Abstract
Atopic dermatitis (AD) is one of the most common skin diseases of dogs. Defects in the skin barrier and overproduction of inflammatory cytokines may be the pathogenesis of canine AD. Therefore, the present study was aimed to quantify the gene expression of certain skin barrier proteins and inflammatory cytokines in dogs with AD. Eleven dogs with AD and three healthy dogs were included in the present study. The skin barrier proteins, namely Filaggrin (FLG) and Involucrin (IVL), gene expression was quantified by Real-time PCR in the lesional skin tissues of the atopic dogs and normal skin of the healthy dogs. In addition to the skin proteins, the gene expressions of the interleukin (IL)-13, IL-31, and tumour necrosis factor (TNF)-α were also quantified in the peripheral blood mononuclear cells (PBMCs) of these dogs. Compared to the healthy dogs, significantly higher (P ≤ 0.01) FLG gene expression and significantly (P ≤ 0.05) lower expression of the IVL gene were quantified in the skin of atopic dogs. Further, the dogs with AD revealed significantly higher expression of TNF-α (P ≤ 0.01), IL-31 (P ≤ 0.05), and IL-13 (P ≤ 0.05) as compared to the healthy dogs. The findings of our present study evidently suggest significantly increased and decreased expressions of FLG and IVL genes, respectively, which may be responsible for disruption of the skin barrier in dogs with AD. While, the over-expressions of TNF-α, IL-31, and IL-13 genes might be attributed to the clinical pathology and manifestations of AD in dogs. However, further studies are warranted to substantiate our hypothesis about pathogenesis and clinical manifestation of AD in dogs by including a large number of animals.
Subject terms: Immunology, Molecular medicine, Pathogenesis
Introduction
Atopic dermatitis (AD) is a common chronic inflammatory skin disease of dogs which shares 3 to 58 per cent of canine skin diseases presented to veterinarians1. A combination of genetic, environmental and immunological factors seems to be responsible for AD and influence its pathogenesis and outcome. The epidermal structural, functional and compositional changes of dogs may predispose to the development of AD by enhancing percutaneous absorption and antigen presentation to the immune system2,3. The enhanced penetration of the environmental allergens owing to defective skin barrier is attributed to activation of the pro-inflammatory cytokines in dogs with AD4–6. The cornified envelop (CE) proteins such as Filaggrin (FLG) and Involucrin (IVL) in the stratum corneum play crucial role in the permeability barrier of the skin. Keratinocytes proliferation and differentiation results in synthesis of several CE proteins including FLG, loricrin, IVL, and S100 in the granular layer7,8. In the final epidermal differentiation, CE proteins help to form the outermost cornified layer of the epidermis and hydration of the skin. Filaggrin has been shown to be a key player in the pathogenesis of AD in human patients and dogs9,10. The epidermal barrier proteins expression, FLG and IVL, in dogs has been investigated by some researchers, however, their precise role in the development of canine atopic dermatitis is yet not well elucidated2,11,12.
Apart from the role of the skin barrier function, immunological hyper-reactivity has also been strongly suggested to be associated with the pathogenesis of atopic dermatitis in humans and dogs. The regulation and direction of the nature of immune responses are commonly attributed to various cytokines13,14. Allergic diseases of humans and dogs could be the result of an inappropriate production of type 2 immune cytokines. The production of IL-4 and the homologous cytokine IL-13 are paramount drivers of type 2 immune response14. Another type 2-derived cytokine is IL-31 which is predominantly produced by the Th2 lymphocytes infiltrating the skin in AD5,15. Interleukin-31 has been recently identified as a potent pruritogenic cytokine which induces itch in AD and other pruritic inflammatory skin disorders in humans and dogs5,16–18. Interferon (IFN)-γ is the main Th1 cytokine; however, TNF-α and IL-2 are also secreted from Th1 cells. The pro-inflammatory cytokines are considered to have a key role in the development of itch sensation and inflammation, which are the hallmark of AD. Moreover, this inflammation down regulates the expression of barrier proteins and exaggerates epidermal barrier dysfunctions in human patients19,20. To date, no detailed studies seem to have been undertaken with an insight into the alterations in the skin barrier proteins expression, and their association with the pruritogenic cytokines expression in dogs with AD. Therefore, the present study aimed to investigate the expression of the skin barrier proteins (FLG and IVL) and alterations in levels of inflammatory cytokines (TNF-α, IL-31, and IL-13) to establish an association between the skin barrier proteins and inflammatory cytokines expressions in dogs with AD.
Materials and methods
Animals
Total 11 clients-owned dogs suffering from dermatological disorder (AD) and presented for the treatment in the Teaching Veterinary Clinics (Kothari hospital) of College of Veterinary Science and Animal Husbandry, DUVASU, Mathura, were included in the present study. Of the 11 atopic dogs, seven (63.6%) were intact males and remaining four were intact females. Out of these 11 AD dogs, five were Labrador Retrievers, two each of Dogo Argentino and Pugs, and one each of the German Shepherd and Beagle breed. The age of the diseased dogs ranged from 2 to 8 years (mean 4.5 years). Three healthy clients-owned dogs (two Labrador retrievers and one Germen shepherd) which were brought to our clinics for routine health check-up and vaccination were included in the present study and kept as controls. Of these three health dogs, two were intact males and one was intact female. They were between 2 and 5 years-age.
The diagnosis of canine AD was based on the history, clinical signs and compliance to the Favrot’s criteria21. The dogs which fulfilled any five of the Favrot’s AD inclusion criteria i.e. (1) revealed onset of signs under three years of age, (2) living mostly indoors, (3) had glucocorticoid-responsive pruritus, (4) had pruritus without lesions at onset, (5) had affected front feet with clinical lesions (6), had affected ear pinnae, (7) had non-affected ear margins and (8) had non-affected dorso-lumbar area were included in the present study. All these dogs were also ardently examined for flea infestations and flea excrement by using flea combs. The diseased dogs that were free from flea infestation and did not have flea excrement were only included in the present study. Furthermore, to detect the mange mites infestation, skin scarping examination was performed. The diseased dogs detected free from any mange mites infestations and who had not revealed any pinnal-pedal scratch reflex on clinical examination were only included in the present study. Further, the dogs included in the present study also had the history of chronic dermatitis and were non-responsive to acaricides. Dogs were also ascertained negative for any of the haemoprotozoan diseases based on thin blood smear examination and had the physiological parameters like body temperature, respiratory-rate and heart-rate within the normal reference range. It was also ascertained that none of the dog included in this study had been treated with glucocorticoids, cyclosporin, oclacitinib, lokivetmab, antihistamines, essential fatty acids or ear products containing glucocorticoids during the last 30 days prior to presentation in our veterinary clinic for treatment. None of the enrolled dogs were receiving allergen-specific immunotherapy. Diagnosis of the concurrent pyoderma and yeast infestation was also made by cytologic examination of the pressure slide impression smears which were prepared from the skin lesions of each participated dog. Bacterial and yeast infections were controlled before inclusion.
Further, clinical evaluation of the canine atopic dermatitis lesion index (CADLI)22 and pruritus visual analogue scale (pVAS) based on owner-derived data23 were also assessed for each of the atopic dogs. Briefly, CADLI was considered only onto the body regions most frequently affected in atopic dogs (head and pinnae, forefeet, hind feet, ventral thorax and axillae, ventral abdomen and inguinal region). The scores of two lesions type subclusters as “erythema-excoriation-erosion” which was referred to as CADLI1 and as “alopecia-lichenification-hyperpigmentation” which was referred to as CADLI2 on a six-point ordinal scale were recorded onto each of the indicated body regions. The integrated severity and extent of the lesion(s) in the area were scored as 0 = none; 1 = mild; 2, 3 = moderate; 4, 5 = severe and extensive lesions (total CADLI between 0 and 50). To evaluate the level of pruritus (pVAS), the pet owners were asked to indicate on a 10-cm-long vertical line where their dog’s pruritus could be placed. The length (in mm) from top to the owner’s sign was measured and used as the tool for quantifying the animal’s pruritus (score ranging from 0 to 10).
Isolation of RNA from the blood and skin biopsy samples
With the written informed consent of the pet owners, 4 mm skin biopsy samples of the lesional skin of dogs with AD, and from normal skin of the healthy dogs were collated with the help of sterilised skin punch biopsy. Before obtaining the punch biopsy, the selected skin lesion was locally anaesthetized by topical application of local anaesthetic, 2% lignocaine jelly. Further, the biopsied skin samples were immediately transferred to liquid nitrogen to prevent the degradation of the RNA. Blood samples (6 ml) were collected from each of the dogs with AD into heparinized tubes and used for isolation of peripheral blood mononuclear cells (PBMC). Blood samples were also collected from the healthy control group in a similar fashion. Total RNA was extracted from the skin tissues by using the PureLink® RNA mini kit. The RNA from blood was extracted by the manual method by using TRIZOL reagent and a phenol/chloroform/isopropyl alcohol method. Isolated RNA was checked for its purity and concentration by using Eppendorf Biophotometer plus. Absorbance was recorded at 260 nm and 280 nm against nuclease-free water as blanks. RNA samples showing A 260/280 value 1.8 in the PBMCs and ratio 1.9–2.0 in the skin samples were used. RNA with a concentration up to 1000 ng was used for cDNA synthesis.
Complementary DNA (cDNA) synthesis
Complementary DNA (cDNA) was synthesised from the mRNA present in the total RNA using Revertaid® First-strand cDNA synthesis kit (Thermo Scientific, USA), following the manufacturer's instruction in thermal cycler using 1000 ng of total RNA. The reaction was carried out in 20 µl of the reaction mixture. 1000 ng of RNA was used for each reaction and the final volume was adjusted by adding nuclease-free water.
Polymerase chain reaction (PCR)
The cDNA was checked for quality by performing PCR with standard GAPDH and RPS 19 primers. The polymerase chain reaction was standardized for each gene using synthesised cDNA. The reaction was carried out at different annealing temperatures and the optimum annealing temperatures for different genes were determined. The protocol suggested by Sambrook and Russel24 was followed. Endpoint optimization was done by using DreamTaq PCR master mix (Thermo Scientific). Primers used for specific genes were suggested by Theerawatanasirikul et al.25 (Table 1).
Table 1.
Gene sequences of the skin barrier proteins and cytokines primers.
| Genes | Primers length (kb) | Gene sequence | |
|---|---|---|---|
| Involucrin (IVL) | 158 |
F R |
AAAGAAGAGCAGGTGCTGGA TGCTCACTGGTGTTCTGGAG |
| Filaggrin (FLG) | 203 |
F R |
GATGACCCAGACACTGCTGA TGGTTTTGCTCTGATGCTTG |
| TNF-α | 121 |
F R |
AGCCAGTAGCTCATGTTGTAGCAA GGCACTATCAGCTGGTTGTCTGT |
| IL-13 | 71 |
F R |
GCGGCAGGGCAGATTTC AGGTTTTTCACCAACTGGATCACT |
| IL-31 | 188 |
F R |
CCTGTTCCTGCTCTGCTCTA TGAGACACAGCAGCAAGGTA |
| RPS 19 | 98 |
F R |
CCTTCCTCAAAAA/GTCTGGG GTTCTCATCGTAGGGAGCAAG |
| GAPDH | 98 |
F R |
AAGGCTGAGAACGGGAAACT TACTCAGCACCAGCATCACC |
Quantitative real-time RT-PCR reaction
Real-time RT-PCR was performed using SYBR Green master mix (PowerUpTMSYBRTM Green master mix [2X]; Thermo Fischer Scientific, USA). Each sample was run in duplicate in 10 µl reaction. The reaction mixture of 10 µl consisted of 5 µl SYBR Green master mix, 0.5 µl from 10 pmol/µl stock solution of each of the gene-specific forward and reverse primers, and 1.0 µl of cDNA (1:3 dilution) and volume was adjusted to 10 µl with nuclease-free water (NFW). To assess the specificity of amplified product, dissociation curve was generated. The results are expressed as threshold cycle values (CT). The melt curve plots and amplification plots for FLG, IVL and RPS19 in the skin punch biopsy samples, and TNF-α, IL-31, IL-13 and GAPDH in PBMCs were recorded for all of the participated dogs.
To study the relative change in gene expression, the 2−ΔΔCT method was used as described by Livak and Schmittgen26. The formula used to calculate the “fold change in mRNA expression” was = 2−ΔΔCT,” [where ΔΔCT = (CT,target gene − CT,reference gene) treatment − (CT,target gene − CT, reference gene) control]. The gene-specific amplification was corrected for the difference in input of RNA by taking reference gene (GAPDH for PBMC or RPS19 for skin samples) to account. For dogs with AD group, evaluation of 2−ΔΔCT indicates the fold change in mRNA expressions relative to healthy dogs (healthy dogs = 1). The results were analysed in comparison with the CT (minimum threshold of amplification) value of the target gene and the reference gene (RPS19 or GAPDH as descried earlier). Difference in values was considered statistically significant at P < 0.05.
Statistical analysis
The unpaired t test was used to determine the statistical difference between the two groups on GraphPad Prism 8 (San Diego, CA, USA). To establish the degree of relationship between the barrier proteins and cytokines, Pearson’s r-correlation statistic was used. Moreover, Pearson’s r-correlation statistic was also used to established the degree of relationship between clinical scores of the atopic dogs (CADLI and pVAS) and studied genes expression of barrier proteins and cytokines. The level of statistical significance for all the comparisons made was established at P < 0.05. Normality of data distribution was tested using the Shapiro–Wilk test. The data were found to be distributed normally. All data were expressed as mean ± SD.
Ethics approval
The study was undertaken in compliance of the ethical standards and the study and experimental protocols were approved by the Institutional Animal Ethics Committee of Uttar Pradesh Pandit Deen Dayal Upadhyaya Pashu-Chikitsa Vigyan Vishwavidyalaya Evam Go Anusandhan Sanstahan (DUVASU), Mathura, India (Approval No: IAEC/18/28). Moreover, the authors complied with the ARRIVE guidelines.
Consent to participate
Samples were collected from client-owned dogs with the written informed consent of the pet owners.
Results
The CADLI and pVAS scores (Mean ± SD) of atopic dogs were calculated to be 29.55 ± 9.10 and 8.36 ± 1.36, respectively. The mRNA fold expression of skin barrier proteins (FLG and IVL) is depicted in Table 2. The dogs with AD revealed significantly higher (P ≤ 0.01) expression of FLG gene as compared to healthy controls. Whereas, significantly (P ≤ 0.05) lower expression of the IVL gene was revealed by the dogs with AD as compared to healthy controls. Compared with the healthy controls, significantly expression of TNF-α (P ≤ 0.01), IL-31 (P ≤ 0.05) and IL-13 (P ≤ 0.05) genes was quantified in the PBMCs of dogs with AD (Table 3). Out of the 11 atopic dogs included in the present study, expression of the IL-13 gene could be detected only in six dogs, while expression of IVL gene was detected in 10 dogs. A non-significant negative correlation of IL-31 and IL-13 with FLG expression was observed in dogs with AD. While, a non-significant positive correlation between TNF-α and FLG expression was detected. Moreover, a non-significant positive correlation of IL-31, IL-13 and TNF-α with IVL was observed in these dogs. The degree of relationship between clinical scores of the severity and the studied genes expression revealed that there was no significant corelation between CADLI, and studied barrier proteins and cytokines expressions. But there was significantly negative correlation between pVAS, and TNF-α (P ≤ 0.01) and IL-13 (P ≤ 0.05) genes expression. However, significant correlation between pVAS, and studied barrier proteins and IL-31 genes expression could not be established.
Table 2.
Relative mRNA expression of Filaggrin and Involucrin in the lesional skin of dogs with AD and healthy controls.
| Genes | Change in mRNA expression (Fold change) | P values | |
|---|---|---|---|
| Healthy dogs | Dogs with AD | ||
| Filaggrin | 1.00 | 2.07 ± 0.66a | 0.01 |
| Involucrin | 1.00 | 0.654 ± 0.26b | 0.05 |
Data presented are Mean ± SD.
aSignificantly higher when compared with healthy control.
bSignificantly lower when compared with healthy control.
Table 3.
Relative mRNA expressions of TNF-α, IL-31 and IL-13 in PBMCs of dogs with AD and healthy controls.
| Genes | Change in mRNA expression (Fold change) | P values | |
|---|---|---|---|
| Healthy dogs | Dogs with AD | ||
| Tumour necrosis factor-α | 1.00 | 8.524 ± 4.21a | 0.011 |
| Interleukin-31 | 1.00 | 3.742 ± 1.84a | 0.028 |
| Interleukin-13 | 1.00 | 4.690 ± 2.46a | 0.041 |
Data presented are Mean ± SD.
aSignificantly higher when compared with healthy control.
Discussion
Filaggrin plays crucial role in maintaining the structural integrity and functions of stratum corneum. Involucrin (IVL) and loricrin are the CE proteins which help in maintaining the homeostasis of stratum corneum17. Filaggrin is the major epidermal protein that has been shown to be an important player in the pathogenesis of AD, and is also known as a modifier of AD9. A markedly diminished expression of epidermal differentiation-associated molecules, such as FLG, IVL and loricrin, has been demonstrated in human patients with AD27,28. In human AD patients, an overexpression of type 2 cytokines, especially IL-4 and IL-13, down regulating epidermal barrier proteins has been demonstrated19,29. But the mechanism that modulates the expression of FLG and integrity of other epidermal barriers in dogs with AD is not well elucidated.
The results of the present study indicated significant increase in mRNA expression of FLG and decrease in mRNA expression of IVL protein in the lesional skin of dogs with AD. The elevated expression of FLG in atopic dogs might be the outcome of compensatory mechanism for restoration of the stratum corneum against the damaging inflammatory cytokines. The expression of FLG is up-regulated in AD patients who are wild type for FLG. ProFLG is up-regulated in the stratum granulosum. In contrast, FLG is reduced in the stratum corneum. This can be explained by reduced activity of proteolytic enzymes that cleave proFLG30–32. Significantly decreased expression of IVL as observed in the present study could be due to downregulatory action of the elevated type-2 cytokines expression in atopic dogs. In agreement to our study, Santoro et al.33 also demonstrated increased FLG mRNA expression in experimentally-induced atopic dermatitis in beagle dogs compared to the healthy dogs. In a similar kind of study conducted by Theerawatanasirikul et al.25 in atopic dogs, an increased level of FLG was observed, however in contrast to our findings, they observed elevated IVL expression. On the contrary, Roque et al.10 performed real time-PCR for quantification of canine FLG in the skin of atopic and non-atopic dogs and they reported significant decrease in overall FLG mRNA expression in the skin of dogs with AD. Findings of our study are also contrary from the reports in human AD, where decrease in both FLG and IVL mRNA expressions in the skin lesions has been reported34–36. Significant increase in IVL mRNA expression has also been reported in the lesional skin of humans with AD37. In an experimental study, non-atopic beagles were sensitized with Dermatophagoides farinae (Df) extract but no significant change in FLG mRNA expression was observed in skin biopsy38. The contradictory findings between our study from those observed in others could be due to species difference or/and variation in the clinical stage of the diseased animals.
To have better insight into the pathogenesis of canine AD, the expression of inflammatory cytokines was undertaken in PBMCs of the atopic and healthy dogs. The mRNA expression of the Th2 cytokines genes, IL-31 and IL-13, and Th1 cytokine gene, TNF-α was quantified using qRT PCR. Markedly higher expression of the IL-13 gene was observed in atopic dogs compared to the healthy ones. In AD dogs, significant negative correlation between the pVAS and IL-13 gene expression was observed which suggests possibly significant role of IL-13 in pathogenesis of canine AD. The result of our study is in agreement with the similar kind of study conducted by Schlotter et al.39 in which significantly higher expression of IL-13 mRNA was demonstrated. Similarly, Marsella et al.40 also reported significantly higher expression of IL-13 in the lesional skin of dogs with AD. Zheng et al.41 used transgenic mouse model which showed the possible direct tissue effects of IL-13 as these mice showed a skin phenotype which reflects AD lesions similar to those observed in humans in several aspects. Hamid et al.42 in a study also demonstrated an increased expression of IL-13 mRNA when compared with the skin biopsy specimens from normal control human subject. In the present study, out of 11 atopic dogs participated; the expression of IL-13 genes could only be detected in six atopic dogs. This could be due to the difference in the duration of the clinical disease (chronicity of the disease) in the enrolled atopic dogs before presentation for the clinical investigation.
In the present study, we observed significantly higher expression of IL-31 gene in PBMCs of dogs with AD; which suggests and substantiates the possible role of this cytokine in the pathogenesis of canine AD. An over expression IL-31 in transgenic mice has been attributed to initiation of various hallmark signs of atopic dermatitis for instance increased inflammatory cells infiltration into the cutaneous tissue, marked pruritus, alopecia and cutaneous lesions. Remarkable elevation in IL-31 level in humans with pruritic skin lesions, and positive correlation of IL-31 with the severity of AD in human patients has been documented43. Recently, a positive correlation of circulating IL-31 level with the severity of canine AD has also been demonstrated44. We observed negative correlation, although non-significant, of IL-31 and IL-13 with FLG expression in AD dogs which indicates key role of these Th2 cytokines in the pathogenesis of AD in dogs. Generation of canine IL-31 protein and its biological function in canine systems, as upon administration of the canine IL-31 to dogs, and significant increase in pruritic behaviour has been reported16. Therefore, IL-31 seems to play crucial role in inducing pruritus across the species and may be dysregulated in dogs with AD16. Results of the present study demonstrated potential association of increased mRNA expression of IL-31 gene with canine AD and is in agreement with the observations in certain recent scientific studies documenting association of IL-31 in dogs with AD16,44. Role of IL-31 in human AD has been established at the protein level coupled with the elevated serum IL-31 level in human AD patients45. In another study, IL-31 mRNA was detected in a variety of tissues in canines, but not in the skin of dogs with AD and based on these observations, they hypothesized that evaluation of IL-31 protein could be more informative than only looking at the mRNA levels46. Altered mRNA expression does not always result in expression at protein level46. Our observation of the elevated IL-31 mRNA expression in PBMCs of dogs with AD is in contrast with the aforesaid hypothesis of Mizuno et al.46. Activation of inflammatory and itch pathways in dogs with AD and significant up-regulation of genes encoding for Th2 (e.g., IL-4, IL-5, IL-13, IL-31 and IL-33), Th9 (IL-9) and Th22 (IL-22) cytokines in acute canine AD skin lesions has been reported15 and their observation is also in agreement with our findings. Significantly higher expression of TNF-α was observed in the present study but there was significantly negative correlation between pVAS and TNF-α genes expression. Maeda et al.47 also observed significantly higher TNF-α in the lesional skin than in the non-lesional skin of the dogs with AD. Nuttall et al.48 also investigated the mRNA expression of Th1 (TNF-α) from the skin biopsy and detected an increased transcription of TNF-α in lesion atopic skin of dogs. Hence, results of the present study indicate that the studied cytokines- IL-13, IL-31 and TNF-α, have key role in the pathogenesis of canine AD and expression of IL-13 and TNF-α genes in atopic dogs might be down-regulated with increased severity of pruritus.
Based on our findings it may be inferred that dogs with atopic dermatitis manifest skin lesions along with the inflammatory response, and the skin barrier proteins (Filaggrin and Involucrin) and inflammatory cytokines (TNF-α, IL-31, IL-13) seem to be key players in the pathogenesis of AD in dogs. Thus, the skin barrier proteins and inflammatory cytokines can be considered as the potential targets in therapeutic management of canine AD, however, further studies are warranted at protein transcriptional level.
Acknowledgements
This study was undertaken with the financial assistance from Indian Council of Agricultural Research, New Delhi, India under “Development Grant” to the University. Laboratory facilities in Central Instrumentation Laboratory (CIL) provided by the Head, Department of Veterinary Pharmacology and Toxicology are thankfully acknowledged.
Author contributions
S.K.S. and S.K.G. had conceived the hypothesis and designed the study plan, analysed data, and drafted and edited the manuscript. S.K., S.K.S., S.P.S., P.K., S.C. and P.K.R. had collected the samples and undertaken laboratory investigations. The competent authority of the University has given permission for publication.
Funding
Indian Council of Agricultural Research, New Delhi, India provided financial assistance under “Development Grant” to the University for strengthening of teaching.
Data availability
Not applicable.
Code availability
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Saridomichelakis MN, Olivry T. An update on the treatment of canine atopic dermatitis. Vet. J. 2016;207:29–37. doi: 10.1016/j.tvjl.2015.09.016. [DOI] [PubMed] [Google Scholar]
- 2.Santoro D, Marsella R, Pucheu-Haston CM. Review: pathogenesis of canine atopic dermatitis: skin barrier and host-micro-organism interaction. Vet. Dermatol. 2015;26:84e-25. doi: 10.1111/vde.12197. [DOI] [PubMed] [Google Scholar]
- 3.Singh SK, Dimri U, Saxena SK, Jadhav RK. Therapeutic management of canine atopic dermatitis by combination of pentoxifylline and PUFAs. J. Vet. Pharmacol. Ther. 2011;33(5):495–498. doi: 10.1111/j.1365-2885.2009.01146.x. [DOI] [PubMed] [Google Scholar]
- 4.Hudson TJ. Skin barrier function and allergic risk. Nat. Genet. 2006;38:399–400. doi: 10.1038/ng0406-399. [DOI] [PubMed] [Google Scholar]
- 5.Chaudhary SK, et al. Alterations in circulating concentrations of IL-17, IL-31 and total IgE in dogs with atopic dermatitis. Vet. Dermatol. 2019;30:383–e114. doi: 10.1111/vde.12762. [DOI] [PubMed] [Google Scholar]
- 6.Proksch E, Folster-Holst R, Brautigam M, Sepehrmanesh M, Pfeiffer S, Jensen JM. Role of the epidermal barrier in atopic dermatitis. J. Dtsch. Dermatol. Ges. 2009;7:899–910. doi: 10.1111/j.1610-0387.2009.07157.x. [DOI] [PubMed] [Google Scholar]
- 7.Candi E, Schmidt R, Melino G. The cornified envelope: a model of cell death in the skin. Mol. Cell Biol. 2005;6:328–340. doi: 10.1038/nrm1619. [DOI] [PubMed] [Google Scholar]
- 8.Proksch E, Brandner JM, Jensen JM. The skin: an indispensable barrier. Exp. Dermatol. 2008;17:1063–1072. doi: 10.1111/j.1600-0625.2008.00786.x. [DOI] [PubMed] [Google Scholar]
- 9.Drislane C, Irvine AD. The role of filaggrin in atopic dermatitis and allergic disease. Ann. Allergy Asthma Immunol. 2020;124(1):36–43. doi: 10.1016/j.anai.2019.10.008. [DOI] [PubMed] [Google Scholar]
- 10.Roque JB, O’Leary CA, Kyaw-Tanner M, Duffy DL, Shipstone M. Real-time PCR quantification of the canine filaggrin orthologue in the skin of atopic and non-atopic dogs: a pilot study. BMC Res. Notes. 2011;4:554. doi: 10.1186/1756-0500-4-554. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Chervet L, et al. Missing C-terminal filaggrin expression, NFkappaB activation and hyperproliferation identify the dog as a putative model to study epidermal dysfunction in atopic dermatitis. Exp. Dermatol. 2010;19:e343–e346. doi: 10.1111/j.1600-0625.2010.01109.x. [DOI] [PubMed] [Google Scholar]
- 12.Marsella R, Samuelson D. Unraveling the skin barrier: a new paradigm for atopic dermatitis and house dust mites. Vet. Dermatol. 2009;20:533–540. doi: 10.1111/j.1365-3164.2009.00809.x. [DOI] [PubMed] [Google Scholar]
- 13.Ajith Y, et al. Immunomodulatory basis of antioxidant therapy and its future prospects: an appraisal. Inflammopharmacology. 2017;25:487–498. doi: 10.1007/s10787-017-0393-5. [DOI] [PubMed] [Google Scholar]
- 14.Lawrence MG, Steinke JW, Borish L. Cytokine-targeting biologics for allergic diseases. Ann. Allergy Asthma Immunol. 2018;120(4):376–381. doi: 10.1016/j.anai.2018.01.009. [DOI] [PubMed] [Google Scholar]
- 15.Olivry T, et al. Early activation of Th1/Th2 inflammatory and pruritogenic pathways in acute canine atopic dermatitis skin lesions. J. Investig. Dermatol. 2016;136(10):1961–1969. doi: 10.1016/j.jid.2016.05.117. [DOI] [PubMed] [Google Scholar]
- 16.Gonzales AJ, et al. Interleukin-31: its role in canine pruritus and naturally occurring canine atopic dermatitis. Vet. Dermatol. 2013;24:48–e12. doi: 10.1111/j.1365-3164.2012.01098.x. [DOI] [PubMed] [Google Scholar]
- 17.Nakahara T, Kido-Nakahara M, Tsuji G, Furue M. Basics and recent advances in the pathophysiology of atopic dermatitis. J. Dermatol. 2021;48:130–139. doi: 10.1111/1346-8138.15664. [DOI] [PubMed] [Google Scholar]
- 18.Saleem MD, Oussedik E, D'Amber V, Feldman SR. Interleukin-31 pathway and its role in atopic dermatitis: a systematic review. J. Dermatol. Treat. 2017;28(7):591–599. doi: 10.1080/09546634.2017.1290205. [DOI] [PubMed] [Google Scholar]
- 19.Howell MD, et al. Cytokine modulation of atopic dermatitis filaggrin skin expression. J. Allergy Clin. Immunol. 2009;124(3S2):R7–R12. doi: 10.1016/j.jaci.2009.07.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Takei K, et al. Antioxidant soybean tar Glyteer rescues T-helper-mediated downregulation of filaggrin expression via aryl hydrocarbon receptor. J. Dermatol. 2015;42(2):171–180. doi: 10.1111/1346-8138.12717. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Favrot C, Steffan J, Seewald W, Picco F. A prospective study on the clinical features of chronic canine atopic dermatitis and its diagnosis. Vet. Dermatol. 2010;21(1):23–31. doi: 10.1111/j.1365-3164.2009.00758.x. [DOI] [PubMed] [Google Scholar]
- 22.Plant JD, Gortel K, Kovalik M, Polissar NL, Neradilek MB. Development and validation of the canine atopic dermatitis lesion index, a scale for the rapid scoring of lesion severity in canine atopic dermatitis. Vet. Dermatol. 2012;23(6):103–515. doi: 10.1111/j.1365-3164.2012.01113.x. [DOI] [PubMed] [Google Scholar]
- 23.Rybníĉek J, Harvey R, Hill PB, Lau-Gillard PJ. Further validation of a pruritus severity scale for use in dogs. Vet. Dermatol. 2009;20:115–122. doi: 10.1111/j.1365-3164.2008.00728.x. [DOI] [PubMed] [Google Scholar]
- 24.Sambrook J, Russell DW. Molecular Cloning. A Laboratory Manual. 3. Cold Spring Harbour Laboratory Press; 2001. [Google Scholar]
- 25.Theerawatanasirikul S, Sailasuta A, Thanawongnuwech R, Suriyaphol G. Alterations of keratins, involucrin and filaggrin gene expression in canine atopic dermatitis. Res. Vet. Sci. 2012;93:1287–1292. doi: 10.1016/j.rvsc.2012.06.005. [DOI] [PubMed] [Google Scholar]
- 26.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta c(T)) method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 27.Furue M. Regulation of filaggrin, loricrin, and involucrin by IL-4, IL-13, IL-17A, IL-22, AHR, and NRF2: pathogenic implications in atopic dermatitis. Int. J. Mol. Sci. 2020;21(15):5382. doi: 10.3390/ijms21155382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Kim BE, Leung DYM. Significance of skin barrier dysfunction in atopic dermatitis. Allergy Asthma Immunol. Res. 2018;10:207–215. doi: 10.4168/aair.2018.10.3.207. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Fiset PO, Leung DY, Hamid Q. Immunopathology of atopic dermatitis. J. Allergy Clin. Immunol. 2006;118(1):287–290. doi: 10.1016/j.jaci.2006.03.046. [DOI] [PubMed] [Google Scholar]
- 30.Fortugno P, et al. The 420K LEKTI variant alters LEKTI proteolytic activation and results in protease deregulation: implications for atopic dermatitis. Hum. Mol. Genet. 2012;21(19):4187–4200. doi: 10.1093/hmg/dds243. [DOI] [PubMed] [Google Scholar]
- 31.Matsui T, et al. SASPase regulates stratum corneum hydration through profilaggrin-to-filaggrin processing. EMBO Mol. Med. 2011;3:320–333. doi: 10.1002/emmm.201100140. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Tan SP, Abdul-Ghaffar S, Weller RB, Brown SB. Protease-antiprotease imbalance may be linked to potential defects in profilaggrin proteolysis in atopic dermatitis. Br. J. Dermatol. 2012;166(5):1137–1140. doi: 10.1111/j.1365-2133.2011.10750.x. [DOI] [PubMed] [Google Scholar]
- 33.Santoro D, Marsella R, Ahrens K, Graves TK, Bunick D. Altered mRNA and protein expression of filaggrin in the skin of a canine animal model for atopic dermatitis. Vet. Dermatol. 2013;24:329–336. doi: 10.1111/vde.12031. [DOI] [PubMed] [Google Scholar]
- 34.Jensen JM, et al. Impaired sphingomyelinase activity and epidermal differentiation in atopic dermatitis. J. Investig. Dermatol. 2004;122:1423–1431. doi: 10.1111/j.0022-202X.2004.22621.x. [DOI] [PubMed] [Google Scholar]
- 35.Seguchi T, Chang-Yi C, Kusuda S, Takahashi M, Aisu K, Tezuka T. Decreased expression of filaggrin in atopic skin. Arch. Dermatol. Res. 1996;288:442–446. doi: 10.1007/BF02505232. [DOI] [PubMed] [Google Scholar]
- 36.Sugiura H, et al. Large-scale DNA microarray analysis of atopic skin lesions shows overexpression of an epidermal differentiation gene cluster in the alternative pathway and lack of protective gene expression in the cornified envelope. Br. J. Dermatol. 2005;152:146–149. doi: 10.1111/j.1365-2133.2005.06352.x. [DOI] [PubMed] [Google Scholar]
- 37.Jarzab J, et al. Locus 1q21 gene expression changes in atopic dermatitis skin lesions: deregulation of small proline-rich region 1A. Int. Arch. Allergy Immunol. 2010;151:28–37. doi: 10.1159/000232568. [DOI] [PubMed] [Google Scholar]
- 38.Schamber P, Schwab-Richards R, Bauersachs S, Mueller RS. Gene expression in the skin of dogs sensitized to the house dust mite Dermatophagoides farina. G3 (Bethesda) 2014;4(10):1787–1795. doi: 10.1534/g3.114.013003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Schlotter YM, Rutten VPMG, Riemers FM, Knol EF, Willemsea T. Lesional skin in atopic dogs shows a mixed type-1 and type-2 immune responsiveness. Vet. Immunol. Immunopathol. 2011;143:20–26. doi: 10.1016/j.vetimm.2011.05.025. [DOI] [PubMed] [Google Scholar]
- 40.Marsella R, Olivry T, Maeda S. Cellular and cytokine kinetics after epicutaneous allergen challenge (atopy patch testing) with house dust mites in high-IgE beagles. Vet. Dermatol. 2006;17:111–120. doi: 10.1111/j.1365-3164.2006.00508.x. [DOI] [PubMed] [Google Scholar]
- 41.Zheng T, Oh MH, Oh SY, Schroeder JT, Glick AB, Zhu Z. Transgenic expression of interleukin-13 in the skin induces a pruritic dermatitis and skin remodeling. J. Invest. Dermatol. 2009;129:742–751. doi: 10.1038/jid.2008.295. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Hamid Q, Naseer T, Minshall EM, Song YL, Boguniewicz M, Leung DYM. In vivo expression of IL-12 and IL-13 in atopic dermatitis. J. Allergy Clin. Immunol. 1996;98:225–231. doi: 10.1016/S0091-6749(96)70246-4. [DOI] [PubMed] [Google Scholar]
- 43.Kim S, Kim H, Yang HS, Kim E, Huh I, Yang J. IL-31 serum protein and tissue mRNA levels in patients with atopic dermatitis. Ann. Dermatol. 2011;23(4):468–473. doi: 10.5021/ad.2011.23.4.468. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Marsella R, Ahrens K, Sanford R. Investigation of the correlation of serum IL-31 with severity of dermatitis in an experimental model of canine atopic dermatitis using beagle dogs. Vet. Dermatol. 2018;28:441–442. doi: 10.1111/vde.12500. [DOI] [PubMed] [Google Scholar]
- 45.Raap U, et al. Correlation of IL-31 serum levels with severity of atopic dermatitis. J. Allergy Clin. Immunol. 2008;122(2):421–423. doi: 10.1016/j.jaci.2008.05.047. [DOI] [PubMed] [Google Scholar]
- 46.Mizuno T, Kanbayashi S, Okawa T, Maeda S, Okuda M. Molecular cloning of canine interleukin-31 and its expression in various tissues. Vet. Immunol. Immunopathol. 2009;131(1–2):140–143. doi: 10.1016/j.vetimm.2009.03.014. [DOI] [PubMed] [Google Scholar]
- 47.Maeda S, et al. Lesional expression of thymus and activation-regulated chemokine (TARC) in canine atopic dermatitis. Vet. Immunol. Immunopathol. 2002;88:79–87. doi: 10.1016/S0165-2427(02)00140-X. [DOI] [PubMed] [Google Scholar]
- 48.Nuttall TJ, Knight PA, McAleese SM, Lamb SR, Hill PB. Expression of Th1, Th2 and immunosuppressive cytokine gene transcripts in canine atopic dermatitis. Clin. Exp. Allergy. 2002;32:789–795. doi: 10.1046/j.1365-2222.2002.01356.x. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Not applicable.
Not applicable.
