Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Jun 2.
Published in final edited form as: Cell Rep. 2020 Jun 9;31(10):107733. doi: 10.1016/j.celrep.2020.107733

Rab7-Mediated Endocytosis Establishes Patterning of Wnt Activity through Inactivation of Dkk Antagonism

Nobuyuki Kawamura 1, Katsuyoshi Takaoka 2, Hiroshi Hamada 3,4, Anna-Katerina Hadjantonakis 5, Ge-Hong Sun-Wada 1,*, Yoh Wada 6,7,*
PMCID: PMC8171381  NIHMSID: NIHMS1703082  PMID: 32521258

SUMMARY

Endocytosis has been proposed to modulate cell signaling activities. However, the role of endocytosis in embryogenesis, which requires coordination of multiple signaling inputs, has remained less understood. We previously showed that mouse embryos lacking a small guanosine triphosphate (GTP)-binding protein Rab7 implicated in endocytic flow are defective in gastrulation. Here, we investigate how subcellular defects associated with Rab7 deficiency are related to the observed developmental defects. Rab7-deficient embryos fail to organize mesodermal tissues due to defects in Wnt-β-catenin signaling. Visceral endoderm (VE)-specific ablation of Rab7 results in patterning defects similar to systemic Rab7 deletion. Rab7 mutants accumulate the Wnt antagonist Dkk1 in the extracellular space and in intracellular compartments throughout the VE epithelium. These data indicate that Rab7-dependent endocytosis regulates the concentration and availability of extracellular Dkk1, thereby relieving the epiblast of antagonism. This intercellular mechanism therefore organizes distinct spatiotemporal patterns of canonical Wnt activity during the peri-gastrulation stages of embryonic development.

In Brief

Kawamura et al. find that the endocytic regulator Rab7 is required for gastrulation in mouse embryos. Rab7-dependent endocytosis participates in Wnt signaling activity by removal of the antagonist Dkk1. This study demonstrates that the endocytic pathway is essential for spatiotemporal patterning of Wnt signaling and plays a role in mammalian development.

Graphical Abstract

graphic file with name nihms-1703082-f0006.jpg

INTRODUCTION

The architecture of multicellular organisms is established through a highly complex process in which various cellular activities are orchestrated responding to a specific context, namely the position of a cell within a population and the timing of tissue morphogenesis. Each cell maintains this spatial and temporal information by organizing its plasma membrane and extracellular environments through secretory and endocytic systems. The secretory system constitutes a synthetic route for trafficking cell surface and extracellular molecules and thus plays an indispensable role in not only assembling but also defining the extracellular milieu. The endocytic pathway participates in the retrieval of surface and extracellular components. The combination of both secretory and endocytic pathways is essential for rapid and efficient reorganization of extra- as well as intracellular activities, which are prerequisite for the execution of the morphogenetic program (Wada and Sun-Wada, 2013; Wada et al., 2016). Various membrane-anchored cell surface receptors are internalized through endocytosis and subsequently relocated to early endosomes, where receptor/ligand complexes relay signals to intracellular mediators (Barbieri et al., 2016). Thereafter, signaling complexes are either recycled back to the plasma membrane or transported to late endocytic compartments for degradation. This endocytic flow of signaling components is thought to be responsible for the spatial downregulation of distinct signal activities (Miaczynska et al., 2004; Willnow et al., 2012).

The anterior-posterior (A-P) body axis of vertebrates is established through coordinate orchestration of multiple signaling cascades, including the transforming growth factor-β (TGF-β)/Nodal, bone morphogenetic protein (BMP), fibroblast growth factor (FGF), and Wnt pathways (Muñoz-Descalzo et al., 2015; Takaoka et al., 2007; Tam and Loebel, 2007). At embryonic day 5.25 (E5.25) (corresponding to pre-gastrulation in the mouse), the most distal position of the visceral endoderm (DVE) starts forming the anterior visceral endoderm (AVE) on one side of the epiblast. The AVE secretes various signaling molecules, including Cer1 and Lefty1, which antagonize TGF-β/Nodal signaling. Consequently, the activation of Nodal signaling is restricted to the posterior side of the epiblast, where gastrulation movements occur and mesoderm is induced (Takaoka et al., 2006; Yamamoto et al., 2004). The AVE also participates in patterning of canonical Wnt signaling activities by producing the Dickkopf (Dkk) antagonists (Kimura-Yoshida et al., 2005). Dkk proteins were first identified due to their head-inducing activities in frogs (Glinka et al., 1998) and are distributed widely among vertebrates. The mechanism of how Dkk1 antagonizes signaling is unique. Dkk1 binds to the Kremen1/2 transmembrane protein, as well as the Wnt co-receptor Lrp5/6, to form a complex at the plasma membrane (Mao et al., 2002). This protein complex is dormant in terms of signaling activity and is subjected to internalization by endocytosis. Thus, Dkk1 activity results in the relocalization of essential components of the Wnt receptor complex from the plasma membrane to endocytic compartments, thereby reducing the availability of Lrp5/6 co-receptors (Sakane et al., 2010; Yamamoto et al., 2008).

Dkk1 transcripts exhibit a unique pattern of expression in peri-gastrulation embryos: they are specifically expressed at the leading edge of the AVE but absent in the cells behind the leading edge (Kemp et al., 2005; Kimura-Yoshida et al., 2005). Interestingly, both Dkks mRNA and protein exhibit this horseshoe-like distribution (Hoshino et al., 2015). This concurrence of mRNA and protein localization suggests that Dkk1 protein has a relatively short half-life. However, the underlying mechanisms regulating Dkk1 turnover remain unclear. Because Dkk1 is a secreted protein, we hypothesized endocytic relocation as a potential scenario for the negative regulation of Dkk1 antagonism.

Trafficking along the endocytic pathway is regulated by numerous molecules, which are involved in vesicle budding, tethering to the destined compartments, and membrane fusion (Hong and Lev, 2014; Spang, 2016). Rab guanosine triphosphatases (GTPases) are small GTP-binding proteins intimately involved in the regulation of membrane dynamics. The transition from early endosomes to late endosomes is regulated by Rab7 (Poteryaev et al., 2010).

Rab7 function is required for the assembly of a unique organelle, an apical vacuole within the VE of mouse embryos (Kawamura et al., 2012; Wada, 2013). Furthermore, mutant embryos lacking Rab7 are unable to develop beyond the gastrulation stage. In this study, we focused on corroborating the mechanistic link between intracellular activities, such as endocytic transport, and the establishment of higher tissue architecture of gastrulae. We found that Rab7-deficient embryos were defective in endocytic clearance of Wnt antagonist Dkk1 and thereby failed to establish correct spatial patterning of Wnt activity.

RESULTS

Rab7 Is Required for Canonical Wnt Signaling

Mouse embryos lacking the Rab7 are defective in endocytic transport and fail to assemble large apical vacuoles within the VE epithelium (Kawamura et al., 2012). Rab7-deficient embryos are also defective in gastrulation: although able to initiate differentiation of nascent mesoderm positive for Brachyury, mesodermal tissues fail to migrate and the primitive streak does not elongate (Figure 1A; Kawamura et al., 2012). Transcripts for Flk-1, a receptor tyrosine kinase normally expressed in the extraembryonic mesoderm (Yamaguchi et al., 1993), were not detected in mutant embryos, demonstrating that extraembryonic mesoderm was not properly formed (Figure 1A). Rab7 mutant developed less obvious mesodermal tissue between the epiblast and endoderm at E7.5 (Kawamura et al., 2012; Figures 1B and 1C). In wild type, nascent mesoderm cells adjacent to primitive streak became negative for E-cadherin, an epithelial-associated cell-adhesion molecule, and started expressing N-cadherin, a mesodermal-associated cell adhesion molecule (Figure 1D, sagittal view; Radice et al., 1997). By contrast, mutant embryos expressed lower amounts of N-cadherin and showed accumulation of E-cadherin (Figure 1D). In wild-type embryos, mesoderm wings appear between the epiblast and endoderm epithelia, resulting in two obvious basal layers positive for the extracellular matrix component laminin (Figure 1D). By contrast, in mutant embryos, only a single laminin-positive layer was detected. The plot profiles of E-cadherin and laminin confirmed that E-cadherin levels were reduced in mesoderm cells sandwiched by the laminin-positive belts in wild-type embryos but distributed more continuously in mutants (Figure 1E). These observations suggest that Rab7-deficient embryos failed to undergo the epithelial-to-mesenchymal transition associated with gastrulation and were defective in organizing tissues derivative of the primitive streak, such as the mesoderm. Consequently, mutant embryos were not able to correctly execute gastrulation and died at around E8.

Figure 1. Gastrulation in Rab7-Deficient Mouse Embryos.

Figure 1.

Open in a new tab

(A) Mesoderm markers Brachyury (anterior on left; posterior on right; wild type: n = 6; rab7−/−: n = 9) and Flk-1 (the embryos are shown in frontal view; wild type: n = 2; rab7−/−: n = 6) were visualized by in situ hybridization.

(B) Technovit-7100-embedded E7.5 embryos were sectioned and stained with hematoxylin and eosin. Scale bar, 100 μm. Boxed areas are shown at a higher magnification. The wild-type embryo developed mesoderm (Mes) in addition to the epiblast (Epi) and endoderm (En) at this stage (n = 5), whereas the rab7 mutant embryo did not exhibit mesodermal tissue (n = 5).

(C) The Mes in the primitive streak region of E7.5 wild-type embryos (n = 3) was observed, whereas rab7 mutant (n = 4) contained a two-layer structure formed by the Epi and the En.

(D) Frozen sections of E7.75 embryos were stained for laminin and E-cadherin (8 wild-type and 11 mutant embryos) and N-cadherin (6 wild-type and 6 mutant embryos).

(E) Intensities of fluorescence of in the yellow rectangle in (D).

Mesoderm formation is regulated through the convergence of multiple signaling pathways, including Wnt, BMP, Nodal/TGF-β, and FGF (Arnold and Robertson, 2009; Muñoz-Descalzo et al., 2015; Rossant and Tam, 2009). Rab7-deficent embryos showed abnormal expression of genes under the regulation of the canonical Wnt pathway. In mutant, Wnt3 was normally expressed at the proximal epiblast with a slight tilt toward the presumptive posterior side of the epiblast (Figure 2A). However, Axin2, a target of Wnt-β-catenin signaling (Jho et al., 2002; Lustig et al., 2002), was almost absent in mutants (Figure 2D). The expression of Snai1 (mouse ortholog of Drosophila snail; Carver et al., 2001; Smith et al., 1992) as well as Brachyury, two genes under direct or indirect regulation of the Wnt signaling pathway (ten Berge et al., 2008), was severely reduced in mutant embryos (Figure 2G). These data collectively suggest that Rab7-deficient embryos are defective in canonical Wnt signaling.

Figure 2. Patterning of Developmental Marker Expression in Rab7-Deficient Embryos.

Figure 2.

Open in a new tab

Expression of markers was examined by in situ hybridization. At least 3 mutant embryos were examined for each marker. Scale bar, 100 μm. See also Figure S1 for expression patterns of Lefty-1 and Cer1.

Expression of Brachyury was restricted to the proximal epiblast located one side (presumable posterior side) of the epiblast of mutants (Figure 1A; Kawamura et al., 2012). A-P patterning was established at E4.5–E6.5 in mutants, as indicated by the anterior-restricted expression of Cer1 and Lefty-1 (Takaoka and Hamada, 2012). These two secretory proteins antagonize Nodal, a member of the TGF-β super family (Brennan et al., 2001; Conlon et al., 1994). In mutant embryos, expression of Cer1 was restricted to the prospective anterior side of the E6.5 epiblast (Figure S1A). Lefty-1 expression was variable: about a half of the mutant embryos (type I; n = 7) showed reduced expression at the anterior side, whereas in the other half (type II; n = 8), there was no detectable Lefty-1 signal (Figure S1B).

Nodal was expressed in a nearly normal pattern, with a gradient along the A-P axis in mutant embryos (Figure 2B; Kawamura et al., 2012). The normal distribution of Nodal transcripts was in agreement with previous findings in which Wnt3 or β-catenin mutants exhibited normal Nodal expression at E6.0 (Ben-Haim et al., 2006; Morkel et al., 2003). The expression patterns of Nodal and Cerl showed that the A-P axis was specified in Rab7-deficient embryos (Kawamura et al., 2012). Nodal is required for the expression of Otx2, a paired-type homeodomain-containing transcription factor, which in turn is required for the establishment of A-P axis (Kimura et al., 2001; Kimura-Yoshida et al., 2005). Otx2 was expressed normally in mutant embryos (Figure 2E). Along with the normal patterns of Wnt3 (Figure 2A), whose expression depends on functional Nodal signaling (Ben-Haim et al., 2006), the loss of the Rab7 function had minimal impact on the Nodal signaling pathway. The epiblast marker, Oct3/4 (aka Pou5f1; Rosner et al., 1990) showed well-defined epiblast localization in mutant embryos, even though the size of the epiblast was reduced when compared to wild-type embryos (Figure 2J).

FGF signaling regulates embryogenesis at multiple steps (Yamaguchi et al., 1994). FGF8 is required for the correct assembly of the primitive streak (Crossley and Martin, 1995; Sun et al., 1999). At E7.5, mutant embryos showed Fgf8 expression in the posterior proximal region of the epiblast, although the level was lower than in wild-type embryos, reflecting defects associated with mesoderm assembly (Figure 2H). Expression of Sprouty2, a gene encoding a negative regulator of FGF signaling, is regulated by the FGF signaling pathway (Minowada et al., 1999). In wild-type embryos, Sprouty2 was expressed throughout the epiblast and more abundantly in the primitive streak. This pattern of expression was conserved in mutant embryos (Figure 2C). Thus, the expression of a key FGF ligand acting at gastrulation, as well as the perception of FGF signaling, was not affected by Rab7 deficiency.

Rab7 Function in the VE Is Essential for Gastrulation

Despite Rab7 transcripts being expressed equally in the epiblast and extraembryonic ectoderm, the VE exhibits a greater abundance of Rab7 protein than the epiblast and extraembryonic ectoderm (Kawamura et al., 2012). We therefore investigated whether Rab7 function was required in the epiblast, which gives rise to the definitive germ layers (mesoderm, endoderm, and ectoderm). We used a Ttr::CreTg/+ strain of mice, driving expression of the Cre recombinase throughout the VE of E5.5 embryos (Kwon and Hadjantonakis, 2009). We crossed Ttr::CreTg/+ rab7+/− male mice to rab7flox/flox female mice (Kawamura et al., 2012). At E6.5, all embryos exhibited normal morphology. However, in Ttr::CreTg/+; rab7flox/− embryos, Rab7 was below detectable levels in the VE, indicating VE-specific inactivation of Rab7 (Figure 3A). The gross morphology of Ttr::CreTg/+; rab7flox/− embryos was similar to mutant embryos having a systemic deletion of Rab7 function. Brachyury expression was initiated at the proximal posterior region, but Brachyury-positive cells did not organize into an elongated primitive streak (Figure 3B). Axin2 expression was significantly reduced in embryos lacking Rab7 function in the VE (Figure 3B). These observations demonstrate that Rab7 function in the VE is essential for gastrulation.

Figure 3. Defective Gastrulation upon VE-Specific Ablation of Rab7 Function.

Figure 3.

Open in a new tab

(A) Female rab7flox/flox mouse was crossed with a male mouse (rab7+/−, Ttr::CreTg/+). Embryos were dissected at E6.5, and Rab7 was detected by immunofluorescence. The rab7 heterozygote (rab7flox/−: n = 11) and rab7 VE deletion (rab7flox/−, Ttr::CreTg/+: n = 8) were observed.

(B) Brachyury expression was examined in 3 rab7 heterozygotes (rab7flox/−) and 10 rab7 VE deleted (rab7flox/−, Ttr::CreTg/ +) embryos. Axin2 expression was observed in 8 rab7 heterozygotes (rab7flox/−) and 9 rab7 VE deleted (rab7flox/−, Ttr::CreTg/ +) embryos.

See also Figure S2 for phenotype of epiblast-specific ablation of Rab7 function.

We next examined the consequence of an epiblast-specific deletion of Rab7 function by expressing the Sox2-promoter-driven Cre (Hayashi et al., 2002). Rab7 protein was undetectable in the epiblast of Sox2::CreTg/+ rab7flox/− embryos at E6.5, demonstrating efficient ablation of Rab7 function. By contrast to the VE-specific deletion, the majority of epiblast-specific knockout embryos (4/5) did not exhibit severe developmental defects at E7.5 (Figure S2), showing that loss of Rab7 in the epiblast resulted in less severe defects than loss of the Rab7 function in the VE. Thus, although expression levels of Rab7 were high in the epiblast of wild-type embryos, its function in the epiblast was dispensable for gastrulation.

Rab7-Dependent Endocytosis Controls Dkk Antagonism

During gastrulation, loss of Rab7 function in the VE was sufficient to result in developmental defects that were comparable to systemic loss of Rab7. This non-cell-autonomous aspect suggests an intercellular mechanism might be responsible for the observed developmental defects. The endocytic compartments are traditionally considered to provide a degradation mechanism. We therefore hypothesized that the defects in Wnt signal transduction may result from failure of abrogating a negative regulation on the pathway.

Wnt signaling is regulated negatively by Dkk proteins (Glinka et al., 1998; Lewis et al., 2008), whose binding to the Wnt coreceptor Lrp5/6 and Kremen leads to endocytosis and a concomitant decrease in Wnt signal receptivity at the plasma membrane (Davidson et al., 2002; Mao et al., 2002; Sakane et al., 2010; Yamamoto et al., 2008). Dkk1 shows a unique expression pattern at E6-E6.5, being restricted to the leading front of the migrating AVE (Kimura-Yoshida et al., 2005; Figure 2I). Rab7-deficient embryos expressed Dkk1 transcripts at a comparable level to wild-type embryos. Dkk1 expression is regulated by Otx2 (Kimura-Yoshida et al., 2005), which was expressed normally in mutant embryos, indicating that transcriptional regulation of both Otx2 and Dkk1 was unaffected. The Dkk1 transcript in E6.5 mutant embryos did however exhibit a more broadened distribution (Figure 2I), most likely reflecting impaired AVE patterning. This was also the case for the expression of Cer1 and Lefty1 (Figure S1; Kawamura et al., 2012). This impaired patterning of AVE was also reported in embryos defective in canonical Wnt signaling (Barrow et al., 2007), supporting our view that Rab7-deficient embryos had reduced Wnt signaling activity.

In E6.5 wild-type embryos, Dkk1 protein was abundant at the leading edge of the presumptive AVE (Figure 4B), exhibiting a horseshoe-like pattern (Video S1; Hoshino et al., 2015), comparable to that of the transcript (Figure 2I). In mutant embryos, Dkk1 was more abundant and the region positive for Dkk1 expanded (Figure 4B; Video S2). At E5.5, when AVE migration commences at the distal region of the epiblast, low levels of Dkk1 protein accumulation were observed in the epiblast of wild-type and mutant embryos. At this stage, no significant difference was observed in Dkk1 distribution. By E6.0, Dkk1 protein became apparent in the leading edge of the proximally migrating AVE of wild-type embryos, although the distal part of the epiblast exhibited a lower level of expression. By contrast, high levels of Dkk1 had accumulated throughout the entire embryonic part of mutant embryos. These elevated levels of Dkk1 were evident until E6.5. At E6.5, Dkk1 protein localization was predominantly inside VE cells of wild-type embryos but undetectable in the extracellular space between VE and the neighboring epiblast (Video S3; Figure 4B). However, mutant embryos exhibited elevated levels of Dkk1 protein, which had accumulated in the extracellular space (Video S4; Figure 4B).

Figure 4. Accumulation of Wnt Antagonist, Dkk1 Proteins in Rab7-Deficient Embryos at Peri-gastrulation Stages.

Figure 4.

Open in a new tab

(A) Schematic diagram of optical sections of a whole mounted embryo.

(B) Localization of Dkk1 at E5.5 (wild type: n = 2 and rab7−/−: n = 5), E6.0 (wild type: n = 20 and rab7−/− n = 16), E6.25 (wild type: n = 10 and rab7−/−: n = 10), and E6.5 (wild type: n = 13 and rab7−/−: n = 6).

(C) Elevated signal of Dkk1 in Rab7-deficient embryos between the visceral endoderm (VE) and Epi. E6.5 wild-type (n = 4) and Rab7-deficient embryos (n = 4) were stained for Dkk1 (green) and E-cadherin (red). The areas outlined by white dashed lines are magnified. Arrows indicate the Dkk1 signals outside the VE cells.

(D) E6.5 wild-type (n = 10) and Rab7-deficient (n = 7) embryos stained for Dkk1 (green) and integrin β1 (red). The areas outlined by white dashed lines are magnified. Arrows indicate the Dkk1 signals outside the VE cells.

See also Videos S1, S2, S3, S4, S5, and S6 for three-dimensional reconstitution of Dkk1 patterning.

We labeled Dkk1 together with E-cadherin, which is localized at the basolateral membrane of epithelial cells. The majority of Dkk1 signal was observed within VE cells (Figure 4C). By contrast, in mutant, strong Dkk1 accumulation was observed in the border of epiblast and VE. In addition, a few puncta of Dkk1 were observed at the lateral extremity of VE cells (Figure 4C). Some of the Dkk1 protein was localized in close proximity to integrin β1 (Figure 4D; Videos S5 and S6), which marks the basal cell surface comprising adherens junctions (Shafaq-Zadah et al., 2016). It therefore appeared as if a significant amount of Dkk1 had accumulated in the extracellular space of Rab7-deficient embryos.

The intracellular Dkk1 signals overlapped with sorting nexin 1 (SNX1), an early endosome marker, within VE cells (Figure 5A), suggesting that Dkk1 was internalized by endocytosis. SNX1-positive compartments were distributed broadly in Rab7-deficient cells, reflecting trafficking defects in the endocytic pathway (Kawamura et al., 2012). Colocalization of Dkk1 with SNX1 was absent in mutant embryos, and Dkk1 proteins appeared to accumulate outside the basal membrane of VE cells (Figure 5A). Dkk1 and Rab4, a resident of subdomains of early endosomes (Daro et al., 1996), existed in close proximity in wild-type VE cells. By contrast, Dkk1 and Rab4 were separated in mutant embryos (Figure S3). These observations suggest that defects in Dkk1 trafficking occur at endocytic compartments rather than in the secretory pathway, leading to accumulation of Dkk1 in extracellular spaces.

Figure 5. Rab7-Dependent Trafficking of Dkk1 Creates Wnt Signal Pattern in Peri-gastrulation Embryo.

Figure 5.

Open in a new tab

(A) E6.0wild-type (n = 20) and Rab7-deficient embryos (n = 16) stained for Dkk1 (green) and sorting nexin 1 (SNX1, red). Arrows indicate colocalization of Dkk1 and SNX1 in the wild-type embryos. Outlined arrows indicate Dkk1 signals observed in Rab7 mutants, which colocalizes neither SNX1 nor Lamp2. Single-channel images are also shown.

(B) E6.5 wild-type embryos (n = 21) stained for Dkk1 (green), Lamp2 (red), and mouse IgG (red). Arrows indicatethe Dkk1 signals overlapping with IgG or Lamp2.

See also Videos S7 and S8.

The VE epithelium takes up immunoglobulin by endocytosis, where it is delivered to Lamp2-positive apical vacuoles (Aoyama et al., 2012; Kawamura et al., 2012). Some internalized Dkk1 at the apical side of VE cells were positive for Lamp2 and immunoglobulins (Figures 5A and 5B), indicating that internalized Dkk1 was being delivered to the terminal compartment of the endocytic pathway, where presumably it is destined for degradation (Videos S7 and S8). By contrast, in Rab7-deficient VE cells, Lamp-2 compartments, which are highly fragmented, did not contain Dkk1 (Figure 5A, open arrows), suggesting that lysosomal trafficking of Dkk1 was defective.

Within the VE, endocytic flow occurs via microautophagy, whereby endosomes are engulfed by apical vacuoles without membrane fusion. The endosomal membranes are then disrupted inside the apical vacuole by lipase activity (Kawamura et al., 2012). In this process, endocytosed materials transiently appear within apical vacuoles as distinctive compartments, reflecting an engulfed but neither merged nor digested status. We often observed Dkk signals at close proximity to Lamp2- or immunoglobulin-positive apical vacuoles as distinctive spots (Videos S7 and S8). This suggests that microautophagy participated, at least in part, in the trafficking of Dkk1 to apical vacuoles.

DISCUSSION

The relevance of endocytosis in mammalian embryogenesis has been demonstrated by a number of studies, implicating it in nutritional and signal transduction (Aoyama et al., 2012; Kawamura et al., 2012; Perea-Gomez et al., 2019; Shim et al., 2006; Strope et al., 2004; Takasuga et al., 2013; Zheng et al., 2006). Here, we demonstrate that Rab7 is required for the proper patterning of Wnt signaling activity by removal of the Wnt antagonist Dkk1. This endocytic retrieval and compartmentalization of Wnt antagonist(s) constitutes an essential mechanism for establishing embryonic patterning during peri-gastrulation development of the mouse embryo.

Stabilization of β-catenin, a cytosolic signal transducer for the Wnt signaling pathway, involves sequestration of GSK3 protein kinase into late endosomes (Albrecht et al., 2018, 2019; Taelman et al., 2010). Wnt signaling has been shown to stabilize the microphtalmia-associated transcription factor (MITF), which regulates the expression of genes required for endosome/lysosome biogenesis (Ploper et al., 2015). These findings demonstrate that Wnt signaling and endosome/lysosome dynamics are intimately connected via a cell-autonomous mechanism. Here, we demonstrate a non-cell-autonomous mechanism for endosomal regulation of Wnt signaling in gastrulating embryos. Rab7 function in the epiblast is not required for gastrulation. However, loss of Rab7 in the VE causes severe gastrulation defects. Notably, β-catenin function has been shown to be required in the embryonic ectoderm, but not in the extraembryonic tissues, for primitive streak development (Engert et al., 2013; Huelsken et al., 2000; Lickert et al., 2002). The contrasting requirements for Rab7 and β-catenin suggest that they act at different steps within the signaling cascade.

Soon after the mouse embryo establishes a cup-shaped “egg cylinder” epiblast (E5.25), anterior markers localized within the adjacent VE tissue layer become highly expressed at the region adjacent to the most distal pole of the epiblast, demarcating the DVE (Takaoka et al., 2007). During subsequent stages of development, the Lefty-1- and Cer1-positive initially distal region extends toward a more proximal region of the epiblast along one side (demarcating the future anterior side of the embryo, being referred to as the AVE). Lefty-1 and Cer1 are expressed throughout the migrating AVE population (Perea-Gomez et al., 2002). By contrast, Dkk1 transcripts demarcate a subpopulation of the AVE as they exhibit a unique horseshoe-like pattern, corresponding to the frontal ridge of the AVE (Kimura-Yoshida et al., 2005). The expression of Dkk1 is under regulation of canonical Wnt signaling (González-Sancho et al., 2005; Niida et al., 2004), and Wnt3-deficient embryos fail to express Dkk1 in the AVE (Lewis et al., 2008). Therefore, the most proximal leading edge of the AVE, highly influenced by Wnt ligands expressed in the proximal epiblast, exhibits a high level of Dkk1 expression. However, Dkk1 protein shuts off Wnt in the trailing (more distally located) cells, resulting in a reduction of Dkk1 transcription. This feedback loop results in the distinctive localization of Dkk1, resulting in a horseshoe-like distribution.

Once Dkk1 acquires its unique pattern, an additional layer of regulation impacts the dynamics of the Dkk1 protein. Fluorescent protein (EGFP) reporters expressed from the Dkk1 locus are localized throughout the VE, failing to recapitulate the distribution of endogenous Dkk1 as observed at the mRNA and protein level. However, when EGFP is destabilized by tagging it with degradation signals, it reproduces the pattern of Dkk1 protein, suggesting that the distribution of Dkk1 is highly dependent on protein turnover (Hoshino et al., 2015). Because Dkk1 is a secreted protein, the active silencing mechanism that physically degrades it must exploit an extracellular and/or endocytic mechanism and be distinct from those for cytosolic degEGFP.

We propose that the aberrant Wnt patterning was causative for the developmental defects associated with the loss of Rab7 function. Lefty-1 expression becomes undetectable in the E6.0 β-catenin mutant (Morkel et al., 2003), whereas less perturbed expression of Cerl was associated with various mutations of Wnt components (Hsieh et al., 2003; Liu et al., 1999; Morkel et al., 2003). Rab7 deficiency brought similar differential impacts on Cerl and Lefty-1, supporting that the Rab7 function is rather selective in canonical Wnt pathway. Rab7 mutant showed an altered patterning in the AVE markers. Loss of either Wnt3 or β-catenin leads broaden AVE, marked by Dkk1 and Cerl (Barrow et al., 2007), similarly to what occurred in the Rab7-deficient embryos. These observations are coherent that Wnt signaling was affected. However, we are not able to rigorously exclude possibilities that Nodal and other signaling pathways are also under regulation of Rab7-dependent endocytosis and their dysregulation is also participated in the embryonic phenotype.

The VE of peri-gastrulation embryos exhibits a unique membrane process, microautophagy, whereby large apical vacuoles engulf endosomes at late stages of endocytosis (Wada et al., 2013). The results we present here demonstrate that Rab7-mediated microautophagy in the VE cells plays a role in Wnt signaling at peri-gastrulation stages. Our observations suggest that microautophagy is not only required for nutritional supplement but also implicated in the spatial regulation of signaling.

STAR METHODS

RESOURCE AVAILABILITY

Lead Contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Yoh Wada (yohwada@sanken.osaka-u.ac.jp)

Materials Availability

The mutant and Tg mice generated in this study will be made available on request from the Lead Contact, but we may require a shipping/handling payment and/or a completed Materials Transfer Agreement.

Data and Code Availability

The published article includes all data generated during the study and the raw data is available on request from the Lead Contact. No code was developed for this study.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Rab7 mutant mice (RRID:IMSR_RBRC05600 and RRID:IMSR_RBRC05601) were described previously (Kawamura et al., 2012). Ttr::Cre transgenic mice were generated by injecting a Ttr-Cre construct (AddGene 32606)(Kwon and Hadjantonakis, 2009) into pronucleus of E0.5 embryos obtained from a hybrid strain of C57BL/6J and C3H/HeJ. The Sox2::Cre mouse (RRID:IMSR_HAR:3359) (Hayashi et al., 2002) were obtained from The Jackson Laboratory. C57BL/6 and ICR mice were purchased from SLC Japan. Adult female mice (> 6 wks) were placed with males (> 10 wks) and examined daily for the presence of a copulation plug. Embryos were obtained from pregnant females sacrificed by isoflurane anesthesia followed by in vivo perfusion fixation, then processed for immunostaining or whole mount in situ hybridization as described previously (Aoyama et al., 2012; Kawamura et al., 2012; Yamamoto et al., 2001). Embryos were staged according to the dissection time (noon of the vaginal plug as E0.5) and morphology. All animal experiments were approved by the institutional committees (ISIR, Osaka Univ. and Doshisha Women’s College), and were carried out in accordance with the rules and regulations of the institutions and the government.

METHOD DETAILS

Genotyping

Mouse genotypes were determined by PCR amplification. After morphological observation and recording, embryos were incubated in 20 μL (for E6.5 and earlier) or 40 μL (for E7.5) of QuickExtract solution (Epicenter) at 50°C overnight and heat inactivated at 95°C for 15 min. One microliter of embryo lysate was used for a PCR reaction of 20 μL volume. PCR products were analyzed either by agarosegel electrophoresis or EvaGreen fluorescence in real-time PCR detection systems (Applied Biosystems 7000 or TaKaRa TP950). The primers used for genotyping were listed in the Key Resources Table. The wild-type allele of Rab7 (Rab7+) was detected as 0.94-kb and 0.32-kb PCR products with primer pairs of Rab7-S10/Rab7-A02 and Rab7-S15/Rab7-A16, respectively. rab7− was detected as 0.45-kb product with a Rab7-S02/Rab7-A05 primer pair. Rab7flox allele gave signals of 1.0-kb and 0.83-kb with primer pairs Rab7-S10/Rab7-A02 and Rab7-S15/Rab7-A16, respectively. The presence of Ttr::Cre or Sox2::Cre transgene was determined by PCR signals of a 0.37-kb fragment. A schematic presentation of the wild-type and modified versions of the Rab7 locus was reported previously (Kawamura et al., 2012).

Technovit Section and Histological Analysis

Mouse embryos were dissected at E7.5 and embedded in Technovit 7100 resin. Sagittal sections were stained with hematoxylin and eosin.

Immunofluorescence Staining

Immunofluorescence staining was performed as previously described (Kawamura et al., 2012). For immunohistochemistry, fixed embryos were incubated with primary and secondary antibodies in a blocking solution containing 0.05% Tween-20, 0.5% TSA blocking reagent (PerkinElmer) and 1% normal donkey serum in PBS. Nuclear DNA was stained by TOPRO-3 or DAPI.

Microscopy

Immunostained embryos were immersed in VECTASHIELD (Vector Laboratories), and mounted in 0.1% gellan gum (Sigma-Aldrich) in PBS plus 40% glycerol and 0.2% Tween-20 in a glass-top 35-mm dish. Bright-field images of the histological or in situ hybridization specimens were acquired with an Olympus BX50 microscope and recorded using a MicroPublisher5.0 (QImaging) camera (tagged image file format mode, auto white balance). Immunofluorescence samples were viewed with a confocal laser scanning microscope (Zeiss LSM 510META or LSM800). Serial Z stacks of fluorescence images in frontal focal plane (XY) were obtained at 0.92 μm intervals by confocal microscopy. The sagittal (ZY) images were converted using Zeiss ZEN2.5 lite software. For electron microscopy, embryos were fixed in 2.5% glutaraldehyde and 4% PFA in 0.1 M potassium phosphate buffer (pH 7.4), and then processed using standard procedures (Sun-Wada et al., 2000, 2006). Electron microscopic observations were conducted at the Hanaichi Ultra-Structure Research Institute (Okazaki, Japan).

QUANTIFICATION AND STATISTICAL ANALYSIS

The sample size of the experiments was defined based on previous experimental experience. For treatments, the embryos were allocated randomly to treatments, but the investigators were not blinded to allocation. Sample numbers of each genotype can be found in the Figure Legends, whereby n values stand for the number of embryos observed. Developmental maker expression in E5.5-7.5 embryos (Figure 2), we observed 7 rab7 mutants for Wnt3, 3 for Nodal, 5 for Sprouty2, 7 for Axin2, 3 for Otx2, 6 for Bmp4, 4 for Snail1, 4 for Fgf8, and 8 for Dkk1. Intensities of fluorescence of E-cadherin and laminin in Figure 1 were analyzed using the Plot Profile module in NIH ImageJ software.

Supplementary Material

Video 2
Download video file (571.8KB, mp4)
Video 3
Download video file (890.1KB, mp4)
Video 1
Download video file (874.8KB, mp4)
Video 4
Download video file (1.3MB, mp4)
Video 7
Download video file (1.5MB, mp4)
Video 5
Download video file (4.2MB, mp4)
Video 8
Download video file (1.8MB, mp4)
Video 6
Download video file (7.6MB, mp4)
1

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Rat anti-E-cadherin Takara Bio M108, Clone ECCD- 2
Rabbit anti-Laminin LSL LB-1013, RRID:AB_605066
Rabbit anti-N-cadherin Abcam Ab18203, RRID:AB_444317
Rabbit anti-Rab7 Prepared in our lab Kawamura et al., 2012 https://doi.org/10.1038/ncomms2069
Goat anti-Dkk1 R&D systems AF1765, RRID:AB_354977
Rat anti-integrin beta 1, clone MB1.2 Merck Millipore MAB1997, RRID: AB_2128202
Rat anti-Lamp2 DSHB Clone GL2A7, RRID:AB_2314737
Rabbit anti-SNX1 Prepared in our lab Nakamura et al., 2001
Sheep anti- Anti Digoxigenin-AP Fab Fragments Roche 11093274910 RRID:AB_514497
Rabbit anti-Rab4 Abcam Ab13252 RRID:AB_2269374
Experimental Models: Organisms/Strains
Mus musculus/Rab7 floxed Kawamura et al., 2012 RRID:IMSR_RBRC0 5600
Mus musculus/Rab7 null Kawamura et al., 2012 RRID:IMSR_RBRC0 5601
Mus musculus/Tg(Ttr-Cre) This study N/A
Mus musculus/Tg(Sox2-cre)1Amc The Jackson Laboratory RRID:IMSR_HAR:33 59
Oligonucleotides
Primer Rab7-S02
ACCTGGAAGAGTGAACCAAG
GGTCAGCATG		 Rab7 intron1-2, sense strand, Kawamura et al., 2012 N/A
Primer Rab7-A05
AATTTAGGATTGGGGTGTGG
CTCCGTGCTC		 Rab7 intron1-2, antisense strand, Kawamura et al., 2012 N/A
Primer Rab7-S10
CAAATGGCTCATTAGTTCTTG
AGCTACCAC		 Rab7 intron 1-2, sense strand, Kawamura et al., 2012 N/A
Primer Rab7-A02
ACCCCTGCCTGGGATTTTGG
TCCTGGATTC		 Rab7 intron 1-2, antisense strand, Kawamura et al., 2012 N/A
Primer Rab7-S15
GGATAAAATAGCAGTAAAAG
CACGGTCGGG		 Rab7 intron 3-4, sense strand, Kawamura et al., 2012 N/A
Primer Rab7-A16
GGTGGATTTTTCTGAGTTTGA
GGCCAGCCT		 Rab7 intron 3-4, antisense strand, Kawamura et al., 2012 N/A
Primer Cre-Fw
ACCTGAAGATGTTCGCGATTATCT		 Bacteriophage P1, Cre recombinase sense strand N/A
Primer Cre-Rv
ACCGTCAGTACGTGAGATATCTT		 Bacteriophage P1, Cre recombinase antisense strand N/A
Recombinant DNA
Ttr:Cre Kwon and Hadjantonakis, 2009 RRID:Addgene_326 06
Software and Algorithms
Zeiss Laser Scanning Microscope LSM510 Carl Zeiss Version 4.2 SP1
Zeiss Laser Scanning Microscope LSM800 Carl Zeiss ZEN 2.3
QImaging QCapture Pro Teledyne QImaging Version 6.0
ImageJ https://imagej.nih.gov/ij/
Open in a new tab

Highlights.

  • Rab7-deficient embryos are defective in gastrulation

  • Rab7 is required in visceral endoderm for gastrulation but dispensable in epiblast

  • Endocytic clearance of Dkk antagonist establishes spatial patterning of Wnt activity

ACKNOWLEDGMENTS

We thank Drs. Richard Behringer, the late Rosa. S. Beddington, Edward M. De Robertis, Thomas Gridley, Hiroshi Sasaki, and Yumiko Saga for providing in situ probe constructs. We thank Drs. Isao Matsuo and Shinji Takada for helpful discussions. This research was supported by Grants-in-Aid from the Ministry of Education, Culture, Sports, Science and Technology of Japan (26291041 and 16H01201 to Y.W., 26440068 to G.-H.S.-W., and 15K21494 to N.K.); Young Researcher Grant from The PMAC for Private Schools of Japan for N.K.; and Individual Research Grants in Doshisha Women’s College to G.-H.S.-W.

Footnotes

SUPPLEMENTAL INFORMATION

Supplemental Information can be found online at https://doi.org/10.1016/j.celrep.2020.107733.

DECLARATION OF INTERESTS

The authors declare no competing interests.

REFERENCES

  1. Albrecht LV, Ploper D, Tejeda-Muñoz N, and De Robertis EM (2018). Arginine methylation is required for canonical Wnt signaling and endolysosomal trafficking. Proc. Natl. Acad. Sci. USA 115, E5317–E5325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Albrecht LV, Bui MH, and De Robertis EM (2019). Canonical Wnt is inhibited by targeting one-carbon metabolism through methotrexate or methionine deprivation. Proc. Natl. Acad. Sci. USA 116, 2987–2995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Aoyama M, Sun-Wada G-H, Yamamoto A, Yamamoto M, Hamada H, and Wada Y (2012). Spatial restriction of bone morphogenetic protein signaling in mouse gastrula through the mVam2-dependent endocytic pathway. Dev. Cell 22, 1163–1175. [DOI] [PubMed] [Google Scholar]
  4. Arnold SJ, and Robertson EJ (2009). Making a commitment: cell lineage allocation and axis patterning in the early mouse embryo. Nat. Rev. Mol. Cell Biol 10,91–103. [DOI] [PubMed] [Google Scholar]
  5. Barbieri E, Di Fiore PP, and Sigismund S (2016). Endocytic control of signaling at the plasma membrane. Curr. Opin. Cell Biol. 39, 21–27. [DOI] [PubMed] [Google Scholar]
  6. Barrow JR, Howell WD, Rule M, Hayashi S, Thomas KR, Capecchi MR, and McMahon AP (2007). Wnt3 signaling in the epiblast is required for proper orientation of the anteroposterior axis. Dev. Biol. 312, 312–320. [DOI] [PubMed] [Google Scholar]
  7. Ben-Haim N, Lu C, Guzman-Ayala M, Pescatore L, Mesnard D, Bischofberger M, Naef F, Robertson EJ, and Constam DB (2006). The nodal pre-cursor acting via activin receptors induces mesoderm by maintaining a source of its convertases and BMP4. Dev. Cell 11, 313–323. [DOI] [PubMed] [Google Scholar]
  8. Brennan J, Lu CC, Norris DP, Rodriguez TA, Beddington RS, and Robertson EJ (2001). Nodal signalling in the epiblast patterns the early mouse embryo. Nature 411, 965–969. [DOI] [PubMed] [Google Scholar]
  9. Carver EA, Jiang R, Lan Y, Oram KF, and Gridley T (2001). The mouse snail gene encodes a key regulator of the epithelial-mesenchymal transition. Mol. Cell. Biol. 21,8184–8188. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Conlon FL, Lyons KM, Takaesu N, Barth KS, Kispert A, Herrmann B, and Robertson EJ (1994). A primary requirement for nodal in the formation and maintenance of the primitive streak in the mouse. Development 120, 1919–1928. [DOI] [PubMed] [Google Scholar]
  11. Crossley PH, and Martin GR (1995). The mouse Fgf8 gene encodes a family of polypeptides and is expressed in regions that direct outgrowth and patterning in the developing embryo. Development 121, 439–451. [DOI] [PubMed] [Google Scholar]
  12. Daro E, van der Sluijs P, Galli T, and Mellman I (1996). Rab4 and cellubrevin define different early endosome populations on the pathway of transferrin receptor recycling. Proc. Natl. Acad. Sci. USA 93, 9559–9564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Davidson G, Mao B, del Barco Barrantes I, and Niehrs C (2002). Kremen proteins interact with Dickkopf1 to regulate anteroposterior CNS patterning. Development 129, 5587–5596. [DOI] [PubMed] [Google Scholar]
  14. Engert S, Burtscher I, Liao WP, Dulev S, Schotta G, and Lickert H (2013). Wnt/β-catenin signalling regulates Sox17 expression and is essential for organizer and endoderm formation in the mouse. Development 140, 3128–3138. [DOI] [PubMed] [Google Scholar]
  15. Glinka A, Wu W, Delius H, Monaghan AP, Blumenstock C, and Niehrs C (1998). Dickkopf-1 is a member of a new family of secreted proteins and functions in head induction. Nature 391, 357–362. [DOI] [PubMed] [Google Scholar]
  16. González-Sancho JM, Aguilera O, García JM, Pendás-Franco N, Peña C, Cal S, García de Herreros A, Bonilla F, and Muñoz A (2005). The Wnt antagonist DICKKOPF-1 gene is a downstream target of β-catenin/TCF and is downregulated in human colon cancer. Oncogene 24, 1098–1103. [DOI] [PubMed] [Google Scholar]
  17. Hayashi S, Lewis P, Pevny L, and McMahon AP (2002). Efficient gene modulation in mouse epiblast using a Sox2Cre transgenic mouse strain. Mech. Dev. 119 (Suppl 1), S97–S101. [DOI] [PubMed] [Google Scholar]
  18. Hong W, and Lev S (2014). Tethering the assembly of SNARE complexes. Trends Cell Biol. 24, 35–43. [DOI] [PubMed] [Google Scholar]
  19. Hoshino H, Shioi G, and Aizawa S (2015). AVE protein expression and visceral endoderm cell behavior during anterior-posterior axis formation in mouse embryos: Asymmetry in OTX2 and DKK1 expression. Dev. Biol 402, 175–191. [DOI] [PubMed] [Google Scholar]
  20. Hsieh JC, Lee L, Zhang L, Wefer S, Brown K, DeRossi C, Wines ME, Rosenquist T, and Holdener BC (2003). Mesd encodes an LRP5/6 chaperone essential for specification of mouse embryonic polarity. Cell 112, 355–367. [DOI] [PubMed] [Google Scholar]
  21. Huelsken J, Vogel R, Brinkmann V, Erdmann B, Birchmeier C, and Birchmeier W (2000). Requirement for β-catenin in anterior-posterior axis formation in mice. J. Cell Biol. 148, 567–578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Jho EH, Zhang T, Domon C, Joo CK, Freund JN, and Costantini F (2002).Wnt/β-catenin/Tcf signaling induces the transcription of Axin2, a negative regulator of the signaling pathway. Mol. Cell. Biol. 22, 1172–1183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kawamura N, Sun-Wada G-H, Aoyama M, Harada A, Takasuga S, Sasaki T, and Wada Y (2012). Delivery of endosomes to lysosomes via microautophagy in the visceral endoderm of mouse embryos. Nat. Commun. 3, 1071. [DOI] [PubMed] [Google Scholar]
  24. Kemp C, Willems E, Abdo S, Lambiv L, and Leyns L (2005). Expression of all Wnt genes and their secreted antagonists during mouse blastocyst and postimplantation development. Dev. Dyn. 233, 1064–1075. [DOI] [PubMed] [Google Scholar]
  25. Kimura C, Shen MM, Takeda N, Aizawa S, and Matsuo I (2001). Complementary functions of Otx2 and Cripto in initial patterning of mouse epiblast. Dev. Biol. 235, 12–32. [DOI] [PubMed] [Google Scholar]
  26. Kimura-Yoshida C, Nakano H, Okamura D, Nakao K, Yonemura S, Belo JA,Aizawa S, Matsui Y, and Matsuo I (2005). Canonical Wnt signaling and its antagonist regulate anterior-posterior axis polarization by guiding cell migration in mouse visceral endoderm. Dev. Cell 9, 639–650. [DOI] [PubMed] [Google Scholar]
  27. Kwon GS, and Hadjantonakis AK (2009). Transthyretin mouse transgenes direct RFP expression or Cre-mediated recombination throughout the visceral endoderm. Genesis 47, 447–455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lewis SL, Khoo PL, De Young RA, Steiner K, Wilcock C, Mukhopadhyay M, Westphal H, Jamieson RV, Robb L, and Tam PP (2008). Dkk1 and Wnt3 interact to control head morphogenesis in the mouse. Development 135, 1791–1801. [DOI] [PubMed] [Google Scholar]
  29. Lickert H, Kutsch S, Kanzler B, Tamai Y, Taketo MM, and Kemler R (2002). Formation of multiple hearts in mice following deletion of β-catenin in the embryonic endoderm. Dev. Cell 3, 171–181. [DOI] [PubMed] [Google Scholar]
  30. Liu P, Wakamiya M, Shea MJ, Albrecht U, Behringer RR, and Bradley A (1999). Requirement for Wnt3 in vertebrate axis formation. Nat. Genet. 22, 361–365. [DOI] [PubMed] [Google Scholar]
  31. Lustig B, Jerchow B, Sachs M, Weiler S, Pietsch T, Karsten U, van de Wetering M, Clevers H, Schlag PM, Birchmeier W, and Behrens J (2002). Negative feedback loop of Wnt signaling through upregulation of conductin/axin2 in colorectal and liver tumors. Mol. Cell. Biol. 22, 1184–1193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Mao B, Wu W, Davidson G, Marhold J, Li M, Mechler BM, Delius H, Hoppe D, Stannek P, Walter C, et al. (2002). Kremen proteins are Dickkopf receptors that regulate Wnt/β-catenin signalling. Nature 417, 664–667. [DOI] [PubMed] [Google Scholar]
  33. Miaczynska M, Pelkmans L, and Zerial M (2004). Not just a sink: endosomes in control of signal transduction. Curr. Opin. Cell Biol. 16, 400–406. [DOI] [PubMed] [Google Scholar]
  34. Minowada G, Jarvis LA, Chi CL, Neubüser A, Sun X, Hacohen N, Krasnow MA, and Martin GR (1999). Vertebrate Sprouty genesare induced by FGF signaling and can cause chondrodysplasia when overexpressed. Development 126, 4465–4475. [DOI] [PubMed] [Google Scholar]
  35. Morkel M, Huelsken J, Wakamiya M, Ding J, van de Wetering M, Clevers H, Taketo MM, Behringer RR, Shen MM, and Birchmeier W (2003). β-catenin regulates Cripto- and Wnt3-dependent gene expression programs in mouse axis and mesoderm formation. Development 130, 6283–6294. [DOI] [PubMed] [Google Scholar]
  36. Muñoz-Descalzo S, Hadjantonakis AK, and Arias AM (2015). Wnt/β-catenin signalling and the dynamics of fate decisions in early mouse embryos and embryonic stem (ES) cells. Semin. Cell Dev. Biol. 47-48, 101–109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Nakamura N, Sun-Wada GH, Yamamoto A, Wada Y, and Futai M (2001). Association of mouse sorting Nexin 1 with early endosomes. J. Biochem 130, 765–771. [DOI] [PubMed] [Google Scholar]
  38. Niida A, Hiroko T, Kasai M, Furukawa Y, Nakamura Y, Suzuki Y, Sugano S, and Akiyama T (2004). DKK1, a negative regulator of Wnt signaling, is a target of the β-catenin/TCF pathway. Oncogene 23, 8520–8526. [DOI] [PubMed] [Google Scholar]
  39. Perea-Gomez A, Vella FD, Shawlot W, Oulad-Abdelghani M, Chazaud C, Meno C, Pfister V, Chen L, Robertson E, Hamada H, et al. (2002). Nodal antagonists in the anterior visceral endoderm prevent the formation of multiple primitive streaks. Dev. Cell 3, 745–756. [DOI] [PubMed] [Google Scholar]
  40. Perea-Gomez A, Cases O, Lelièvre V, Pulina MV, Collignon J, Hadjantonakis AK, and Kozyraki R (2019). Loss of Cubilin, the intrinsic factor-vitamin B12 receptor, impairs visceral endoderm endocytosis and endodermal patterning in the mouse. Sci. Rep. 9, 10168. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Ploper D, Taelman VF, Robert L, Perez BS, Titz B, Chen HW, Graeber TG, von Euw E, Ribas A, and De Robertis EM (2015). MITF drives endolysosomal biogenesis and potentiates Wnt signaling in melanoma cells. Proc. Natl. Acad. Sci. USA 112, E420–E429. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Poteryaev D, Datta S, Ackema K, Zerial M, and Spang A (2010). Identification of the switch in early-to-late endosome transition. Cell 141, 497–508. [DOI] [PubMed] [Google Scholar]
  43. Radice GL, Rayburn H, Matsunami H, Knudsen KA, Takeichi M, and Hynes RO (1997). Developmental defects in mouse embryos lacking N-cadherin. Dev. Biol. 181, 64–78. [DOI] [PubMed] [Google Scholar]
  44. Rosner MH, Vigano MA, Ozato K,Timmons PM, Poirier F, Rigby PW, and Staudt LM (1990). A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature 345, 686–692. [DOI] [PubMed] [Google Scholar]
  45. Rossant J, and Tam PP (2009). Blastocyst lineage formation, early embryonic asymmetries and axis patterning in the mouse. Development 136, 701–713. [DOI] [PubMed] [Google Scholar]
  46. Sakane H, Yamamoto H, and Kikuchi A (2010). LRP6 is internalized by Dkk1 to suppress its phosphorylation in the lipid raft and is recycled for reuse. J. Cell Sci. 123, 360–368. [DOI] [PubMed] [Google Scholar]
  47. Shafaq-Zadah M, Gomes-Santos CS, Bardin S, Maiuri P, Maurin M, Iranzo J, Gautreau A, Lamaze C, Caswell P, Goud B, and Johannes L (2016). Persistent cell migration and adhesion rely on retrograde transport of β(1) integrin. Nat. Cell Biol. 18, 54–64. [DOI] [PubMed] [Google Scholar]
  48. Shim JH, Xiao C, Hayden MS, Lee KY, Trombetta ES, Pypaert M, Nara A, Yoshimori T, Wilm B, Erdjument-Bromage H, et al. (2006). CHMP5 is essential for late endosome function and down-regulation of receptor signaling during mouse embryogenesis. J. Cell Biol. 172, 1045–1056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Smith DE, Franco del Amo F, and Gridley T (1992). Isolation of Sna, a mouse gene homologous to the Drosophila genes snail and escargot: its expression pattern suggests multiple roles during postimplantation development. Development 116, 1033–1039. [DOI] [PubMed] [Google Scholar]
  50. Spang A (2016). Membrane tethering complexes in the endosomal system. Front. Cell Dev. Biol. 4, 35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Strope S, Rivi R, Metzger T, Manova K, and Lacy E (2004). Mouse amnionless, which is required for primitive streak assembly, mediates cell-surface localization and endocytic function of cubilin on visceral endoderm and kidney proximal tubules. Development 131, 4787–4795. [DOI] [PubMed] [Google Scholar]
  52. Sun X, Meyers EN, Lewandoski M, and Martin GR (1999). Targeted disruption of Fgf8 causes failure of cell migration in the gastrulating mouse embryo. Genes Dev. 13, 1834–1846. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Sun-Wada G, Murata Y, Yamamoto A, Kanazawa H, Wada Y, and Futai M (2000). Acidic endomembrane organelles are required for mouse postimplantation development. Dev. Biol. 228, 315–325. [DOI] [PubMed] [Google Scholar]
  54. Sun-Wada GH, Toyomura T, Murata Y, Yamamoto A, Futai M, and Wada Y (2006). The a3 isoform of V-ATPase regulates insulin secretion from pancreatic β-cells. J. Cell Sci. 119, 4531–4540. [DOI] [PubMed] [Google Scholar]
  55. Taelman VF, Dobrowolski R, Plouhinec JL, Fuentealba LC, Vorwald PP, Gumper I, Sabatini DD, and De Robertis EM (2010). Wnt signaling requires sequestration of glycogen synthase kinase 3 inside multivesicular endosomes. Cell 143, 1136–1148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Takaoka K, and Hamada H (2012). Cell fate decisions and axis determination in the early mouse embryo. Development 139, 3–14. [DOI] [PubMed] [Google Scholar]
  57. Takaoka K, Yamamoto M, Shiratori H, Meno C, Rossant J, Saijoh Y, and Hamada H (2006). The mouse embryo autonomously acquires anterior-posterior polarity at implantation. Dev. Cell 10, 451–459. [DOI] [PubMed] [Google Scholar]
  58. Takaoka K,Yamamoto M, and Hamada H (2007). Origin of body axes in the mouse embryo. Curr. Opin. Genet. Dev. 17, 344–350. [DOI] [PubMed] [Google Scholar]
  59. Takasuga S, Horie Y, Sasaki J, Sun-Wada GH, Kawamura N, Iizuka R, Mizuno K, Eguchi S, Kofuji S, Kimura H, et al. (2013). Critical roles of type III phosphatidylinositol phosphate kinase in murine embryonic visceral endoderm and adult intestine. Proc. Natl. Acad. Sci. USA 110, 1726–1731. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Tam PP, and Loebel DA (2007). Gene function in mouse embryogenesis: get set for gastrulation. Nat. Rev. Genet. 8, 368–381. [DOI] [PubMed] [Google Scholar]
  61. ten Berge D, Koole W, Fuerer C, Fish M, Eroglu E, and Nusse R (2008). Wnt signaling mediates self-organization and axis formation in embryoid bodies. Cell Stem Cell 3, 508–518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Wada Y (2013). Vacuoles in mammals: a subcellular structure indispensable for early embryogenesis. Bioarchitecture 3, 13–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Wada Y, and Sun-Wada G-H (2013). Positive and negative regulation of developmental signaling by the endocytic pathway. Curr. Opin. Genet. Dev. 23, 391–398. [DOI] [PubMed] [Google Scholar]
  64. Wada Y, Sun-Wada GH, and Kawamura N (2013). Microautophagy in the visceral endoderm is essential for mouse early development. Autophagy 9, 252–254. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Wada Y, Sun-Wada GH, Kawamura N, and Yasukawa J (2016). Membrane dynamics in mammalian embryogenesis: implication in signal regulation. Birth Defects Res. C Embryo Today 108, 33–44. [DOI] [PubMed] [Google Scholar]
  66. Willnow TE, Christ A, and Hammes A (2012). Endocytic receptor-mediated control of morphogen signaling. Development 139, 4311–4319. [DOI] [PubMed] [Google Scholar]
  67. Yamaguchi TP, Dumont DJ, Conlon RA, Breitman ML, and Rossant J (1993). flk-1, an fit-related receptortyrosine kinase is an early marker for endothelial cell precursors. Development 118, 489–498. [DOI] [PubMed] [Google Scholar]
  68. Yamaguchi TP, Harpal K, Henkemeyer M, and Rossant J (1994). fgfr-1 is required for embryonic growth and mesodermal patterning during mouse gastrulation. Genes Dev. 8, 3032–3044. [DOI] [PubMed] [Google Scholar]
  69. Yamamoto M, Meno C, Sakai Y, Shiratori H, Mochida K, Ikawa Y, Saijoh Y, and Hamada H (2001). The transcription factor FoxH1 (FAST) mediates Nodal signaling during anterior-posterior patterning and node formation in the mouse. Genes Dev. 15, 1242–1256. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Yamamoto M, Saijoh Y, Perea-Gomez A, Shawlot W, Behringer RR, Ang SL, Hamada H, and Meno C (2004). Nodal antagonists regulate formation of the anteroposterior axis of the mouse embryo. Nature 428,387–392. [DOI] [PubMed] [Google Scholar]
  71. Yamamoto H, Sakane H, Yamamoto H, Michiue T, and Kikuchi A (2008). Wnt3a and Dkk1 regulate distinct internalization pathways of LRP6 to tune the activation of β-catenin signaling. Dev. Cell 15, 37–48. [DOI] [PubMed] [Google Scholar]
  72. Zheng B, Tang T, Tang N, Kudlicka K, Ohtsubo K, Ma P, Marth JD, Farquhar MG, and Lehtonen E (2006). Essential role of RGS-PX1/sorting nexin 13 in mouse development and regulation of endocytosis dynamics. Proc. Natl. Acad. Sci. USA 103, 16776–16781. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Video 2
Download video file (571.8KB, mp4)
Video 3
Download video file (890.1KB, mp4)
Video 1
Download video file (874.8KB, mp4)
Video 4
Download video file (1.3MB, mp4)
Video 7
Download video file (1.5MB, mp4)
Video 5
Download video file (4.2MB, mp4)
Video 8
Download video file (1.8MB, mp4)
Video 6
Download video file (7.6MB, mp4)
1
NIHMS1703082-supplement-1.pdf (11.5MB, pdf)

Data Availability Statement

The published article includes all data generated during the study and the raw data is available on request from the Lead Contact. No code was developed for this study.

RESOURCES