Evaluation of laser induced sarcomere micro-damage: Role of damage extent and location in cardiomyocytes

Dominik Müller; Thorben Klamt; Lara Gentemann; Alexander Heisterkamp; Stefan Michael Klaus Kalies

doi:10.1371/journal.pone.0252346

. 2021 Jun 4;16(6):e0252346. doi: 10.1371/journal.pone.0252346

Evaluation of laser induced sarcomere micro-damage: Role of damage extent and location in cardiomyocytes

Dominik Müller ^1,^2,^3,^*, Thorben Klamt ^1,³, Lara Gentemann ^1,³, Alexander Heisterkamp ^1,^2,³, Stefan Michael Klaus Kalies ^1,^2,³

Editor: Xiaolei Xu⁴

PMCID: PMC8177425 PMID: 34086732

Abstract

Whereas it is evident that a well aligned and regular sarcomeric structure in cardiomyocytes is vital for heart function, considerably less is known about the contribution of individual elements to the mechanics of the entire cell. For instance, it is unclear whether altered Z-disc elements are the reason or the outcome of related cardiomyopathies. Therefore, it is crucial to gain more insight into this cellular organization. This study utilizes femtosecond laser-based nanosurgery to better understand sarcomeres and their repair upon damage. We investigated the influence of the extent and the location of the Z-disc damage. A single, three, five or ten Z-disc ablations were performed in neonatal rat cardiomyocytes. We employed image-based analysis using a self-written software together with different already published algorithms. We observed that cardiomyocyte survival associated with the damage extent, but not with the cell area or the total number of Z-discs per cell. The cell survival is independent of the damage position and can be compensated. However, the sarcomere alignment/orientation is changing over time after ablation. The contraction time is also independent of the extent of damage for the tested parameters. Additionally, we observed shortening rates between 6–7% of the initial sarcomere length in laser treated cardiomyocytes. This rate is an important indicator for force generation in myocytes. In conclusion, femtosecond laser-based nanosurgery together with image-based sarcomere tracking is a powerful tool to better understand the Z-disc complex and its force propagation function and role in cellular mechanisms.

Introduction

A high degree of cellular cytoskeletal organization is needed to perform work and generate force in the contractile cells of the heart, the cardiomyocytes (CMs). An impairment of this specific structure-function relationship has been associated with cardiac dysfunction and heart failure [1, 2]. As a popular example, mutation-induced misalignment of sarcomeric integrity was found in the heterogeneous group of cardiomyopathies [3].

In 2015, 2.5 million people suffered from cardiomyopathy and myocarditis repercussions [4]. Over the years, the lateral borders (Z-discs) of sarcomeres, the smallest contractile units in CMs, were discovered as critical areas for cardiomyopathy-causing mutations [5]. The multi-protein Z-disc complex is crucial for lateral and longitudinal force transmission [6] and simultaneously acts as a signaling hub to regulate cellular functions [7, 8]. Hence, it has become evident, that knowledge of the fundamental cytoarchitecture and mechanical properties of CMs are prerequisites to explain the causes and consequences of cardiomyopathies [9]. Only a complete understanding of the contractile apparatus and the events occurring at the sarcomere level will improve our knowledge of the whole heart in healthy and diseased conditions.

In former studies, we established a femtosecond (fs) laser-based system to manipulate CMs with sub-micrometer precision, by introducing spatially confined micro-damage to the cells [10–12]. Pulsed laser beams in the fs regime allow a precise, non-invasive ablation of cellular elements without any out off-focus interactions with the tissue [13]. The ablation of structures is achieved by focusing the fs laser beam with a high numerical aperture into the sample to generate a low-density plasma, which results in free-electron-mediated bond breaking. The laser-mediated thermal and mechanical energy transfer is negligible and does not influence the surrounding tissues [13, 14]. In comparison to chemical treatments or overexpression studies, which alter cellular elements in identical quantities [5, 15], this approach allows us to directly analyze cellular repair kinetics. In our recent study, we observed high cell viability and normal calcium homeostasis after ablation of a single Z-disc per CM. Furthermore, the endogenous repair of the initial sarcomeric pattern was detected in more than 40% of treated CMs within hours.

In this study, based on our initial analysis, we utilized the same laser system to firstly analyze the relationship between the damage extent, representing the number of ablated Z-discs, and cell survival. Secondly, we investigated if the location of the damage is associated with cell viability. We analyzed CMs, which received damage central and peripheral to the cell nucleus. In addition, we accounted for multinucleated cells. We evaluated the viable cells after treatment and compared the distribution of cell area and Z-disc number before and after laser treatment. Additionally, we recorded videos of CMs before and after Z-disc ablations to compare sarcomeric organization and CM contractility at different time points. All data underwent a sophisticated image analysis pipeline: We used a self-written software to access the number of Z-discs, SarcTrack to analyze the contractile behavior, and the scanning gradient Fourier transformation to examine the sarcomeric cytoarchitecture.

Methods

Neonatal rat cardiomyocyte isolation and culture

Rat cardiomyocytes were isolated from postnatal Spraque-Dawley rats (P2-P5) of both sexes as previously described [11]. One million cardiomyocytes were seeded into 35 mm glass bottom dishes (Ibidi, Germany) for imaging and ablation experiments. Glass bottom dishes were plasma treated (High-Frequency Generator BD-20A, ETP, USA) and coated with 0.1% gelatin 2 h beforehand. After incubation at 37°C and 5% CO₂ atmosphere, cells were washed twice with Dulbecco’s phosphate-buffered saline (DPBS, without Ca²⁺, Mg²⁺) the following day and cultured in new medium. CMs were cultured in MEM Eagle medium (PAN Biotech, Germany) supplemented with 5% fetal bovine serum, 100 U/mL penicillin/streptomycin, 0.1 mM bromodeoxyuridine, 1.5 μM vitamin B12, and 1x non-essential amino acids. The medium was exchanged every 2–3 days. CM experiments were performed 8–10 days after isolation. The experiments were in accordance with the German Animal Welfare Legislation (§4, TierSchG) and approved by the local Institutional Animal Care and Research Advisory Committee and permitted by the Lower Saxony State Office for Consumer Protection and Food Safety (reference number 42500/1H).

Cardiomyocyte transfection and transduction

In the first set of experiments, rat CMs were transfected with tdTurboRFP-Alpha-Actinin-19 (Addgene plasmid #58050, a gift from Michael Davidson), to visualize the Z-discs in cells. Therefore, 8 μL of ViaFect™ transfection reagent (Promega, Germany) was diluted in 100 μL Opti-MEM (Gibco, Germany) and mixed with 2 μg tdTurboRFP-Alpha-Actinin-19 in 100 μL Opti-MEM. After incubation at room temperature for 20 min, the ViaFect™:DNA solution was added dropwise to the cells (2 μg DNA per dish). The medium was replaced by new medium the following day and experiments were performed two days after transfection. To simultaneously visualize cardiomyocytes’ nuclei and Z-discs, cardiomyocytes were transduced with lentiviral particles (pLenti CMV Neo DEST mCherry-H2A-10 and pLenti CMV GFP-ACTN2 Puro). The pLenti CMV GFP-ACTN2 Puro was generated and kindly provided by Christopher S. Chen [16]. The pLenti CMV Neo DEST mCherry-H2A-10 plasmid was generated by cloning the mCherry-H2A-10 construct (Addgene plasmid # 55054, a gift from Michael Davidson) into the destination vector pLenti CMV Neo DEST (Addgene plasmid #17392, a gift from Eric Campeau and Paul Kaufman) via Gateway® Cloning Technology (Invitrogen, USA). Viral particles were produced with a 3rd-generation split packaging system in 293T cells (DSMZ, Germany) using calcium phosphate transfection as previously described [17]. After 48 and 72 hours, the viral supernatant was collected, concentrated by centrifugation at 100 000 g for 2 h at 4°C and resuspended in DPBS. Lentiviral titers were determined by primers targeting the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE-For: AGCTATGTGGATACGCTGCTTTA and WPRE-Rev: AGAGACAGCAACCAGGATTTATAC) using the Luna^® Universal One-Step RT-qPCR Kit (NEB, Germany). We reproducibly obtained up to 1.05 x 10⁸ infectious units (IU) per mL for pLenti CMV GFP-ACTN2 Puro and 1.07 x 10⁸ IU/mL for pLenti CMV Neo DEST mCherry-H2A-10. Cardiomyocytes were transduced with a multiplicity of infection (MOI) of one overnight and the medium was exchanged the following morning. Z-disc ablation experiments were performed 48 hours post-infection.

Laser setup, cell imaging and manipulation

A Ti:Sapphire laser system with a pulse length of 140 fs and a repetition rate of 80 MHz was used for multiphoton imaging and Z-disc ablation [11]. The custom-build setup was further equipped with a High-Power LED (SOLIS-3C, Thorlabs, USA) and a CCD camera (ProgRes® MF^cool, Jenoptik, Germany) to allow epi-illumination and recording of CMs using fluorescence microscopy. This allowed higher imaging speed compared to multiphoton microscopy. Before each experiment, the laser power entering the microscope was adjusted to guarantee equal experimental settings. Fluorescent Z-discs expressing cardiomyocytes were randomly selected with a motorized stage (Prior Scientific, Cambridge, UK) and positions were saved. Multiphoton imaging of tdTurboRFP-Alpha-Actinin-19 or mCherry-H2A-10 was performed at an excitation wavelength of 730 nm. The fluorescence was detected via a photomultiplier tube (Hamamatsu Photonics, Japan) and an emission filter at 607 ± 18 nm. GFP-actinin expressing CMs were imaged with an excitation wavelength of 870 nm and detected with an emission filter at 510–560 nm. Image acquisition with the CCD camera was performed with a dsRed filter cube for tdTurboRFP-Alpha-Actinin-19 and mCherry-H2A-10. GFP-actinin fluorescence was detected with a GFP filter cube. Before nanosurgery, randomly selected CMs were imaged with the CCD camera and via multiphoton microscopy. For nanosurgery, Z-discs were ablated at a wavelength of 730 nm, a scanning velocity of 100 μm/s, and a laser power of 0.9 nJ as revealed in our recent study. These parameters were validated to result in Z-disc loss via subsequent immunostaining against α-actinin [11]. A minimum of three treated and untreated CMs were recorded per trial. All data were determined from at least three replicates per experiment and condition. All imaging data were analyzed using Fiji [18] and MatLab (MathWorks, Natrick MA, USA, version 2020b).

Ablation of multiple Z-discs

For multiple Z-discs ablations, positions of tdTurboRFP-Alpha-Actinin-19 expressing CMs were saved and different Z-disc numbers (3, 5, or 10) were selected in a neighboring, longitudinal set or randomly diversified over the whole cell and ablated. Images were recorded before, 10 s, 1 h, and 2 h after ablation. Untreated CMs served as control cells. The viability of CMs was assessed 2 h post nanosurgery by adding 2 μM Calcein-AM to the culture medium. In preliminary experiments, we identified this period as sufficient to identify dead cells. To prove this hypothesis, we performed the same experiment as described above and ablated three Z-discs per CM but analyzed the metabolic activity after 24 h. Recorded images were analyzed equally and compared with viability data 2 h post nanosurgery.

After an incubation time of 20 min at 37°C and 5% CO₂ atmosphere, the Calcein fluorescence, which indicates an active cell metabolism, was determined and images were taken with the CCD camera. Non-fluorescent cells were counted as dead cells. Recorded images were further processed to identify if the number of Z-discs is relevant to the damage response. For this purpose, we developed an OpenCV based Python application to quantify the number of Z-discs within the cell area before nanosurgery. In short, Fourier transformation, automated thresholding, and edge-detection based methods were implemented to detect and count the Z-discs (S1 Fig). Furthermore, the visualized cytoskeleton of CMs was encircled with Fiji to calculate the ratio of cell area to Z-discs per cell.

Central or distal Z-disc ablation

In a randomly selected portion of mCherry-H2A-10 and GFP-actinin expressing CMs, a single Z-disc per cell (proximal or distal to the nucleus) was ablated. Untreated CMs served as control cells. Images of the Z-disc pattern were recorded before and every hour after nanosurgery. The distance between the ablated Z-disc and the center of the nearest nucleus was measured using Fiji. The metabolic activity was assessed after 24 h. Non-fluorescent cells were counted as dead cells.

Cell analysis using SarcTrack and Scanning Gradient Fourier Transformation (SGFT)

To identify the impact of multiple Z-discs ablations on the sarcomere shortening, the contraction and relaxation time, and the contraction period, we used a MatLab based software algorithm (SarcTrack) recently published by Toepfer et al. [19]. Video sequences of GFP-actinin expressing CMs were recorded before, 1 min, and 2 h after ablation of different Z-disc numbers (1, 3, or 5) at a frame rate of 4 FPS. Videos were optimized by bleach correction, background subtraction, and enhanced local contrast adjustment using Fiji. The SarcTrack parameters were optimized such that the paired wavelet matching method reliably identified sarcomeres in 92% of all CMs.

Furthermore, images of contracted and relaxed CMs were extracted from the recorded videos to determine sarcomere orientation and alignment before and after Z-disc removal. For this analysis, a MatLab package for the scanning gradient Fourier transform (SGFT) method recently published by Salick et al. was utilized [20].

Data analysis and statistics

All data sets were analyzed and graphically represented using Origin (OriginLab, USA, version OriginPro 2018b) or MatLab. Viability data were expressed as mean + standard deviation (SD) and analyzed with a One-Way ANOVA followed by post-hoc Tukey t-test analysis. The data obtained for the cell areas and Z-disc counts were plotted as Violin plots, excluding outliers. A Kolmogorov-Smirnov test was used to detect statistically significant distributions. The SarcTrack data were depicted as raw data and analyzed with a Two-Way ANOVA considering the point in time and the number of ablated Z-discs. Post-hoc analysis was performed using a Holm-Bonferroni test. The sarcomeric angular distributions, obtained from the SGFT measurements, were either depicted as an angular distribution (single cell at different points in time) or as raw data (all measurements). To test if the angular distribution changed significantly post or 2 h after ablation in relation to the pre-ablation state, a Watson-Williams-test (MatLab circular statistics toolbox [21]) was performed comparing these three datasets for every single cell. Additionally, we aimed to analyze the absolute alignment change for all cells with a Two-Way ANOVA considering the point in time and the number of ablated Z-discs. Post-hoc analysis was performed using a Holm-Bonferroni test.

For all experiments, all cells per dish were randomly selected and at least three independent dishes per experimental condition were used. In all cases, p-values < 0.05 were considered as statistically significant.

Results

Cardiomyocyte viability associates with the extent of Z-disc damage within 2 h after damage

To determine if the extent of Z-disc removal relates with CMs viability, we ablated multiple Z-discs per CM. We compared the metabolic activity with Calcein-AM 2 h after ablation of 3, 5, or 10 Z-discs per cell. Furthermore, the Z-discs were either ablated in a longitudinal set (Fig 1A) or randomly diversified over the cell´s Z-disc pattern (Fig 1B). We detected a significant reduction of CM viability after ablation of 10 Z-discs to 16% for neighboring Z-discs (Fig 1C, p ≤ 0.006) and 9% for randomly selected Z-discs (Fig 1D, p ≤ 0.003) compared to untreated control CMs. Besides, we observed that the ablation of 10 Z-discs leads to cell death within minutes after nanosurgery, independent of the damage pattern (S2 Fig). Ablation of 5 neighboring Z-discs led to a CMs survival of 50%, while a significant viability decrease (p ≤ 0.02) to 31% was detected for randomly ablated Z-discs. A non-significantly decreased viability was observed after ablation of 3 Z-discs.

Fig 1 — Femtosecond laser-based nanosurgery was used to ablate 10, 5, or 3 Z-discs per CM. Neighboring Z-discs were ablated in a longitudinal set (A, C) or randomly selected Z-discs were ablated (B, D) over the cell. A representative turboRFP linked α-actinin expressing rat CM before and directly after the ablation of 3 Z-discs in a set (yellow box) is depicted in (A). A merged image before (red) and after (cyan) random ablation of 3 Z-discs is shown in (B). Scale bars 20 μm. Bar charts represent mean viabilities + standard deviation. Treated CMs were statistically compared with untreated, control CMs (individual determined for each experiment) using a One-Way ANOVA followed by Tukey test (**p < 0.01, and *p < 0.05).

Cell area and total Z-disc count are not critical for CM survival

Due to the strong interconnection of Z-discs in CMs, we hypothesized that smaller CMs are more susceptible to Z-disc ablation, compared to large CMs. To examine this hypothesis, the cell area of all CMs was analyzed before and after the ablation of multiple Z-discs (Fig 2). We did not observe a significant relationship between cell area and CM survival, neither for ablation of Z-discs in a set (p ≥ 0.14) nor for randomly selected Z-discs (p ≥ 0.81) within the cell. We also counted the Z-discs within the cell area and could not detect a significant influence of the Z-disc count (p ≥ 0.09) on the cell survival.

Fig 2 — Violin plots are displayed to visualize the distribution, median (dotted line) and mean (solid line) of CMs in terms of cell area (upper panel) and total Z-disc counts (lower panel) pre (grey) and 2 h post (blue) multiple Z-discs ablations. Each dot represents a single cell. Neighboring Z-discs in a longitudinal set: 10 Z-discs n = 26, 5 Z-discs n = 32, 3 Z-discs 27; Randomly selected Z-discs: 10 Z-discs n = 39, 5 Z-discs n = 29, 3 Z-discs n = 33.

Multiple Z-disc damage induces immediate CM death

In the next series of experiments, we analyzed the time-dependent survival rate of CMs post nanosurgery. 3 Z-discs per CM were either ablated in a longitudinal set or randomly selected over the cell´s Z-disc pattern as described before. The metabolic activity was visualized 2 h or 24 h after Z-disc ablation with Calcein-AM (Fig 3). No statistically significant differences in viability were observed for the ablation of randomly selected Z-discs (p = 0.99) as well as for the ablation of neighboring Z-discs (p = 0.59).

In addition, the cell area and Z-disc number of CMs were analyzed before and after ablation of 3 Z-discs for both points in time (Fig 3). Both, the distribution of cell area and Z-disc count were comparable between pre and post ablation state for both time intervals.

Cardiomyocyte survival is independent of the damage position

To analyze potential differences between peripheral and central micro-damage in CMs, we selectively ablated a single Z-disc per cell at different distances to the nucleus. Cells were double transduced to visualize the nucleus and the Z-disc pattern. Following ablation of a single Z-disc per CM either close to the nucleus or peripheral, the cell metabolism was visualized 24 h after nanosurgery. We observed a viability of treated CMs of 62% (Fig 4A) compared to untreated control CMs (89%). Adjacent cells were unaffected by laser-induced manipulation. Furthermore, the micro-damage distance to the nucleus was not significantly influencing the viability of CMs (p = 0.58, Fig 4B).

We also assessed whether the number of nuclei and the damage distance to the nucleus are related to cell survival (Fig 4C, 4D). In CMs with two nuclei, the distance to the ablated Z-disc was determined to the nearest nucleus. No statistically different viabilities were observed (p ≥ 0.48).

Sarcomere reorientation during contraction

A critical factor for force generation in cardiomyocytes is a homogeneous sarcomere alignment. To analyze the impact of micro-damage to the myofibril integrity, we quantified the level of sarcomere organization by recording videos pre, 1 min, and 2 h post Z-disc ablation. Neighboring Z-discs were ablated and either 1, 3, or 5 ablations were performed. We calculated the direction and orientation of the myofibril network using a scanning gradient Fourier transform (SGFT) method [20]. Thereby, local sarcomere orientations were determined and overall alignment was assessed by weighing the direction values. A representative analysis of a sarcomeric pattern is depicted in Fig 5. The angular distribution was computed from the Z-disc pattern. In addition, the gradient mapping of Z-discs generated a quiver plot of sarcomere directions, and a pattern strength heat map was created to identify regions with repeating patterns. In this example, the overlay of the Z-disc pattern pre (red) and 1 min post-ablation (cyan) clearly indicates the ablation of 5 Z-discs (Fig 5B, yellow arrow). The SGFT analysis did not reveal a significant change in the myofibrillar alignment and orientation between pre and 1 min post-ablation. In contrast, by comparing the pre and the 2 h post nanosurgery patterns, a significant alteration was detected (p = 0.006).

Fig 5 — From a representative Z-disc pattern of a GFP-actinin expressing CM before nanosurgery (A), the angular orientation distribution, the sarcomere direction (quiver plot), and the sarcomere pattern strength were examined. The pattern strength heat map visualized regions with high levels of repeating patterning in yellow/white and less repeating structures in darker red. Following, 5 neighboring Z-discs were ablated (yellow arrow). An overlay of the Z-disc pattern pre (red) and post-ablation (cyan) is shown in (B). The SGFT analysis revealed a non-significant change in the angular distribution (p = 0.45). In contrast, a significant change was found 2 h post-ablation (p = 0.006). Data were statistically compared using a Watson-Williams-test for circular distributions. Scale bar 20 μm.

We also compared the angular distributions of myofibril alignment in the relaxed (Fig 6A) and contracted (Fig 6B) cell state of CMs. Therefore, the percentage of sarcomeres within a range of 20°, as a robust angle for disarray detection, was compared to the post ablation alignment. The data of all groups were not significantly different, neither for all time points nor for the number of ablated Z-discs. However, the statistical comparison between the angular distributions on a single cell level revealed, that even a single Z-disc ablation could lead to a significantly different angular distribution (S1 Video). This was observed for more than 40% of CMs in the relaxed (Fig 6C) and 67% in the contracted cell state (Fig 6D). This percentage further increased at later time points but not necessarily with the number of ablated Z-discs. However, it needs to be considered that the Watson-Williams-test mainly addresses the means of the distribution.

To elucidate the influence of micro-damage on the contractility and sarcomere shortening in CMs, we applied the software package SarcTrack, which was recently developed by Toepfer et al. [19]. Videos of CMs pre and post ablation of Z-discs were processed to track sarcomere displacement, contraction period, relaxation duration, and contraction time. The data demonstrate, that no statistical differences were observed by comparing mean values for contraction time (Fig 7A), contraction period (Fig 7B), and relaxation duration (Fig 7C). The same holds true for the percentage of sarcomere shortening after ablation of 3 and 5 Z-discs. However, the sarcomere shortening decreased significantly (p = 0.035, with a statistical power of 68%) from 7.7% (post ablation) to 4.7% (2 h post ablation) by ablation of a single Z-disc in CMs (Fig 7D).

Fig 7 — The sarcomere pattern of GFP-actinin expressing CMs pre, 1 min, and 2 h post nanosurgery were analyzed. CM contractility was compared pre and post ablation of 1, 3, or 5 Z-discs in a longitudinal set in terms of contraction time (A) and contraction period (B). In addition, the relaxation duration (C, time from max contraction to max relaxation) and the sarcomere shortening as a percentage of the initial sarcomere length (D) were plotted. Each dot represents a single cell. Charts represent mean values ± SEM. Data were tested for significance with a Two-Way-ANOVA and Holm-Bonferroni test. *p < 0.05. 1 Z-disc n = 14, 3 Z-discs n = 12, 5 Z-discs n = 11.

Discussion

In the field of cardiomyopathies, many studies revealed a pivotal role of sarcomere organization and altered sarcomere structures as key factors during disease development and progression. However, the exact role of isolated sarcomere elements in the orchestra of the CM cytoskeleton is still very patchy. In particular, the role of the Z-disc complex during sarcomere repair has to be investigated. Therefore, this study was designed to evaluate the consequences of physical Z-disc removal in a systematic way. To do this, we used an fs laser-based setup to precisely ablate Z-disc elements in CMs. This setup allowed us to introduce different damage patterns in CMs in a spatio-temporal confined and reliable fashion [11, 12].

In contrast to electric stimulation [22] or mechanical strain [23], which results in irregular sarcomere disruption, we precisely introduced different extent of damage by ablating 3, 5, or 10 Z-discs per CM. The metabolic activity of cells was assessed 2 h post nanosurgery. As expected, we observed a significant dependency between damage extent and CM survival. Increased cytoskeletal damage results in increased mortality of CMs. However, the damage response of CMs is multiphasic and cell death mechanism might depend on the damage extent. In our earlier study, we detected membrane blebbing in some of the treated CMs after ablation of a single Z-disc, which might indicate an apoptosis-like pathway [24, 25]. In the present study, we observed an immediate cell death within minutes after ablation of 10 Z-discs without membrane blebbing. Therefore, it might be that damage over a certain threshold lead to disruption of the sarcolemma, as Z-discs are physically coupled to the sarcolemma via costameres [26]. Studies have shown that the sarcolemma of contracting cells is very susceptible to damage [24, 27]. Thus, sufficient damage could result in sarcolemma instability or collapse and leaking of sarcoplasm. If so, this might be characteristic for a necrotic cell death pathway [24]. Nevertheless, this hypothesis needs to be evaluated in further studies. An induced cell death via reactive oxygen species (ROS) is unlikely, as we could not detect significantly elevated ROS formation after laser-induced Z-disc ablations (S3 Fig). Nonetheless, it is possible that the application of the nanosurgery itself will induce further downstream effects, which influence cell survival, in particular, for many Z-disc ablations. However, this cannot be reliably elucidated due to the strong dependence of fs laser-based nanosurgery on the cell type, state and the ablated structure [12].

As critical factors for CM survival after Z-disc removal, we hypothesized that the total number of Z-discs and/or the cell area are essential. Therefore, we measured the cell area and counted the total number of Z-discs. We did not observe a significant relationship between cell area or Z-disc count and CM survival.

The Z-disc complex is, in addition to its force propagation function, a signaling hub for a variety of cellular pathways. For instance, Z-disc proteins like FATZ, ENH or titin are involved in sensing mechanical stress, regulating contraction and downstream phosphorylation of proteins [1]. Furthermore, associated Z-disc proteins can shuttle between the Z-disc complex and the nucleus in CMs. Nuclear translocation was reported for muscle LIM proteins (MLPs) in response to extrinsic pressure overload leading to MLP mediated cell-fate determination and tissue-specific gene expression [28–31]. Hence, we were interested if the distance between Z-disc ablation and nucleus is crucial for CM survival. By comparing the viability pre and 24 h post ablation of a single Z-disc per CM, the median distributions were similar. In earlier studies on glioma cells, regional variations after stress fiber (SF) ablations were observed. Disruption of peripheral SFs can trigger retraction of the whole-cell whereas central SF disrupts consequences only in minor changes [32]. In future studies, our femtosecond laser setup could also be used to clarify the hypothesis, that the addition of new sarcomeres during repair processes is possible throughout the entire length of CMs [23].

As myofibrillar rearrangement occurs during healthy, developing myocardium [33] but disarray after eccentric exercise [34] or in pathogenic phenotypes [35–37], we used the SGFT software to determine sarcomere arrangement. By analyzing the sarcomere orientation pre and post ablation of different numbers of Z-discs, the myofibril alignment in a 20° angle along a single axis was similar to the pre surgery state by comparing all groups. Nevertheless, on a single cell level, we observed significantly different angular distributions by more than 40% of CMs, with an increased percentage at later time points but not necessarily with the number of ablated Z-discs. Studies have shown that damaged sarcomere regions can enlarge from one or more sarcomeres, which will lead to disorientation of the original pattern [22, 23]. However, the main focus in this study is on the single cell level. Therefore, it is impossible to relate our findings to specific disease conditions.

As homogenous and controlled contraction is essential for sufficient force production but altered pathophysiological during diseases [38–40], we analyzed sarcomere dynamics of CMs with SarcTrack. We revealed a constant contraction time, contraction period, and relaxation duration after nanosurgery. These findings are in agreement with earlier studies by Leber et al. [41] and with calcium measurements after ablation of a single Z-disc in CMs [11]. Continuous contraction has also been reported as a critical factor for proper myofibril assembly [15], which is required during sarcomere repair. In addition, these observations suggest a stabilization of the damaged region, as found for Filamin C [41] or F-actin [23], without relinquishment of contractility. Nevertheless, earlier studies indicate that damaged regions are stretchable but non-contractile, resulting potentially in reduced tension or force transmission in CMs [22]. An important indicator for force generation in myocytes is the change in sarcomere length (SL) during contraction [42]. We observed shortening rates between 6–7% of the initial sarcomere length. While maximal force is generated close to resting sarcomere length [43], it might be that force generation is not significantly affected after Z-disc ablations. Nevertheless, further direct methods [44–46] should be performed to quantify local force generation after laser-based manipulation on a single cell level. The significant reduction of sarcomere shortening in case of ablation of a single Z-disc might speculatively be related to faster endogenous repair. However, this needs to be analyzed in future experiments.

The architecture, composition, and functionality of cardiomyocyte cytoskeleton still lacks data on the mechanisms involved in the repair and reassembling of these complex structures. In particular, the exact nature of sarcomere damage response for defined damage patterns and regions remains under-characterized. In this study, we showed that CM survival associates with the damage extent, but not with the the cell area or total number of Z-discs. Furthermore, CM survival is independent of the damage position and can be compensated. This might be due to sarcomere reorganization during ongoing contraction [41]. In conclusion, femtosecond laser-based nanosurgery in combination with software-based sarcomere tracking is a powerful tool to investigate CM repair scenarios and improvement of these on a single cell level. This will accelerate cardiovascular research from mechanistic discoveries to therapeutic applications.

Supporting information

S1 Fig. Automated Z-disc count in cardiomyocytes.

An OpenCV application was developed to quantify the total Z-disc count by single CMs. Therefore, unprocessed images were Fourier transformed, thresholded and via edge-detection refined to allow Z-disc counts in the processed layer. The representative image depicts the different processing layers and an example of a selected area and the resulting count of 5 Z-discs with a next-neighbor-distance of 1.83 μm.

(TIF)

Click here for additional data file.^{(936.9KB, tif)}

S2 Fig. Rapid cell death of CMs after 10 Z-discs ablations.

Using Calcein-AM dye, this representative image series depicts an active cell metabolism of a CM before (A) and a rapid cell death within minutes (D-F) after nanosurgery. A turboRFPlinked α-actinin expressing CM is shown before (A) and after ablating of 10 neighboring Z-discs (C, damage region indicated by the yellow arrow). 15 minutes post ablation (F), the treated CM did not show an active cell metabolism (white arrow). Accumulation of Calcein in untreated cells was found in all experimental trials after an extended incubation time with Calcein-AM. Scale bar 25 μm.

(TIF)

Click here for additional data file.^{(1.1MB, tif)}

S3 Fig. Negligible generation of reactive oxygen species after Z-disc ablations.

CMs were transduced with pLenti CMV mApple-ACTN2 Puro to visualize the Z-disc pattern and loaded with 10 μM 5-(and-6)-chloromethyl-2′,7′-dichlorodihydrofluorescein diacetate, acetyl ester (CM-H₂DCFDA; Invitrogen, USA) for 30 min in DPBS with Ca²⁺ and Mg²⁺ to detect reactive oxygen species (ROS) after nanosurgery. After washing twice with Opti-MEM (Gibco 11058–021, Germany), Z-disc pattern and the basal fluorescence of H₂DCFDA, at a wavelength of 850 nm, were recorded. Following ablation of different numbers of Z-discs, H₂DCFDA fluorescence was assed directly, 1 min and 2 min post ablation. A representative time series for the ablation of one and five Z-discs (marked by arrows) and the region were H₂DCFDA fluorescence was assed (dotted circle, pseudocolor) is shown in (B). H₂DCFDA fluorescence was normalized to the pre ablation level and non-significant ROS generation was found after ablation of Z-discs in all treated cells (C) as well as in neighboring cells (D). A significant ROS increase was observed in the positive control, where 100 μM H₂O₂ was added (A). Untreated CMs served as negative control. Scale bars 10 μm. Bar charts represent relative fluorescence intensities (%) + standard deviation.***p < 0.01, One-Way ANOVA followed by Tukey test. ctr. n = 14, 1 Z-disc n = 20, 3 Z-discs n = 19, 5 Z-discs n = 14, 10 Z-discs n = 17.

(TIF)

Click here for additional data file.^{(9.4MB, tif)}

S1 Video. Contracting cardiomyocyte before and after ablation of a single Z-disc.

(AVI)

Click here for additional data file.^{(25.5MB, avi)}

Acknowledgments

We thank Jasmin Bohlmann and Jennifer Harre from NIFE for providing the neonatal rat puppies. We also acknowledge Prof. Christopher S. Chen and his group from the Department of Biomedical Engineering, Boston University, USA, for kindly providing the pLenti CMV GFP-ACTN2 Puro and the pLenti CMV mApple-ACTN2 vectors.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This study was funded by the REBIRTH Research Center for Translational Regenerative Medicine (ZN3440, State of Lower Saxony, Ministry of Science and Culture (Nieders. Vorab)). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Sequeira V, Nijenkamp LLAM, Regan JA, Van Der Velden J. The physiological role of cardiac cytoskeleton and its alterations in heart failure. Biochimica et Biophysica Acta—Biomembranes. 2014. pp. 700–722. doi: 10.1016/j.bbamem.2013.07.011 [DOI] [PubMed] [Google Scholar]
2.Ehler E. Cardiac cytoarchitecture—why the “hardware” is important for heart function! Biochimica et Biophysica Acta—Molecular Cell Research. 2016. pp. 1857–1863. doi: 10.1016/j.bbamcr.2015.11.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Florescu C, Rogoveanu I, Vere CC, Târtea GC, Târtea EA, Mogoantă L. From molecular mechanism to morphological changes in cardiomyopathy. Rom J Morphol Embryol. 2016;57: 1207–1214. Available: http://www.rjme.ro/RJME/resources/files/57041612071214.pdf. [PubMed] [Google Scholar]
4.Forouzanfar MH, Afshin A, Alexander LT, Ross Anderson H, Bhutta ZA, Biryukov S, et al. Global, regional, and national comparative risk assessment of 79 behavioural, environmental and occupational, and metabolic risks or clusters of risks, 1990–2015: a systematic analysis for the Global Burden of Disease Study 2015. Lancet. 2016;388: 1659–1724. doi: 10.1016/S0140-6736(16)31679-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
5.Knöll R, Buyandelger B, Lab M. The sarcomeric Z-disc and Z-discopathies. Journal of Biomedicine and Biotechnology. Hindawi Publishing Corporation; 2011. p. 569628. doi: 10.1155/2011/569628 [DOI] [PMC free article] [PubMed] [Google Scholar]
6.Willingham TB, Kim Y, Lindberg E, Bleck CKE, Glancy B. The unified myofibrillar matrix for force generation in muscle. Nat Commun. 2020;11: 1–10. doi: 10.1038/s41467-019-13993-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
7.Frank D, Kuhn C, Katus HA, Frey N. The sarcomeric Z-disc: A nodal point in signalling and disease. Journal of Molecular Medicine. 2006. pp. 446–468. doi: 10.1007/s00109-005-0033-1 [DOI] [PubMed] [Google Scholar]
8.Buyandelger B, Mansfield C, Knöll R. Mechano-signaling in heart failure. Pflugers Archiv European Journal of Physiology. 2014. pp. 1093–1099. doi: 10.1007/s00424-014-1468-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
9.Pecorari I, Mestroni L, Sbaizero O. Current understanding of the role of cytoskeletal cross-linkers in the onset and development of cardiomyopathies. Int J Mol Sci. 2020;21: 1–16. doi: 10.3390/ijms21165865 [DOI] [PMC free article] [PubMed] [Google Scholar]
10.Kuetemeyer K, Rezgui R, Lubatschowski H, Heisterkamp A. Influence of laser parameters and staining on femtosecond laser-based intracellular nanosurgery. Biomed Opt Express. 2010;1: 587. doi: 10.1364/BOE.1.000587 [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Müller D, Hagenah D, Biswanath S, Coffee M, Kampmann A, Zweigerdt R, et al. Femtosecond laser-based nanosurgery reveals the endogenous regeneration of single Z-discs including physiological consequences for cardiomyocytes. Sci Rep. 2019;9: 3625. doi: 10.1038/s41598-019-40308-z [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Hagenah D, Heisterkamp A, Kalies S. Effects of cell state and staining on femtosecond laser nanosurgery. Journal of Biophotonics. 2018. doi: 10.1002/jbio.201700344 [DOI] [PubMed] [Google Scholar]
13.Vogel A, Noack J, Hüttman G, Paltauf G. Mechanisms of femtosecond laser nanosurgery of cells and tissues. Appl Phys B Lasers Opt. 2005;81: 1015–1047. doi: 10.1007/s00340-005-2036-6 [DOI] [Google Scholar]
14.Zeigler MB, Chiu DT. Laser selection significantly affects cell viability following single-cell nanosurgery. Photochem Photobiol. 2009;85: 1218–1224. doi: 10.1111/j.1751-1097.2009.00581.x [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Skwarek-Maruszewska A, Hotulainen P, Mattila PK, Lappalainen P. Contractility-dependent actin dynamics in cardiomyocyte sarcomeres. J Cell Sci. 2009;122: 2119–2126. doi: 10.1242/jcs.046805 [DOI] [PubMed] [Google Scholar]
16.Chopra A, Kutys ML, Zhang K, Polacheck WJ, Sheng CC, Luu RJ, et al. Force Generation via β-Cardiac Myosin, Titin, and α-Actinin Drives Cardiac Sarcomere Assembly from Cell-Matrix Adhesions. Dev Cell. 2018;44: 87–96.e5. doi: 10.1016/j.devcel.2017.12.012 [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Schambach A, Galla M, Modlich U, Will E, Chandra S, Reeves L, et al. Lentiviral vectors pseudotyped with murine ecotropic envelope: Increased biosafety and convenience in preclinical research. Exp Hematol. 2006;34: 588–592. doi: 10.1016/j.exphem.2006.02.005 [DOI] [PubMed] [Google Scholar]
18.Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: An open-source platform for biological-image analysis. Nat Methods. 2012;9: 676–682. doi: 10.1038/nmeth.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Toepfer CN, Sharma A, Cicconet M, Garfinkel AC, Mücke M, Neyazi M, et al. SarcTrack. Circ Res. 2019;124: 1172–1183. doi: 10.1161/CIRCRESAHA.118.314505 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Salick MR, Napiwocki BN, Kruepke RA, Knight GT, Ashton RS, Crone WC. The scanning gradient Fourier transform (SGFT) method for assessing sarcomere organization and alignment. J Appl Phys. 2020;127: 194701. doi: 10.1063/1.5129347 [DOI] [Google Scholar]
21.Berens Philipp. CircStat: A MATLAB Toolbox for Circular Statistics. JournalofStatisticalSoftware. 2009;31. [Google Scholar]
22.Orfanos Z, Gödderz MPO, Soroka E, Gödderz T, Rumyantseva A, Van Der Ven PFM, et al. Breaking sarcomeres by in vitro exercise. Sci Rep. 2016;6: 1–9. doi: 10.1038/s41598-016-0001-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Yu JG, Russell B. Cardiomyocyte remodeling and sarcomere addition after uniaxial static strain in vitro. J Histochem Cytochem. 2005;53: 839–844. doi: 10.1369/jhc.4A6608.2005 [DOI] [PubMed] [Google Scholar]
24.Kung G, Konstantinidis K, Kitsis RN. Programmed necrosis, not apoptosis, in the heart. Circ Res. 2011;108: 1017–1036. doi: 10.1161/CIRCRESAHA.110.225730 [DOI] [PubMed] [Google Scholar]
25.Galluzzi L, Vitale I, Aaronson SA, Abrams JM, Adam D, Agostinis P, et al. Molecular mechanisms of cell death: Recommendations of the Nomenclature Committee on Cell Death 2018. Cell Death Differ. 2018;25: 486–541. doi: 10.1038/s41418-017-0012-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Peter AK, Cheng H, Ross RS, Knowlton KU, Chen J. The costamere bridges sarcomeres to the sarcolemma in striated muscle. Prog Pediatr Cardiol. 2011;31: 83–88. doi: 10.1016/j.ppedcard.2011.02.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Armstrong RB, Ogilvie RW, Schwane JA. Eccentric exercise-induced injury to rat skeletal muscle. J Appl Physiol Respir Environ Exerc Physiol. 1983;54: 80–93. doi: 10.1152/jappl.1983.54.1.80 [DOI] [PubMed] [Google Scholar]
28.Ecarnot-Laubriet A, De Luca K, Vandroux D, Moisant M, Bernard C, Assem M, et al. Downregulation and nuclear relocation of MLP during the progression of right ventricular hypertrophy induced by chronic pressure overload. J Mol Cell Cardiol. 2000;32: 2385–2395. doi: 10.1006/jmcc.2000.1269 [DOI] [PubMed] [Google Scholar]
29.Arber S, Halder G, Caroni P. Muscle LIM protein, a novel essential regulator of myogenesis, promotes myogenic differentiation. Cell. 1994;79: 221–231. doi: 10.1016/0092-8674(94)90192-9 [DOI] [PubMed] [Google Scholar]
30.Kato T, Murask J, Chen Y, Tsujita Y, Wall J, Glembotsk CC, et al. Atrial natriuretic peptide promotes cardiomyocyte survival by cGMP-dependent nuclear accumulation of zyxin and Akt. J Clin Invest. 2005;115. doi: 10.1172/JCI24335 [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Rosado M, Barber CF, Berciu C, Feldman S, Birren SJ, Nicastro D, et al. Critical roles for multiple formins during cardiac myofibril development and repair. Mol Biol Cell. 2014;25: 811–827. doi: 10.1091/mbc.E13-08-0443 [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Tanner K, Boudreau A, Bissell MJ, Kumar S. Dissecting regional variations in stress fiber mechanics in living cells with laser nanosurgery. Biophys J. 2010;99: 2775–2783. doi: 10.1016/j.bpj.2010.08.071 [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Bildyug N. Extracellular matrix in regulation of contractile system in cardiomyocytes. Int J Mol Sci. 2019;20. doi: 10.3390/ijms20205054 [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Li S, Nguyen NUN, Xiao F, Menendez-Montes I, Nakada Y, Tan WLW, et al. Mechanism of Eccentric Cardiomyocyte Hypertrophy Secondary to Severe Mitral Regurgitation. Circulation. 2020;141: 1787–1799. doi: 10.1161/CIRCULATIONAHA.119.043939 [DOI] [PubMed] [Google Scholar]
35.Melo TG, Almeida DS, Meirelles MNSL, Pereira MCS. Disarray of sarcomeric alpha-actinin in cardiomyocytes infected by Trypanosoma cruzi. Parasitology. 2006;133: 171–178. doi: 10.1017/S0031182006000011 [DOI] [PubMed] [Google Scholar]
36.Arber S, Hunter JJ, Ross J, Hongo M, Sansig G, Borg J, et al. MLP-deficient mice exhibit a disruption of cardiac cytoarchitectural organization, dilated cardiomyopathy, and heart failure. Cell. 1997;88: 393–403. doi: 10.1016/s0092-8674(00)81878-4 [DOI] [PubMed] [Google Scholar]
37.Prondzynski M, Lemoine MD, Zech AT, Horváth A, Di Mauro V, Koivumäki JT, et al. Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy. EMBO Mol Med. 2019;11. doi: 10.15252/emmm.201911115 [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Vikhorev PG, Vikhoreva NN. Cardiomyopathies and related changes in contractility of human heart muscle. Int J Mol Sci. 2018;19. doi: 10.3390/ijms19082234 [DOI] [PMC free article] [PubMed] [Google Scholar]
39.Iorga B, Schwanke K, Weber N, Wendland M, Greten S, Piep B, et al. Differences in contractile function of myofibrils within human embryonic stem cell-derived cardiomyocytes vs. Adult ventricular myofibrils are related to distinct sarcomeric protein isoforms. Front Physiol. 2018;8: 1–20. doi: 10.3389/fphys.2017.01111 [DOI] [PMC free article] [PubMed] [Google Scholar]
40.Seidman JG, Seidman C. The Genetic Basis for Cardiomyopathy: from Mutation Identification to Mechanistic Paradigms. Cell. 2001;104: 557–567. doi: 10.1016/s0092-8674(01)00242-2 [DOI] [PubMed] [Google Scholar]
41.Leber Y, Ruparelia AA, Kirfel G, van der Ven PFM, Hoffmann B, Merkel R, et al. Filamin C is a highly dynamic protein associated with fast repair of myofibrillar microdamage. Hum Mol Genet. 2016;25: 2776–2788. doi: 10.1093/hmg/ddw135 [DOI] [PubMed] [Google Scholar]
42.Moo EK, Herzog W. Single sarcomere contraction dynamics in a whole muscle. Sci Rep. 2018;8: 1–10. doi: 10.1038/s41598-017-17765-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Gordon AM, Huxley AF, Julian FJ. The variation in isometric tension with sarcomere length in vertebrate muscle fibres. J Physiol. 1966;184: 170–192. doi: 10.1113/jphysiol.1966.sp007909 [DOI] [PMC free article] [PubMed] [Google Scholar]
44.Matsudaira K, Takahashi H, Hirayama-Shoji K, Nguyen TV, Tsukagoshi T, Shimoyama I. A MEMS-based measurement system for evaluating the force-length relationship of human induced pluripotent stem cell-derived cardiomyocytes adhered on a substrate. J Micromechanics Microengineering. 2019;29. doi: 10.1088/1361-6439/ab093d [DOI] [Google Scholar]
45.Beussman KM, Rodriguez ML, Leonard A, Taparia N, Thompson CR, Sniadecki NJ. Micropost arrays for measuring stem cell-derived cardiomyocyte contractility. Methods. 2016;94: 43–50. doi: 10.1016/j.ymeth.2015.09.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
46.Mannhardt I, Breckwoldt K, Letuffe-Brenière D, Schaaf S, Schulz H, Neuber C, et al. Human Engineered Heart Tissue: Analysis of Contractile Force. Stem Cell Reports. 2016;7: 29–42. doi: 10.1016/j.stemcr.2016.04.011 [DOI] [PMC free article] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0252346.r001

Decision Letter 0

Xiaolei Xu

9 Feb 2021

PONE-D-21-00038

Evaluation of laser induced sarcomere micro-damage: role of damage extent and location in cardiomyocytes

PLOS ONE

Dear Dr. Müller,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Mar 26 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

We look forward to receiving your revised manuscript.

Kind regards,

Xiaolei Xu

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

3. Please include captions for your Supporting Information files at the end of your manuscript, and update any in-text citations to match accordingly. Please see our Supporting Information guidelines for more information: http://journals.plos.org/plosone/s/supporting-information.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript PONE-D-21-00038 “Evaluation of laser induced sarcomere micro-damage: role of damage extent and location in cardiomyocytes” by Müller et al evaluates laser-induced Z-disc damage. Previously (Sci Rep 2019), the group reported that ablation of a single Z-disc in a single cell did not affect viability or calcium homeostasis. In the current study, the authors compare ablation of a single, three, five, or ten Z-disc structures in a single cell. They report that ten ablations cause cell death and multiple ablations cause myofibril disarray and alterations in sarcomere shortening.

Major/Interpretation Concerns

1) The authors note that 10 cell ablations do cause cellular death, but do not know the mechanism nor indicate that total power in the cell was controlled.

A) This reviewer is concerned that the mechanism itself may be important to the interpretation of the author’s data. In both the earlier study and the current study, the authors do not study reactive oxygen species generation (although they clearly note it as a possible consequence in the 2019 study). The authors also do not shot show conclusively that Z-disc proteins are ablated, only that fluorescence is eliminated then re-formed. Thus, this reviewer is concerned that the authors are merely de-activating the fluorescence by causing the RFP or mCherry to ablate. Could the ablation itself and/or the laser input be causing ROS? If this is true, then the authors are studying local ROS generation instead of Z-disc dysfunction. Such a mechanism may also provide a mechanism for cell death in the 10 ablation strategy. This reviewer suggests measuring the ROS production in the cells.

If the authors cannot generate such data, this reviewer suggests that the authors provide a detailed comparison between their findings and findings in pathophysiological states that may alter Z-disc alignment, such as muscular dystrophy or nemaline myopathies.

B) While the authors note that the laser power settings were equalized for each experiment (Methods lines 151/152), they do not indicate that total power/energy delivery into the cell was normalized. This reviewer suggests: controlling for absolute power/energy delivered into the cell (for example 100 small bursts of 10% of the ablation pulse through the cell) to determine if cell death is based the total power/energy delivered to the cell.

Note that the reviewer believes that this may also provide evidence for or against the hypothesis that ROS production causes the cell death and damage

2) Discussion Paragraph around Line 422. The authors suggest that Refs 22, 29-31 indicate that myofibril disarray occurs. To this reviewer’s reading, they refer primarily to cellular alignment (for example, Ref 31 discusses cellular myoFIBER alignment, not myoFIBRIL alignment. Reference 22 is an invitro model, not a true disease model. Only a very small statement in reference 29 about the pre-myofibril is clearly indicative of alignment.

The authors should clearly note this limitation or provide stronger justification that such a small number of Z-discs would ultimately cause disease.

3) Discussion Lines 456-457: The authors state that “This occurs probably by sarcomere reorganization under controlled contractility.” The “probably” may be to strong as it is without evidence from this study, nor is it referenced.

Data/Statistical Concerns

4) Results and Figures 2,4: The authors note that they did not observe a correlation between cell area and ablation. Similarly, they describe no clear correlation between distance from nucleus to ablation, except in the presence of an interaction with the number of sarcomeres. The legend of the figures are titled “Correlation of CMs…”. However, Figures 2,4 only includes violin plots. A) Please provide statistical results regarding regression/correlations.

B) For figure 4, was an interaction between distance and number of nuclei included in the test? If not, could the authors include such or describe why it is not needed?

5) Results Lines 276-279: The authors report percent changes without statistics. Please clarify whether the data were significantly reduced by ablations or not.

6) Results Lines 369-371: Please indicate the reported power of this test to provide confidence that the reduced shortening is not a Type II (false positive). statistical error

Minor Concerns

7) The authors note throughout that number and distance to the nucleus differed. However, they do not include a hypothesis or justification for looking at nuclei instead of other cellular compartments (for example the endoplasmic reticulum or mitochondria). Please describe why this and/or the finding that 2 nuclei improve survival is an important factor to study.

8) Results Lines 343-344: The authors describe that alignment within a 20 degree angle was compared. Please include a statement of why this range was chosen.

9) Figure 6 Panels C,D: Please check the comparative text to see if the “pre” and “post” labels have been flipped. (E.g. the analysis was unlikely to be done 2 h PRE ablation).

Reviewer #2: The manuscript by Mueller et al. entitled “Evaluation of laser induced sarcomere micro-damage…” is devoted to evaluation of method to introduce micro-damage in sarcomere. This new laser-based approach allows for the precise ablation of individual elements of the sarcomere, i.e. Z-disc. In their previous article (Mueller at al. 2019) the authors established the femtosecond laser-based system with the sub-micrometer precision cell manipulation. Here, they demonstrate correlation between spatially confined micro-damages and cell survival. The problem of the study is very important: many cardiomyopathies develop sarcomere disarray demonstrating cardiomyocyte losses. The femtosecond laser-based nanosurgery followed by the fluorescence microscopy is a powerful tool to better understand integrity and structure-function of the sarcomeric machinery in healthy and disease conditions.

These evaluation assays might be of interest for the researchers who study cardiomyopathies: this is a good model of the sarcomere disarray. These methods will also help to investigate cytoskeleton structure-function and sarcomere reparation.

I suppose that this interesting methodological research article can be published in PLoS One , just some flaws need to be corrected and some important questions should be addressed prior publication.

Major:

I could not find an answer to the following question that should be addressed:

1. Authors should convince a reader that the ablation of the Z-disk really took place.

Rat newborn cardiomyocytes were transfected with anti-a-actinin fused with turbo-RFP for visualization of Z-disks. The ‘free-electron-mediated bond-breaking’ can also affect structure of the RFP reporter, recognition site of antibody etc. Authors should show phase microscopy photographs in parallel to the fluorescence microscopy images for reader to ensure that the damage really took place in the Z-disk proteins.

2. How cell area was measured? It is not clear from the Methods. For the in vivo cardiomyocyte membrane visualization, I would recommend di-4 ANEPPS membrane voltage -sensitive dye.

3. What was the cause of the cell death after ablation(s)? This important question should be addressed in Discussion. If the main purpose of the paper is evaluation of the method, and cell viability is most important parameter, this question at least should be discussed.

Minor:

Intro:

Line 90: ‘influence of location of the damage’. Influence on what?

Results:

Line 233: add words ‘within 2 hrs after damage’ Do the same for the Figure 1 capture. Why did authors choose 2 hrs interval in those experiments? Why in some experiments authors use 24 hrs instead of 2 hrs?

Figure 1. It might be a good idea to show a correlation plot Viability vs # of Z-disk ablations.

Line256: “A critical factor for CMs survival […] could be the size and the total number of Z-disks…” This is not good hypothesis to test. Hypothesis should be something like “CMs with smaller cell area more susceptible to the damage ”

Line 263: ‘Cardiomyocytes with fewer Z-disc counts…’ Very confusing sentence. Need to re-phrase.

Line 277 and 279: Were these differences significant?

Figure 4, panels C and D: Are these differences significant? How to treat these violin plots w/o statistical significance?

Line 308: Why opposite correlation was observed in CMs with two nuclei? Significant?

Figure 5. Mistype: pattern strengTH

Could authors explain for a reader how to read these pattern strength maps? It is not easy.

Line 317: What is ‘continuous’ contractility? Contractility is a property of CMs: it can’t be continuous. Contraction?

Line 330: It is not clear where. Authors should point out the location where 5 Z-disks were ablated.

Figure 6, panels C and D: note the units (% of cells)

Figure 7, panel D: why only single Z-disk damage reflected in sarcomere shortening? It is not convincing for a reader.

Discussion:

Line 387: Did authors study sarcomeregenesis?

Line 397-398: to make this conclusion authors needed to compare randomly to neighboring Z-disks damage. This comparison had not been made.

Lines 443-447. Forces can’t be directly quantified from these experiments.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Jun 4;16(6):e0252346. doi: 10.1371/journal.pone.0252346.r002

Author response to Decision Letter 0

2 Mar 2021

We gratefully appreciate the helpful comments and critique of the reviewers on our paper. We have addressed all points raised by the reviewers in the Revision - Response to Decision file.

Attachment

Submitted filename: Revision - Response to Decision.pdf

Click here for additional data file.^{(419.9KB, pdf)}

PLoS One. doi: 10.1371/journal.pone.0252346.r003

Decision Letter 1

Xiaolei Xu

25 Mar 2021

PONE-D-21-00038R1

Evaluation of laser induced sarcomere micro-damage: role of damage extent and location in cardiomyocytes

PLOS ONE

Dear Dr. Müller,

Please submit your revised manuscript by May 09 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Xiaolei Xu

Academic Editor

PLOS ONE

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Partly

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: The submission PONE-D-21-00038R1 by Muller et al, argues that ablation of multiple z-disks using a femtosecond laser is associated with cell death and damage to contractile function, related to mofibril disarray. While the authors have substantial evidence to suggest that the laser treatment causes z-disc misalignment, this reviewer remains unconvinced that the cell death is due to z-disc ablation and not the laser treatment. Nonetheless, the authors report unique methodology and provide improved context and limitations within the discussion.

Major Comment:

1. Statistics: While this reviewer is grateful that the authors improved their reporting of statistical results, the revised results section highlights several concerns. For example, line 281-282 of the highlighted manuscript states "A non

significant decreased viability from 68% (2 h) to 60% (24 h) was observed (p = 0.99)...". It is unclear why the authors would highlight changed percentages when the differences were not statistically significant. Even for data nearing p~0.15, it would seem that the authors are purposely highlighting a difference that is not there. Given the sample sizes, this reviewer would suggest removing statements that state differences or trends in mean differences when the data are not near p=0.05.

Minor Comments:

2. Statistics: Given that Viability (Figure 1C/D) included two factors (control/treated; number of ablations), why are the authors reporting a one-way ANOVA instead of a multi-factor ANOVA?

3. (Related to Reviewer's original Comment 1) While this reviewer understand the author's interest in further pursing the mechanisms of cell death in future studies (and greatly appreciates the inclusion of the new ROS data and expanded discussion), this reviewer is not convinced that the z-disc removal causes the cell death. This reviewer would be more comfortable with the results if they showed that femtosecond laser treatment was not the cause of cell death. (For example, via distributed treatment, as previously suggested, or by treating a non-sarcomeric structure with the same ablation (either in a muscle cell away from nuclei and striations, which is difficult, or a non-muscle cell type).

Reviewer #2: The manuscript by Mueller et al. entitled “Evaluation of laser induced sarcomere micro-damage…” was significantly improved in my opinion.

A couple of things to fix, though:

i) I still do not like lines 259-261. Authors should mention that this is amount of Z-disks in ROI, not total. I would stick to the parameter ‘cell area’ instead of amount of Z-disks. I think that is most suitable.

ii) I would suggest not to make ANY conclusion on insignificant data (Lines 268-269; also lines 314-315). Please, check throughout whole manuscript.

Otherwise the manuscript looks much better and certainly match the publication criteria in the PLoS One journal.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

PLoS One. 2021 Jun 4;16(6):e0252346. doi: 10.1371/journal.pone.0252346.r004

Author response to Decision Letter 1

26 Mar 2021

We gratefully appreciate the helpful comments and critique of the reviewers on our manuscript. We have addressed all points raised by the reviewers in the Response to Reviewers file.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(35.1KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0252346.r005

Decision Letter 2

Xiaolei Xu

19 Apr 2021

PONE-D-21-00038R2

Evaluation of laser induced sarcomere micro-damage: role of damage extent and location in cardiomyocytes

PLOS ONE

Dear Dr. Müller,

Please submit your revised manuscript by Jun 03 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Xiaolei Xu

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #1: (No Response)

Reviewer #2: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

**********

6. Review Comments to the Author

Reviewer #1: The authors, Muller et al, further revise PONE-D-21-00038R2, "Evaluation of laser induced sarcomere micro-damage: role of damage extent and location in cardiomyocytes". The authors provide data suggesting that z-disc ablation using a femtosecond laser is associated with both cell death and myofibril re-alignment.

The authors have addressed the most substantial concerns, but this reviewer suggests further edits on statistical reporting for one result:

Line 278/279 (results for figure 3). It does not make sense to this reviewer that a p=0.99 and 0.59 be highlighted as "a non-significant decreased viability". Since the graphs do visually show stronger trends, this reviewer suggest re-evaluating the data used to derive this statistic. If the p-values are replicated, this reviewer suggest that the authors highlight that 'despite a visual difference' there was no statistically significant difference in viability, instead of maintaining the wording in the current draft.

Reviewer #2: I am satisfied how the reviewer's questions were addressed by the authors. I think the manuscript deserved to be published in PLoS One.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

PLoS One. 2021 Jun 4;16(6):e0252346. doi: 10.1371/journal.pone.0252346.r006

Author response to Decision Letter 2

19 Apr 2021

We gratefully appreciate the helpful comments and critique of the reviewers on our manuscript. We have addressed all points raised by the reviewers in the Response to Reviewers file.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(26.5KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0252346.r007

Decision Letter 3

Xiaolei Xu

14 May 2021

Evaluation of laser induced sarcomere micro-damage: role of damage extent and location in cardiomyocytes

PONE-D-21-00038R3

Dear Dr. Müller,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Xiaolei Xu

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

**********

6. Review Comments to the Author

Reviewer #1: The manuscript PONE-D-21-00038R3 has been further revised and the reviewer thanks the authors for addressing the concerns.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

PLoS One. doi: 10.1371/journal.pone.0252346.r008

Acceptance letter

Xiaolei Xu

19 May 2021

PONE-D-21-00038R3

Evaluation of laser induced sarcomere micro-damage: role of damage extent and location in cardiomyocytes

Dear Dr. Müller:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Xiaolei Xu

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Automated Z-disc count in cardiomyocytes.

(TIF)

Click here for additional data file.^{(936.9KB, tif)}

S2 Fig. Rapid cell death of CMs after 10 Z-discs ablations.

(TIF)

Click here for additional data file.^{(1.1MB, tif)}

S3 Fig. Negligible generation of reactive oxygen species after Z-disc ablations.

(TIF)

Click here for additional data file.^{(9.4MB, tif)}

S1 Video. Contracting cardiomyocyte before and after ablation of a single Z-disc.

(AVI)

Click here for additional data file.^{(25.5MB, avi)}

Attachment

Submitted filename: Revision - Response to Decision.pdf

Click here for additional data file.^{(419.9KB, pdf)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(35.1KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(26.5KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0252346.ref001] 1.Sequeira V, Nijenkamp LLAM, Regan JA, Van Der Velden J. The physiological role of cardiac cytoskeleton and its alterations in heart failure. Biochimica et Biophysica Acta—Biomembranes. 2014. pp. 700–722. doi: 10.1016/j.bbamem.2013.07.011 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref002] 2.Ehler E. Cardiac cytoarchitecture—why the “hardware” is important for heart function! Biochimica et Biophysica Acta—Molecular Cell Research. 2016. pp. 1857–1863. doi: 10.1016/j.bbamcr.2015.11.006 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref003] 3.Florescu C, Rogoveanu I, Vere CC, Târtea GC, Târtea EA, Mogoantă L. From molecular mechanism to morphological changes in cardiomyopathy. Rom J Morphol Embryol. 2016;57: 1207–1214. Available: http://www.rjme.ro/RJME/resources/files/57041612071214.pdf. [PubMed] [Google Scholar]

[pone.0252346.ref004] 4.Forouzanfar MH, Afshin A, Alexander LT, Ross Anderson H, Bhutta ZA, Biryukov S, et al. Global, regional, and national comparative risk assessment of 79 behavioural, environmental and occupational, and metabolic risks or clusters of risks, 1990–2015: a systematic analysis for the Global Burden of Disease Study 2015. Lancet. 2016;388: 1659–1724. doi: 10.1016/S0140-6736(16)31679-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref005] 5.Knöll R, Buyandelger B, Lab M. The sarcomeric Z-disc and Z-discopathies. Journal of Biomedicine and Biotechnology. Hindawi Publishing Corporation; 2011. p. 569628. doi: 10.1155/2011/569628 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref006] 6.Willingham TB, Kim Y, Lindberg E, Bleck CKE, Glancy B. The unified myofibrillar matrix for force generation in muscle. Nat Commun. 2020;11: 1–10. doi: 10.1038/s41467-019-13993-7 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref007] 7.Frank D, Kuhn C, Katus HA, Frey N. The sarcomeric Z-disc: A nodal point in signalling and disease. Journal of Molecular Medicine. 2006. pp. 446–468. doi: 10.1007/s00109-005-0033-1 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref008] 8.Buyandelger B, Mansfield C, Knöll R. Mechano-signaling in heart failure. Pflugers Archiv European Journal of Physiology. 2014. pp. 1093–1099. doi: 10.1007/s00424-014-1468-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref009] 9.Pecorari I, Mestroni L, Sbaizero O. Current understanding of the role of cytoskeletal cross-linkers in the onset and development of cardiomyopathies. Int J Mol Sci. 2020;21: 1–16. doi: 10.3390/ijms21165865 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref010] 10.Kuetemeyer K, Rezgui R, Lubatschowski H, Heisterkamp A. Influence of laser parameters and staining on femtosecond laser-based intracellular nanosurgery. Biomed Opt Express. 2010;1: 587. doi: 10.1364/BOE.1.000587 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref011] 11.Müller D, Hagenah D, Biswanath S, Coffee M, Kampmann A, Zweigerdt R, et al. Femtosecond laser-based nanosurgery reveals the endogenous regeneration of single Z-discs including physiological consequences for cardiomyocytes. Sci Rep. 2019;9: 3625. doi: 10.1038/s41598-019-40308-z [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref012] 12.Hagenah D, Heisterkamp A, Kalies S. Effects of cell state and staining on femtosecond laser nanosurgery. Journal of Biophotonics. 2018. doi: 10.1002/jbio.201700344 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref013] 13.Vogel A, Noack J, Hüttman G, Paltauf G. Mechanisms of femtosecond laser nanosurgery of cells and tissues. Appl Phys B Lasers Opt. 2005;81: 1015–1047. doi: 10.1007/s00340-005-2036-6 [DOI] [Google Scholar]

[pone.0252346.ref014] 14.Zeigler MB, Chiu DT. Laser selection significantly affects cell viability following single-cell nanosurgery. Photochem Photobiol. 2009;85: 1218–1224. doi: 10.1111/j.1751-1097.2009.00581.x [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref015] 15.Skwarek-Maruszewska A, Hotulainen P, Mattila PK, Lappalainen P. Contractility-dependent actin dynamics in cardiomyocyte sarcomeres. J Cell Sci. 2009;122: 2119–2126. doi: 10.1242/jcs.046805 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref016] 16.Chopra A, Kutys ML, Zhang K, Polacheck WJ, Sheng CC, Luu RJ, et al. Force Generation via β-Cardiac Myosin, Titin, and α-Actinin Drives Cardiac Sarcomere Assembly from Cell-Matrix Adhesions. Dev Cell. 2018;44: 87–96.e5. doi: 10.1016/j.devcel.2017.12.012 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref017] 17.Schambach A, Galla M, Modlich U, Will E, Chandra S, Reeves L, et al. Lentiviral vectors pseudotyped with murine ecotropic envelope: Increased biosafety and convenience in preclinical research. Exp Hematol. 2006;34: 588–592. doi: 10.1016/j.exphem.2006.02.005 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref018] 18.Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al. Fiji: An open-source platform for biological-image analysis. Nat Methods. 2012;9: 676–682. doi: 10.1038/nmeth.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref019] 19.Toepfer CN, Sharma A, Cicconet M, Garfinkel AC, Mücke M, Neyazi M, et al. SarcTrack. Circ Res. 2019;124: 1172–1183. doi: 10.1161/CIRCRESAHA.118.314505 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref020] 20.Salick MR, Napiwocki BN, Kruepke RA, Knight GT, Ashton RS, Crone WC. The scanning gradient Fourier transform (SGFT) method for assessing sarcomere organization and alignment. J Appl Phys. 2020;127: 194701. doi: 10.1063/1.5129347 [DOI] [Google Scholar]

[pone.0252346.ref021] 21.Berens Philipp. CircStat: A MATLAB Toolbox for Circular Statistics. JournalofStatisticalSoftware. 2009;31. [Google Scholar]

[pone.0252346.ref022] 22.Orfanos Z, Gödderz MPO, Soroka E, Gödderz T, Rumyantseva A, Van Der Ven PFM, et al. Breaking sarcomeres by in vitro exercise. Sci Rep. 2016;6: 1–9. doi: 10.1038/s41598-016-0001-8 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref023] 23.Yu JG, Russell B. Cardiomyocyte remodeling and sarcomere addition after uniaxial static strain in vitro. J Histochem Cytochem. 2005;53: 839–844. doi: 10.1369/jhc.4A6608.2005 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref024] 24.Kung G, Konstantinidis K, Kitsis RN. Programmed necrosis, not apoptosis, in the heart. Circ Res. 2011;108: 1017–1036. doi: 10.1161/CIRCRESAHA.110.225730 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref025] 25.Galluzzi L, Vitale I, Aaronson SA, Abrams JM, Adam D, Agostinis P, et al. Molecular mechanisms of cell death: Recommendations of the Nomenclature Committee on Cell Death 2018. Cell Death Differ. 2018;25: 486–541. doi: 10.1038/s41418-017-0012-4 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref026] 26.Peter AK, Cheng H, Ross RS, Knowlton KU, Chen J. The costamere bridges sarcomeres to the sarcolemma in striated muscle. Prog Pediatr Cardiol. 2011;31: 83–88. doi: 10.1016/j.ppedcard.2011.02.003 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref027] 27.Armstrong RB, Ogilvie RW, Schwane JA. Eccentric exercise-induced injury to rat skeletal muscle. J Appl Physiol Respir Environ Exerc Physiol. 1983;54: 80–93. doi: 10.1152/jappl.1983.54.1.80 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref028] 28.Ecarnot-Laubriet A, De Luca K, Vandroux D, Moisant M, Bernard C, Assem M, et al. Downregulation and nuclear relocation of MLP during the progression of right ventricular hypertrophy induced by chronic pressure overload. J Mol Cell Cardiol. 2000;32: 2385–2395. doi: 10.1006/jmcc.2000.1269 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref029] 29.Arber S, Halder G, Caroni P. Muscle LIM protein, a novel essential regulator of myogenesis, promotes myogenic differentiation. Cell. 1994;79: 221–231. doi: 10.1016/0092-8674(94)90192-9 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref030] 30.Kato T, Murask J, Chen Y, Tsujita Y, Wall J, Glembotsk CC, et al. Atrial natriuretic peptide promotes cardiomyocyte survival by cGMP-dependent nuclear accumulation of zyxin and Akt. J Clin Invest. 2005;115. doi: 10.1172/JCI24335 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref031] 31.Rosado M, Barber CF, Berciu C, Feldman S, Birren SJ, Nicastro D, et al. Critical roles for multiple formins during cardiac myofibril development and repair. Mol Biol Cell. 2014;25: 811–827. doi: 10.1091/mbc.E13-08-0443 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref032] 32.Tanner K, Boudreau A, Bissell MJ, Kumar S. Dissecting regional variations in stress fiber mechanics in living cells with laser nanosurgery. Biophys J. 2010;99: 2775–2783. doi: 10.1016/j.bpj.2010.08.071 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref033] 33.Bildyug N. Extracellular matrix in regulation of contractile system in cardiomyocytes. Int J Mol Sci. 2019;20. doi: 10.3390/ijms20205054 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref034] 34.Li S, Nguyen NUN, Xiao F, Menendez-Montes I, Nakada Y, Tan WLW, et al. Mechanism of Eccentric Cardiomyocyte Hypertrophy Secondary to Severe Mitral Regurgitation. Circulation. 2020;141: 1787–1799. doi: 10.1161/CIRCULATIONAHA.119.043939 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref035] 35.Melo TG, Almeida DS, Meirelles MNSL, Pereira MCS. Disarray of sarcomeric alpha-actinin in cardiomyocytes infected by Trypanosoma cruzi. Parasitology. 2006;133: 171–178. doi: 10.1017/S0031182006000011 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref036] 36.Arber S, Hunter JJ, Ross J, Hongo M, Sansig G, Borg J, et al. MLP-deficient mice exhibit a disruption of cardiac cytoarchitectural organization, dilated cardiomyopathy, and heart failure. Cell. 1997;88: 393–403. doi: 10.1016/s0092-8674(00)81878-4 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref037] 37.Prondzynski M, Lemoine MD, Zech AT, Horváth A, Di Mauro V, Koivumäki JT, et al. Disease modeling of a mutation in α‐actinin 2 guides clinical therapy in hypertrophic cardiomyopathy. EMBO Mol Med. 2019;11. doi: 10.15252/emmm.201911115 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref038] 38.Vikhorev PG, Vikhoreva NN. Cardiomyopathies and related changes in contractility of human heart muscle. Int J Mol Sci. 2018;19. doi: 10.3390/ijms19082234 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref039] 39.Iorga B, Schwanke K, Weber N, Wendland M, Greten S, Piep B, et al. Differences in contractile function of myofibrils within human embryonic stem cell-derived cardiomyocytes vs. Adult ventricular myofibrils are related to distinct sarcomeric protein isoforms. Front Physiol. 2018;8: 1–20. doi: 10.3389/fphys.2017.01111 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref040] 40.Seidman JG, Seidman C. The Genetic Basis for Cardiomyopathy: from Mutation Identification to Mechanistic Paradigms. Cell. 2001;104: 557–567. doi: 10.1016/s0092-8674(01)00242-2 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref041] 41.Leber Y, Ruparelia AA, Kirfel G, van der Ven PFM, Hoffmann B, Merkel R, et al. Filamin C is a highly dynamic protein associated with fast repair of myofibrillar microdamage. Hum Mol Genet. 2016;25: 2776–2788. doi: 10.1093/hmg/ddw135 [DOI] [PubMed] [Google Scholar]

[pone.0252346.ref042] 42.Moo EK, Herzog W. Single sarcomere contraction dynamics in a whole muscle. Sci Rep. 2018;8: 1–10. doi: 10.1038/s41598-017-17765-5 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref043] 43.Gordon AM, Huxley AF, Julian FJ. The variation in isometric tension with sarcomere length in vertebrate muscle fibres. J Physiol. 1966;184: 170–192. doi: 10.1113/jphysiol.1966.sp007909 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref044] 44.Matsudaira K, Takahashi H, Hirayama-Shoji K, Nguyen TV, Tsukagoshi T, Shimoyama I. A MEMS-based measurement system for evaluating the force-length relationship of human induced pluripotent stem cell-derived cardiomyocytes adhered on a substrate. J Micromechanics Microengineering. 2019;29. doi: 10.1088/1361-6439/ab093d [DOI] [Google Scholar]

[pone.0252346.ref045] 45.Beussman KM, Rodriguez ML, Leonard A, Taparia N, Thompson CR, Sniadecki NJ. Micropost arrays for measuring stem cell-derived cardiomyocyte contractility. Methods. 2016;94: 43–50. doi: 10.1016/j.ymeth.2015.09.005 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0252346.ref046] 46.Mannhardt I, Breckwoldt K, Letuffe-Brenière D, Schaaf S, Schulz H, Neuber C, et al. Human Engineered Heart Tissue: Analysis of Contractile Force. Stem Cell Reports. 2016;7: 29–42. doi: 10.1016/j.stemcr.2016.04.011 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Evaluation of laser induced sarcomere micro-damage: Role of damage extent and location in cardiomyocytes

Dominik Müller

Thorben Klamt

Lara Gentemann

Alexander Heisterkamp

Stefan Michael Klaus Kalies

Roles

Abstract

Introduction

Methods

Neonatal rat cardiomyocyte isolation and culture

Cardiomyocyte transfection and transduction

Laser setup, cell imaging and manipulation

Ablation of multiple Z-discs

Central or distal Z-disc ablation

Cell analysis using SarcTrack and Scanning Gradient Fourier Transformation (SGFT)

Data analysis and statistics

Results

Cardiomyocyte viability associates with the extent of Z-disc damage within 2 h after damage

Fig 1. Relationship between CMs viability and the extent of Z-disc damage within 2 h after damage.

Cell area and total Z-disc count are not critical for CM survival

Fig 2. Relationship between CMs cell areas and total Z-disc counts with cell survival.

Multiple Z-disc damage induces immediate CM death

Fig 3. Comparison of CM survival after 2 h and 24 h post ablation of 3 Z-discs.

Cardiomyocyte survival is independent of the damage position

Fig 4. Relationship between damage position and CM survival.

Sarcomere reorientation during contraction

Fig 5. Sarcomere orientation was analyzed pre and post Z-disc ablation using Scanning Gradient Fourier Transform (SGFT) method.

Fig 6. Quantitative analysis of sarcomere orientation pre and post Z-disc ablation using Scanning Gradient Fourier Transform (SGFT) method.

Fig 7. SarcTrack assessment of CMs pre and post Z-disc ablation.

Discussion

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Xiaolei Xu

Roles

Author response to Decision Letter 0

Decision Letter 1

Xiaolei Xu

Roles

Author response to Decision Letter 1

Decision Letter 2

Xiaolei Xu

Roles

Author response to Decision Letter 2

Decision Letter 3

Xiaolei Xu

Roles

Acceptance letter

Xiaolei Xu

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases