RNAi, fertility and fecundity are drastically decreased, and egg vitality is decreased drastically as well.

In diapausing insects, the ability to efficiently remove oxidative stress for overwintering survival is crucial (Zhao and Shi, 2010). During our investigation, the oxidoreductin-like protein, oxidor, was shown to be upregulated one week after eclosion of adult diapausing females compared to non-diapausing counterparts. When oxidor was knocked down in diapausing females, mortalitiy increased significantly, which was observed when the genes encoding FOXO, Catalase, Superoxide dismutase-2 and Glycogen synthase (Sim and Denlinger, 2008, 2011; King et al., 2019) were knocked down. These results thus point that the oxidoreductin-like protein is related to these genes in respect to detoxify reactive oxygen species in diapausing female mosquitoes at least in early-phase of overwintering diapause.

Oxidor is an antioxidant-related gene that was previously identified during ChIP-seq analysis as a potential for reducing oxidative stress during mosquito diapause (Sim et al., 2015). This gene was shown to be highly upregulated in diapausing female mosquitoes one week after adult eclosion in comparison to control populations. When oxidor was suppressed using dsi-RNAs, the proportion of degenerating follicles increased substantially in diapausing females compared to nondiapausing counterparts. Follicles from diapausing females that had oxidor suppressed using dsi-RNAs, an increase in condensed chromatin was observed after staining with Acridine orange, which is a key characteristic of cellular apoptosis. In addition, the survival of diapausing females drastically decreased at 7–10 days after the injection of dsi-RNAs targeting the oxidor gene, and continued a downward trend of survival while diapausing mosquitoes that were injected with the control dsi-RNAs showed no significant decrease in survivability even after 30 d after the injections. This result is similar organismal response when the activity of the FOXO gene was suppressed (Sim and Denlinger, 2008). It may support the fact that oxidor is one of the downstream genes under the control of FOXO transcriptional factor, which is activated at the onset of diapause program in the mosquito Cx. pipiens.

It has been shown in previous research that the insulin/FOXO pathway is a key molecular switch for initiating and maintaining overwintering diapause in the mosquito Cx. pipiens (Sim and Denlinger, 2008), and ChIP-seq analysis using FOXO antibody found the potential target genes involved in this diapause program. Among them, several genes are linked to overwintering stress tolerance for reducing oxidative stress based on the gene ontology analysis (Sim et al., 2015; Sim and Denlinger, 2011). The insulin/FOXO signaling pathway is also highly conserved in other model organisms such as the fruit fly D. melanogaster and the nematode, C. elegans, and similar phenotypes were elucidated including oxidative stress tolerance in these organisms. For example, fly FOXO activation increases stress tolerance through SODs (Honda and Honda, 1999; Mattila et al., 2009), and when dFOXO is knocked down, sensitivity to oxidative stress increases in the fly D. melanogaster (Jünger et al., 2003).

In conclusion, we have demonstrated that the gene encoding an oxidoreductin-like protein offers a role in protecting diapausing mosquitoes and also plays a key role in protecting diapausing ovaries from potential oxidative damage. However, additional research is needed on how this gene plays a role in oxidation-related processes other than diapause, as well as in other forms of diapause in different insects.

Acknowledgements

This work was supported in part by the National Institutes of Health under grant number R15AI139861 and by the National Science Foundation under grant number IOS-1944214.

Abbreviations:

Oxidor

oxidoreductin-like protein

dsi-oxidor

dicer-substrate RNAi of Cx. pipiens oxidoreductin-like protein

dsi-control

dicer-substrate RNAi of control gene

qRT-PCR

quantitative real-time PCR

RNAi

RNA interference

ND

non-diapause

D

diapause

Footnotes

Data deposition

The sequences reported in this paper have been deposited in the Genbank database (accession no. Culex pipiens oxidor, KP057868 ).

Declaration of Competing Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Anderson ME, Mavica J, Shackleford L, Flis I, Fochler S, Basu S, et al. , 2019. CRISPR/Cas9 gene editing in the West Nile Virus vector, Culex quinquefasciatus Say. PLoS One 14 (11), e0224857. 10.1371/journal.pone.0224857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Araki K, Nagata K, 2011. Functional in vitro analysis of the ERO1 protein and protein-disulfide isomerase pathway. J. Biol. Chem 286, 32705–32712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Baker KM, Chakravarthi S, Langton KP, Sheppard AM, Lu H, Bulleid NJ, 2008. Low reduction potential of Ero1α regulatory disulphides ensures tight control of substrate oxidation. EMBO J. 27, 2988–2997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bray SJ, 2016. Notch signalling in context. Nat. Rev. Mol. Cell Biol 17, 722–735. [DOI] [PubMed] [Google Scholar]
  5. Christophers S, 1911. The development of the egg follicle in Anophelines. Paludism 1, 73–88. [Google Scholar]
  6. Cox DR, 1972. Regression models and life tables. J. R. Stat. Soc. B 34, 187–220. [Google Scholar]
  7. Denlinger DL, 2002. Regulation of diapause. Annu. Rev. Entomol 47, 93–122. [DOI] [PubMed] [Google Scholar]
  8. Feng X, Amo V, Mameli E, Lee M, Biship A, Perrimon N, Gantz V, 2021. Optimized CRISPR tools and site-directed transgenesis in Culex quinquefasciatus mosquitoes for gene drive development. bioRxiv 10.1101/2021.02.10.430702,02.10.430702. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Frand AR, Kaiser CA, 1998. The ERO1 gene of yeast is required for oxidation of protein dithiols in the endoplasmic reticulum. Mol. Cell 1, 161–170. [DOI] [PubMed] [Google Scholar]
  10. Frand AR, Cuozzo JW, Kaiser CA, 2000. Pathways for protein disulphide bond formation. Trends Cell Biol. 10 (5), 203–210 (ISSN 0962–8924). [DOI] [PubMed] [Google Scholar]
  11. Giannakou ME, Partridge L, 2007. Role of insulin-like signalling in Drosophila lifespan. Trends Biochem. Sci 32, 180–188. [DOI] [PubMed] [Google Scholar]
  12. Guindon S, Olivier Gascuel O, 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol 52 (5), 696–704. [DOI] [PubMed] [Google Scholar]
  13. Guindon S, Lethiec F, Duroux P, Gascuel O, 2005. PHYML Online—a web server for fast maximum likelihood-based phylogenetic inference. Nucleic Acids Res. 33, W557–W559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Haynes CM, Titus EA, Cooper AA, 2004. Degradation of misfolded proteins prevents ER-derived oxidative stress and cell death. Mol Cell 15, 767–776. [DOI] [PubMed] [Google Scholar]
  15. Honda Y, Honda S, 1999. The daf-2 Gene Network for Longevity Regulates Oxidative Stress Resistance and Mn-superoxide Dismutase Gene Expression in Caenorhabditis elegans. [PubMed]
  16. Jünger MA, Rintelen F, Stocker H, Wasserman JD, Végh M, Radimerski T, Greenberg ME, Hafen E, 2003. The Drosophila Forkhead transcription factor FOXO mediates the reduction in cell number associated with reduced insulin signaling. J. Biol 2, 20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kang D, Kim S, Cotton M, Sim C, 2021. Transcript assembly and quantification by RNA-Seq reveals significant differences in gene expression and genetic variants in mosquitoes of the Culex pipiens complex. J. Med. Entomol 58, 139–145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kim S, Sideris DP, Sevier CS, Kaiser CA, 2012. Balanced Ero1 activation and inactivation establishes ER redox homeostasis. J. Cell Biol 196, 713–725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. King B, Li S, Liu C, Kim SJ, Sim C, 2019. Suppression of glycogen synthase expression reduces glycogen and lipid storage during mosquito overwintering diapause. J. Insect Physiol 120, 103971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Krzywinski J, Grushko OG, Besansky NJ, 2006. Analysis of the complete mitochondrial DNA from Anopheles funestus: an improved dipteran mitochondrial genome annotation and a temporal dimension of mosquito evolution. Mol. Phylogenet. Evol 39, 417–423. [DOI] [PubMed] [Google Scholar]
  21. Lee RYN, Hench J, Ruvkun G, 2001. Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the DAF-2 insulin-like signaling pathway. Curr. Biol 11, 1950–1957. [DOI] [PubMed] [Google Scholar]
  22. Livak KJ, Schmittgen TD, 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. [DOI] [PubMed] [Google Scholar]
  23. Mattila J, Bremer A, Ahonen L, Kostiainen R, Puig O, 2009. Drosophila FOXO regulates organism size and stress resistance through an adenylate cyclase. Mol. Cell. Biol 29, 5357–5365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Mitchell CJ, 1983. Differentiation of host-seeking behavior from blood-feeding behavior in overwintering Culex pipiens (Diptera: Culicidae) and observations on gonotrophic dissociation. J. Med. Entomol 20, 157–163. [DOI] [PubMed] [Google Scholar]
  25. Mitchell CJ, Briegel H, 1989. Fate of the blood meal in force-fed, diapausing Culex pipiens (Diptera: Culicidae). J. Med. Entomol 26, 332341. [DOI] [PubMed] [Google Scholar]
  26. Ouellet J, Li S, Roy R, 2008. Notch signalling is required for both dauer maintenance and recovery in C. elegans. Development 135, 2583–2592. [DOI] [PubMed] [Google Scholar]
  27. Pollard MG, Travers KJ, Weissman JS, 1998. Ero1p: a novel and ubiquitous protein with an essential role in oxidative protein folding in the endoplasmic reticulum. Mol. Cell 1, 171–182. [DOI] [PubMed] [Google Scholar]
  28. R Core Team, 2014. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria. http://www.R-project.org/. [Google Scholar]
  29. Robich RM, Denlinger DL, 2005. Diapause in the mosquito Culex pipiens evokes a metabolic switch from blood feeding to sugar gluttony. Proc Natl Acad Sci U S A 102, 15912–15917. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Sanburg LL, Larsen JR, 1972. Effect of photoperiod and temperature on ovarian development in Culex pipiens pipiens. J. Insect Physiol 19, 1173–1190. [DOI] [PubMed] [Google Scholar]
  31. Seo M, Ryou H-J, Yun E-Y, Goo T-W, 2015. Molecular characterization of endoplasmic reticulum Oxidoreductin 1 from Bombyx mori. Int. J. Mol. Sci 16, 26520–26529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sim C, Denlinger DL, 2008. Insulin signaling and FOXO regulate the overwintering diapause of the mosquito Culex pipiens. Proc. Natl. Acad. Sci 105, 6777–6781. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Sim C, Denlinger DL, 2009. A shut-down in expression of an insulin-like peptide, ILP-1, halts ovarian maturation during the overwintering diapause of the mosquito Culex pipiens. Insect Mol. Biol 18, 325–332. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Sim C, Denlinger DL, 2011. Catalase and superoxide dismutase-2 enhance survival and protect ovaries during overwintering diapause in the mosquito Culex pipiens. J. Insect Physiol 57, 628–634. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Sim C, Kang DS, Kim S, Bai X, Denlinger DL, 2015. Identification of FOXO targets that generate diverse features of the diapause phenotype in the mosquito Culex pipiens. Proc. Natl. Acad. Sci 112, 3811–3816. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Tien A-C, Rajan A, Schulze KL, Ryoo HD, Acar M, Steller H, Bellen HJ, 2008. Ero1L, a thiol oxidase, is required for Notch signaling through cysteine bridge formation of the Lin12-Notch repeats in Drosophila melanogaster. J. Cell Biol 182, 1113–1125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Tu BP, Weissman JS, 2002. The FAD- and O2-dependent reaction cycle of Ero1-mediated oxidative protein folding in the endoplasmic reticulum. Mol. Cell 10, 983–994. [DOI] [PubMed] [Google Scholar]
  38. Yamamoto R, Tatar M, 2011. Insulin receptor substrate Chico acts with the transcription factor FOXO to extend Drosophila lifespan. Aging Cell 10, 729–732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zhao LC, Shi LG, 2010. Metabolism of hydrogen peroxide between diapause and nondiapause eggs of the silkworm, Bombyx Mori during chilling at 5 °C. Arch. Insect Biochem 74, 127–134. [DOI] [PubMed] [Google Scholar]
  40. Zito E, 2015. ERO1: a protein disulfide oxidase and H2O2 producer. Free Rad. Bio. Med 83, 299–304. [DOI] [PubMed] [Google Scholar]

RESOURCES