Molecular detection of E. coli and Vibrio cholerae in ballast water of commercial ships: a primary study along the Persian Gulf

Abstract

Purpose

Ballast water is one of the most important ways for the transfer of aquatic organisms such as Escherichia coli (E. coli) and Vibrio cholerae. The aim of this study was to investigate Mdh gene of E. coli and the OmpW gene of Vibrio cholerae bacteria by PCR technique in the ballast water of commercial ships entering Bushehr port along the Persian Gulf.

Methods

In this study, 34 samples of ballast water entered Bushehr port were studied by using culture and PCR methods to determine Mdh gene of E. coli and OmpW gene of Vibrio cholerae. Genomic DNA of bacterial strains was extracted and PCR was performed by using specific primers of E. coli and Vibrio cholerae.

Results

The specific Mdh gene of E. coli was detected in 4 ballast water samples and the positive samples were analyzed by antisera methods for E. coli O157:H7. Results of antisera showed that there were 3 positive samples of O157:H7 serotype. The results of the PCR technique showed that the OmpW gene of Vibrio cholerae was negative for all positive culture samples.

Conclusions

Further studies are highly recommended to monitor other aquatic organisms in ballast water to protect the marine environment.

Introduction

The international maritime industry transports approximately 80–90 % of the world’s commodities [1]. One of the inadvertent subsequences of this trade is the transport and delivery of organisms and chemical such as heavy metals from one location to another via ballast water [2, 3], which is carried by vessels to control draft, stability, and trim [4]. Recently, the amount of ballast water discharged into oceans and coastal waters has increased around the world [5]. So the transmission of pollutants and microorganisms through ballast water has recently been known as a global concern [6, 7]. Recent studies have reported a high bacterial diversity in ballast water [8–12]. For example, Ng et al., (2015) found the indicator organisms E. coli, Enterococcus and P. aeruginosa in the ballast water samples tested [13]. In another study, Burkholder et al. (2007) reported the presence of some pathogens including Phytoplanktons, L. monocytogenes, E. coli, Mycobacterium spp., P. aeruginosa and Vibrio cholerae in 48 % of ballast waters surveyed from vessels in the east and west coast of the United States [14]. Altug et al. (2012) also, detected the heterotrophic aerobic bacteria (HPC) and Salmonella spp. in ballast water samples from different regions [15]. The most important effects of pathogens such as the E. coli and Vibrio cholerae that may transmit by ballast water are altering the environment, economic losses, and health effects on humans [16, 17]. E. coli is a member of gastrointestinal tract microflora in humans and other animals. Certain serovars of this bacterium are potentially pathogenic and may cause different diseases [18]. Among the E. coli strains that cause diarrhea, Shiga-toxin producing E. coli (STEC) strains including O157:H7 serotype are important because of the ability to cause severe illnesses in humans [19].

Vibrio cholerae is an important enteric disease, which causes watery diarrhea that can result in rapid dehydration and death of infected persons [20]. Over 200 serogroups of Vibrio cholerae have been recognized so far, and among them, serotypes O1 and O139 are the causes of epidemics and pandemic, and these strains are important in the viewpoint of public health [21]. However, diarrhea in humans was caused by Vibrio cholerae O1 and O139 serogroups through the ingestion of improperly cooked seafood or exposure to a contaminated aquatic environment [22–25]. So, seawater is a major source of Vibrio cholerae and cholerae is generally transmitted to humans [26–28]. For example, there is strong evidence that ballast water has imported pandemic strains of both Vibrio cholerae and Vibrio parahaemolyticus into novel coastal regions [27, 29]. Several studies showed that ballast water caused the 1991 cholerae epidemic in South America, which terminated in over 1,000,000 cases of cholerae and 10,000 deaths [30, 31].

In Bushehr port, approximately 3 million tons types of goods are exported or imported by ships each year. So annually, a large volume of ballast water is discharged to the shores of Bushehr port, which may damage to coastal environments. To the best of our knowledge, there is no study on the survey of E .coli O157: H7 in ballast water so far. However, there are a few studies on the survey of Vibrio cholerae in ballast water worldwide, but has not been well studied yet in the Persian Gulf and no study has been done in the northern part of the Persian Gulf. So, the aim of the present study was to investigate E. coli O157:H7 and the OmpW gene of Vibrio cholerae bacteria by PCR technique in the commercial ships entering Bushehr port along the northern part of the Persian Gulf.

Materials and methods

Ballast water samples were collected from 34 commercial ships entered the Bushehr port from different ports around the world (Fig. 1). Each sample was taken directly from the manhole of each tank, at a depth of 4 m. Samples were placed in an icebox at 4 °C and transported to the laboratory within 2 h.

Fig. 1.

Locations of all ports that their commercial ships entered Bushehr port

For bacteria isolation, 10 liters of water samples were filtered through 0.42 µm membranes. Membranes were washed with 2 ml of alkaline peptone water (pH: 8.6), and subsequently incubated for 6–8 h at 37 °C. In the case of Vibrio cholerae, 0.2 ml of broth was streaked onto selective bacteriological media (TCBS agar, Merck, Germany) and incubated for 18 h at 37 °C. Then, oxidase test was carried out on all plates and positive samples for oxidase test were examined with PCR method by using specific primers. Oligonucleotide primers specific for the Mdh genes of E. coli and OmpW gene of Vibrio cholerae are shown in Table 1. The reason for choosing these genes in this study was that according to nucleotide BLAST on NCBI, Mdh is a general gene for the detection of all E. coli strains, and V. cholerae O1 and O139 serogroups are positive for OmpW genes. E. coli ATCC 25,922 and Vibrio cholerae ATCC 14,035 were used as quality control organisms in antimicrobial susceptibility determination.

Table 1.

Oligonucleotide primers specific for the OmpW gene of Vibrio cholerae and Mdh genes of E. coli

Bacteria	Primer ID	Primer sequence	PCR product (bp)	Annealing Temperature	References
Vibrio cholerae	ompW-F	CACCAAGAAGGTGACTTTATTGTG	588 bp	60 °C	[33, 34]
	ompW-R	GAACTTATAACCACCCGCG
E. coli	Mdh-F	AGGCGCTTGCACTACTGTTA	835 bp	56 °C	[35]
	Mdh-R	AGCGCGTTCTGTTCAAATG

For E. coli isolation, 0.2 ml of broth were streaked on EMB agar plates (Merck, Germany) and incubated for 18 h at 37 °C. Then, gram-negative bacteria were isolated from EMB agar and determined at the species level by cytochrome oxidase, TSI agar, urea and indole tests as putatively E. coli [35].

Three specific colonies of each plate were cultured in LB broth and incubated at 37 °C overnight. The cell suspension was transferred to a 1.5 ml microfuge tube and was centrifuged at10,000 rpm and 25 °C for 5 min. Then, the supernatant was discarded and 1 ml of sterile distilled water was added and vortexed. The cell suspension was then centrifuged (at 10,000 rpm and 25 °C for 5 min), the supernatant was discarded and again 0.2 ml of sterile distilled water was added. After vortex, the cell suspension was incubated in waterbath (at 95 °C for 10 min). The tube was plunged into ice and kept for 10 min and after centrifuge at10,000 rpm, the supernatant was transferred to a new tube. The supernatant contained genomic DNA was used as a template for OmpW gene detection in Vibrio cholerae and Mdh gene detection in E. coli [32, 33].

The PCR reactions were performed in a total volume of 25 µl including, 2 µl template DNA, 2.5 µl 10 x PCR buffer with 15 mM MgCl₂, 0.5 µl dNTP, 10 pmoles of each specific primers and 1 unit of Taq DNA polymerase. The PCR amplification was performed with an initial denaturation of 5 min at 95 °C followed by 35 cycles of 30 s denaturation at 95 °C, annealing temperature for 30 s and extension for 1 min at 72 °C with a final extension of 5 min at 72 °C [32, 34, 36].

PCR products were separated by electrophoresis in 2 % agarose gel (Sigma-Aldrich) in 1x TBE. Five µl PCR products were loaded into sample wells and a voltage value of 100 volts was used for 1 h. Then the gel was visualized under UV transilluminator (590 nm) and finally, E. coli strains were analyzed by antisera methods. The strains were serotyped using O and H standard antisera. The agglutination test with specific antiserum for E. coli O157:H7 (Difco, USA) was used [37].

Results and discussion

Results of microbial examination of ballast water samples from different ports around the world are shown in Table 2. The bacterial culture test results showed that 19 (55.88 %) and 14 (41.17 %) of 34 ballast water samples were positive for the presence of E. coli and Vibrio cholerae respectively (Table 2). The results of the PCR technique showed that from 19 positive E. coli samples (culture test), 4 samples (21.05 %) were positive in the case of Mdh gene target (Fig. 2a, b, c). Then the positive samples (4 samples) were analyzed for O157:H7 serotype by antisera method. The results showed that 3 samples were positive. The positive samples were from Duqm–Oman, Kuwait–Kuwait and Manila–Philippines ports. The results of the PCR technique also showed that the specific OmpW gene target of Vbrio cholerae, was negative for all 14 positive samples (culture test) of ballast water (Fig. 2d).

Table 2.

Results of microbial examination of ballast water samples from different ports around the world (n = 34)

Location of harvesting ballast water	E. coli (culture and gram-staining)	Mdh genes	E. coli O157: H7	Vibrio cholerae (culture and oxidase test)	OmpW gene
Dammam - Saudi Arabia	-	-	-	+	-
Davao – Philippines	+	-	-	+	-
Phuket – Thailand	-	-	-	-	-
Duqm – Oman	+	+	+	-	-
Jawaharlal Nehru Port – India	-	-	-	+	-
Kuwait – Kuwait	+	+	+	+	-
Jebel ali-Emirate	-	-	-	-	-
Mumbai – India	-	-	-	-	-
Shuhaikh – Kuwait	+	-	-	+	-
hamriyah – Emirate	+	-	-	-	-
Kandla port – India	-	-	-	-	-
Ajman port – Emirate	+	-	-	-	-
Mina rashid – Emirate	+	-	-	+	-
Singapore – Singapore	-	-	-	+	-
Port said – Egypt	+	-	-	-	-
Antwerp- Belgium	+	-	-	-	-
Muscat- Oman	+	+	-	+	-
Portsmouth - U.K	-	-	-	+	-
Basra – Iraq	-	-	-	-	-
Aden – Yemen	+	-	-	-	-
Suez – Egypt	-	-	-	-	-
Navlakhi – India	+	-	-	+	-
Bangkonk – Thailand	-	-	-	-	-
Sohar – Oman	-	-	-	+	-
Shanghai – Chain	+	-	-	-	-
Salalah – Oman	+	-	-	+
Laem chabang – Thailand	+	-	-	-	-
Hong kong – Chain	+	-	-	-	-
Busan – Korea	-	-	-	+	-
Shenzhen – Chain	+	-	-	-	-
Kaohsiung – Taiwan	-	-	-	-	-
Manila – Philippines	+	+	+	+	-
Jeddah - Saudi Arabia	+	-	-	-	-
Nagoya – Japan	-	-	-	-	-
Positive number	19	4	3	14	0

Fig. 2.

a, b, c View of E. coli specific PCR product on agarose gel. M: DNA ladder; -: Negative control; +: Positive control; 3, 6, 9 and 16 lines: E. coli. d View of Vibrio cholerae specific PCR product on agarose gel

Conventional culture methods for the detection of E. coli and Vibrio cholerae are time-consuming, requiring several days to acquire confirmatory results [37, 38]. Rapid detection and the identification of pathogens are essential from a public health viewpoint. Therefore, in the last years, a considerable number of detection methods using faster molecular tools, mainly based on PCR techniques, have been proposed [39, 40]. The PCR technique is a rapid procedure with both high sensitivity and specificity for the immediate detection and identification of specific pathogenic bacteria from different samples [41, 42]. Therefore, PCR method can be used directly and without initial tests such as microbial culture test to examine different samples.

Different studies as shown in Table 3, have been done in the field of microorganism transmission and aquatic species by ballast water. In Fykse et al. study, Vibrio cholerae was one of the most important pathogens in the ballast water of vessels, which were identified by using PCR method with other target organisms [26]. Rivera et al. also isolated Vibrio cholerae in 9.5 % of ballast water samples [27]. Similar to our findings, Ng et al. (2015) not detected Vibrio cholerae in ballast water samples. Similarly, samples of ballast water have low occurrence of indicator bacteria such as Enterococci and E. coli [10, 12, 13, 43].

Table 3.

Various studies in the field of microorganism or aquatic species transmission by ballast water

Receiving Port	Ballast water origin	Type of study microorganism or aquatic species	References
Gulf of Mexico (Mexico)	30 ports from USA	S. marcescens, P. corallycticum, Sphingomonas WP type II, Begiatoaspp. and Desulfovibrio spp.	[44]
Santana (Brazil)	Santana	E. coli, Total coliforms	[45]
USA	9 ports on the U.S West Coast and 4 ports on the U.S. East Coast	Phytoplanktons, L. monocytogenes, E. coli,Mycobacterium spp., P. aeruginosa, Vibrio cholerae.	[14]
New Westminster, Inchon (Japan)	New Westminster, British Columbia, Inchon	Bacterial abundance	[46]
Houston, Texas (USA)	Malabo, Africa and Port of New Orleans, Louisiana	Eukaryotic diversity	[47]
Vladivostok (Russia)	different ports from China and Japan	Enterococci, L monocytogenes, Aeromonas spp., P. rettgeri, Salmonella spp., E. coli, and other representatives of Enterobacteri aceae, Mycobacterium spp., C. perfingens, P. aeruginosa, P. putrefaciens,V. algynolyticus, Vibrio cholerae, and Vibrio spp.	[48]
Bushehr port	34 ports all of the world	Total coliform, Fecal coliform, HPC, P. aeruginosa	[6]

It was reported that Vibrio cholerae strains have similar morphological characteristics with other species of Vibrio genus and Aeromonas species. Aeromonas species are oxidase-positive similar to Vibrio genus and is not recognizable from Vibrio genus by common laboratory diagnostic methods [49, 50].

So the positive oxidase samples in this study that PCR technique was applied to them and they were negative, this may be related to other species of Vibrio, such as V. alginolyticus or Aeromonas species. Therefore, the results demonstrated the higher efficiency and accuracy of PCR method as compared to conventional culture methods, and this method can reduce the time and cost required for the specific diagnosis.

According to International Maritime Organization (IMO) guideline, all ships should discharge and re-watering their ballast water tanks in open waters before entering the destination port and coastal areas to prevent the transmission of pathogenic species and damage the marine environment. IMO has also suggested the regulation to limit the concentrations of living organisms that may be discharged by ballast water. In this regulation harmful or indicator microorganisms such as Enterococcus, E. coli and Vibrio cholerae serotypes O1 and O139 should be < 100 cfu/100 ml, < 250 cfu/100 ml and < 1 cfu/100 ml respectively [51].

The results of this study indicated that measured indicator microorganisms including Vibrio cholerae serotypes O1 and O139 were lower in the ballast water samples compared with the levels of Vibrio cholerae serotypes O1 and O139 discharge into coastal waters of IMO guidelines. Regulation and enforcement of the national and international laws for ballast water discharge are necessary to care for the health of aquatic species and the sanitary of receiver port waters.

Although there are international guidelines such as treatment of ballast water or discharge and re-watering in open waters to control the problem of invasive species transferences but these strategies and regulations have been ignored and not implemented as international law for all ships. Due to the importance of organisms transfer from one place to another by ballast water, management of ballast water, especially in the third world countries, is suggested to minimize the emissions risk of these organisms.

Conclusions

Our results showed that four ballast water samples were positive in the case of Mdh gene target and three samples were positive for E. coli O157:H7 serotype, but OmpW gene target of Vibrio cholerae, were negative for all positive samples (culture test) of ballast water. This study provides the first study of the E. coli O157:H7 detection in the ballast waters and can be useful as a database for further studies. Also, the results of this study confirmed that PCR assays could be an alternative to the current conventional culture methods and this method would help provide quick and accurate analysis for human pathogens in different samples including water and food, which has many advantages in terms of detection time, labor, and sensitivity. Therefore, it is suggested to more application PCR technique in future studies and samples can be examined directly by this method without using conventional culture methods. Also, such studies can provide more information on the biological profile of ballast water that may be useful and practical in the performance of ballast water management strategies and assessment of their environmental effects on coastal regions of the world’s oceans and seas. Therefore, further studies in this field and environmental impact assessment of long-term ballast water discharges are highly suggested.

Declarations

Conflict of interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.