Skip to main content
NCBI home page
Heredity logoLink to Heredity
. 2021 Mar 8;126(6):942–954. doi: 10.1038/s41437-021-00419-8

Low levels of genetic differentiation with isolation by geography and environment in populations of Drosophila melanogaster from across China

Lei Yue 1, Li-Jun Cao 1,✉, Jin-Cui Chen 1, Ya-Jun Gong 1, Yan-Hao Lin 1,2, Ary Anthony Hoffmann 3, Shu-Jun Wei 1,✉
PMCID: PMC8178374  PMID: 33686193

Abstract

The fruit fly, Drosophila melanogaster, is a model species in evolutionary studies. However, population processes of this species in East Asia are poorly studied. Here we examined the population genetic structure of D. melanogaster across China. There were 14 mitochondrial haplotypes with 10 unique ones out of 23 known from around the globe. Pairwise FST values estimated from 15 novel microsatellites ranged from 0 to 0.11, with geographically isolated populations showing the highest level of genetic uniqueness. STRUCTURE analysis identified high levels of admixture at both the individual and population levels. Mantel tests indicated a strong association between genetic distance and geographical distance as well as environmental distance. Full redundancy analysis (RDA) showed that independent effects of environmental conditions and geography accounted for 62.10% and 31.58% of the total explained genetic variance, respectively. When geographic variables were constrained in a partial RDA analysis, the environmental variables bio2 (mean diurnal air temperature range), bio13 (precipitation of the wettest month), and bio15 (precipitation seasonality) were correlated with genetic distance. Our study suggests that demographic history, geographical isolation, and environmental factors have together shaped the population genetic structure of D. melanogaster after its introduction into China.

Subject terms: Genetic variation, Population genetics

Introduction

Patterns of population genetic variation can be shaped by neutral and adaptive evolutionary processes and there is an increasing understanding of how demography, gene flow, and selection interact to drive extant genetic patterns across space (Bradburd & Ralph, 2019; Lowe et al., 2017; Semenov et al., 2019). The fruit fly, Drosophila melanogaster, has been recognized as a useful model organism in understanding such interactions following many decades of research. The species has a cosmopolitan distribution and shows an ability to rapidly adapt to varying environments (David & Capy, 1988; Markow & O’Grady, 2005). Past biogeographical and systematic studies have confirmed that D. melanogaster was native to sub-Saharan Africa (Lachaise et al., 1988), and expanded its range from Middle East into the Eurasian continent roughly at 1800 years ago (Sprengelmeyer et al., 2020) and to America and Australia only about 100–200 years ago (Arguello et al., 2019; Stephan & Li, 2007). Current studies have shown that both historical demographic events and local adaptation as well as their interplay play crucial roles in shaping the population genetic structure of D. melanogaster (Arguello et al., 2016; Flatt, 2016; Keller, 2007; Laurent et al., 2011).

One factor influencing the population genetic structure of D. melanogaster is historical dispersal (Keller, 2007; Sprengelmeyer et al., 2020). North American and African populations of D. melanogaster have been affected by African and European migrations associated with human cargo transportation (Bergland et al., 2016; David & Capy, 1988; Kao et al., 2015; Lachaise et al., 1988). The exchange of fruit around the world has provided an opportunity for ongoing gene flow among populations, contributing to genetic admixture worldwide in recent years as documented in African (Kauer et al., 2003; Pool et al., 2012), North American (Duchen et al., 2013), and Australian (Bergland et al., 2016) populations. Compared to rural populations, African urban populations exhibit substantial genetic admixture from European populations (Kauer et al., 2003; Pool et al., 2012); although the high levels of inferred non-African ancestry can be affected by adaptation, ongoing trade might also contribute (Kauer et al., 2003; Pool et al., 2012).

Another factor influencing the population genetic structure of D. melanogaster is natural selection (Flatt, 2016; Hoffmann et al., 2003; Sigh et al., 1982). Numerous studies have revealed clinal variation in phenotypes, chromosomal arrangements, and genotypes across environmental gradients for this species, implicating spatially varying selection (Flatt, 2016; Hoffmann & Weeks, 2007). DNA variation in genic targets of clines can be connected with adaption to ecological factors like temperature, precipitation, and oxygen concentration (Parkash & Munjal, 2000; Schmidt et al., 2005; Weeks et al., 2002). To understand such clinal variation in D. melanogaster, the effect of natural selection should be disentangled from demographic events (Miller et al., 2020; Sexton et al., 2014; Smith et al., 2020).

The Eurasian continent has been proposed as one of the earliest areas colonized by D. melanogaster out of its native range (David & Capy, 1988). The East Asian populations of D. melanogaster may have some unique genetic characteristics compared to other populations (Schlötterer et al., 2006). However, there are very few studies on the population genetic structure of D. melanogaster across East Asia, with most previous studies concentrating on African, European, Australian, and American populations (Duchen et al., 2013; Kapun et al., 2018; Kauer et al., 2003; Stephan & Li, 2007). East Asia has a diversified geographical environment and a long history of human colonization. This area is one of the most important regions in the spread and diffusion of many species (Leipe et al., 2019; Molina et al., 2011; Xiang et al., 2018; Yu et al., 2018), especially those associated with human trade-which are likely to include D. melanogaster (Arguello et al., 2019; Keller, 2007). However, limited knowledge on the population genetic structure of D. melanogaster in East Asia has hindered an understanding of expansion and adaptation processes in this region and connections to other areas.

Here, we examined the genetic diversity and population structure of D. melanogaster populations collected across China based on the mitochondrial cox1 gene and microsatellite loci. We hypothesized that (1) low population genetic differentiation exists among Chinese populations of D. melanogaster owing to its relatively short history of introduction into China; and (2) genetic distance across Chinese populations are correlated with both geographical distance and environmental factors, given the rapid adaptive evolution of D. melanogaster and varied ecological environment across China, as already seen in other non-migratory invertebrates in this region (Cao et al., 2016b, 2019; Wei et al., 2015).

Materials and methods

Sample collection and DNA extraction

Specimens of D. melanogaster were collected from 16 locations in China through trapping by using rotten fruits (e.g., grapes, watermelon, and banana) in 2019 (Table 1 and Fig. 1). The sampled flies were first checked morphologically using an anatomical lens, followed by molecular identification by BLAST searching of the mitochondrial cytochrome oxidase subunit I (cox1) gene (see below) against the nucleotide database (nt) and in the BOLD system (http://www.boldsystems.org) to ensure the reliability of morphological identification. All samples were stored in 98% alcohol, and frozen at −80 °C before DNA extraction. A DNeasy Blood and Tissue Kit (Qiagen, Germany) was used to extract total genomic DNA individually for 330 samples randomly selected from 16 populations.

Table 1.

Collection information for Drosophila melanogaster specimens used in this study.

Population code Collection location Longitude (°E), Latitude (°N) Collection date (year/month)
XJKL Korla, Xinjiang Province 86.18, 41.73 2019/10
YNDH Dehong, Yunnan Province 98.59, 24.44 2019/10
SCPZ Panzhihua, Sichuan Province 101.73, 26.59 2019/10
QHXN Xining, Qinghai Province 101.78, 36.62 2019/10
YNKM Kunming, Yunnan Province 102.85, 24.87 2019/11
SCCD Chengdu, Sichuan Province 104.08, 30.66 2019/10
SXAK Ankang, Shannxi Province 109.04, 32.69 2019/10
NMHH Huhhot, Neimenggu Province 111.76, 40.85 2019/10
GDGZ Guangzhou, Guangdong Province 113.27, 23.14 2019/10
HBWH Wuhan, Hubei Province 114.31, 30.60 2019/09
JXSR Shangrao, Jiangxi Province 117.95, 28.46 2019/10
SDLY Linyi, Shandong Province 118.36, 35.11 2019/10
FJFZ Fuzhou, Fujian Province 119.30, 26.08 2019/09
NMHB Hulun Buir, Neimenggu Province 120.19, 50.25 2019/09
ZJHZ Hangzhou, Zhejiang Province 120.22, 30.25 2019/09
LNHL Huludao, Liaoning Province 120.84, 40.72 2019/09
Open in a new tab

Fig. 1. Collection site and geographical distribution of the mitochondrial cox1 haplotypes of Drosophila melanogaster.

Fig. 1

Open in a new tab

The haplotype frequency for each population is represented by colors in the pie charts. See Table 1 for population codes. Four of the five population groups identified in population genetic structure analysis are marked by circles: NW northwest, SW southwest, SE southeast, NE northeast. The rest of the populations formed the CE (central) group.

Mitochondrial gene amplification and sequencing

To characterize the mitochondrial variation and validate correct identification of the specimens, a fragment of the cox1 gene involving the DNA barcoding region of insects was sequenced using the universal primer pairs AF (5’-GGTCAACAAATCATAAAGATATTGG-3’) and AR (5’-TAAACTTCAGGGTGACCAAAAAATCA-3’) (Folmer et al., 1994). Polymerase chain reaction (PCR) was conducted using the Mastercycler Pro system (Eppendorf, Germany) in a 10 μL volume consisting of 0.5 µL of template DNA (5–20 ng/µL), 0.5 µL of LA Taq (Takara Biomedical, Japan, 5 U/μL), 1 µL of LA PCR Buffer II (Mg2+), 0.16 µL of forward primer (10 mM), 0.16 µL of reverse primer (10 mM), and 7.68 µL of ddH2O. The thermal profiles for DNA amplification were as follows: 4 min at 94 °C; 35 cycles of 30 s at 94 °C, 30 s at 52 °C, and 60 s at 72 °C, followed by a final 10-min extension at 72 °C. Amplified products were purified and sequenced on an ABI 3730xl DNA Analyzer by TianYi HuiYuan Biotechnology Co. Ltd (Beijing, China).

Microsatellite marker development and genotyping

We developed genome-wide microsatellites from the D. melanogaster genome (accession PGRM00000000). The QDD3 program (Meglecz et al., 2010) was used to extract microsatellites along with their flanking sequences (300 bp each) from the scaffolds, and to design the primers. According to previous reports, dinucleotide microsatellites are prone to polymerase slippage during the amplification process, which may lead to mistyping, so multi- (including tri-, tetra-, penta-, and hexa-) nucleotide loci were preferentially selected in this study. The criteria and parameters of primer design for the isolated microsatellite markers followed Cao et al. (2016a). Next, the output primers were further filtered manually using more stringent criteria: (i) only perfect (without repeat region interruptions) loci were retained; (ii) the minimum distance between the 3′ end of two primer pairs and their target region had to be >10 bp; and (iii) primers using the “A” design strategy that do not have multiple microsatellites, nanosatellites, or homopolymers in the amplicon were retained. A total of 60 primer pairs were ultimately screened out, which were used for further isolation of polymorphic microsatellite loci.

The 60 primer pairs were initially chemically synthesized by Tsingke Biotechnology Co. Ltd (Beijing, China), with a universal primer (CAGGACCAGGCTACCGTG) added to the 5′ end of the forward primers based on the method of Blacket et al. (2012). One individual D. melanogaster from each of the 16 populations was randomly selected to test the polymorphism level of target microsatellite sequences and the amplification efficiency of synthesized primers. The PCR amplification reaction was carried out in a 10 μL volume consisting of 0.5 µL of template DNA (5–20 ng/µL), 5 µL of Master Mix (Promega, Madison, WI, USA), 0.08 µL of PC tail modified forward primer (10 mM), 0.16 µL of reverse primer (10 mM), 0.32 µL of fluorescence-labeled PC tail (10 mM), and 3.94 µL of ddH2O. The thermal profiles for DNA amplification were as follows: 4 min at 94 °C; 35 cycles of 30 s at 94 °C, 30 s at 56 °C, and 45 s at 72 °C, followed by a final 10-min extension at 72 °C. The amplified PCR fragments were analyzed on an ABI 3730xl DNA Analyzer (Applied Biosystems) using the GeneScan 500 LIZ size standard (Applied Biosystems). Genotyping was conducted using GENEMAPPER 4.0 (Applied Biosystems, USA). Primer pairs that failed in the PCR amplification for more than two individuals, that were monomorphic in tested individuals, or that produced more than two peaks were discarded (Table 2).

Table 2.

Fifteen microsatellite markers developed to genotype Drosophila melanogaster in this study.

Locus Chr. Position Repeat motif Allele number Size range (bp) Forward primer (5’-3’) Reverse primer (5’-3’)
S04 2L 2,932,573 AGC 6 136–149 CTTCGCCTTTCCAGCTTTGT GTCGTAGTTGTGTCGCTGTC
S09 2R 23,181,060 AGC 10 135–175 GGGCTTCCTCATCCGGAATT GCCCACCTCGCTGATAATTG
S10 2R 12,896,467 AGCC 21 141–229 GTCCTTAGTCGAACCGCTCT CACGAGCGACCATTGCATTT
S14 2R 13,082,536 AGC 9 159–194 TTGCTTTGTCTGATTGCGGA CGAATCTGGCAACTGTGGAG
S17 2L 3,419,414 AGC 8 183–206 TCCGTTCCCATTCTTCTCGG GCTCCGGCTGCAACTTAATT
S18 3L 12,644,547 AGC 8 181–214 CAAGGCAGAGCATCACCATC CAAACTCACTTCCTGCGCTG
S28 3R 15,812,776 ACT 3 223–235 ATCCACGTCCCACCAGAAG AAACGCACAACAACGCCATA
S39 2L 21,941,431 ATCCG 9 265–304 AAACGCATTTGCCCACCTTT GGCACCGAACATCAATCTCC
S41 2L 9,658,593 AGC 11 290–325 AGTTAACAAGTGACACGCCC ATCTCGAATCGCCTTGGCTA
S42 2L 16,449,207 ACC 6 287–305 TATTTAAGGGCATGGCGGGT GCCACGAGGAATTGGACATC
S44 2R 11,206,856 AGC 8 312–337 GAGGTCGGTGAAAGGAGTGG CGATCATCATTCTGCCGCAA
S47 2R 13,921,847 AGCC 11 307–357 GGTGCGCTCCTTAATGTCAG ATGCATAAAGGTCCGGCAAG
S48 3R 5,290,483 AGG 4 324–336 GCTTCCCTCTCCAATTCTGC ATGGATGGGCACTAACGGAA
S52 3L 13,589,683 AGC 7 350–367 GCCTTGCCAAGTTTCCAGTT AAGCACACCATATCGCAGAC
S55 3L 8,663,943 ATC 7 343–359 GTTGTTGAAAGCGATTGCCC CTTGTTGACGCGGCATCTAA
Open in a new tab

Allele number and size range for each locus was calculated from 16 populations of Drosophila melanogaster in this study.

Chr. chromosome.

Identification of relatives within populations

We identified relatives within each population to reduce the influence of close relatives on genetic diversity and population structure analysis. The software of SPAGeDi v 1.5 (Hardy & Vekemans, 2002) was used to calculate Loiselle’s K based on microsatellite loci. Kinship among individuals was identified based on the K scores of pairwise individuals. The maximum K value among individual pairs with different mitochondrial cox1 haplotypes was used as a standard to discriminate the related pairs. Individual pairs with K values larger than the standard were considered as relatives.

Genetic diversity analysis

For the mitochondrial cox1 gene, sequencing results from both strands were assembled into a consensus sequence using the software SEQMAN in LASERGENE version 7.1.2 (DNASTAR, Inc., USA). Sequences from all individuals were aligned using CLUSTALW (Thompson et al., 1994) implemented in MEGA version 7 (Kumar et al., 2016). The number of polymorphic sites (S), haplotype diversity (h), and nucleotide diversity (π) were analyzed in DnaSP version 5.10 (Librado & Rozas, 2009).

For microsatellite loci, the genotyping results were corrected with the software MICRO-CHECKER (van Oosterhout et al., 2004). The number of alleles, observed heterozygosity (HO), and expected heterozygosity (HE) were calculated in the Microsoft Excel microsatellite toolkit version 3.1 (Park, 2001). Deviation from Hardy–Weinberg equilibrium (HWE) at each locus/population combination, linkage disequilibrium (LD) among loci within each population, and pairwise mean population differentiation (FST) were examined using GENEPOP 4.2.1 (Rousset, 2008). We compared the total number of alleles (AT), standardized number of alleles (AS), and standardized expected heterozygosity (HES) among populations with different sample sizes using a rarefaction method in GENCLONE (Arnaud‐Haond & Belkhir, 2007). Allelic richness (AR) and allelic richness of private alleles (PAR) were calculated with a rarefaction approach in HP-RARE version 1.1 (Kalinowski, 2005) on a minimum sample size of 12 diploid individuals. Finally, the inbreeding coefficient (Fis) within populations was estimated by FSTAT version 2.9.3 (Goudet, 2017).

Phylogenetic relationship and population genetic structure analysis

For mitochondrial DNA, a neighbor-joining phylogenetic tree was constructed by MEGA version 7 (Kumar et al., 2016) to examine phylogenetic relationships among mitochondrial cox1 haplotypes of D. melanogaster from different sampling locations worldwide. Apart from sequences obtained in this study, we searched orthologous cox1 gene sequences from NCBI nucleotide database and included those with sampling locations in phylogenetic analysis (Nunes et al., 2008a, b). A Kimura two-parameter distance model was used in the tree inference as suggested by analysis in PartitionFinder version 1.1.1 (Lanfear et al., 2012). We conducted a bootstrap test with 1000 replicates.

For microsatellite loci, a Bayesian cluster method implemented in STRUCTURE version 2.3.4 (Pritchard et al., 2000) and a discriminant analysis of principal components (DAPC) were used, respectively, to investigate genetic structure across the populations. In the STRUCTURE analysis, 30 replicates for each K (from 1 to 10) were run with 200,000 Markov Chain Monte Carlo iterations after a burn-in of 100,000 iterations. The optimal K value was obtained using the delta (K) method by submitting output results of STRUCTURE to the online software of STRUCTURE HARVESTER version 0.6.94 (Earl, 2012) (http://taylor0.biology.ucla.edu/structureHarvester/). CLUMPP version 1.1.2 (Jakobsson & Rosenberg, 2007) based on the greedy algorithm was used to combine the membership coefficient matrices (Q‐matrices) of replicated runs for each K from STRUCTURE HARVESTER, and DISTRUCT version 1.1 (Rosenberg, 2004) was applied to prepare the visual representation. We ran a DAPC analysis in the R package ADEGENET 1.4-2 (Jombart et al., 2008) to identify genetic clusters among sampling individuals. DAPC analyses do not rely on any biological assumptions, providing a supplement to model-based STRUCTURE analysis.

Demographic history analysis

We used the approximate Bayesian computation, a model-based method, implemented in DIYABC version 2.1.0 (Cornuet et al., 2014), to infer the demographic history of D. melanogaster in China using the microsatellite data. This method allows a comparison of competing scenarios and incorporates unsampled populations in the analysis (Bertorelle et al., 2010). It has proven to be a powerful approach to test complex population genetic models in many species (Fraimout et al., 2017; Lombaert et al., 2014; Stone et al., 2017; Wei et al., 2015). In the analysis, we considered the relationship between the NW (XJKL) group, SW (SCPZ and YNDH) group, and CE (QHXN, YNKM, SCCD, SXAK, NMHH, HBWH, JXSR, SDLY, FJFZ, NMHL, and ZJHZ) group by comparing 18 competing scenarios involving three types of dispersal models (scenarios 1–6: any two groups were sequentially from the other group; scenarios 7–12: one group was an admixture of the other two; scenarios 13–18: the three groups dispersed in a stepping stone way) (Supplementary Fig. S1). We tested these scenarios using 22 datasets generated from one population of each group. Comparison of competing scenarios, estimation of posterior distributions of demographic parameters, model checking and evaluation of confidence in scenario choice, and accuracy of parameter estimation were performed following methods of previous studies (Cao et al., 2016b; Wei et al., 2015). Priors of each parameter involving in each scenario are shown in Supplementary Table S1.

Partitioning geographic and climate effects on genetic variation

To evaluate the effect of geographical separation and environmental factors on genetic differentiation of D. melanogaster, isolation by distance (IBD) and isolation by environment (IBE) analyses were performed. For IBD analysis, the correlation coefficient between pairwise population differentiation (calculated by FST/(1 – FST)) and geographic distance was estimated using the R package ade4, with 10,000 permutations. For IBE analysis, 19 standard bioclimatic variables for each sampling location across China were downloaded from WorldClim database version 2 with a spatial resolution of 10 min, and other parameter settings were identical to those in the IBD analysis.

To examine the extent to which genetic distance based on microsatellite genotypes was explained by geographical and environmental factors and by their interaction, a multivariate redundancy analysis (RDA) was performed. As a constrained linear ordination method, RDA combines multiple linear regression and principal component analysis. The geographic information and climate data for 16 different sampling sites were used, as for the IBD and IBE analyses above. Genetic distance between populations (not individuals) was computed. Before RDA analysis, the matrices of pairwise geographic distances were transformed into principal components of neighborhood matrices (PCNM) with the pcnm function implemented in the R package vegan (https://github.com/vegandevs/vegan), and only the first half of positive eigenvectors was used as explanatory variables of genetic variance among populations. To avoid the high collinearity among explanatory variables, a standard value of variance inflation factor (VIF) was set in advance; any candidate variables with VIF value higher than 10 were excluded as described in Cao et al. (2019). This led to three geographic variables (PCNM1, PCNM2, and PCNM4) and five climate variables (bio2, mean diurnal air temperature range; bio3 isothermality, bio5, maximum temperature of warmest month; bio13, precipitation of the wettest month; and bio15, precipitation seasonality) being retained in the model. Both the full RDA (environmental variables and geographical components) and partial RDA (environmental variables or geographical components) analyses were performed using the vegan package in R. With a full RDA model, the degree of geography, environment, and their collinear proportion were analyzed, while the independent effect of the environment was estimated using the partial RDA model in which geographic effects were constrained.

Results

Mitochondrial haplotype diversity and phylogeny

After removing one of the individuals from pairs of relatives (in total, 58 removed), there were 272 individuals available for analysis. Fourteen mitochondrial haplotypes were identified in these individuals from the 16 populations collected across China (Fig. 1). Hap01 was dominant in all the populations. Hap02 was mainly found in populations from western China, excepting XJKL and YNDH. In addition, populations from the western and southwest areas, except for XJKL and YNDH, possessed a higher number of haplotypes than most populations from the central and eastern areas. Populations from SXAK adjacent to the southwestern regions of China showed the highest level of mitochondrial DNA diversity, with the highest values for both haplotype diversity (Hd) and nucleotide diversity (Pi) (Table 3). NMHH and GDGZ populations also exhibited relatively high diversity, as indicated by Hd and Pi.

Table 3.

Population genetic diversity of Drosophila melanogaster collected from China.

Population Mitochondrial DNA Microsatellite loci
N H Hd Pi S AR PAR AT AS Ho HET FIS
XJKL 17 1 0.000 0.00000 0 3.70 0.04 59 55.49 0.526 0.535 0.018
YNDH 20 2 0.189 0.00036 1 3.72 0.02 64 57.79 0.562 0.535 –0.074
SCPZ 15 4 0.467 0.00098 3 3.76 0.05 60 56.45 0.507 0.510 0.006
QHXN 17 3 0.324 0.00065 2 4.21 0.10 72 63.11 0.553 0.556 0.005
YNKM 14 3 0.473 0.00094 2 4.32 0.07 69 67.35 0.574 0.602 0.031
SCCD 15 3 0.448 0.00090 2 4.40 0.14 81 75.59 0.499 0.575 0.076
SXAK 20 5 0.616 0.00356 10 4.28 0.13 74 64.23 0.620 0.596 –0.041
NMHH 14 2 0.538 0.00103 1 4.09 0.08 64 61.23 0.581 0.553 –0.052
GDGZ 12 3 0.545 0.00405 7 3.93 0.12 59 59.00 0.528 0.535 0.013
HBWH 17 1 0.000 0.00000 0 4.05 0.01 66 60.58 0.549 0.549 –0.001
JXSR 17 2 0.118 0.00022 1 4.05 0.15 67 60.77 0.573 0.541 –0.059
SDLY 29 3 0.135 0.00039 3 4.38 0.16 96 70.94 0.558 0.589 0.013
FJFZ 16 1 0.000 0.00000 0 4.01 0.07 69 63.48 0.544 0.556 –0.014
NMHB 16 2 0.125 0.00048 2 3.98 0.05 75 67.48 0.552 0.593 0.020
ZJHZ 16 1 0.000 0.00000 0 4.22 0.12 70 63.84 0.547 0.576 0.042
LNHL 19 2 0.105 0.00020 1 4.14 0.11 71 62.53 0.514 0.536 0.035
Open in a new tab

N number of individuals used in the analysis, H number of haplotypes, Hd haplotype diversity, Pi nucleotide diversity, S number of polymorphic sites, AR average allelic richness for 12 individuals per population, PAR private allelic richness for 12 individuals per population, AT total number of alleles, As standardized total number of alleles (for 12 individuals), Ho observed heterozygosity, HET expected heterozygosity, FIS inbreeding coefficient.

We related Chinese haplotypes in this study to cosmopolitan haplotypes by including D. melanogaster cox1 haplotypes from previous reports into the analysis. The results showed that 14 of 23 currently identified mitochondrial haplotypes could be found in China, and 10 of them were unique to China (Fig. 2). The phylogenetic relationships among all haplotypes indicated that Hap12 (unique to YNKM) and Hap 2 (from NMHH, SDLY, SCCD, SXAK, YNKM, SCPZ, QHXN, and Hsinchu of Taiwan) in China were relatively ancestral, following the African haplotypes Hap19 and Hap 20.

Fig. 2. Neighbor-joining phylogenetic relationships among mitochondrial cox1 haplotypes of Drosophila melanogaster worldwide.

Fig. 2

Open in a new tab

Hap1 to Hap 14 were found in this study, while Hap15 to Hap23 were reported in previous studies. The haplotypes unique to China are in red. Drosophila simulans was used as the outgroup.

Microsatellite marker development and genetic diversity

The QDD3 program provided 63,888 primer pairs, which included 50,412 tri-, 10,070 tetra-, 1651 penta-, and 1755 hexa-nucleotide microsatellites. Following our stringent filter, a total of 60 primer pairs flanking perfect microsatellites were retained. Among them, the number of primer pairs flanking tri-, tetra-, and penta-nucleotide microsatellites was 55, 4, and 1, respectively. In our initial test of these 60 primer pairs, 15 pairs generated polymorphic genotypes, 15 pairs failed to generate amplification in any individuals, and 30 pairs failed in more than two individuals. Finally, 15 microsatellite markers were retained for population-level genotyping (Table 2).

The genetic diversity in 16 populations of D. melanogaster from China was evaluated using the 15 developed microsatellite markers. Significant departures from HWE (p < 0.05) were detected in 18 of the 240 population-locus combinations after sequential Bonferroni correction. However, multi-locus tests revealed that none of the 16 populations departed consistently from HWE. In addition, 65 of 1680 locus-locus pairs showed LD in at least one population (p < 0.05), whereas 2 (S04–S39 pair on the Chromosome 2L, and S10–S44 pair on the Chromosome 2R) of 105 locus pairs showed LD across all populations. Inversions could produce LD between distantly located loci on the same chromosome, but the two members had not been identified in the same inversion fragment for any LD pairs by referring to the website PopFly (http://popfly.uab.cat/) (Hervas et al., 2017). Perhaps new inversions exist in the chromosomes of D. melanogaster from China. Genetic diversity parameters (Table 3 and Supplementary Fig. S2) varied among populations, and most of the southwest populations except for YNDH showed relatively high values of diversity, including the average allelic richness (AR) and the standardized total number of alleles (AS), when compared to central and eastern populations.

There was no significant correlation in the diversity parameters between microsatellite loci and mitochondrial cox1. The association was significant for pairs of parameters estimated from the same type of genetic markers, such as Hd vs Pi (r = 0.78, p < 0.001), Pi vs S (r = 0.93, p < 0.001), AR vs AS (r = 0.84, p < 0.001), and AR vs HET (r = 0.74, p < 0.001).

Population genetic structure

For the microsatellite loci, pairwise FST values ranged from 0 to 0.11, with an average FST value of 0.03 (Table 4 and Supplementary Table S2). Among them, XJKL, GDGZ, NMHB, and LNHL showed the highest level of genetic differentiation from the other populations. Contingency tests (based on likelihood ratios) on genotype frequencies across populations revealed that most pairwise FST estimates were significantly different (p < 0.05, Table 4).

Table 4.

Pairwise population differentiation (FST, lower triangle) and their statistical significance (p values from exact G test, upper triangle) among 16 populations of Drosophila melanogaster based on microsatellites.

Population XJKL YNDH SCPZ QHXN YNKM SCCD SXAK NMHH GDGZ HBWH JXSR SDLY FJFZ NMHB ZJHZ LNHL
XJKL <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01
YNDH 0.09 <0.01 <0.01 <0.01 0.03 <0.01 <0.01 <0.01 <0.01 0.01 <0.01 0.01 <0.01 <0.01 <0.01
SCPZ 0.07 0.02 <0.01 0.22 0.70 0.02 0.02 <0.01 <0.01 0.09 0.10 0.02 <0.01 0.01 <0.01
QHXN 0.04 0.06 0.04 0.07 0.04 0.39 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01
YNKM 0.05 0.02 <0.01 0.02 0.52 0.33 0.41 <0.01 <0.01 0.07 0.07 0.04 <0.01 0.09 <0.01
SCCD 0.04 0.01 <0.01 0.02 <0.01 0.48 0.21 <0.01 <0.01 0.45 0.78 0.19 <0.01 0.24 0.04
SXAK 0.05 0.03 0.02 <0.01 <0.01 0.01 0.37 <0.01 0.15 0.01 <0.01 <0.01 0.15 0.04 <0.01
NMHH 0.08 0.04 0.02 0.04 <0.01 0.01 <0.01 <0.01 <0.01 0.02 0.06 <0.01 <0.01 <0.01 <0.01
GDGZ 0.11 0.05 0.05 0.07 0.05 0.05 0.05 0.07 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01
HBWH 0.05 0.03 0.02 0.03 0.02 0.02 0.02 0.04 0.03 <0.01 <0.01 <0.01 <0.01 0.02 <0.01
JXSR 0.07 0.02 <0.01 0.03 0.01 <0.01 0.01 0.02 0.04 0.02 0.22 <0.01 <0.01 0.04 <0.01
SDLY 0.05 0.02 <0.01 0.02 <0.01 –0.01 0.01 0.01 0.04 0.01 <0.01 0.04 <0.01 0.04 0.02
FJFZ 0.09 0.02 0.02 0.06 0.01 0.01 0.03 0.04 0.04 0.04 0.03 0.02 <0.01 <0.01 <0.01
NHHB 0.06 0.06 0.05 0.03 0.03 0.03 0.01 0.04 0.06 0.03 0.03 0.02 0.07 0.02 <0.01
ZJHZ 0.07 0.03 0.02 0.02 0.01 <0.01 0.01 0.03 0.07 0.03 0.01 <0.01 0.04 0.01 0.02
LNHL 0.06 0.06 0.03 0.03 0.02 0.02 0.04 0.06 0.06 0.04 0.03 0.01 0.04 0.04 0.01
Open in a new tab

STRUCTURE analysis indicated that almost all populations could not be well separated when K increased from 3 to 6, aside from XJKL when K = 5 and K = 6 (Fig. 3a). Some correlation was found between the proportion of some clusters and the longitudinal distribution of populations (the blue cluster when K = 5: R2 = 0.449, p < 0.001; the yellow cluster when K = 6: R2 = 0.386, p < 0.001). DAPC results showed a similar pattern of population differentiation as that revealed by the STRUCTURE analysis, with XJKL and LNHL populations forming outliers and the other populations clumping together (Fig. 3b).

Fig. 3. Population genetic structure of 16 Drosophila melanogaster populations from China based on 15 microsatellite loci.

Fig. 3

Open in a new tab

a Genetic structure inferred from STRUCTURE and b DAPC analysis. The optimal number of clusters for the STRUCTURE analysis was five; K = 3, 4, 5, and 6 are presented (a) with populations arranged from west to east. DAPC analysis shows LNHL, XJKL, GDGZ, and NMHB to be outlier populations (b).

Demographic history of D. melanogaster in China

In the DIYABC analysis, scenarios 8, 13, and 14 were supported with the highest posterior probabilities by 4, 5, and 13 out of 22 datasets, respectively (Supplementary Table S3). All of these three scenarios assumed that the NW group was ancestral of D. melanogaster in China. The posterior probability in datasets supporting scenarios 8, 13, and 14 ranged from 0.115 to 0.276, from 0.207 to 0.276, and from 0.170 to 0.285, respectively (Supplementary Table S3). The sum of posterior probabilities for all scenarios in each dataset that support the NW (scenarios 1, 2, 7, 8, 13, and 14), CE (scenarios 3, 4, 9, 10, 15, and 16), and SW (scenarios 5, 6, 11, 12, 17, and 18) origin ranged from 0.534 to 0.903, from 0.055 to 0.321, and from 0.032 to 0.182, respectively.

Geographic and climate effects on genetic variance

Mantel tests indicated an extremely significant association between genetic distance and geographical distance (r = 0.5253, p = 0.0014; Fig. 4a) and environmental distance (r = 0.344, p = 0.009; Fig. 4b) for all sampling individuals from China.

Fig. 4. Scatter plots of isolation by geograhical distance and environment for all populations of Drosophila melanogaster in China.

Fig. 4

Open in a new tab

a Correlations between population genetic differentiation ((FST/(1 – FST)), geographical distance, and b environmental distance analyzed by Mantel tests Genetic differentiation was calculated based on 15 microsatellite loci. Correlation coefficients (r) and p values are given.

A full RDA model showed that only 9.1% of the total genetic variance could be explained by the effect of geography, the environment, and their interaction. For the explained genetic variance, independent effects of environmental conditions and geography accounted for 62.10% and 31.58%, respectively, while their collinear component accounted for 6.32%. When environmental and geographic effects were considered simultaneously in the full RDA analysis, two climatic variables (bio3 (isothermality) and bio13 (precipitation of the wettest month)) and two geographic variables (PCNM3 and PCNM4) were correlated with genetic distance (Supplementary Fig. S3). When geographic variables were constrained in the RDA analysis, three environmental variables (bio2 (mean diurnal air temperature range), bio13 (precipitation of the wettest month), and bio15 (precipitation seasonality)) were correlated with genetic distance (Fig. 5).

Fig. 5. Partial RDA analysis on genetic variance explained environmental variables when geographical variables were constrained.

Fig. 5

Open in a new tab

Individuals from the same population are represented by dots with the same color. The blue vectors are the environmental predictors used in this study, and arrows indicate the strength of correlations between the environmental variable and genetic variance. Five climate variables were included in analysis: bio2 (mean diurnal air temperature range), bio3 (isothermality), bio5 (maximum temperature of warmest month), bio13 (precipitation of the wettest month), and bio15 (precipitation seasonality).

Discussion

Distribution of genetic diversity in D. melanogaster from China

The mitochondrial data in this study showed that Chinese populations had a large number of unique haplotypes, and some of them were previously undescribed (Fig. 2). The high differentiation between Asian D. melanogaster and populations from other parts of the world has been noted in previous studies (Hale & Singh, 1991; Nunes et al., 2008a; Schlötterer et al., 2006). A founder event (bottleneck) occurring in the early phase of colonization may be one reason for the high genetic divergence between Chinese populations and other populations. A “Far Eastern Race” has previously been theorized to explain differentiation in D. melanogaster between Asian and other populations, reflecting independent colonization events during the out-of-Africa habitat expansion of D. melanogaster into the Asian area (David & Capy, 1988). However, this theory has been questioned because of a lack of genomic evidence from Southeast Asian samples (Laurent et al., 2011). Further analyses that include multiple Asian and African populations from across these regions are needed to test these historical connections (Arguello et al., 2019).

In addition, both the mitochondrial variation and microsatellite data showed that, with a few exceptions, southwest China populations had relatively high levels of genetic polymorphism as measured by haplotype diversity (Hd), nucleotide diversity (Pi), average allelic richness (AR), and standardized total number of alleles (AS), when compared to most populations from eastern regions of China (Table 3). Further studies by including samples from and outside China may help to adequately examine this pattern of genetic diversity as well as its underlying evolutionary processes.

Population genetic structure of D. melanogaster in China

Pairwise FST results among the sampled populations revealed relatively low levels of population differentiation, with an average value of 0.031 (Table 4). The low-level divergence among D. melanogaster populations within China might be attributed to a lack of time for genetic drift to occur in the absence of strong bottlenecks. Similarly, low levels of differentiation have also been documented within the European population and between populations on different continents that may have recent European ancestry (e.g. Australia, North America) (Nunes et al., 2008a, b; Kapun et al., 2020). In contrast, higher levels of differentiation have usually been found between populations from southeast Asia and Oceania (Schlötterer et al., 2006). Nevertheless, we were able to find some differentiation among populations. In particular, XJKL, GDGZ, NMHB,1 and LNHL, which were from the westernmost, southernmost, northernmost, and easternmost collection points in the current study, showed the highest genetic differentiation from other populations (Supplementary Table S2).

Demographic history of D. melanogaster in China

Our DIYABC analysis showed that scenarios of the northwestern origin of the D. melanogaster in China have the highest posterior probabilities. Although DIYABC analysis has proven to be a powerful approach in exploring the genetic relationship among the sampled or unsampled populations by comparing potential competing scenarios (Bertorelle et al., 2010), it should be acknowledged that limited coverage of sampling and a lack of potential source populations may bias the results. We found that the posterior probability for the best-fit scenario in each dataset was very low in our study. This is our best estimate, but it provides weak support. Thus, our results cannot be used to reach a robust conclusion, especially in the absence of additional samples from the northwest and outside of China. Additional populations should be further sampled in an ensuing study to validate the dispersal history of D. melanogaster into and within China.

Ecological adaptation of D. melanogaster in China

Despite low FSTs (Table 4), we did find a potential longitudinal pattern accompanied by admixture (blue cluster when K = 5, yellow cluster when K = 6 in Fig. 3a; Fig. 4b), and RDA analysis suggests that precipitation may have had an impact on patterns of genetic variation in Chinese populations of D. melanogaster (Fig. 5). Consistent with the RDA results, the XJKL and LNHL populations, which came from the driest and wettest regions among our sampling locations, had the highest levels of differentiation from other populations, as revealed by the DAPC and FST analyses. Adult D. melanogaster is sensitive to ambient humidity, and precipitation is usually regarded as one of the most important ecological factors limiting the distribution ranges of this species in nature (Gibbs et al., 1997; Hoffmann & Parsons, 1993). Laboratory selection in D. melanogaster can lead to rapid adaptation to desiccation stress (Telonis-Scott et al., 2016). Previously published work has shown genetically determined clinal variation in D. melanogaster along precipitation gradients (Hoffmann et al., 2001; Karan & Parkash, 1998; Parkash & Munjal, 2000). Our results may, therefore, partly reflect strong selection and adaptation in natural populations of D. melanogaster assuming some linkage between the microsatellite markers and traits under selection, which would be enhanced for microsatellite markers located within D. melanogaster inversion polymorphisms that respond rapidly to clinal selection (Kennington et al., 2006). Furthermore, an association between environmental factors and genetic structure over and above geographical distance could reflect patterns of genetic exchange driven by environmental conditions, which in themselves might reflect trade, given that regions with similar climates should support similar types of fruit production. Given the overall rapid decay of LD in parts of the D. melanogaster genome, these patterns need to be further investigated with high-density markers such as SNPs. Sampling will need to be robust because FST values were low and because the factors we considered here only accounted for around 9% of the genetic variance among populations.

Conclusion

In this study, we considered the population genetic structure of D. melanogaster across China. We found low levels of genetic differentiation, high levels of admixture, and isolation by geographical and environmental factors in this species. China covers a range of climatic conditions within a complex topography where there has been a long history of human colonization. This context provides an opportunity for further research with D. melanogaster populations, such as in linking putative adaptive polymorphisms to climatic selection (Hoffmann et al., 2003) and in understanding the role of inversions in local adaptation by testing for parallel patterns across different continents (Kapun et al., 2018).

Supplementary information

Supplemental information (838.6KB, docx)
Supplemental information (15.9KB, xlsx)

Acknowledgements

We thank De-Qiang Pu, Qian Li, Xiang-Zhao Yue, Kai Liu, Jia-Ying Zhu, Li-Na Sun, and Jin-Yu Li for their help on the collection of the samples. This research was funded by the National Natural Science Foundation of China (32070464), the Joint Laboratory of Pest Control Research Between China and Australia (Beijing Municipal Science & Technology Commission, 201100008320013), Beijing Postdoctoral Research Foundation (2020-22-108), and Beijing Key Laboratory of Environmental Friendly Management on Pests of North China Fruits (BZ0432).

Data availability

Mitochondrial genes and microsatellite data generated in this study were deposited to the Dryad database: 10.5061/dryad.37pvmcvgv.

Compliance with ethical standards

Conflict of interest

The authors declare no competing interests.

Footnotes

Associate Editor Darren Obbard

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Li-Jun Cao, Email: gmatjhpl@163.com.

Shu-Jun Wei, Email: shujun268@163.com.

Supplementary information

The online version contains supplementary material available at 10.1038/s41437-021-00419-8.

References

  1. Arguello JR, Laurent S, Clark AG. Demographic history of the human commensal Drosophila melanogaster. Genome Biol Evolution. 2019;11(3):844–854. doi: 10.1093/gbe/evz022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Arguello JR, Cardoso-Moreira M, Grenier JK, Gottipati S, Clark AG, Benton R. Extensive local adaptation within the chemosensory system following Drosophila melanogaster’s global expansion. Natrue Commun. 2016;7:11855. doi: 10.1038/ncomms11855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Arnaud‐Haond S, Belkhir K. GENCLONE: a computer program to analyse genotypic data, test for clonality and describe spatial clonal organization. Mol Ecol Notes. 2007;7(1):15–17. [Google Scholar]
  4. Bergland AO, Tobler R, González J, Schmidt P, Petrov D. Secondary contact and local adaptation contribute to genome‐wide patterns of clinal variation in Drosophila melanogaster. Mol Ecol. 2016;25(5):1157–1174. doi: 10.1111/mec.13455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bertorelle G, Benazzo A, Mona S. ABC as a flexible framework to estimate demography over space and time: some cons, many pros. Mol Ecol. 2010;19(13):2609–2625. doi: 10.1111/j.1365-294X.2010.04690.x. [DOI] [PubMed] [Google Scholar]
  6. Blacket MJ, Robin C, Good RT, Lee SF, Miller AD. Universal primers for fluorescent labelling of PCR fragments-an efficient and cost-effective approach to genotyping by fluorescence. Mol Ecol Resour. 2012;12(3):456–463. doi: 10.1111/j.1755-0998.2011.03104.x. [DOI] [PubMed] [Google Scholar]
  7. Bradburd GS, Ralph PL. Spatial population genetics: it’s about time. Annu Rev Ecol, Evolution, Syst. 2019;50(1):427–449. [Google Scholar]
  8. Cao LJ, Wei SJ, Hoffmann AA, Wen JB, Chen M. Rapid genetic structuring of populations of the invasive fall webworm in relation to spatial expansion and control campaigns. Diversity Distrib. 2016;22(12):1276–1287. [Google Scholar]
  9. Cao LJ, Li ZM, Wang ZH, Zhu L, Gong YJ, Chen M, et al. Bulk development and stringent selection of microsatellite markers in the western flower thrips Frankliniella occidentalis. Sci Rep. 2016;6:26512. doi: 10.1038/srep26512. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cao LJ, Gao YF, Gong YJ, Chen JC, Chen M, Hoffmann A, et al. Population analysis reveals genetic structure of an invasive agricultural thrips pest related to invasion of greenhouses and suitable climatic space. Evolut Appl. 2019;12(10):1868–1880. doi: 10.1111/eva.12847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cornuet J-M, Pudlo P, Veyssier J, Dehne-Garcia A, Gautier M, Leblois R, et al. DIYABC v2.0: a software to make approximate Bayesian computation inferences about population history using single nucleotide polymorphism, DNA sequence and microsatellite data. Bioinformatics. 2014;30(8):1187–1189. doi: 10.1093/bioinformatics/btt763. [DOI] [PubMed] [Google Scholar]
  12. David JR, Capy P. Genetic variation of Drosophila melanogaster natural populations. Trends Genet. 1988;4(4):106–111. doi: 10.1016/0168-9525(88)90098-4. [DOI] [PubMed] [Google Scholar]
  13. Duchen P, Živković D, Hutter S, Stephan W, Laurent S. Demographic inference reveals African and European admixture in the North American Drosophila melanogaster population. Genetics. 2013;193(1):291–301. doi: 10.1534/genetics.112.145912. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Earl DA. STRUCTURE HARVESTER: a website and program for visualizing STRUCTURE output and implementing the Evanno method. Conserv Genet Resour. 2012;4(2):359–361. [Google Scholar]
  15. Flatt T. Genomics of clinal variation in Drosophila: disentangling the interactions of selection and demography. Mol Ecol. 2016;25(5):1023–1026. doi: 10.1111/mec.13534. [DOI] [PubMed] [Google Scholar]
  16. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol. 1994;3(5):294–299. [PubMed] [Google Scholar]
  17. Fraimout A, Debat V, Fellous S, Hufbauer RA, Foucaud J, Pudlo P, et al. Deciphering the Routes of invasion of Drosophila suzukii by Means of ABC Random Forest. Mol Biol Evolution. 2017;34(4):980–996. doi: 10.1093/molbev/msx050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gibbs AG, Chippindale AK, Rose MR. Physiological mechanisms of evolved desiccation resistance in Drosophila melanogaster. J Exp Biol. 1997;200(12):1821–1832. doi: 10.1242/jeb.200.12.1821. [DOI] [PubMed] [Google Scholar]
  19. Goudet J. FSTAT (Version 1.2): a computer program to calculate F-statistics. J Heredity. 2017;86(6):485–486. [Google Scholar]
  20. Hale LR, Singh RS. A comprehensive study of genic variation in natural populations of Drosophila melanogaster. IV. Mitochondrial DNA variation and the role of history vs. selection in the genetic structure of geographic populations. Genetics. 1991;129(1):103–117. doi: 10.1093/genetics/129.1.103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hardy OJ, Vekemans X. SPAGeDi: a versatile computer program to analyse spatial genetic structure at the individual or population levels. Mol Ecol Notes. 2002;2(4):618–620. [Google Scholar]
  22. Hervas S, Sanz E, Casillas S, Pool JE, Barbadilla A. PopFly: the Drosophila population genomics browser. Bioinformatics. 2017;33(17):2779–2780. doi: 10.1093/bioinformatics/btx301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hoffmann AA, Parsons P. Selection for adult desiccation resistance in Drosophila melanogaster: fitness components, larval resistance and stress correlations. Biol J Linn Soc. 1993;48(1):43–54. [Google Scholar]
  24. Hoffmann AA, Weeks AR. Climatic selection on genes and traits after a 100 year-old invasion: a critical look at the temperate-tropical clines in Drosophila melanogaster from eastern Australia. Genetica. 2007;129(2):133. doi: 10.1007/s10709-006-9010-z. [DOI] [PubMed] [Google Scholar]
  25. Hoffmann AA, Sørensen JG, Loeschcke V. Adaptation of Drosophila to temperature extremes: bringing together quantitative and molecular approaches. J Therm Biol. 2003;28(3):175–216. [Google Scholar]
  26. Hoffmann AA, Hallas R, Sinclair C, Mitrovski P. Levels of variation in stress resistance in Drosophila among strains, local populations, and geographic regions: patterns for desiccation, starvation, cold resistance, and associated traits. Evolution. 2001;55(8):1621–1630. doi: 10.1111/j.0014-3820.2001.tb00681.x. [DOI] [PubMed] [Google Scholar]
  27. Jakobsson M, Rosenberg NA. CLUMPP: a cluster matching and permutation program for dealing with label switching and multimodality in analysis of population structure. Bioinformatics. 2007;23(14):1801–1806. doi: 10.1093/bioinformatics/btm233. [DOI] [PubMed] [Google Scholar]
  28. Jombart T. Adegenet: a R package for the multivariate analysis of genetic markers. Bioinformatics. 2008;24:1403–1405. doi: 10.1093/bioinformatics/btn129. [DOI] [PubMed] [Google Scholar]
  29. Kalinowski ST. HP-RARE 1.0: a computer program for performing rarefaction on measures of allelic richness. Mol Ecol Notes. 2005;5(1):187–189. [Google Scholar]
  30. Kao JY, Zubair A, Salomon MP, Nuzhdin SV, Campo D. Population genomic analysis uncovers African and European admixture in Drosophila melanogaster populations from the south‐eastern United States and Caribbean Islands. Mol Ecol. 2015;24(7):1499–1509. doi: 10.1111/mec.13137. [DOI] [PubMed] [Google Scholar]
  31. Kapun M, Barrón MG, Staubach F, Vieira J, Obbard DJ, Goubert C, et al. (2018). Genomic analysis of European Drosophila populations reveals longitudinal structure and continent-wide selection. bioRxiv: 313759 [DOI] [PMC free article] [PubMed]
  32. Kapun M, Barrón MG, Staubach F, Obbard DJ, Wiberg RAW, Vieira J et al. (2020) Genomic analysis of European Drosophila melanogaster populations reveals longitudinal structure, continent-wide selection, and previously unknown DNA viruses. Mol Biol Evol 37(9): msaa120 [DOI] [PMC free article] [PubMed]
  33. Karan D, Parkash R. Desiccation tolerance and starvation resistance exhibit opposite latitudinal clines in Indian geographical populations of Drosophila kikkawai. Ecol Entomol. 1998;23(4):391–396. [Google Scholar]
  34. Kauer M, Dieringer D, Schlotterer C. Nonneutral admixture of immigrant genotypes in African Drosophila melanogaster populations from Zimbabwe. Mol Biol Evolution. 2003;20(8):1329–1337. doi: 10.1093/molbev/msg148. [DOI] [PubMed] [Google Scholar]
  35. Keller A. Drosophila melanogaster’s history as a human commensal. Curr Biol. 2007;17(3):77–81. doi: 10.1016/j.cub.2006.12.031. [DOI] [PubMed] [Google Scholar]
  36. Kennington WJ, Partridge L, Hoffmann AA. Patterns of diversity and linkage disequilibrium within the cosmopolitan inversion In (3R) Payne in Drosophila melanogaster are indicative of coadaptation. Genetics. 2006;172(3):1655–1663. doi: 10.1534/genetics.105.053173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol Biol Evolution. 2016;33(7):1870–1874. doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lachaise D, Cariou M-L, David JR, Lemeunier F, Tsacas L, Ashburner M (1988). Historical biogeography of the Drosophila melanogaster species subgroup Evolutionary Biology. Springer, pp 159–225
  39. Lanfear R, Calcott B, Ho SYW, Guindon S. PartitionFinder: combined selection of partitioning schemes and substitution models for phylogenetic analyses. Mol Biol Evolution. 2012;29(6):1695–1701. doi: 10.1093/molbev/mss020. [DOI] [PubMed] [Google Scholar]
  40. Laurent SJ, Werzner A, Excoffier L, Stephan W. Approximate Bayesian analysis of Drosophila melanogaster polymorphism data reveals a recent colonization of Southeast Asia. Mol Biol Evolution. 2011;28(7):2041–2051. doi: 10.1093/molbev/msr031. [DOI] [PubMed] [Google Scholar]
  41. Leipe C, Long T, Sergusheva E, Wagner M, Tarasov P. Discontinuous spread of millet agriculture in eastern Asia and prehistoric population dynamics. Sci Adv. 2019;5(9):eaax6225. doi: 10.1126/sciadv.aax6225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Librado P, Rozas J. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics. 2009;25(11):1451–1452. doi: 10.1093/bioinformatics/btp187. [DOI] [PubMed] [Google Scholar]
  43. Lombaert E, Guillemaud T, Lundgren J, Koch R, Facon B, Grez A, et al. Complementarity of statistical treatments to reconstruct worldwide routes of invasion: the case of the Asian ladybird Harmonia axyridis. Mol Ecol. 2014;23(24):5979–5997. doi: 10.1111/mec.12989. [DOI] [PubMed] [Google Scholar]
  44. Lowe WH, Kovach RP, Allendorf FW. Population genetics and demography unite ecology and evolution. Trends Ecol Evolution. 2017;32(2):141–152. doi: 10.1016/j.tree.2016.12.002. [DOI] [PubMed] [Google Scholar]
  45. Markow TA, O’Grady P. Drosophila: a guide to species identification and use. Elsevier; 2005. [Google Scholar]
  46. Meglecz E, Costedoat C, Dubut V, Gilles A, Malausa T, Pech N, et al. QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects. Bioinformatics. 2010;26(3):403–404. doi: 10.1093/bioinformatics/btp670. [DOI] [PubMed] [Google Scholar]
  47. Miller AD, Coleman MA, Clark J, Cook R, Naga Z, Doblin MA, et al. (2020). Local thermal adaptation and limited gene flow constrain future climate responses of a marine ecosystem engineer. Evolutionary Applications eva.12909 [DOI] [PMC free article] [PubMed]
  48. Molina J, Sikora M, Garud N, Flowers JM, Purugganan MD. Molecular evidence for a single evolutionary origin of domesticated rice. J Agric Biotechnol. 2011;108(20):8351–8356. doi: 10.1073/pnas.1104686108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Nunes MD, Nolte V, Schlotterer C. Nonrandom Wolbachia infection status of Drosophila melanogaster strains with different mtDNA haplotypes. Mol Biol Evolution. 2008;25(11):2493–2498. doi: 10.1093/molbev/msn199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Nunes MD, Neumeier H, Schlotterer C. Contrasting patterns of natural variation in global Drosophila melanogaster populations. Mol Ecol. 2008;17(20):4470–4479. doi: 10.1111/j.1365-294X.2008.03944.x. [DOI] [PubMed] [Google Scholar]
  51. van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes. 2004;4(3):535–538. [Google Scholar]
  52. Park S (2001). Animal Genomics Laboratory, UCD, Ireland.
  53. Parkash R, Munjal AK. Evidence of independent climatic selection for desiccation and starvation tolerance in Indian tropical populations of Drosophila melanogaster. Evolut Ecol Res. 2000;2(5):685–699. [Google Scholar]
  54. Pool JE, Corbett-Detig RB, Sugino RP, Stevens KA, Cardeno CM, Crepeau MW, et al. Population genomics of sub-saharan Drosophila melanogaster: African diversity and non-African admixture. PLoS Genet. 2012;8(12):e1003080. doi: 10.1371/journal.pgen.1003080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Pritchard JK, Stephens M, Donnelly P. Inference of population structure using multilocus genotype data. Genetics. 2000;155(2):945–959. doi: 10.1093/genetics/155.2.945. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Rosenberg NA. DISTRUCT: a program for the graphical display of population structure. Mol Ecol Notes. 2004;4(1):137–138. [Google Scholar]
  57. Rousset F. genepop'007: a complete re-implementation of the genepop software for Windows and Linux. Mol Ecol Resour. 2008;8(1):103–106. doi: 10.1111/j.1471-8286.2007.01931.x. [DOI] [PubMed] [Google Scholar]
  58. Schlötterer C, Neumeier H, Sousa C, Nolte V. Highly structured Asian Drosophila melanogaster populations: A new tool for hitchhiking mapping? Genetics. 2006;172(1):287–292. doi: 10.1534/genetics.105.045831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Schmidt PS, Matzkin L, Ippolito M, Eanes WF. Geographic variation in diapause incidence, life‐history traits, and climatic adaptation in Drosophila melanogaster. Evolution. 2005;59(8):1721–1732. [PubMed] [Google Scholar]
  60. Semenov GA, Safran RJ, Smith CCR, Turbek SP, Mullen SP, Flaxman SM. Unifying theoretical and empirical perspectives on genomic differentiation. Trends Ecol Evolution. 2019;34(11):987–995. doi: 10.1016/j.tree.2019.07.008. [DOI] [PubMed] [Google Scholar]
  61. Sexton JP, Hangartner SB, Hoffmann AA. Genetic isolation by environment or distance: which pattern of gene flow is most common? Evolution. 2014;68(1):1–15. doi: 10.1111/evo.12258. [DOI] [PubMed] [Google Scholar]
  62. Sigh RS, Hichey DA, David J. Genetic differentiation between geographically distant populations of Drosophila melanogaster. Genetics. 1982;101(2):235–256. doi: 10.1093/genetics/101.2.235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Smith AL, Hodkinson TR, Villellas J, Catford JA, Csergo AM, Blomberg SP, et al. Global gene flow releases invasive plants from environmental constraints on genetic diversity. Proc Natl Acad Sci USA. 2020;117(8):4218–4227. doi: 10.1073/pnas.1915848117. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Sprengelmeyer QD, Mansourian S, Lange JD, Matute DR, Cooper BS, Jirle EV, et al. Recurrent collection of Drosophila melanogaster from wild African environments and genomic insights into species history. Mol Biol Evolution. 2020;37(3):627–638. doi: 10.1093/molbev/msz271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Stephan W, Li H. The recent demographic and adaptive history of Drosophila melanogaster. Heredity (Edinb) 2007;98(2):65–68. doi: 10.1038/sj.hdy.6800901. [DOI] [PubMed] [Google Scholar]
  66. Stone GN, White SC, Csóka G, Melika G, Mutun S, Pénzes Z, et al. Tournament ABC analysis of the western Palaearctic population history of an oak gall wasp, Synergus umbraculus. Mol Ecol. 2017;26(23):6685–6703. doi: 10.1111/mec.14372. [DOI] [PubMed] [Google Scholar]
  67. Telonis-Scott M, Sgrò CM, Hoffmann AA, Griffin PC. Cross-study comparison reveals common genomic, network, and functional signatures of desiccation resistance in Drosophila melanogaster. Mol Biol Evolution. 2016;33(4):1053–1067. doi: 10.1093/molbev/msv349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994;22(22):4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Weeks AR, McKechnie SW, Hoffmann AA. Dissecting adaptive clinal variation: markers, inversions and size/stress associations in Drosophila melanogaster from a central field population. Ecol Lett. 2002;5(6):756–763. [Google Scholar]
  70. Wei SJ, Cao LJ, Gong YJ, Shi BC, Wang S, Zhang F, et al. Population genetic structure and approximate Bayesian computation analyses reveal the southern origin and northward dispersal of the oriental fruit moth Grapholita molesta (Lepidoptera: Tortricidae) in its native range. Mol Ecol. 2015;24(16):4094–4111. doi: 10.1111/mec.13300. [DOI] [PubMed] [Google Scholar]
  71. Xiang H, Liu X, Li M, Yn Zhu, Wang L, Cui Y, et al. The evolutionary road from wild moth to domestic silkworm. Nat Ecol Evolution. 2018;2(8):1268–1279. doi: 10.1038/s41559-018-0593-4. [DOI] [PubMed] [Google Scholar]
  72. Yu Y, Fu J, Xu Y, Zhang J, Ren F, Zhao H, et al. Genome re-sequencing reveals the evolutionary history of peach fruit edibility. Nat Commun. 2018;9(1):5404. doi: 10.1038/s41467-018-07744-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental information (838.6KB, docx)
Supplemental information (15.9KB, xlsx)

Data Availability Statement

Mitochondrial genes and microsatellite data generated in this study were deposited to the Dryad database: 10.5061/dryad.37pvmcvgv.

Articles from Heredity are provided here courtesy of Nature Publishing Group

RESOURCES