Skip to main content
Elsevier Sponsored Documents logoLink to Elsevier Sponsored Documents
. 2021 Jun 1;33(6):1155–1170.e10. doi: 10.1016/j.cmet.2021.04.007

Obesity-associated hyperleptinemia alters the gliovascular interface of the hypothalamus to promote hypertension

Tim Gruber 1,2,3, Chenchen Pan 4,5, Raian E Contreras 1,2,6,7, Tobias Wiedemann 8, Donald A Morgan 9, Alicja A Skowronski 10, Sandrine Lefort 1,2, Cahuê De Bernardis Murat 1,2, Ophelia Le Thuc 1,2, Beata Legutko 1,2, Francisco J Ruiz-Ojeda 2,11, María de la Fuente-Fernández 12, Angel Luis García-Villalón 12, Daniel González-Hedström 12, Melanie Huber 1,2, Klara Szigeti-Buck 13, Timo D Müller 1,2,14, Siegfried Ussar 2,11,15, Paul Pfluger 1,2,6,7, Steve C Woods 16, Ali Ertürk 4,5, Charles A LeDuc 10, Kamal Rahmouni 9, Miriam Granado 12, Tamas L Horvath 3,13, Matthias H Tschöp 1,2,17,, Cristina García-Cáceres 1,2,18,19,∗∗
PMCID: PMC8183500  PMID: 33951475

Summary

Pathologies of the micro- and macrovascular systems are a hallmark of the metabolic syndrome, which can lead to chronically elevated blood pressure. However, the underlying pathomechanisms involved still need to be clarified. Here, we report that an obesity-associated increase in serum leptin triggers the select expansion of the micro-angioarchitecture in pre-autonomic brain centers that regulate hemodynamic homeostasis. By using a series of cell- and region-specific loss- and gain-of-function models, we show that this pathophysiological process depends on hypothalamic astroglial hypoxia-inducible factor 1α-vascular endothelial growth factor (HIF1α-VEGF) signaling downstream of leptin signaling. Importantly, several distinct models of HIF1α-VEGF pathway disruption in astrocytes are protected not only from obesity-induced hypothalamic angiopathy but also from sympathetic hyperactivity or arterial hypertension. These results suggest that hyperleptinemia promotes obesity-induced hypertension via a HIF1α-VEGF signaling cascade in hypothalamic astrocytes while establishing a novel mechanistic link that connects hypothalamic micro-angioarchitecture with control over systemic blood pressure.

Keywords: obesity, hypertension, leptin, hypothalamus, angiogenesis, astrocytes, HIF1α-VEGF

Graphical abstract

graphic file with name fx1.jpg

Highlights

  • The hypothalamic gliovascular interface is dynamically remodeled during obesity

  • Circulating leptin couples hypercaloric states with hypothalamic microangiopathy

  • Leptin-induced astroglial HIF1α-VEGF drives angiogenesis in the hypothalamus

  • VEGF in astrocytes promotes the development of arterial hypertension during obesity


Here, Gruber et al. show that during diet-induced obesity in mice there is a profound remodeling of the gliovascular interface in the hypothalamus, resulting in arterial hypertension. This process is driven by elevated leptin levels and upregulation of a HIF1α-VEGF signaling axis in local astrocytes.

Introduction

Both macro- and microvascular complications are comorbidities of obesity, and vascular dysfunction is considered to be a primary factor in the increased risk of obesity-associated mortality and disability (Flegal et al., 2013; Poirier et al., 2006). While obesity often leads to damage of macrovessels in the form of atherosclerosis and arterial hypertension, the microvascular compartment is also frequently pathologically restructured. Importantly, macrovascular hypertension is widely regarded both to precede and to functionally contribute to the development of microvascular remodeling by inducing increased capillary pressure (Folkow et al., 1958). As extensively documented with regard to the retina, kidney, and peripheral nerves, microvascular instability and neovascularization confer the major threat of progressive organ failure and risk of disability during diabetes and obesity (Rask-Madsen and King, 2013).

Microvascular remodeling, however, is not solely restricted to peripheral tissues and can occur within the brain. For example, consumption of a high-calorie diet induces a peculiar remodeling of the hypothalamic microvasculature that is observable in both mice and humans (Yi et al., 2012). Intrigued by this observation, we interrogated whether hypothalamic hypervascularization during diet-induced obesity (DIO) is a prerequisite for the development of arterial hypertension. We also explored the involvement of astrocytes, as these cells are an integral cell type of the neurovascular unit, which forms direct physical contacts with cerebral blood vessels via their perivascular endfeet (Mathiisen et al., 2010). Because astrocytes occupy such a privileged position within the brain parenchyma, we hypothesized that they are ideally situated to survey the metabolic status of the organism and, in turn, to homeostatically and pathologically remodel local vascular beds.

Astrocytes critically contribute to the formation and maintenance of the blood-brain barrier (BBB) via both physical contact and by releasing an array of soluble factors. The gliovascular interface has thus attracted considerable interest toward brain-based pharmacotherapies, and much effort is being placed on the understanding of how astrocytes modulate BBB function and, more specifically, whether astrocytes might control the selective access of some circulating factors into the brain. Consistent with this role, our previous studies have demonstrated that astrocytes regulate the accessibility of circulating factors (lipids, glucose, and hormones) within the brain and in turn cooperate with neurons in the regulation of feeding and systemic glucose metabolism (Kim et al., 2014; Gao et al., 2017; García-Cáceres et al., 2016, 2019).

It remains to be elucidated if and how this structural remodeling at the gliovascular interface contributes to the initiation and progression of obesity. Here, we report that feeding a high-fat, high-sugar (HFHS) diet to mice induces rapid-onset microvascular remodeling within the hypothalamus, including within pre-autonomic centers, and that this occurs prior to changes in systemic arterial blood pressure but concurrent with substantial diet-induced body weight gain and elevated serum leptin levels. Moreover, both local astrocytes and the vasculature in the hypothalamus undergo profound pathological changes that are not found elsewhere in the brain. We further found that the hypoxia-inducible factor 1α-vascular endothelial growth factor (HIF1α-VEGF) pathway acts downstream of leptin signaling in hypothalamic astrocytes, and that HFHS diet feeding and hyperleptinemia trigger the pathological reorganization of the local angioarchitecture. Collectively, these findings reveal the unprecedented involvement of astrocytes in the mediobasal hypothalamic regulation of systemic blood pressure. Furthermore, these findings identify a hitherto unrecognized functional link between astrocyte-mediated dynamic remodeling of the hypothalamic vasculature and the regulation of systemic blood pressure in response to high-calorie diets and elevated leptin levels.

Results

HFHS diet feeding induces microangiopathy specifically in the hypothalamus and prior to the development of systemic hypertension in mice.

Feeding an obesogenic diet to mice induces vascular dysfunction in various organ systems over time, and it is frequently used to model human obesity-related cardiovascular complications. Here, we compared the temporal development of diet-induced damage of blood vessels in the periphery versus in the brain of C57BL/6J mice. Consistent with previous observations (Ternacle et al., 2017; Oishi et al., 2018), the systemic elevation of arterial blood pressure was manifested upon chronic, but not short-term, exposure to a HFHS diet in comparison to a standard chow (SC) diet (Figure 1A). In contrast, neovascularization of the hypothalamus, which was recently identified as a consequence of high-calorie exposure (Yi et al., 2012), occurred more rapidly, becoming significant after only 2 weeks of HFHS diet feeding (Figure 1A). By combining fluorescent angiography, optical tissue clearing, and 3D imaging of the entire mouse brain vasculature (Ertürk et al., 2012), we observed that diet-induced cerebrovascular remodeling was restricted to specific hypothalamic nuclei where the local microenvironment seemed to be susceptible to hypervascularization upon HFHS exposure (Figures 1B and 1C; Video S1). Notably, we additionally observed that a substantial proportion of these more abundant vessels display signs of HFHS diet-induced structural and functional impairments, as previously reported in other tissues from individuals with obesity, diabetes mellitus, or hypertension (Roggendorf et al., 1988; Tsilibary, 2003). Specifically, we found that hypothalamic capillaries of HFHS diet-fed mice exhibit a discontinuous coverage by Claudin-5, an essential component of tight-junctions at the BBB (HFHS diet: −15.17% ± 1.48% Claudin-5 vessel coverage versus SC diet: −3.97% ± 0.65% Claudin-5 vessel coverage; data not shown). Furthermore, these structural changes were associated with higher extravasation of serum proteins, such as albumin (vascular hyperpermeability), suggesting functional impairment in barrier properties (Figures 1D and S1A; HFHS diet: 1.94% ± 0.57% extravascular pixels versus SC diet: 0.48% ± 0.06% extravascular pixels; data not shown). In addition, these hypothalamic microvessels had a marked thickening in their basement membrane as evidenced by greater deposition of extracellular matrix proteins, collagen-IV (HFHS diet: 2.64 ± 0.13 μm versus SC diet: 1.76 ± 0.19 μm), and laminin (HFHS diet: 2.67 ± 0.2 μm versus SC diet: 1.61 ± 0.2 μm; Figure 1E). Using electron microscopy, we further confirmed ultrastructural alterations in the hypothalamic microvasculature of DIO mice and found that chronic HFHS diet exposure resulted in significant thickening of the endothelial basal membrane than SC-diet-fed mice (Figure 1F). Overall, these results reveal a particular vulnerability of distinct hypothalamic nuclei to develop hypervascular microangiopathy in response to short-term HFHS diet feeding, and it precedes any changes in systemic blood pressure.

Figure 1.

Figure 1

HFHS diet feeding induces hypervascular microangiopathy specifically in the hypothalamus

(A) Mean arterial blood pressure (MAP) and vessel length in the mediobasal hypothalamus (MBH) of C57BL/6J mice fed a high-fat, high-sugar (HFHS) diet for 2 or >20 weeks in comparison to a standard chow (SC) diet. Data are represented as a mean MAP of individual mice repeatedly measured over separate days and as total vessel length per individual MBH hemisection. n = 4–7 mice per group (blood pressure) and n = 6–7 mice (fluorescent angiography); 6–8 hemisections/mouse.

(B) Light-sheet microscopy images (ventral views) of the 3D whole-brain angioarchitecture in mice fed SC or HFHS diet. Images are representative of data in (C).

(C) Quantitative assessment of HFHS diet-induced vascular density in different brain regions relative to an SC diet. LS, lateral septum; CPu, caudate-putamen; NAcc, nucleus accumbens; S1BF, somatosensory cortex, barrel field; HIPP, hippocampus; PVN, paraventricular nucleus; DMH, dorsomedial hypothalamus; LHA, lateral hypothalamus; VMH, ventromedial hypothalamus; ARC, arcuate nucleus; NTS, nucleus tractus solitarius; RVLM, rostral ventrolateral medulla. n = 3 mice per group; consecutive focal planes (z-step: 8 μm) were cropped out according to the brain region and individually analyzed; each brain region was analyzed from both hemispheres.

(D) Confocal micrographs of hypothalamic microvessels (green), Claudin-5 (red; upper panel), and albumin (red; lower panel) in mice fed with an SC or HFHS diet.

(E) High-resolution 3D-rendered confocal micrographs of cross-sectional hypothalamic microvessels (∅ = 4–8 μm) depicting collagen-IV (yellow) and laminin (magenta) in mice fed with an SC or HFHS diet.

(F) Representative electron micrographs of hypothalamic microvessels of mice fed with an SC or HFHS diet, with highlighted endothelial basal membranes. Below, the quantification of the endothelial basal membrane thickness. n = 3–6 mice per group; 4–6 ultra-thin sections/mouse.

Scale bars, 200 μm (B), 10 μm (D and E), and 500 nm (F). ∗∗p < 0.01, ∗∗∗p < 0.001, and ∗∗∗∗p < 0.0001. n.s., not significant. Statistical tests included unpaired Student’s t test (A, C, and F).

Video S1. 3D imaging of 3DISCO-cleared mouse brain vasculature, related to Figure 1
Download video file (27.9MB, mp4)

Hypothalamic microangiopathy occurs at the onset of bodyweight gain and coincides with increased circulating leptin

Obesogenic diets have previously been described to trigger profound cellular rearrangements affecting the cytoarchitecture of the hypothalamus (Horvath et al., 2010), several of which occur with remarkable rapidity and prior to any metabolic disturbances in the periphery (Thaler et al., 2012). We therefore sought to temporally pinpoint the exact initiation of the hypothalamic angiogenic response to HFHS diet feeding to determine if it occurs prior to or secondary to bodyweight gain. As previously reported by others (Williams et al., 2014), a 5-day HFHS diet feeding was sufficient to impair peripheral glucose tolerance in normal-weight mice relative to an SC diet (Figure S1B) but with no apparent changes in hypothalamic vessel density (Figure S1B). Likewise, a prolonged period of severe hyperglycemia in a non-obese mouse model of streptozotocin (STZ)-induced type 1 diabetes led to only a slight tendency of hypothalamic neovascularization (Figure S1C), which was of far smaller magnitude overall when compared with changes upon chronic HFHS diet feeding (Figure 1C). Together, these findings argue against a major causal role of impaired glucose metabolism in the process of hypothalamic vessel remodeling.

In contrast, the onset of hypothalamic hypervascularization in HFHS diet-fed mice occurred at the time when bodyweight started to significantly diverge between mice fed with an HFHS diet or SC diet, i.e., after 15 days of diet exposure (Figures 1A and 2A). Notably, this process was accompanied by higher expression of pro-angiogenic signaling cues in the hypothalamus, but not in the cortex (Figure S2D), with VEGF being among the most robustly induced factors among those elevated in response to HFHS diet feeding (Figures 2B and S2A). Notably, the moment of hypothalamic hypervascularization was not only concurrent with the moment of significant body weight gain but also coincided with the onset of higher leptin levels with HFHS diet feeding (Figure 2C). We thus conclude that, whereas hypothalamic vascularization is not modulated by elevated blood glucose levels, it is associated with a significantly higher expression of pro-angiogenic genes in the hypothalamus, as well as increased body weight and elevated circulating leptin levels with an HFHS diet.

Figure 2.

Figure 2

Hypothalamic vascularity is rapidly and dynamically altered by HFHS diet feeding in association with circulating leptin levels

(A) Bodyweight of SC and HFHS diet-fed mice. The red arrow indicates the onset of HFHS-induced hypothalamic hypervascularization in mice (see Figure 1A). n = 4–7 mice per group.

(B) mRNA expression of vascular endothelial growth factor A (Vegfa) in the hypothalamus and cortex from mice fed with an SC diet and an HFHS diet at different time points. n = 8 mice per group.

(C) Serum leptin levels in mice fed with an SC diet or 14-day HFHS diet. Data are presented as individual mice and mean ± SEM. n = 4–7 mice per group (unpaired t test).

(D) Confocal micrographs depicting the MBH vessel profile of SC diet-fed, HFHS diet-fed, and diet-reversed (DR) mice. Data are representative of the cohort depicted in Figure S1G.

(E) Linear regression analysis between the length of vessels in the MBH and the body fat mass of mice fed SC, HFHS, DR, and calorie-restricted (CR) diet. The average 24-h food intake of respective groups is shown on the right. n = 6 mice per group.

(F) Quantification of the number of VEGF+ cells in the MBH between groups. Data are represented as individual hemisection and mean ± SEM. n = 6 mice per group; 6–8 hemisections/mouse.

(G) Quantification of serum leptin levels between groups. n = 6 mice per group.

Scale bars, 100 μm (D). p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, and ∗∗∗∗p < 0.0001. n.s., not significant. Statistical tests included two-way ANOVA (A), one-way ANOVA (B, F, and G), and unpaired Student’s t test (C).

Hypothalamic hypervascularity in mice is reversed by diet-induced weight loss and normalization of serum leptin levels

We next sought to investigate if hypothalamic hypervascularization in mice could be reversed by a diet-based weight loss intervention. We thus switched DIO mice back to an SC diet for 5 weeks to reduce excess bodyweight and fat mass (Figure S2B), along with serum leptin levels (Figure S2C). As revealed by post hoc fluorescent angiography, diet reversal potently normalized the hypothalamic vessel profile to levels seen in lean control mice solely fed with an SC diet (Figure 2D). In order to determine if microvascular remodeling in the hypothalamus was specifically dependent on an altered diet composition or more generally the result of reduced caloric intake and body fat loss, we included a calorie-restricted (CR) group given 70% of their ad libitum HFHS diet intake (Figure 2E). Notably, a strong positive linear relationship (r2 = 0.8046) was found between the extent of hypothalamic vascularity and the degree of adiposity across all four groups (Figure 2E). Moreover, hypothalamic vascular profiles in lean, DIO, CR, and diet-reversed—i.e., formerly DIO—mice mirrored the number of VEGF+ cells in the MBH and serum leptin levels (Figures 2F and 2G, respectively). Overall, these results suggest that the derangement of microvascular networks in the hypothalamus in response to DIO constitutes a dynamic process that can be reversed upon weight loss. Furthermore, we found that changes in circulating leptin levels are associated with the extent of hypothalamic vascularity.

Leptin signaling in the brain rather than obesity per se acts as a driver in the development of hypothalamic neovascularization

Given the substantial cross-correlation between adiposity and leptin levels, we aimed to functionally disentangle whether hypothalamic microangiopathy is driven by HFHS diet-induced signals such as leptin, as opposed to adiposity per se. Thus, we profiled monogenetically obese leptin-deficient (Lepob/ob) and leptin receptor-deficient (Lepdb/db) mice maintained on an SC diet. Despite the substantial adiposity of these models relative to their respective heterozygous littermate controls (Figure S3A), the hypothalamic vessel density remained entirely unchanged in Lepob/ob and Lepdb/db mice (Figure 3A), both of which are characterized by the single commonality of absent leptin signaling. Intrigued by the different vascular profiles of these two genetically obese mouse models as compared with DIO mice and, given that leptin receptor (LepR) is highly expressed in the MBH (Figure S3B), we further explored a putative involvement of leptin in promoting hypothalamic neovascularization. Thus, we tested this hypothesis by treating leptin-deficient Lepob/ob mice with an HFHS diet or exogenous leptin. While 14 days of HFHS diet feeding in Lepob/ob mice did not lead to a greater hypothalamic vessel density, central leptin infusion resulted in significant and robust hypervascularization of the MBH at both a low dose (50 ng/day for 10 days) as well as a higher dose (200 ng/day for 7 days) (Figure 3A). Importantly, this expansion in microvascular density occurred under the state of rapid and pronounced bodyweight loss (−25.8% ± 0.87% at termination), supporting that leptin signaling, rather than other aspects of obesity, confers pro-angiogenic stimulation in the hypothalamus. To further disentangle the confounding cross-correlation between serum leptin and body fat (r2 = 0.9260; Figure S3C), we employed a transgenic mouse model (TRE-LeprtTA) to induce overexpression of leptin by adding doxycycline (DOX) to the drinking water (Skowronski et al., 2020). Exposing these lean mice to DOX for 4 weeks rendered them significantly hyperleptinemic (Figure S3C). Yet, such hyperleptinemia was sufficient to promote a significantly higher vascular density of the MBH when compared with littermate controls (TRE-Lep) also receiving DOX but without leptin elevation (Figure 3A). Consistently, DOX-induced leptin overexpression and repeated pharmacological leptin administration to lean C57BL/6J mice (3 mg/kg BW i.p. twice daily for 3 days; Figure 3B) led to significantly higher levels of endothelial proliferation markers such as Ki67, Vegfr2/Kdr, and Cd105/endoglin (Figures 3C and S3D), as well as pro-angiogenic VEGF expression within the hypothalamus (Figure 3D). Interestingly, the rise of hypothalamic VEGF expression in exogenous leptin-infused mice exceeded the effect of 2-week feeding with an HFHS diet (Figure 3D). Conversely, VEGF expression levels were unaltered in the MBH of both Lepdb/db mice and Lepob/ob mice, despite massive obesity (Figure 3D).

Figure 3.

Figure 3

Leptin signaling induces pro-angiogenic signaling in the hypothalamus

(A) Quantification of MBH vascularity in diet-induced obese C57BL/6J mice, genetically obese SC diet-fed Lep db/db mice, Lep ob/ob mice fed SC diet or HSHS diet (2 weeks) or receiving one of two doses of chronic leptin minipump infusions into the lateral ventricle (50 or 200 ng/day, respectively), and leptin-overproducing TRE-Lep rtTA mice receiving doxycycline in the drinking water (4 weeks). Data are presented relative to respective controls as indicated. n = 4–6 mice per group; 6–8 hemisections/mouse.

(B) Experimental paradigm of repeated leptin injections (3 mg/kg i.p.) twice daily for 2 days in the morning and the evening with a terminal injection prior to sacrifice.

(C) High-power confocal micrographs of hypothalamic vasculature (white) exhibiting cells immunoreactive for Ki67+ (magenta) from mice treated with leptin or vehicle.

(D) Whole hypothalamic gene expression of Vegfa mRNA of C57BL/6J mice fed 15-day HFHS diet or receiving repeated leptin injections according to (B); TRE-Lep rtTA mice receiving doxycycline in the drinking water (4 weeks) and Vegfa expression of MBH micropunches from Lep db/db mice and Lep ob/ob mice. Data are presented relative to respective controls. n = 7–14 mice per group.

(E) Linear regression analysis of the vessel length in the MBH and the number of VEGF+ cells of C57BL/6J mice fed SC diet or HFHS diet, or undergoing calorie restriction, diet reversal, or diet reversal with leptin re-substitution (1 mg/kg s.c. every other day). Arithmetic means of SC diet and HFHS diet indicated as dotted lines (gray). n = 6 mice per group.

(F) Western blot pictures depicting hypothalamic HIF1α protein content of C57BL/6J mice fed SC diet or HFHS diet, or acutely leptin-injected mice (5 mg/kg i.p.) and Lep ob/ob mice. n = 3 mice per group. Representative western blot of two independent experiments.

(G) Photographic-bioluminescent image of two anesthetized HIF1/ODD-luciferase mice that received either vehicle or exogenous leptin 60 min prior to bioluminescence in vivo imaging.

(H) Corresponding quantification of total photon flux from the ventral side of the head of HIF1/ODD-luciferase mice receiving either vehicle or exogenous leptin (5 mg/kg i.p.). n = 4 mice per group.

(I) Quantification of luciferase activity in hypothalamic or cortical lysates of HIF1/ODD-luciferase mice that were either fed with an SC diet or an HFHS diet (5 days), or acutely injected with leptin (5 mg/kg i.p.). n = 7 per group.

(J) Confocal micrographs depicting hypothalamic vessels (green), VEGF immunoreactivity (red), and GFAP-positive astrocytes (gray).

(K) Schematic illustration depicting the experimental design to detect the presence of LepRa and LepRb isoforms in hypothalamic astrocytes by employing astrocyte-specific, Cre-dependent dual fluorescent reporter mouse line, a representative FACS blot, and image of the gel electrophoretic separation of LepRa (98 bp) and LepRb (81 bp) amplicons upon RT-PCR.

(L) Confocal scans illustrating the VEGF immunoreactivity (red) in the MBH from mice lacking the LepR specifically in GFAP-positive astrocytes (LepRiΔastro/GFAP+) and respective controls, both receiving repeated leptin injections or vehicle. Images are representative of data in (M).

(M) Corresponding quantification of VEGF immunoreactive cells within the MBH between groups. n = 3–4 mice per group; 6–8 hemisections/mouse.

(N) Hypothalamic expression of Vegfa mRNA in control mice and LepRiΔGFAP/+ mice both receiving exogenous leptin according to (B) or vehicle. n = 4–5 mice per group.

(O) Quantification of pERK1/2+ cells in the MBH of LepRiΔGFAP/+ and control mice receiving leptin according to (B) or vehicle. n = 4–6 mice per group; 6–8 hemisections/mouse.

(P) Quantification of pSTAT3+ cells in the MBH of LepRiΔGFAP/+ and littermate control mice receiving leptin according to (B) or vehicle. n = 4–6 mice per group; 6–8 hemisections/mouse.

Scale bars, 10 μm (C [left panel] and L [inner panel]), 25 μm (J), and 100 μm (C [right panel] and L [outer panel]). ∗∗∗∗p < 0.0001, ∗∗∗p < 0.001, ∗∗p < 0.01, and p < 0.05. n.s., not significant. Statistical tests included one-way ANOVA (A, D, I, and N) and unpaired Student’s t test (A, H, M, O, and P).

Next, we aimed to disentangle whether the normalization of vascularity and VEGF expression upon weight loss (Figures 2D–2F) are driven by hyperleptinemia rather than adiposity per se. To address this question, we pharmacologically maintained elevated leptin levels in formerly DIO mice undergoing diet reversal (1 mg/kg BW every other day, s.c.) and observed that elevated leptin levels abrogated the normalization of hypothalamic vascular profiles (Figure 3E). Prompted by these findings in the hypothalamus, we next sought to investigate if the interrelations among adiposity, serum leptin, and neurovasculopathy would extend to other tissues, such as those of the eye, which contain neurovascular beds that are highly susceptible to metabolic damage. However, while HFHS diet feeding over the course of 4 months induced marked hypothalamic hypervascularity, it failed to change vascular density in the retina, as assessed in whole retinal flat mounts in mice (data not shown), suggesting separate tissue-specific mechanisms underlying microvascular remodeling in DIO mice.

Next, we assessed the protein levels of the hypoxia-inducible factor 1 alpha (HIF1α), the direct transcriptional regulator of VEGF in the hypothalamus and found that hypothalamic HIF1α levels tended to be higher in response to HFHS diet feeding and an acute leptin administration (5 mg/kg BW i.p.). Notably, obese leptin-deficient Lepob/ob mice tended to have lower HIF1α protein levels in SC diet-fed, HFHS diet-fed, or leptin-injected mice (Figure 3F). We further confirmed the induction of HIF1α in response to leptin by using HIF1/ODD-luciferase mice, which exhibited significant increases in total photon flux during in vivo bioluminescence imaging from the ventral part of the head 60 min after leptin administration than vehicle injection (5 mg/kg BW; i.p.) (Figures 3G and 3H). Notably, leptin administration induced higher luciferase activity particularly in hypothalamic, but not cortical, protein lysates ex vivo, when compared with its administration in mice fed with an SC diet (Figure 3I). Overall, these findings indicate that leptin signaling, regardless of the adiposity grade, is a determining factor driving the upregulation of HIF1α-VEGF signaling as well as hypervascularization particularly in the hypothalamus of obese mice; a recurrent phenomenon observed in DIO mice but absent in Lepob/ob and Lepdb/db mice.

Astrocytes are the main cellular source of HFHS diet-induced VEGF in the hypothalamus

To identify the cellular source of hypothalamic VEGF production upon either HFHS diet feeding or leptin treatment, we conducted an array of double-immunohistochemical staining. VEGF immunoreactivity (ir) was revealed to exclusively co-localize with astrocytes positive for glial fibrillary acidic protein (GFAP+) (Figure 3J), while being absent from both neurons (NeuN+) and microglia (Iba1+) (Figure S3E). Contrary to the traditionally held view, astrocytes constitute a diverse class of cells displaying substantial inter- and intraregional heterogeneity in their molecular profiles and function (Haim and Rowitch, 2017). Hence, we assessed hypothalamic astroglial VEGF-ir across two astroglial populations as identified by their expression of the astrocyte-enriched marker proteins GFAP and/or glutamate-aspartate transporter (GLAST). Over the course of this analysis, we noticed that VEGF-ir colocalized completely (100%) with astrocytes expressing GFAP filaments of perivascular endfeet independent of the presence of GLAST, suggesting a crucial role for GFAP in VEGF transport toward the endothelium (Table 1; Figure S3F). Thus, we repeated these co-immunostainings using brain sections of global GFAP−/− mice (Pekny et al., 1995) and observed a dramatic reduction in hypothalamic VEGF-ir that appeared disorganized and punctate (Figure S3G), further supporting the importance of GFAP-expressing astrocytes in gliovascular remodeling. To gain genetic access to this VEGF+ subset of hypothalamic astrocytes, we first profiled the recombination pattern of human GFAP and GLAST-inducible Cre-driver lines (hGFAP.CreERT2 and GLAST.CreERT2, respectively). To visualize postnatally tamoxifen-induced recombined astrocyte subpopulations, we crossed each of these astrocytic CreERT2-driver lines with the Cre-dependent reporter mouse line ROSA26mT/mG. The induction of VEGF immunoreactivity by HFHS diet feeding was found to be substantially attributable to both GFAP.CreERT2/mG+ astrocytes (55.6%; N0 = 188 cells; 3 mice) and GLAST.CreER T2/mG+ astrocytes (65.9%; N0 = 219 cells; 4 mice) (Figure S3H).

Table 1.

Colocalization of VEGF-ir with astrocytic population in the MBH

Diet Number of VEGF+ cells/hemisection MBH % GFAP+ astrocytes % GLAST+ (/GFAP+) astrocytes
SC diet 6.416 ± 0.965 (n = 3) 100 ± 0 13.278 ± 3.979
5-day HFHS diet 12.166 ± 2.446 (n = 3) 100 ± 0 27.42 ± 5.892
15-day HFHS diet 13.1667 ± 0.588 (n = 3) 100 ± 0 42.428 ± 1.931

SC diet, standard chow diet; HFHS diet, high-fat/high-sugar diet; VEGF, vascular endothelial growth factor; GFAP, glial fibrillary acidic protein; GLAST, glutamate-aspartate transporter 1.

Leptin receptors in hypothalamic astrocytes regulate the production of VEGF in response to hyperleptinemia

To assess if the production of VEGF in hypothalamic astrocytes might be mediated by the direct influence of leptin, we sorted pre-enriched GLAST.CreERT2/mG+ astrocytes by means of fluorescence-assisted cell sorting (FACS) to screen for the expression of both the short (LepRa) and the long (LepRb) leptin receptor isoforms by RT-PCR. In agreement with previous reports (Kim et al., 2014), we found that hypothalamic astrocytes express LepR (Figure 3K). Importantly, however, we only detected the truncated LepRa, isoform in FACS-isolated GLAST-expressing astrocytes (mG+), whereas no amplification of the long-form LepRb was found as compared with whole hypothalamic lysates (Figure 3K). Stimulation of the short LepRa isoform is known to robustly induce p42/44 MAPK (pERK1/2) signaling, which we found was gradually more abundant in the MBH of mice upon either HFHS diet exposure (5 and 15 days) or repeated leptin injections (3 mg/kg BW i.p.; two times per day for 3 days) (Figure S3J). Among hypothalamic pERK1/2+ cells, we were able to detect a subset of astrocytes previously rendered identifiable by the cytosolic expression of a green fluorescent protein from the viral GFAP(2.2 kb) promoter (Figure S3I). To assess if indeed the direct influence of leptin action in astrocytes leads to increased hypothalamic production of VEGF, we postnatally ablated LepR in hGFAP.CreERT2/+ positive cells (LepRiΔastro/GFAP+ mice), as previously described (Kim et al., 2014). Importantly, we observed that LepRiΔastro/GFAP+ mice failed to exhibit higher VEGF levels in response to leptin administration, both on the protein as well as mRNA level, as compared with littermate control mice (Figures 3L–3N). Moreover, we observed a tendency for attenuated pERK1/2 induction in the MBH of LepRiΔastro/GFAP+ mice in response to repeated leptin administration (3 mg/kg BW i.p.; two times per day for 3 days) relative to wild-type littermate controls (Figure 3P). In contrast, no changes were detected in neuronal, LepRb-dependent activation of pSTAT3 (Figure 3O). Additionally, we assessed hypothalamic vascularity in LepRiΔastro/GFAP+ mice fed with an HFHS diet. Although leptin failed to increase hypothalamic VEGF-ir in these mice, LepRiΔastro/GFAP+ mice still exhibited some degree of hypothalamic hypervascularization upon long-term HFHS diet feeding (Figure S3K). Importantly, however, the extent of HFHS diet-induced hypervascularity was significantly less pronounced in LepRiΔastro/GFAP+ mice (125.2% ± 3.99% of SC diet control) as compared with wild-type littermates (147.1% ± 5.49% of SC diet control). Collectively, these results suggest that astrocytes regulate the VEGF production in the hypothalamus upon LepRa activation while not being sufficient to fully prevent HFHS diet-induced hypothalamic hypervascularization.

Astrocyte-specific loss of HIF1α abrogates HFHS diet-induced VEGF expression and hypervascularization in the hypothalamus

The preponderance of evidence pointed us toward leptin as a stimulator of HIF1α-VEGF signaling in hypothalamic astrocytes during HFHS diet feeding. Thus, we generated genetic loss-of-function mouse models to assess whether the dynamic remodeling of the hypothalamic vasculature by HFHS diet feeding depends on the expression of HIF1α in either GFAP- and/or GLAST-expressing astrocytes. HIF1αloxP/loxP mice were crossed with respective astrocytic CreERT2-driver lines giving rise to knockout HIF1α in GFAP or GLAST-expressing astrocytes (HIF1αiΔastro/GFAP+ mice and HIF1αiΔastro/GLAST+ mice, respectively). Successful postnatal ablation of HIF1α was validated by backcrossing the Cre-dependent ROSA26mT/mG reporter line (Figure S4A) following two methods: (1) by comparing HIF1α expression after sorting non-recombined (tdTomato+; red) and recombined (GFP+; green) astrocytes collected from the same HIF1αiΔastro/GFAP+ mice (internal control: HIF1α downregulation in GFAP+ astrocytes: 79.8% ± 0.09%; Figure S4B), and (2) by comparing HIF1α expression in recombined (GFP+; green) astrocytes isolated from separate hGFAP.CreERT2:ROSA26mT/mG reporter mice that harbor HIF1α alleles flanked by loxP sites as compared with mice carrying wild-type alleles (external control: HIF1α downregulation in GFAP+ astrocytes: 43.5% ± 0.15%; Figure S4C).

Next, we challenged these mice with an HFHS diet and examined their capacity to increase astroglial VEGF production and vascular density in the MBH. Strikingly, HFHS diet-fed HIF1αiΔastro/GFAP+ mice were protected from excessive induction of VEGF expression in astrocytes compared with their corresponding HFHS diet-fed littermate controls (Figures 4A and 4B). In addition, the ablation of HIF1α from either GFAP+ or GLAST+ astrocytes abrogated the development of hypervascular angiopathy induced by HFHS diet feeding (Figure 4C). Besides the normalization of hypothalamic vessel density, astroglial HIF1α deletion averted several hypothalamic microvessel-glia abnormalities as observed in HFHS diet-fed mice (Figures 4D–4G). HFHS diet feeding in mice lacking HIF1α in astrocytes maintained endothelial coverage with the tight-junction protein claudin-5 (Figures 4D and S4E), showed an attenuated basement membrane thickening due to increased collagen-IV and laminin deposition (Figures 4E and S4D), and prevented the HFHS diet-induced increase in Iba+ microglia in the MBH relative to littermate controls (Figures 4F and S4G), which was consistent with lower expression levels of pro-inflammatory Tnf (Figure S4F). Likewise, astroglial ablation of HIF1α abrogated vascular hyperpermeability to albumin and FITC-dextrans (40 kDa) as compared with HFHS diet-fed littermate controls (Figures 4G and 4H). Lastly, protection from HFHS diet-induced alterations at the glia-vascular interface was further corroborated at the ultrastructural level. Electron microscopic inspections revealed that HIF1αiΔastro/GFAP+ mice did not exhibit endothelial basal membrane thickening in response to HFHS diet when compared with HFHS diet-fed littermate controls (73.22 ± 5.82 nm versus 114.2 ± 9.22 nm, respectively).

Figure 4.

Figure 4

Astrocyte-specific loss of HIF1α abrogates VEGF upregulation and hypothalamic angiopathy in response to HFHS diet feeding

(A) Representative confocal micrographs depicting the vascular profile (green) and VEGF immunoreactivity (red) in the MBH of control mice and mice lacking HIF1α in GFAP-positive astrocytes (HIF1αiΔastro/GFAP+) fed either with an SC or HFHS diet.

(B) Quantification of VEGF+ astrocytes in the MBH of control and HIF1αiΔastro/GFAP+ mice fed with an SC or HFHS diet. n = 4–6 mice per group; 6–8 hemisections/mouse.

(C) Length of labeled vessels in the MBH from control mice and mice lacking HIF1α in hGFAP+ or GLAST+ cells either fed with an SC or HFHS diet. n = 4–6 mice per group; 6–8 hemisections/mouse.

(D) Quantification of microvascular claudin-5 coverage in control and HIF1αiΔastro/GFAP+ mice fed either an SC or HFHS diet relative to entire vascular segment per field of view. n = 4–6 mice per group; 6–8 hemisections/mouse.

(E) Quantification of basement membrane thickness in control mice and mice lacking HIF1α in hGFAP+ or GLAST+ cells either fed with an SC or HFHS diet. n = 4–6 mice per group; 6–8 hemisections/mouse.

(F) Quantification of Iba1+ cells in the MBH of control and HIF1αiΔastro/GFAP+ mice fed either an SC or HFHS diet. n = 4–6 mice per group; 6–8 hemisections/mouse.

(G) Quantification of relative extravasation of albumin and FITC-dextran (40 kDa) in control mice and mice lacking HIF1α in hGFAP+ or GLAST+ cells either fed with an SC or HFHS diet. n = 4–6 mice per group; 6–8 hemisections/mouse.

(H) High-power confocal micrographs of hypothalamic microvasculature of mice receiving i.v. injections of a vessel tracer (magenta; albumin-A647) along with an indicator of blood-brain barrier permeability (green; FITC-dextran).

Scale bars, 100 μm (A) and 10 μm (H). ∗∗∗∗p < 0.0001, ∗∗∗p < 0.001, ∗∗p < 0.01, and p < 0.05. n.s., not significant. ##p < 0.01 and #p < 0.05 between HFHS diet groups of the respective genotypes. Statistical tests included unpaired Student’s t test (B–G) and one-way ANOVA (E).

Astrocyte-derived VEGF is sufficient for dynamic hypothalamic microvascular remodeling

In order to confirm that astrocyte-derived VEGF is the necessary and sufficient factor underlying the dynamic remodeling of the hypothalamic vasculature, we directly manipulated the expression of VEGF in astrocytes of the MBH by virus-mediated gene transfer (Figure S5A). First, we knocked down local VEGF expression in MBH astrocytes using small hairpin (sh)RNA expression (Figures S5B and S5C) driven from the long synthetic GFAP 2.2 kb promoter (Gfa2) and observed that the hypervascularization response to HFHS diet feeding was readily abrogated in the MBH of shRNA(VEGF)GFAP+ mice (Figures 5A and 5B). We next restored VEGF expression in astrocytes otherwise devoid of HIF1α (Figure S5D). To accomplish this, we employed a dual virus approach and injected two separate vectors (AAV.Gfa2.iCre and AAV.Gfa2.VEGFGFP, respectively) in order to (1) knockout HIF1α in MBH astrocytes and (2) concomitantly re-express VEGF in the injection site. Of all HIF1α-deficient astrocytes in the MBH (29.5 ± 4.63 per hemisection), roughly 30% were co-infected hence re-expressing transgenic VEGF (Figures S5E and S5F). Strikingly, we found that re-induction of astroglial VEGF expression in a fraction of HIF1αAAV.Gfa2.iCre mice proved sufficient for promoting marked hypervascularization, even exceeding what is typically observed in HFHS diet-fed control mice (Figures 5D and 5E). Overall, these findings indicate that MBH astroglial VEGF is necessary and sufficient for developing hypothalamic angiopathy in response to HFHS diet feeding.

Figure 5.

Figure 5

Blocking astroglial VEGF in the MBH protects from hypothalamic angiopathy as well as the development of arterial hypertension in mice upon HFHS diet feeding

(A) Confocal micrographs depicting the vascular profile in the MBH of HFHS-fed mice with astroglial knockdown of VEGF (shRNA(VEGF)GFAP+) versus control (scrambled control RNA; shRNA(scrmbl)GFAP+). Images are representative of data in (B).

(B) Quantification of labeled vessels in the MBH of HFHS diet-fed shRNA(VEGF)GFAP+ versus shRNA(scrmbl)GFAP+ mice. n = 4–7 mice per group; 6–8 hemisections/mouse.

(C) Quantification of MAP in a separate cohort of HFHS diet-fed shRNA(VEGF)GFAP+ and shRNA(scrmbl)GFAP+ mice. Data are represented as a mean MAP of individual mice repeatedly measured over separate days. n = 7–9 mice per group

(D) Confocal micrographs showing the vascular profiles in the MBH of astrocyte-specific HIF1α-deficient mice (HIF1α AAV.Gfa2.iCre) compared with astrocyte-specific HIF1α-deficient mice re-expressing VEGF in astrocytes (HIF1α AAV.Gfa2.iCre + VEGF) both fed with HFHS diet. Images are representative of data in (E).

(E) Quantification of MBH vessel length in control, HIF1α AAV.Gfa2.iCre, and HIF1α AAV.Gfa2.iCre + VEGF mice, all fed with an HFHS diet. n = 5–8 mice per group; 6–8 hemisections/mouse.

(F) Tail-cuff analysis of MAP in a separate cohort of SC diet-fed control, HIF1α AAV.Gfa2.iCre, and HIF1α AAV.Gfa2.iCre + VEGF mice. Data are represented as mean MAP of individual mice repeatedly measured over separate days. n = 5–7 mice per group.

(G) Time-resolved assessment of acute changes in renal SNA in anesthetized C57BL/6J mice upon central infusion of VEGF (25 ng; upper panel) with representative neurograms (middle panel; n = 6 mice per group). In a separate cohort, MAP was assessed in conscious mice upon central infusion of VEGF (lower panel; n = 3 mice per group; cross-over design).

Scale bar, 100 μm (A and D). ∗∗∗∗p < 0.0001, ∗∗∗p < 0.001, and p < 0.05. n.s., not significant. Statistical tests included one-way ANOVA (E and F), two-way ANOVA (G), and unpaired Student’s t test (B and C).

Blocking HIF1α or VEGF expression in MBH astrocytes prevents arterial hypertension and sympathetic hyperactivity in diet-induced obesity

Arterial hypertension is widely regarded as a significant contributor to microvascular remodeling and damage (Folkow et al., 1958; Feihl et al., 2008; de Montgolfier et al., 2019) However, as our data indicate, HFHS diet-induced astroglial VEGF induction and hypervascularization of the hypothalamus occur significantly prior to diet-induced arterial hypertension (Figure 1A). This unexpected temporal succession prompted us to determine if microvascular abnormalities in hypothalamic pre-autonomic areas impact central hypertensive regulation upon HFHS diet feeding. Strikingly, mice receiving virus-mediated blockade of astroglial VEGF expression were protected from developing arterial hypertension upon an HFHS diet (Figure 5C), despite being as obese as control animals (Figure S5H). Of note, this depressor effect of mean arterial blood pressure (MAP) was entirely abolished in HIF1α AAV.Gfa2.iCre mice that additionally underwent a restoration of high VEGF expression by the same dual virus approach as described before (Figure 5F), despite no changes in bodyweight between groups (Figure S5I). Importantly, the marked protection from arterial hypertension in shRNA(VEGF)GFAP/+ mice was independent of changes in serum leptin levels (Figure S5J) as well as basic endothelial function as measured by acetylcholine-induced vascular relaxation of aorta segments in obese shRNA(VEGF)GFAP+ (Figure S5K). Instead, our data suggest that blockade of astroglial VEGF in DIO mice prevented obesity-induced hypertension through a reduction in sympathetic hyperactivity directed toward cardiovascular targets. To assess sympathomodulation in cardiovascular regulation, we administered several vasoactive compounds via the carotid artery while measuring heart rate and blood pressure responses simultaneously. While the experimental lowering of blood pressure by infusing intracarotid sodium nitroprusside (SNP; nitric oxide donor) resulted in a similar vasodilation across all experimental groups (Figure S5L), HFHS diet-fed control mice showed a surprising acceleration of the counterregulatory increase in heart rate (baroreflex) relative to SC fed mice; notably, no heart rate differences were observed between HFHS diet versus SC diet-fed shRNA(VEGF)GFAP+ mice upon SNP administration (Figure S5L). To further assess how a reduction in astroglial VEGF affects sympathetic modulation of the cardiovascular system, we probed β1/2-adrenoreceptor function by intracarotid infusion of its pharmacological agonist isoproterenol (50 μg/kg BW). Notably, obese shRNA(VEGF)GFAP+ mice retained normal sensitivity toward isoproterenol-mediated stimulation of heart rate, whereas obese control mice displayed substantial chronotropic incompetence suggesting myocardial dysfunction such as impaired cardiac contractility or a potential desensitization toward catecholamines due to chronic overstimulation (Figure S5L). While no changes in circulating catecholamines were detected (Figure S5M), though, shRNA(VEGF)GFAP+ mice fed with an HFHS diet had an increased expression of β2-adrenergic receptors in the heart (Figure S5N), potentially underlying the restored contractile responsivity toward isoproterenol upon withdrawal of putative sympathoexcitatory VEGF produced in hypothalamic astrocytes.

Lastly, we further explored the hypothesis that central VEGF may modulate sympathetic outflow acutely by a direct mechanism and thus infused VEGF into the lateral cerebral ventricle (25 ng; i.c.v.) while electrically recording from the postganglionic nerve bundle innervating the kidney. Strikingly, we observed a large and steady increase in renal sympathetic nerve activity (SNA) upon central VEGF infusion as compared with vehicle delivery; central VEGF-induced sympathoexcitation was further accompanied by an acute rise in MAP as measured by radiotelemetry in a separate set of mice following a cross-over design (Figure 5G). Overall, these findings indicate that central VEGF directly increases sympathetic nerve traffic and that conversely, the interference with astroglial VEGF expression that is locally restricted to the MBH prevents the development of HFHS diet-induced arterial hypertension via the abrogation of hyperactive sympathetic outflow toward the cardiovascular system.

HFHS diet feeding, but not hypertension per se, induces hypothalamic angiogenesis in rats

Wondering if hypothalamic angiopathy is potentially primary or solely secondary to elevated blood pressure, we examined a cohort of male Wistar Kyoto (WKY) rats, a subset of which spontaneously develop hypertension on SC diet (Doris, 2017). Despite their dramatically elevated blood pressure, spontaneously hypertensive rats (SHR) showed normal vascularity of the MBH as compared with their normotensive WKY rat littermates (Figures 6A and 6B). Of note, and consistent with our observations in mice, we found that 4 weeks of HFHS diet feeding resulted in a significant hypervascularization response of the rat MBH when arterial blood pressure was not yet increased by the diet (Figures 6B and 6C). In conclusion, we provide evidence that increased vascularity in the hypothalamus is associated with hypertension, which in isolation seems insufficient to trigger hypothalamic vascular remodeling as determined in a hypertensive rat model with diet-independent spontaneous elevations in blood pressure.

Figure 6.

Figure 6

HFHS diet exposure, but not spontaneously developing hypertension, induces hypothalamic microangiopathy in rats

(A) Quantification of hypothalamic vascularity in Wistar Kyoto (WKY) rats fed SC or HFHS diet (4 weeks), or with spontaneously developing hypertension (SHR) under SC diet. Data are presented as mean ± SEM.

(B) Quantification of corresponding terminal bodyweights of WKY rats fed either SC or HFHS diet (4 weeks) as compared with SHR. Data are presented as mean ± SEM.

(C) Quantification of MAP of WKY rats fed either SC or HFHS diet (4 weeks) as compared with SHR as determined by the tail-cuff system measured repeatedly over separate days. Data are presented as mean ± SEM.

∗∗∗∗p < 0.0001. Statistical tests included one-way ANOVA.

Discussion

We have uncovered and characterized an unprecedented involvement of hypothalamic astrocytes in the regulation of systemic blood pressure via a leptin-dependent HIF1α-VEGF mechanism. We initially observed that hypothalamic astrocytes rapidly induce pro-angiogenic HIF1α-VEGF signaling as a consequence of elevated peripheral leptin levels under HFHS diet feeding. This early event during high-calorie exposure was paramount for the initiation of a dynamic astrocyte-dependent hypervascularization response, which proved to be unique to the hypothalamus. The brain-body interface within the MBH is highly susceptible to high-calorie diet exposure and well known to display various cytoarchitectural rearrangements, metabolic disturbances, and pro-inflammatory signaling. Notably, peripheral inflammation, which occurs as a consequence of hypercaloric feeding, for example, in white adipose tissue, has recently been linked to increased HIF1α-VEGF signaling. Importantly, the adipocyte-specific ablation of HIF1α was found to significantly reduce adipose tissue inflammation in mice (Lee et al., 2014), consistent with the improvements we observed in the hypothalamus upon astroglial HIF1α ablation. Analogous to the rapid induction of astroglial VEGF upon high-calorie exposure, a recent report demonstrated an increase of VEGF in the circulation (Jais et al., 2016). In contrast to the pro-angiogenic and permeability-promoting effects of astroglial VEGF (Argaw et al., 2012), the circulating VEGF pool induced by a hypercaloric diet was instead identified as instrumental in a counterregulatory mechanism that restores glucose transport across the cerebral endothelium upon its transient, lipid-induced impairment (Jais et al., 2016; Schüler et al., 2018). These differential downstream effects of VEGF at the cerebral endothelium are likely determined by the site of ligand binding, with blood-borne VEGF acting on endothelial cells from the luminal side as opposed to tissue-produced or parenchymal VEGF which signals to endothelial cells from the abluminal side. Indeed, a previous report delineated the underlying mechanism of differential VEGF signaling, which is specific to neurovascular interfaces and predicated on the polarized apicobasal distribution of endothelial VEGFR-1 (luminal) and VEGFR-2 (abluminal) (Hudson et al., 2014).

Here, we report that HFHS diet feeding triggers the release of VEGF by MBH astrocytes acting on endothelial cells from the parenchymal side. Notably, some tissue-borne VEGF can also stem from tanycytes, which are specialized ependymal cells residing at the third ventricle and previously reported to induce fenestrations in a small subset of specialized vessels in a VEGF-dependent manner upon metabolic challenges (Langlet et al., 2013). While this tanycyte-mediated plasticity appears highly regionalized, phasic by nature, and restricted to a small set of fenestrated vessels, our data here suggest that neighboring astrocytes located deeper within the parenchyma are instead sensitive to more tonic signals reflecting long-term energy status in order to initiate a chronic hypervascularization, barrier impairment, and neuroinflammation. Moreover, we further report that leptin action in the brain is a paramount factor for the development of hypothalamic angiopathy by inducing pro-angiogenic HIF1α-VEGF signaling in local astrocytes. Consistent with this finding, recently emerging evidence suggests that certain cytokines, growth factors, and hormones can modulate HIF1α-VEGF signaling independent of hypoxia (Kietzmann et al., 2016). By engaging different kinase-regulated pathways, these extracellular signals have been shown to result in various phosphorylation events that modify HIF1a signaling either directly or indirectly. Notably, however, mounting evidence suggests that phosphorylation-dependent regulation of HIF signaling may vary greatly depending on the cell type, the combination of signals, and the physiological context (Kietzmann et al., 2016). Here, for the first time, while we report an evidence suggesting that leptin administration potently induces pERK1/2 signaling as well as LepRa-dependent-VEGF induction in MBH astrocytes, the detailed molecular mechanisms involved in coupling leptin signaling with HIF1α-VEGF induction in hypothalamic astrocytes requires further investigations.

Interestingly, a potential link between leptin, VEGF, and the development of vasculopathies has been previously suggested for the retina (Cao et al., 2001; Suganami et al., 2004). In agreement, sparse clinical reports suggest elevations in serum, and particularly vitreal, leptin to independently predict the severity of proliferative diabetic retinopathy in humans (Gariano et al., 2000). Intrigued by these previous reports suggesting that leptin plays a general role in vascular pathobiology, we also assessed the retinal microvasculature in HFHS versus SC diet-fed mice. Even though chronic exposure of C57BL/6J mice to HFHS diet was sufficient to greatly elevate serum leptin levels and induce hypervascularization in the hypothalamus, vascular density remained constant in the retinae of these mice (data not shown). These discrepant results with previous studies may be due to the fact that leptin’s pro-angiogenic effects in the retina were studied upon an ischemic stimulus in mice (Suganami et al., 2004) and/or in human subjects with precedent retinopathy (Gariano et al., 2000), each representing highly distinct pathophysiological contexts.

Besides its pro-angiogenic actions at the microvasculature, leptin has also been linked with the development of arterial hypertension and was proposed as an independent factor conferring the obesity-associated risk for cardiovascular mortality. Ample evidence suggests that leptin’s effect on cardiovascular regulation is retained in obese individuals, whereas the hormone’s capacity to reduce bodyweight and food intake is significantly compromised (“physiologically selective leptin resistance”; reviewed in Mark, 2013). Importantly, the mechanisms by which leptin impacts the cardiovascular system are largely mediated via the central nervous system, particularly through tuning sympathetic outflow from hypothalamic and medullary pre-autonomic nuclei (reviewed in Simonds and Cowley, 2013). Notably, however, recent evidence now suggests that leptin can also act on neural components outside the CNS such as the carotid bodies thereby contributing to sympathoexcitation and hypertension via alternative routes (Caballero-Eraso et al., 2019). Within the CNS, though, the dorsomedial hypothalamus constitutes a region that has gained particular attention for its implications in leptin’s hemodynamic and sympathetic effects (Marsh et al., 2003; Simonds et al., 2014). Yet the importance of several other hypothalamic nuclei demands appreciation. Accordingly, considerable evidence has stated that site-specific microinjections of leptin directly into the arcuate nucleus (as part of the MBH) leads to robust increases in sympathetic nerve traffic and a rise in arterial pressure (Rahmouni and Morgan, 2007), while genetic deletion of LepR specifically in this region abrogates these responses (Harlan et al., 2011). While past research was largely focused on the direct—and often transient—effects of leptin on pre-autonomic neurons, we have now extended this model reporting that hypothalamic astrocytes respond to elevations in leptin by chronically increasing HIF1α-VEGF signaling. In turn, increased VEGF seems to promote hyperactivation of the sympathetic nervous system both directly as well as indirectly via chronic remodeling of the gliovascular interface. In light of the immediate pressor and sympathoexcitatory response upon central VEGF administration, central VEGF could trigger direct changes in neuronal excitability and synaptic function of pre-autonomic hypothalamic neurons. Indeed, several reports suggest that VEGF can exert various “non-traditional” functions within the brain that extend beyond the role of a vascular growth and permeabilizing factor, including the acute modulation of neurophysiological properties (Xu et al., 2003; Ma et al., 2009; Huang et al., 2010). On the other hand, our data suggest that VEGF promotes sympathoexcitation via an additional indirect mechanism that involves the chronic remodeling of the gliovascular interface. Here, we propose that by rendering pre-autonomic areas of the hypothalamus more susceptible to pro-inflammatory and pressor-promoting cytokines such as TNF-α (Han et al., 2016), such leptin-VEGF interactions in astrocytes further bias local neurons toward increased SNA in order to promote—and sustain—arterial hypertension in obesity. Sympathetic overdrive as a result of combined neurogenic and gliagenic mechanisms bears severe implications for cardiovascular regulation, including impaired sensitivity of the baroreceptor reflex, an index of arterial baroreceptor function. Contrary to previous reports, however, our studies in DIO mice fed HFHS diet failed to induce impairments in baroreflex sensitivity as assessed in response to blood pressure-lowering or upon administration of the α1-adrenergic receptor agonist phenylephrine. Importantly, however, most studies investigating baroreflex regulation in the context of obesity were performed in species other than mice, such as in humans (Grassi et al., 1998; Skrapari et al., 2007), dogs (Lohmeier et al., 2016), and rats (McCully et al., 2012), or in obese monogenic mice critically lacking leptin (Hilzendeger et al., 2010) or leptin receptors (Goncalves et al., 2009). In light of leptin’s prominent role in enhancing the baroreceptor reflex (Li et al., 2013; Shi et al., 2020), and the fact that endogenous leptin action is retained in DIO at least in mice (Ottaway et al., 2015), further studies are required to elucidate if differences in leptin sensitivity are responsible for the enhanced baroreflex gain we observed in DIO mice.

Conclusions

We propose that exposure to a hypercaloric diet rapidly triggers hypothalamic microangiopathy, a phenomenon that not only occurs prior to and independent of systemic hypertension but also directly contributes to systemic hemodynamic derangements via exaggerated sympathoexcitation. In contrast to other tissues in which elevated capillary pressure has been extensively described as sufficient for triggering renal (Folkow et al., 1958), retinal (Wong et al., 2016), or cortical (de Montgolfier et al., 2019) vascular remodeling, we have found that HFHS diet-induced remodeling of microvascular beds in the hypothalamus is instead primarily driven by hyperleptinemia and predominantly mediated by an intricate gliovascular crosstalk centered at astrocytic VEGF.

In conclusion, here, we highlight the importance of astrocytes for assimilating and integrating the peripheral leptin signal to in turn restructure select hypothalamic microcirculations for orchestrating long-term elevations in sympathetic outflow and blood pressure.

Limitations of study

The obvious limitation of our study entail a paucity of a more detailed insight into the underlying mechanisms that link astrocytic VEGF with autonomic outflow and blood pressure. This gap in the mechanistic understanding of a gliovascular-to-neuron communication could, for example, be bridged by employing our pharmacological and transgenic mouse models with microendoscopy or fiber-photometry in order to assess pathophysiological changes in astrocytic and neuronal activity within the MBH in vivo. Moreover, because of inherent methodological constraints, we report acute, but not longitudinal, analysis of SNA upon central VEGF infusion. Lastly, despite careful acclimatization and handling of mice, a stress-associated effect on tail-cuff blood pressure and serum catecholamines cannot be ruled out entirely.

STAR★Methods

Key resources table

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies

Rat anti-ACSA-2 Milteny 130-097-678
Sheep anti-albumin Abcam Cat# ab8940; RRID: AB_306875
Mouse anti-claudin-5 Life technology Cat# 35-2500; RRID: AB_2533200
Goat anti-collagen IV Chemicon/Merck Cat# AB769; RRID: AB_11210995
Rabbit anti-phospho-p44/42 MAPK/ERK1/2) (Thr202/Tyr204) Cell Signaling Technology Cat# 9101; RRID: AB_331646
Goat anti-GFAP Dako Cat# Z0334; RRID: AB_10013382
Chicken anti-GFP Abcam Cat# ab13970; RRID: AB_300798
Rabbit anti-HIF-1α Abcam Cat# ab82832; RRID: AB_1860665
Goat anti-Iba1 Synaptic Systems Cat# 234 003; RRID: AB_10641962
Anti-Ki67 Abcam Cat# ab16667; RRID: AB_302459
Rabbit anti-laminin Dako Cat# Z0097; RRID: AB_2313665
Mouse anti-NeuN Merck Cat# MAB377; RRID: AB_2298772
Rabbit anti-phospho-STAT3 (Tyr705) (D3A7) Cell Signaling Technology Cat# 9145; RRID: AB_2491009
Rabbit anti-VEGF (A-20) Santa Cruz Cat# sc-152; RRID: AB_2212984
Mouse anti-β-actin (AC-15) (HRP) Abcam Cat# ab49900; RRID: AB_867494
Alexa Fluor 488 goat anti-chicken IgG Invitrogen Cat# A-11039; RRID: AB_142924
Alexa Fluor 647 donkey anti-goat IgG Invitrogen Cat# A-21447; RRID: AB_141844
Alexa Fluor 405 goat anti-mouse IgG Invitrogen Cat# A-31553; RRID: AB_221604
Alexa Fluor 568 donkey anti-rabbit IgG Invitrogen Cat# A10042; RRID: AB_2534017
Alexa Fluor 647 donkey anti-rabbit IgG Invitrogen Cat# A-31573; RRID: AB_2536183
Alexa Fluor 647 donkey anti-sheep IgG Invitrogen Cat# A21448; RRID: AB_1500712

Chemicals, peptides, and recombinant proteins

Acetylcholine Sigma-Aldrich A6625
Benzyl alcohol Sigma-Aldrich 24122-1L
Benzyl benzoate Sigma-Aldrich B6630-250ML
Cobalt (II) chloride hexahydrate Sigma-Aldrich C8661-25G
Dichloromethane Sigma-Aldrich 270997-100ML
Doxycycline hyclate Sigma-Aldrich D9891
Durcupan Electron Microscopy Sciences 14040
Formvar Electron Microscopy Sciences 15800
Gelatin from porcine skin (SUMI) VWR International SAFSG1890
Glutaraldehyde Electron Microscopy Sciences 16316
Heparin Sigma-Aldrich H0200000
Isoproterenol Sigma-Aldrich I-5627
KCl Sigma-Aldrich P9541
MTBE Sigma-Aldrich 1634-04-4
NuPAGE LDS sample buffer (4x) Novex/Life Technologies NP008
Osmium Tetroxide Electron Microscopy Sciences 19150
Paraformaldehyde Carl Roth 0335.2
Pepsin DAKO/Agilent S3002
Primers Thermo Fisher N/A
Recombinant mouse leptin R&D systems 498-OB
Recombinant Mouse VEGF164 R&D systems 493-MV
Skim milk powder Sigma-Aldrich 70166-500 g
Sodium nitroprusside Sigma-Aldrich 1614501
Tamoxifen Sigma-Aldrich T5648-1g
TaqMan Gene Expression Assay Thermo Fisher N/A
TaqMan Universal Master Mix II, no UNG Thermo Fisher 4440040
Tetrahydrofuran Sigma-Aldrich 186562-1L
Thromboxane A2 U46619 Sigma-Aldrich CAS 56985-40-1
Triton X-100 Roche Diagnostics 11858620
Tween-20 Sigma-Aldrich 9005-64-5

Critical commercial assays

Adult Brain Dissociation Milteny 130-107-677
Bright-Glo Luciferase Assay System Promega E2610
Mouse/Rat Leptin ELISA Alpco 22-LEPMS-E01
Pierce BCA protein assay Thermo Fisher 23228
QuickDetect catecholamine (mouse) ELISA Kit Enzo Lifesciences E4462
RNeasy Micro Kit QUIAGEN 74004
RNeasy Mini Kit QUIAGEN 74104
SMARTer PCR cDNA synthesis kit TaKaRa 634455

Experimental models: Organisms/strains

Mouse Lepob/ob Jackson Laboratory B6.Cg-Lepob/J;BKS.Cg-Dock7m+/+
Mouse Lepdb/db Jackson Laboratory Leprdb/J; Maine, USA
Mouse TRE-LeprtTA Dr. LeDuc; Columbia University; USA (Skowronski et al., 2020) N/A
Mouse LepRb:Ai14 This paper B6.129(Cg)-LepRtm(cre)Rck/J;B6.Cg-Gt(ROSA)26Sortm14(CAGtdTomato)Hze/J
Mouse LepRiΔastro/GFAP+ Kim et al., 2014 B6.129P2-Leprtm1Rck/J;B6.Cg-Tg(GFAPcre/ERT2)505Fmv/J
Mouse HIF-1αiΔastro/GFAP+ This paper B6.129-Hif1atm3Rsjo/J;B6.Cg-Tg(GFAPcre/ERT2)505Fmv/J
Mouse HIF-1αiΔastro/GLAST+ This paper B6.129-Hif1atm3Rsjo/J;Slc1a3tm1(cre/ERT2)Mgoe
Mouse HIF1/ODD-Luciferase Jackson Laboratory FVB.129S6-Gt(ROSA)26Sortm2(HIF1A/luc)Keal/Js
Mouse hGFAP.CreERT2 Dr. Vaccarino; Yale University; USA B6.Cg-Tg(GFAPcre/ERT2)505Fmv/J
Mouse GLAST.CreERT2 Prof. Goetz; LMU/HMGU Munich; GER Slc1a3tm1(cre/ERT2)Mgoe
Mouse ROSA26 mT/mG Jackson Laboratory B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J
Rat Wistar Kyoto Envigo WKY/NHsd
Rat SHR (spontaneous hypertensive rat) Envigo SHR/NHsd

Oligonucleotides

VEGF shRNA targeting sequence 5′ -TGA AGA TGT ACT CTA TCT CGT-3′ Vector Biolabs Nt 1218-1238 of NM_009505
Hairpin loop sequence 5′ -GTT TTG GCC ACT GAC TGAC-3′ Vector Biolabs N/A
VEGF164 overexpressing sequence Vector Biolabs RefSeq#:BC061468
LepRa forward primer 5′ -GAA GTC TCT CAT GAC CAC TAC AGA TGA-3′ Sigma-Aldrich N/A
LepRa reverse primer 5′ - TTG TTT CCC TCC ATC AAA ATG TAA -3′ Sigma-Aldrich N/A
LepRb forward primer 5′ - GCA TGC AGA ATC AGT GAT ATT TGG-3′ Sigma-Aldrich N/A
LepRb reverse primer 5′ - CAA GCT GTA TCG ACA CTG ATT TC TTC -3′ Sigma-Aldrich N/A

Software and algorithms

FIJI NIH https://imagej.net/Fiji/Downloads
FlowJo BD N/A
GraphPad Prism 6.0 h GraphPad Software N/A
IMARIS x64 9.1.2 Oxford instruments N/A
MacLab Chart Pro 7.0 GE Healthcare N/A

Other

Bovine serum albumin Sigma Aldrich A8806
Gelatin from porcine skin (SUMI) VWR International SAFSG1890
Glo Lysis Buffer Promega E2661
Halt protease and phosphatase inhibitors (100x) Thermo Fisher Scientific, Waltham, USA 78446
Radioimmunoprecipitation assay (RIPA) buffer Sigma-Aldrich R0278-500ML
AAV.Gfa2.iCre Vector Biolabs Cat. No.: VB1172
AAV.Gfa2.VEGFGFP Vector Biolabs Cat. No.: AAV-275992
AAV.Gfa2.EGFP Vector Biolabs Cat. No.: VB1180
Lectin-FITC conjugate Thermo Fisher L4895
WGA-Alexa Fluor 647 Thermo Fisher W32466
NeuroTrace 435/455 Thermo Fisher N21479
NeuroTrace 500/525 Thermo Fisher N21480
Albumin FITC Sigma Aldrich A9771
Dextran-FITC (40 kDa) Sigma Aldrich Cat# 53379

Resource availability

Lead contact

Request for further information, reagents and resources should be directed and will be fulfilled by the Lead Contact, Cristina García-Cacéres (garcia-caceres@helmholtz-muenchen.de).

Materials availability

Mouse lines (HIF1α::hGFAP.CreERT2; HIF1α::hGLAST.CreERT2; LepR::hGFAP.CreERT2) and AAV vectors (e.g. Gfa2.shRNA(VEGF/scrmbl, Gfa2.VEGF.GFP over expressing, etc.) generated in this study are available from the lead contact upon request.

Data and code availability

Not applicable.

Experimental model and subject details

Mouse models

Mouse studies were approved by the Animal Ethics Committee of the government of Upper Bavaria (Germany), the Yale University School of Medicine (CT, US), Medicine Faculty of Universidad Autónoma de Madrid (Spain) and the University of Iowa (IA, UA). Wildtype mice (C57BL/6J, Janvier, Le Genest-Saint-Isle, France) or genetically modified mice aged 12 weeks were provided ad libitum access to either a pelleted standard chow (SC) diet (5.6% fat; LM-485, Harlan Teklad) or a high-fat, high-sucrose (HFHS) diet (D12331; 58% of calories from lipids; Research Diets, New Brunswick, NJ). Animals had continuous free access to water and were maintained at 23°C with constant humidity on a 12-h light–dark cycle. Lepob/ob mice and Lepdb/db mice were originally provided from Jackson Laboratory (strain name: B6.Cg-Lepob/J; BKS.Cg-Dock7m +/+ Leprdb/J; Maine, USA). Leptin-overexpressing mice (TRE-Lep rtTA) were generated from KH2 embryonic stem cell line to include M2rtTA at the Rosa26 locus and the mouse Lep gene with tetracycline-response element (TRE) upstream (TRE-Lep) as described previously (Skowronski et al., 2020). Study animals were bred by crossing homozygous TRE-Lep females with heterozygous ROSA26rtTA males to generate 50% of TRE-LeprtTA, which induce leptin production when exposed to doxycycline (DOX), and 50% TRE-Lep control littermates unresponsive to doxycycline (DOX). 200 μg/ml of DOX was administered to a cohort of 14-week-old male and female mice in their drinking water for 4 weeks. For visualization of the expression pattern of the long-form leptin receptor the LepRb:Ai14 reporter mouse model was employed, which was derived from inter-crossing LepRb-Cre mice (DeFalco et al., 2001) and Ai14 mice (Madisen et al., 2010) both provided from Jackson Laboratory (strain name: B6.129(Cg)-LepRtm(cre)Rck/J and B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J, respectively). LepR loxP/loxP mice (McMinn et al., 2005), HIF1α loxP/loxP mice (Ryan et al., 2000) as well as HIF1/ODD-Luciferase mice (Safran et al., 2006) were generated and described previously and provided from Jackson Laboratory (strain name: B6.129-Hif1atm3Rsjo/J, B6.129P2-Leprtm1Rck/J and FVB.129S6-Gt(ROSA)26Sortm2(HIF1A/luc)Keal/J, respectively). In order to generally excise sequences flanked by loxP sites, mice were crossed with one of the astrocyte-specific CreERT2-driver lines: (1) the transgenic hGFAP-CreERT2 mouse line, which was generated on a C57BL/6J background and provided by F.M. Vaccarino (Yale University, School of Medicine, CT, US), or (2) the GLAST.CreERT2 mouse line in which Cre recombinase is knocked into the locus of the GLAST gene (Mori et al., 2006). All experiments using the GLAST-specific driver mice were performed with the GLAST.CreERT2 allele in heterozygosity. In both inducible models, nuclear translocation and hence activation of CreERT2 was induced postnatally in 6-week-old mice by repeated injections of Tamoxifen (10 mg/kg BW; i.p.) for 5 consecutive days. Tamoxifen (Sigma) was dissolved in sunflower oil at a final concentration of 10 mg/ml at 37°C and filter sterilized. Whenever indicated, mice were further backcrossed to the Cre-dependent reporter mouse line ROSA26 mT/mG provided from Jackson Laboratory (strain name: mT/mG) in order to identify recombined cells by means of membrane-localized EGFP expression. As described previously, GFAP-CreERT2 driver mice displayed extensive recombination in thalamic and hypothalamic regions with poor cortical recombination, while GLAST.CreERT2 mice displayed extensive recombination in all brain regions except for thalamic nuclei (García-Cáceres et al., 2016). All mice used in experiments displayed good general health. C57BL/6J wildtype mice (Janvier) as well as Lepob/ob mice and Lepdb/db mice (Jackson Laboratory) were purchased and immediately entered experiments upon sufficient acclimatization to the facility. The remaining genetically modified mice were generated and maintained as in-house colonies. While both sexes were included for the study of TRE-LeprtTA mouse model, the remaining experiments were conducted in exclusively male littermates.

Genotyping of mouse lines

Eartags were obtained from mice at the age of 3 weeks and DNA was isolated by boiling the eartags for 30 min in 200 μl 50 mM NaOH at 95°C (ThermoMixer C, Eppendorf). Afterwards, 20 μl 1 M Tris was added to normalize the pH. 2 μl of isolated genomic DNA was used for the genotyping PCR (Promega) using respective protocols.

Rat model

Rat studies were approved by the Animal Ethics Committee of the government of Universidad Autónoma de Madrid (Spain). Spontaneously hypertensive rats (SHR) and Wistar Kyoto (WKY) rats (Envigo; Indianapolis; USA) were group housed with continuous free access to pelleted food and water and were maintained at 23°C with constant humidity on a 12-h light–dark cycle. All rats used in experiments were directly purchased (Envigo), displayed good general health and immediately entered experiments upon sufficient acclimatization to the facility. Hypothalamic vascular profiles were assessed in 16-week-old male WKY rats either fed 4 weeks HFHS diet (D12331; 58% of calories from lipids; Research Diets, New Brunswick, NJ) or SC diet and compared to littermates with spontaneously hypertensive rats (SHR) maintained on SC diet. Bodyweight was assessed repeatedly as well as blood pressure using tail cuff measurements conducted over the course of four consecutive days (Niprem 645 blood pressure system; Cibertec, Madrid, Spain). At the day of sacrifice, rats received 10 ml/kg of FITC-albumin (10 mg/ml in 0.9% NaCl; MW 69 kDa, Merck, Germany) via the tail vein. After circulation of the tracer for 5 min, rats were decapitated, blood was collected for determining circulating leptin levels and brains were rapidly immersion-fixed in 4% PFA in 0.1 M PBS (pH 7.4) for 72 h at 4°C.

Method details

STZ-induced diabetes mouse model

Insulin-dependent diabetes mellitus was experimentally induced by administering the β-cell toxin Streptozotocin (STZ) to 8-week-old, male wild-type mice (C57BL/6J) according to the multiple low-dose injection protocol of the Diabetic Complications Consortium (50 mg/kg BW; i.p for 5 days versus vehicle (Na-Citrate Buffer)). One group received daily injections of polyethylene-glycosylated (PEGylated)-insulin (25 nmol/kg/day in 5 μl/g) to achieve normoglycemia. PEGylated insulin was synthesized by N-terminal amine reductive amination with 20K methoxy PEG propionaldehyde. In brief, human insulin was dissolved in 50 mM sodium acetate buffer (pH 5.0) and 50% acetonitrile. A 30-fold excess of sodium cyanoborohydride and a 1.5-fold excess of methoxy PEG propionaldehyde (M-ALD-20K, JenKem Technology USA, Plano, TX) was added to the insulin-containing buffer for 3 h at room temperature with stirring. Purification by reverse phase chromatography on a C-8 column in 0.1% TFA acetonitrile solvents yielded PEGylated insulin at greater than 95% purity.

Body composition analysis

Body composition (fat and lean mass) was assessed by using a magnetic resonance whole-body composition analyzer (Echo-MRI, Houston, TX).

Measurement of mean arterial pressure in conscious mice by the tail cuff system

Mean arterial blood pressure (MAP) measurements were performed in each mouse every other day for two weeks before sacrifice by tail-cuff plethysmography using either a Niprem 645 blood pressure system (Cibertec, Madrid, Spain) or a Hatteras MC4000 multichannel blood pressure analysis system (Hatteras, North Carolina, USA). For that purpose, mice were placed in a quiet area (22±2°C) and habituated to the experimental conditions for at least 3 days. Before measurements, mice were pre-warmed to 34°C for 10–15 min. Then, the occlusion cuff was placed at the base of the tail and the sensor cuff was placed next to the occlusion cuff. Next, the occlusion cuff was inflated to 250 mm Hg and deflated over 20 s. Five to six measurements were recorded in each mouse and the mean of all measurements was calculated each day per animal.

Arterial pressure and heart rate recording in anesthetized mice

Mice were anesthetized with a mixture of ketamine (70 mg/kg) and xylazine (5 mg/kg). Afterwards, the throat was incised from below the mandible to the thoracic inlet. Under a dissecting microscope, the left carotid artery was exposed and carefully separated from other neighboring structures including the vagus nerve. After left carotid isolation, a silk suture (6-0) was placed distally for the complete ligation of the vessel. Then the left carotid artery was proximally occluded with a clamp to produce temporary obstruction of blood flow. Afterwards a small incision was made to insert a polyethylene tube filled with saline containing 100 units heparin/ml. The polyethylene tube had two branches; one for the injection of drugs and the other one with a lateral connection in the perfusion cannula connected to a pressure transducer (Statham Instruments, Los Angeles, CA, US). Mean arterial blood pressure was recorded using the PowerLab/8e data acquisition system (ADInstruments, Colorado Springs, CO, US), and the heart rate was obtained from the arterial pressure recording. The baroreflex control of the heart rate was assessed by administering a bolus of sodium nitroprusside (SNP; 500 μg/kg BW). The α-adrenergic sensitivity was assessed by measuring the changes in mean blood pressure (MBP) after phenylephrine carotid infusion (PE; 50 μg/kg BW) and the β-adrenergic sensitivity was assessed by measuring the changes in both MBP and heart rate to isoproterenol carotid administration (IPR; 50 μg/kg BW).

Implantation of intracerebroventricular (i.c.v.) cannulation

C57BL/6J mice were anesthetized with isoflurane (5% for induction; 1-2% to sustain). Once anesthetized, each mouse was placed in a stereotaxic device and implanted with a stainless-steel cannula (25G, 9 mm length) into the lateral brain ventricle (0.3 mm posterior and 1.0 mm lateral to bregma and 3.0 mm below the surface of the skull) as described previously (Bell et al., 2018). Mice were allowed to recover for 7-10 days. Cannula-implanted mice were either selected for implantation of a radiotelemetry unit (see below) or for the acute effects of VEGF (i.c.v.) versus vehicle (PBS) on blood pressure (BP), heart rate (HR) and renal sympathetic nerve activity (rSNA) in the anesthetized mouse.

Central VEGF effects in conscious mice with radiotelemetry units

Blood pressure (BP) and heart rate (HR) were monitored in conscious, unrestrained mice with an implantable radio-telemetry device (TA11PA-C10, Data Science International). Under isoflurane anesthesia (5% for induction; 1-2% to sustain) and aseptic surgical conditions, a radio-telemetric catheter was implanted into the left common carotid artery through a ventral neck incision. The transmitter unit was placed in a sub-cutaneous pocket located on the right flank below the ribs. After 10-12 days of recovery, direct BP and HR were continuously measured in a conscious, unrestrained mouse with the use of a single-unit telemetry acquisition device (R11CPA, Data Science International). After 2 h of stable basal telemetry measurements, an injection of VEGF (25 ng, i.c.v.) or vehicle (PBS 1μl, i.c.v.) was randomly given and BP and HR responses were recorded for the next 5 h.

Central effects of VEGF on blood pressure, heart rate and renal sympathetic nerve activity in anesthetized mice

On the day of the study, each mouse was anesthetized with intraperitoneal administration of Ketamine (91 mg/kg, BW) and Xylazine (9.1 mg/kg, BW) then underwent intubation with PE-50 to provide an unimpeded airway for the mouse to spontaneously breathe O2-enriched room air. A micro-renathane tubing (MRE-40, Braintree Scientific) was inserted into the right jugular vein for intravenous infusion of the anesthetic agent: α-chloralose (initial dose: 12 mg/kg, then a sustaining dose of 6 mg/kg/h). Another MRE-40 catheter was inserted into the left carotid artery and connected to a pressure transducer (BP-100; ADInstruments) for continuous measurement of BP and HR. Core body temperature, monitored through a rectal probe, was maintained at 37.5°C with a temperature controller. A left retroperitoneal incision was made to access the postganglionic nerve fibers that subserve the left kidney (rSNA). After careful isolated from surrounding connective tissues, a bipolar platinum-iridium electrode (36-gauge, A-M Systems) was suspended under the renal nerve fascicle and secured with silicone gel (Kwik-Sil, WPI). The electrode was attached to a high-impedance probe (HIP-511, Grass Instruments) and the nerve signal was amplified 105 times and filtered at a 100- and 1000-Hz cut-off with a Grass P5 AC pre-amplifier. The amplified and filtered nerve signal was routed to a speaker system and to an oscilloscope (model 54501A, Hewlett-Packard) to monitor the audio and visual quality of the sympathetic nerve recordings. For quantification purposes; the amplified, filtered nerve signal was directed to a resetting voltage integrator (model B600c, University of Iowa Bioengineering, IA, USA) and to a MacLab analogue-digital converter (Model 8S, ADInstruments Castle Hill, New South Wales, Australia) containing the software (MacLab Chart Pro; Version 7.0) that utilizes a cursor to analyze the number of spikes/second that exceeds the background noise threshold. Baseline BP, HR and rSNA were recorded over a 10 min control period before i.c.v. injection of VEGF (25 ng) or Vehicle (PBS: 1 μl) was made. The rSNA response was continuously recorded and quantified at 15 min intervals over the next 4 h. Any residual nerve activity that remained after death was considered background noise and thus was subtracted from the measured SNA for both resetting voltage integration and spikes/s. The experiment was conducted in a non-blinded fashion.

Leptin administration in vivo

Repeated intraperitoneal leptin administration protocol

5 mg of recombinant mouse leptin (498-OB, R&D systems, Minneapolis, US) was dissolved in 1 ml ice-cold Tris-HCl buffer (20 mM, pH 8). This stock solution (5 mg/ml) was further diluted with ice-cold PBS (pH 7.4) to get a 1 mg/mL working solution. For vehicle control injections, the equivalent volume of plain 20 mM Tris-HCl was diluted in ice-cold PBS (pH 7.4). Whenever indicated, mice received repetitive leptin administration 3 mg/kg BW i.p. twice daily over two days plus another terminal injection in the following morning. Mice were sacrificed by transcardial perfusion 45 min following the injection to allow for immunohistochemical detection of pSTAT3 or 30 min post-injection for pERK1/2. In acute studies, mice received 5 mg/kg BW leptin i.p. 90 min before sacrifice to determine HIF1α induction by means of Western blot and HIF1A-1/ODD luciferase activity.

Intracerebroventricular delivery of leptin to Lepob/ob mice

The pro-angiogenic effect of leptin was studied in homozygous Lepob/ob mice and heterozygous Lepob/+ littermates at 12 weeks of age. Intracerebroventricular (i.c.v.) cannula and micropump implantations were performed as previously described (Ducy et al., 2000; Sato et al., 2007). In brief, a cannula was implanted into the cerebral lateral ventricle (AP: −0.50 mm, ML: ± 1.3 mm, DV: −2.3 mm), and an osmotic micropumps (model 1002D, Alzet) was implanted subcutaneously via a catheter connected to the cannula. Micropumps were loaded with either high-dose leptin (200 ng/day), low-dose leptin (50 ng/day) or vehicle (aCSF) the day prior to surgery. Food intake and bodyweight loss was controlled daily. High-dose leptin group was terminated prior (day 7 post-surgery) due to the culminating anorexia whereas all remaining groups were terminated at day 10 post-surgery.

Analysis of serum leptin concentrations in mice

Food was removed from mice for 3 h in the morning. Blood was collected from the tail vein into microvette tubes and immediately stored on ice in order to obtain serum (5,000 x g for 10 min at 4°C). Serum leptin concentrations determined by a commercial mouse leptin ELISA (Alpco) following the manufacturer’s instructions.

Glucose metabolism in mice in vivo

Before glucose tolerance tests, mice were fasted for 4 h and then given an intraperitoneal injection of glucose dissolved in 1xPBS (pH 7.4) at 2 g/kg BW. Glycemia was measured by sampling blood from the tail vein before (0 min) and at 15, 30, 60 and 120 min post injection via a handheld glucometer (Abbott, Wiesbaden, Germany). In order to assess insulin sensitivity, additional blood was collected at 0 min using EDTA-coated microvette tubes (Sarstedt, Nürnbrecht, Germany) to obtain plasma (5,000 x g for 10 min at 4°C). Insulin concentration was determined using a commercial insulin ELISA following the manufacturer’s instructions (Ultra-sensitive Mouse Insulin ELISA Kit, #90080 Crystalchem, Netherlands). HOMA-IR was calculated using the formula: HOMA-IR=[fasting insulin (mU/l) fasting glucose (mg/dl) / 405] (Matthews et al., 1985).

Viral targeting of astrocytic VEGF signaling in the mediobasal hypothalamus (MBH)

In order to manipulate Vegfa expression levels in the MBH, recombinant adeno-associated viruses of serotype 2/5 (AAV2/5) were commercially generated (VectorBioLabs, Malvern, US) and configured such that viral transgene expression was driven in each case from a synthetic 2.2 kb GFAP promoter element (Gfa2) faithfully restrictive to astrocytes as described previously (Brenner et al., 1994). Respective AAVs were injected bilaterally (0.5 μl per hemisphere; 1.0 x 1012 viral genomes/ml) using a stereotaxic system combined with a binocular 3.5x-90x stereomicroscope (AMScope, USA) and a 2 μl syringe (2 μl with a 30 G needle; Hamilton, US). Injection speed was set at 250 nl/min and undesired diffusion of viral particles was further prevented by slow retraction of the cannula 5 min post injection. The following stereotaxic coordinates were obtained from ‘The Mouse Brain in Stereotaxic Coordinates’ (Franklin and Paxinos, 2008) and used to target the MBH of the mouse brain: −1.4 mm posterior and ±0.2 mm lateral to the bregma and −5.8 mm ventral from the dura mater. Anesthesia was performed by a mixture of ketamine and xylazine (100 mg/kg BW and 7 mg/kg BW, respectively) while acute Metamizol (200 mg/kg, subcutaneous) followed by Meloxicam (1 mg/kg, on three consecutive days, subcutaneous) was administered for postoperative analgesia.

Knockdown of Vegfa mRNA in astrocytes was achieved by using an AAV2/5 variant (AAV.shRNA(VEGF) vΔGFAP/+) driving GFP expression together with a shRNA targeted against Vegfa separated by a P2A linker peptide within the GFP 3’UTR. The following targeting sequence was selected after providing >60% knockdown efficiency in an initial validation screen: TGAAGATGTACTCTATCTCGT (nt1218-1238 of NM_009505). This sequence was further fused to the following hairpin loop sequence: GTTTTGGCCACTGACTGAC. Control AAV was identical except for carrying a scrambled RNA sequence (AAV.scrmbl.RNAGFAP/+). Respective AAV’s were injected into male C57BL/6J mice that were either fed a HFHS diet 10 d post injection or that already had established diet-induced obesity.

Restoration of Vegfa expression in hypothalamic astrocytes devoid of HIF1α was achieved by using a combination of the following AAV2/5 variants to be injected into the MBH of HIF1α loxP/loxP mice: (1) AAV.Gfa2.iCre + expressing codon-optimized Cre recombinase (Cat. No: VB1172) combined with (2) AAV.Gfa2.VEGFGFP driving the expression of Vegfa164 together with GFP separated by a by a P2A linker peptide (AAV2/5.Gfa2-GFP-2A-m-VEGF-a; Cat.No: AAV-275992; RefSeq#:BC061468; VectorBioLabs, Malvern, US). As control groups, mice were either injected with AAV.Gfa2.iCre (VB1172; VectorBioLabs, Malvern, US) (HIF1α knockout group) or injected with AAV.Gfa2.EGFP (VB1180; VectorBioLabs, Malvern, US) (control). Mice were switched to HFHS diet 10 d post injection.

In vivo bioluminescence imaging of HIF1A/ODD-Luciferase mice

Food was removed from homozygous HIF1A/ODD-Luc mice 3 h prior to the experiment. Pairs of mice received either vehicle or leptin (5 mg/kg BW; i.p.) followed by another injection 50 min thereafter with the improved luciferin analog CycLuc1 (100 μl of 10 μM; i.p.). 60 minutes after the injection, pairs of anesthetized mice were placed in an IVIS Spectrum in vivo imaging system (PerkinElmer). Luminescent exposure was set at 60 s with an open emission filter and binning factor 8. For image acquisition, a field of view 6.6 cm was used along with subject size of 1.5 cm (mouse).

Ex vivo luciferase assay of HIF1A/ODD-Luc brain homogenates

Luciferase activity in mouse hypothalamus and cortex was assessed as previously described (Hoppe et al., 2016). Briefly, HIF1A/ODD-Luc mice were sacrificed upon food removal for 3 h, their hypothalami and cortex were rapidly dissected and homogenized in Glo Lysis Buffer (Promega) using a glass homogenizer (Duran Wheaten Kimble, US) on ice. Cell debris was spun down at 10,000 x g, 4°C for 10 min. Protein concentration of supernatant was determined using BCA protein assay (ThermoFisher Scientific, Rockford, IL US) and adjusted to 250 μg in a final volume of 100 μl of Glo Lysis Buffer (Promega). Samples were placed in a white opaque 96-well plate, brought to room temperature and mixed with an equal volume (100 μL) of ready-to-use luciferase substrate Bright-Glo Luciferase Assay System (Promega), and luminescence was measured immediately by a luminometer (PheraStar F; BMG LABTECH GmbH, Ortenberg, Germany).

Vascular reactivity experiments in aorta segments

For the vascular reactivity experiments, the aorta was carefully dissected, cut in 2 mm segments and kept in cold isotonic saline. Each aorta segment was set in a 4 ml organ bath containing modified Krebs–Henseleit solution (mM) (NaCl, 115; KCl, 4.6; KH2PO4, 1.2; MgSO4, 1.2; CaCl2, 2.5; NaHCO3, 25; glucose, 11) at 37 °C. The solution was equilibrated with 95% oxygen and 5% carbon dioxide to a pH of 7.3–7.4. For the setting process, two fine steel wires (100 μm diameter) were passed through the lumen of the vascular segment. One wire was attached to the organ bath wall and the other wire was connected to a strain gauge for isometric tension recording (Universal Transducing Cell UC3 and Statham Microscale Accessory UL5, Statham Instruments). This arrangement permits applying passive tension in a perpendicular plane to the long axis of the vascular cylinder. The changes in isometric force were recorded using a PowerLab data acquisition system (ADInstruments, Colorado Springs, CO, US). After applying an optimal passive tension of 1 g, vascular segments were allowed to equilibrate for 60–90 min. Afterwards, segments were stimulated with potassium chloride (KCl 100 mM) to determine the contractility of smooth muscle. Segments which failed to contract at least 50 mg to KCl were discarded. After equilibration, the segments were pre-contracted with the analogue of thromboxane A2 U46619 (10-8 M) (Sigma-Aldrich, St. Louis, MO, USA). Then, in order to assess the endothelium-dependent and endothelium-independent relaxation, cumulative dose-response curves in response to acetylcholine (ACh) (10-9-10-4 M) and sodium nitroprusside (10-9-10-4 M) (Sigma-Aldrich) were performed. The relaxation in response to ACh was determined based on the percentage of the active tone achieved by the NO donor sodium nitroprusside (10-5 M) (Sigma-Aldrich). For each dose–response curve, the maximum effect (Emax) and the logarithm of the concentration producing 50% of the maximal response (ED50) was calculated by geometric interpolation.

Magnetic-activated and fluorescence-assisted cell sorting (MACS/FACS)

In order to validate the efficient deletion of exon 2 in HIF1α flox/flox mice, we generated dual fluorescent reporter mice (HIF1α loxP/loxP::hGFAP.CreERT2::ROSA26mT/mG) allowing us to differentiate non-recombined (tdTomato+EGFP-) from recombined (tdTomato+EGFP+) astrocytes for separate downstream analyses. Cre-mediated recombination was induced by tamoxifen injection at the age of 6 weeks as described before (10 mg/5 d). At 12 weeks of age, mice were sacrificed, their brains were rapidly removed and one hemisphere per mouse was subjected to magnetic-bead assisted cell sorting (MACS) enrichment using the astrocyte-specific surface marker ACSA-2 (Batiuk et al., 2017; Kantzer et al., 2017). ACSA-2+ astrocytes were enriched according to a commercially available standard protocol (Isolation and Cultivation of Astrocytes from Adult Mouse Brain; Miltenyi Biotec) using LS columns and an elution volume of 1 mL PBS. Cells were then rapidly subjected to fluorescence-activated cell sorting (FACS) in order to further separate recombined from non-recombined ACSA-2+ tdTomato+ astrocytes based on EGFP expression. To accurately gate the aforementioned subpopulations, a non-tamoxifen injected littermate reporter mouse (tdTomato+ EGFP- ACSA-2+) and a non-fluorescent C57BL/6J wildtype mouse (tdTomato- EGFP- ACSA-2+) were initially analyzed by FACS. Sorting was performed using a FACS-Aria III (BD Biosciences, Heidelberg, Germany) with an 85 μm nozzle. For optimal visualization of all ACSA-2+ astrocytes, logarithmic scales and low acquisition voltages (75 and 190) were implemented for forward scatter (FSC) and side scatter (SSC) plots, respectively. Sorted cells were collected in cold PBS, pelleted by centrifugation for 5 min at 600 x g and 4°C, resuspended in 350 μl RLT buffer supplemented with 0.4 mM DTT and stored at -80°C until RNA extraction (RNeasy MicroKit; Quiagen) and cDNA synthesis (SMARTer PCR cDNA synthesis kit; TaKaRa) following manufacturer’s indications.

In a separate set of mice, the reduction in astrocytic Hif1α expression was compared between hGFAP.CreERT2::ROSA26mT/mG mice that harbour either wildtype alleles for HIF1α (HIF1α wt/wt) or both alleles with exon 2 flanked by loxP sites (HIF1α loxP/loxP). Cre-mediated recombination was induced by tamoxifen injection at the age of 6 weeks as described before (10 mg/5 d). At 12 weeks of age, mice were sacrificed, their brains were rapidly removed, the hypothalami were collected and recombined astrocytes (tdTomato+EGFP+) were magnetically separated via MACS by using a GFP-antibody coupled to magnetic beads (μMACS GFP isolation kit, Miltenyi Biotec). As for pre-enrichment for ACSA-2+ astrocytes, the commercially available standard protocol was followed (Isolation and Cultivation of Astrocytes from Adult Mouse Brain; Miltenyi Biotec) using LS columns and an elution volume of 1 mL PBS. For quantitatively assessing HIF1a expression via qPCR, a TaqMan probe was selected that span exon 2 that is flanked by loxP sites.

Fluorescent angiography

To obtain detailed information of the mouse brain vascular profile, animals were sacrificed with CO2 and transcardially perfused with 20 ml phosphate-buffered saline (PBS) (GibcoTM, pH 7.4) supplemented with Lectin-FITC conjugate (25 μg/ml; Tritium vulgaris; L4895; Merck, Germany) by using a peristaltic pump at 120 mmHG (Instech, High Flow P720 equipped with 21G canula). Cohorts of animals already expressing green-fluorescent reporter proteins were perfused with an alternative vessel dye (wheat heat-germ agglutinin (WGA) conjugated to fluorchromophores Alexa Fluor 647; W21404; ThermoFisher, Germany). Perfusions were finalized with 20 ml of 4% paraformaldehyde (PFA) in PBS, pH 7.4, brains were removed and post-fixed in 4% PFA at 4°C. In order to rule out potential confounding by applying a uniform pressure source in perfusion-based angiography, we subjected one cohort of mice to intravenous administration of FITC-albumin (10 mg/ml in 0.9% NaCl; MW 69 kDa, Merck, Germany), which was infused slowly into the tail vein over 5 min. After 8 more min in which the dye was allowed to become distributed solely by means of cardiovascular function, mice were decapitated and brains rapidly immersion-fixed in 4% PFA in 0.1 M PBS (pH 7.4) for 72 h at 4°C. In either case, brains were then equilibrated with 30% sucrose in Tris-buffered saline (TBS, pH 7.2) for 48 h before being sectioned into 40 μm coronal slices using a cryostat (CM3050S; Leica, Germany). Three to four brain sections per mouse were selected containing the middle portion of the MBH and either directly mounted on gelatine-coated glass slides, dried and cover-slipped by a polyvinyl alcohol (mowiol, Merck, Germany) mounting medium supplemented with DABCO (Merck, Germany) or further subjected to additional immunohistochemistry.

Assessment of blood-brain barrier integrity

Properties of the blood-brain barrier were analyzed by immunohistochemical detection of endogenous albumin (ca. 68 kDa) extravasating into the parenchyma (indicative of protein permeability). In another set of animals, we administered the exogenous tracer FITC-Dextran 40 kDa (100 ul of 100 mg/ml; i.v.). In order to avoid diffusion and washout of low-molecular tracers we employed a specific histological preparation technique described previously (Hoffmann et al., 2011). In brief, tracer was allowed to circulate for 5 min, mice were sacrificed by rapid decapitation and brains were immersion fixed for 48h at 4°C. Brains were frozen upon brief (> 12 h) dehydration in 30% sucrose and cut at a cryostat at 50 μm. Coronal brain sections were immediately mounted and cover-slipped without rehydration.

Image acquisition and analysis of vascularity in consecutive brain sections

Images were acquired as z-stacks using a confocal microscope (Leica TCS SP5 and SP8, Germany) with an air-immersed 20x objective (mice) or 10x objective (rats) with 2 μm step size in the z-direction. ImageJ/FIJI was used to trace and manually quantify the length of fluorescently labelled vessels in the MBH. The mean length of vasculature within the MBH (hemisection) was calculated for each experimental group. For high-magnification assessment of e.g. vascular basement membranes, vascular permeability towards albumin or FITC-Dextran (40 kDa) co-localization analysis, a glycerol-immersed 63x objective was used.

Brain sectioning and immunohistochemistry

Brains were post-fixed overnight in 4% PFA at 4°C, followed by equilibration with 30% sucrose in Tris-buffered saline (TBS, pH 7.2) for 48 h before being sectioned into 40 μm coronal slices using a cryostat (CM3050S; Leica, Germany). Three to four brain sections per mouse were selected containing the middle portion of the MBH and subjected to the immunohistochemical protocol. Brains were first washed with TBS and incubated overnight at 4°C with primary antibodies (anti-VEGF 1:500; anti-GFAP 1:1000; anti-claudin-5 1:300; anti-albumin 1:500; anti-Iba1 1:1000; anti-Ki67 1:500; anti-NeuN 1:300; anti-pSTAT3 TYR 1:500; anti-pERK1/2 1:500) in a solution containing 0.25% porcine gelatine and 0.5% Triton X-100 in TBS, pH 7.2. The next morning, sections were serially rinsed in TBS, pH 7.2, and incubated with respective secondary antibodies all diluted 1:1000 in TBS, pH 7.2 containing 0.25% porcine gelatine and 0.5% Triton X-100 for 2h. Sections were serially washed in TBS with the last washing additionally containing DAPI (2 μg/ml in TBS, pH 7.2) in order to facilitate the demarcation of brain region for downstream image analyses. Where indicated, sections were additionally treated with fluorescent Nissl stain (1:100 NeuroTraceTM 435/455 or 500/525; ThermoFisher, Germany) to identify neuronal cells.

Immunostaining for pSTAT3 and pERK1/2

Slight adjustments of this basic protocol were implemented for the immunohistochemical visualization of pSTAT3 TYR (1:500) and pERK1/2 (p-42/44 MAPK; 1:500) such that brain sections were pre-incubated in 100% methanol at -20°C for 15 min.

Immunostaining for laminin and collagen-IV

In the adult, formalin-fixed mouse brain, most basement membrane proteins tend to be inaccessible for immunohistochemical labelling. We hence applied a specific antigen retrieval protocol to unmask vasculature-associated laminin (1:300) and collagen IV (1:300) as described previously (Franciosi et al., 2007). In brief, pepsin digestion was carried out on free-floating sections with pre-incubation in distilled water for 5 min at 37°C before being transferred to 1 mg/ml pepsin (Dako, Carpinteria, CA) in 0.2 N HCl for 10 min at 37°C.

3DISCO-assisted optical clearing of whole brains

To obtain three-dimensional information of the global mouse brain vasculature, animals were transcardially perfused with a vessel tracer conjugated to a fluorochromophor with emission peaks in the far-red range (WGA-Alexa Fluor 633; ThermoFisher, Germany) in order to overcome tissue autofluorescence, to facilitate light penetration and to improve the signal-to-background ratio. Following the perfusion with 4% PFA and the overnight post-fixation in 4% PFA, brains were washed three times in PBS, pH 7.4, before being subjected to an organic solvent-based, optical clearing protocol (3DISCO) described previously (Ertürk et al., 2012). In brief, brains were serially incubated in 50%, 70%, 80% and 100% (v/v) of tetrahydrofuran (THF) at room temperature on a shaker for 1 h followed by incubation in 100% v/v THF overnight. The next morning, THF was refreshed and brains were incubated for another hour. De-lipidation of brains was achieved by incubation in dichloromethane (DCM) for 1 hour at room temperature. Finally, brains were optically cleared by immersion in BABB (benzyl alcohol:benzyl benzoate; 1:2 ) and stored within until image acquisition.

Light-sheet microscopy imaging

Mouse brains were placed into the imaging chamber having its reservoir filled with the final clearing solution (BABB) in order to match the refractive indices. Importantly, brains were oriented upright and single-plane illuminated (light-sheet) image stacks were acquired along the rostrocaudal axis for maximal coronal resolution. Image acquisition was carried out at an Ultramicroscope II (LaVision BioTec), featuring an axial resolution of 4 μm with the following filter sets: ex 640/40 nm, em 690/50 nm. For high magnification-whole-brain imaging of the global mouse brain vasculature, a 4x Olympus objective was used (Olympus XLFLUOR 4x corrected/0.28 NA [WD = 10 mm]) combined with an Olympus revolving zoom body unit (U-TVCAC). Keeping the zoom factor as 1x and setting 2x3 tile scans with 20% overlap, we imaged a field of view of 6.14 x 8.82 mm, covering the entire width and depth of the mouse brain from the rostral surface to the cerebellum region up to 7.2 mm using a z-step of 8 μm. Exposure time was 70 ms, laser power was adjusted depending on the intensity of the fluorescent signal (in order to never reach the saturation) and the light-sheet width was kept at maximum. For high resolution imaging of the hypothalamus area, a 2x Olympus objective (Olympus MVPLAPO2XC/0.5 NA [WD = 6 mm]) attached to an Olympus MVX10 zoom body was used with a zoom factor at 1.25. Single z-stack scans were taken from the ventral surface of the brain to 3.5-4.5 mm in depth using a z-step of 6 μm to cover the entire hypothalamus.

Analysis of vascularity in 3D whole-brain data sets

Whole-brain coronal stacks were loaded in ImageJ/FIJI and divided into sub-stacks in which pre-defined masks were used to crop out selected brain regions from each hemisphere (LS: lateral septum, CPu: caudate putamen, NAcc: nucleus accumbens, S1BF: somatosensory cortex barrel field, HIPP: hippocampus, PVN: paraventricular nucleus, DMH: dorsomedial hypothalamus, LH: lateral hypothalamus, VMH: ventromedial hypothalamus, ARC: arcuate nucleus). Given slight differences in clearing efficiency across brain regions, individual thresholds were applied for each sub-stack. Next, sub-stacks were subjected to a filter function of 2 pixel at median intensity before being binarized and skeletonized. Each coronal single plane was analyzed by using the histogram function of ImageJ/FIJI in order to relatively quantify vascular versus non-vascular pixels. Means of all individual planes derived from a respective brain region were calculated per hemisphere.

Analysis of MBH vascularity of consecutive confocal micrographs

Image files (z-stacks at 2 μm step size) were imported to FIJI/ImageJ and converted into maximum projections. A pre-defined region-of-interest was cropped out, binarized and subjected to individual thresholding. Total vessel length of hemisection MBH was assessed by manual tracing of the vascular network.

Analysis of basement membrane thickness

Scans of brain sections immunostained for both collagen-IV and laminin were imported to FIJI/ImageJ and converted into maximum projections. Transversely cut blood vessels were selected and the thickness of both collagen-IV and laminin immunoreactivity was assessed by averaging the width of immunoreactivity perpendicular to three randomly chosen tangents.

Electron microscopy

Mice were anaesthetized and perfused transcardially with 0.9% saline followed by fixative containing 4% paraformaldehyde and 0.1% glutaraldehyde. After overnight (4°C) post-fixation in glutaraldehyde-free fixative, 50-micron vibratome sections (Pelco EasySlicer; Ted Pella, Redding, CA, USA) were cut. The sections were osmicated in 1% osmium tetroxide, and dehydrated in increasing ethanol concentrations. 1% uranyl acetate was added to the 70% ethanol to enhance ultrastructural membrane contrast. Flat embedding in Durcupan followed dehydration. Ultrathin sections were cut on a Leica ultramicrotome (Leica Microsystems, Buffalo Grove, IL, USA). The sections were collected on Formvar coated slot grids, and analyzed with a Tecnai 12 Biotwin electron microscope (ThermoFisher Scientific, Hillsboro, OR, USA). Endothelial basal membrane thickness was assessed at 4900 magnification.

Protein extraction and Western blotting

Protein content of hypothalamic tissue was extracted using RIPA buffer supplemented with 200 μM CoCl2 (Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany) and protease and phosphatase inhibitors (1% v/v; ThermoFisher Scientific, Rockford, IL US) in a final volume of 80 μl using a glass homogenizer (Duran Wheaten Kimble, US). Cellular debris was centrifuged at 10,000 x g at 4°C for 10 min and protein concentration of the supernatant was determined using BCA protein assay (ThermoFisher Scientific, Rockford, IL US). Protein was adjusted to 30 μg per sample, complemented with Laemmli loading buffer plus 10% β-mercaptoethanol, denatured by heating at 95°C for 10 min and separated by molecular weight using SDS-PAGE. Protein was blotted on 0.45 μm PVDF membranes and blocked in 5% skimmed milk in TBS with 0.1% Tween-20 (TBS-T) for one hour at room temperature. Membranes were incubated with primary antibodies (anti-HIF1α 1:1000) overnight at 4°C, serially washed in TBS-T and incubated with the respective HRP-coupled secondary antibodies (anti-β-actin 1:5000) for one hour at room temperature. Membrane development was carried out with chemiluminescent HRP substrate (Immobilion Western, Millipore) using films (Hyperfilm ECL, GE Life Sciences; CL-XPosure Film, ThermoFisher Scientific).

RNA isolation and qPCR analysis

RNA was isolated from tissues or primary mouse astrocytes using a commercially available kit (MircoRNeasy Kit, Qiagen, Hilden, Germany). Identical amounts of RNA were reverse-transcribed to cDNA using Superscript III (Invitrogen, Darmstadt, Germany) and gene expression was analyzed using TaqMan probes (ThermoFisher Scientific, Rockford, IL USA) at a ViiATM7 Real Time PCR System or QuantStudio 6 FLEX Real Time PCR System (ThermoFisher Scientific, Rockford, IL USA). Expression changes were calculated using the 2-ΔΔCt method normalized by Hprt or Rpl32 as housekeeping genes. In order to determine the presence of LepR isoforms in cDNA derived from magnetic-assisted cell sorted astrocytes the following primers were used as previously described (Hsuchou et al., 2009): LepRa (forward primer: GAAGTCTCTCATGACCACTACAGATGA; reverse primer: TTGTTTCCCTCCATCAAAATGTAA; product size 98 bp). LepRb (forward primer: GCATGCAGAATCAGTGATATTTGG; reverse primer: CAAGCTGTATCGACACTGATTTCTTC; product size 81 bp).

Quantification and statistical analysis

Data analysis was conducted using GraphPad Prism (Version 6). No power calculations were used to predetermine sample sizes. Sets of data were analyzed by linear regression analysis, Student’s t-test, or one- or two-way analysis of variance (ANOVA) with Tukey post-hoc analyses to determine statically significant differences. Normal distribution of populations at the 0.05 level was tested using the D’Agostino-Pearson omnibus normality test. Data were screened using the maximum normal residual Grubb’s test to identify singular, statistically significant outliers. Exclusion criteria of samples included mistargeting of AAV injections (2 mice in HIF1α AAV.Gfa2.iCre and HIF1α AAV.Gfa2.iCre + VEGF, respectively) and poor perfusion-based vascular labelling (5 mice in TRE-LeprtTA and 3 mice in HIF1αiΔastro/GLAST+ mice). p values ≤ 0.05 were considered statistically significant. Cohorts of mice receiving AAV nanoinjections were randomly assigned to respective groups; thus, bodyweight-matched littermates received either of the respective AAVs while remaining group housed for the duration of the experiment. Inducible knockout models were bred following a heterozygous x wildtype scheme (CreERT2 allele); offspring were born at expected mendelian ratios, what determined group composition since all littermates were treated with tamoxifen as previously indicated. All data are presented as mean ± standard error (SEM) and all p values as well as n are reported in the individual figure legends.

Acknowledgments

The authors thank Dr. Nuria Fernández and Dr. Sara Amor for helping with cardiovascular analyses, Stephan Sachs for kindly providing STZ-treated diabetic mice, and Clarita Layritz, Marlene Kilian, Nicole Wiegert, Elisavet Lola, and Cassie Holleman for their excellent technical assistance. This work was supported in part by funding to R.E.C. and P.P. from a Marie Skłodowska-Curie grant (ChroMe # 675610) and M.H.T. and C.G.-C. from the European Research Council (AdG grant Hypoflam # 695054 and STG grant AstroNeuroCrosstalk #757393, respectively), and the German Research Foundation under Germany’s Excellence Strategy within the framework of the Munich Cluster for Systems Neurology (EXC 2145 SyNergy – ID 390857198) and Helmholtz Excellence Network. T.D.M. received grant support from the German Research Foundation (SFB TRR152/P23 and SFB TRR296). K.R. is supported by the US National Institutes of Health (HL084207), the Department of Veterans Affairs (merit grant BX004249), the University of Iowa Fraternal Order of Eagles Diabetes Research Center, and the Iowa Neuroscience Institute. T.G. and T.L.H. received support from the Technische Universität München – Institute for Advanced Study, funded by the German Excellence Initiative and the European Union Seventh Framework Programme under grant agreement no. 291763.

Author contributions

T.G., C.G.-C., and M.H.T. conceptualized all studies and designed all experiments. T.G. and C.P. (light-sheet microscopy); R.E.C. (flow-cytometry); T.W. (blood pressure in mice); S.L., C.D.B.M., O.L.T., B.L., and M.H. (metabolic phenotyping); F.J.R.-O. (western blotting); K.S.-B. (electron microscopy); M.G., M.F.-F., A.L.G.-V., and D.G.-H. (blood pressure regulation in mice and rats); A.A.S. and C.A.L. (TRE-LeprtTA cohort); and D.A.M. (rSNA and radiotelemetry measurements) conducted the experiments and collected and analyzed the data. T.G., C.G.C., and M.H.T. wrote the manuscript in discussion with T.L.H., S.C.W., M.G., C.A.L., K.R., T.D.M., S.U., A.E., C.D.A.S., and P.T.P., who revised the article critically for important intellectual content. All authors have read and approved the final version of the manuscript.

Declaration of interests

The authors declare no competing interests.

Published: May 4, 2021

Footnotes

Supplemental information can be found online at https://doi.org/10.1016/j.cmet.2021.04.007.

Contributor Information

Matthias H. Tschöp, Email: matthias.tschoep@helmholtz-muenchen.de.

Cristina García-Cáceres, Email: garcia-caceres@helmholtz-muenchen.de.

Supplemental information

Document S1. Figures S1–S5
mmc1.pdf (32.5MB, pdf)
Document S2. Article plus supplemental information
mmc3.pdf (37.3MB, pdf)

References

  1. Argaw A.T., Asp L., Zhang J., Navrazhina K., Pham T., Mariani J.N., Mahase S., Dutta D.J., Seto J., Kramer E.G. Astrocyte-derived VEGF-A drives blood-brain barrier disruption in CNS inflammatory disease. J. Clin. Invest. 2012;122:2454–2468. doi: 10.1172/JCI60842. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Batiuk M.Y., de Vin F., Duqué S.I., Li C., Saito T., Saido T., Fiers M., Belgard T.G., Holt M.G. An immunoaffinity-based method for isolating UltraPure adult astrocytes based on ATP1B2 targeting by the ACSA-2 antibody. J. Biol. Chem. 2017;292:8874–8891. doi: 10.1074/jbc.M116.765313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bell B.B., Harlan S.M., Morgan D.A., Guo D.F., Cui H., Rahmouni K. Differential contribution of POMC and AgRP neurons to the regulation of regional autonomic nerve activity by leptin. Mol. Metab. 2018;8:1–12. doi: 10.1016/j.molmet.2017.12.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Brenner M., Kisseberth W.C., Su Y., Besnard F., Messing A. GFAP promoter directs astrocyte-specific expression in transgenic mice. J. Neurosci. 1994;14:1030–1037. doi: 10.1523/JNEUROSCI.14-03-01030.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Caballero-Eraso C., Shin M.K., Pho H., Kim L.J., Pichard L.E., Wu Z.J., Gu C., Berger S., Pham L., Yeung H.Y.-.B. Leptin acts in the carotid bodies to increase minute ventilation during wakefulness and sleep and augment the hypoxic ventilatory response. J. Physiol. 2019;597:151–172. doi: 10.1113/JP276900. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cao R., Brakenhielm E., Wahlestedt C., Thyberg J., Cao Y. Leptin induces vascular permeability and synergistically stimulates angiogenesis with FGF-2 and VEGF. Proc. Natl. Acad. Sci. USA. 2001;98:6390–6395. doi: 10.1073/pnas.101564798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. De Montgolfier O., Pinçon A., Pouliot P., Gillis M.-A., Bishop J., Sled J.G., Villeneuve L., Ferland G., Lévy B.I., Lesage F. High systolic blood pressure induces cerebral microvascular endothelial dysfunction, neurovascular unit damage, and cognitive decline in mice. Hypertension. 2019;73:217–228. doi: 10.1161/HYPERTENSIONAHA.118.12048. [DOI] [PubMed] [Google Scholar]
  8. DeFalco J., Tomishima M., Liu H., Zhao C., Cai X., Marth J.D., Enquist L., Friedman J.M. Virus-assisted mapping of neural inputs to a feeding center in the hypothalamus. Science. 2001;291:2608–2613. doi: 10.1126/science.1056602. [DOI] [PubMed] [Google Scholar]
  9. Doris P.A. Genetics of hypertension: an assessment of progress in the spontaneously hypertensive rat. Physiol. Genomics. 2017;49:601–617. doi: 10.1152/physiolgenomics.00065.2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Ducy P., Amling M., Takeda S., Priemel M., Schilling A.F., Beil F.T., Shen J., Vinson C., Rueger J.M., Karsenty G. Leptin inhibits bone formation through a hypothalamic relay: a central control of bone mass. Cell. 2000;100:197–207. doi: 10.1016/s0092-8674(00)81558-5. [DOI] [PubMed] [Google Scholar]
  11. Ertürk A., Becker K., Jährling N., Mauch C.P., Hojer C.D., Egen J.G., Hellal F., Bradke F., Sheng M., Dodt H.U. Three-dimensional imaging of solvent-cleared organs using 3DISCO. Nat. Protoc. 2012;7:1983–1995. doi: 10.1038/nprot.2012.119. [DOI] [PubMed] [Google Scholar]
  12. Feihl F., Liaudet L., Levy B.I., Waeber B. Hypertension and microvascular remodelling. Cardiovasc. Res. 2008;78:274–285. doi: 10.1093/cvr/cvn022. [DOI] [PubMed] [Google Scholar]
  13. Flegal K.M., Kit B.K., Orpana H., Graubard B.I. Association of all-cause mortality with overweight and obesity using standard body mass index categories: a systematic review and meta-analysis. JAMA. 2013;309:71–82. doi: 10.1001/jama.2012.113905. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Folkow B., Grimby G., Thulesius O. Adaptive structural changes of the vascular walls in hypertension and their relation to the control of the peripheral resistance. Acta Physiol. Scand. 1958;44:255–272. doi: 10.1111/j.1748-1716.1958.tb01626.x. [DOI] [PubMed] [Google Scholar]
  15. Franciosi S., De Gasperi R., Dickstein D.L., English D.F., Rocher A.B., Janssen W.G., Christoffel D., Sosa M.A., Hof P.R., Buxbaum J.D., Elder G.A. Pepsin pretreatment allows collagen IV immunostaining of blood vessels in adult mouse brain. J. Neurosci. Methods. 2007;163:76–82. doi: 10.1016/j.jneumeth.2007.02.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Franklin K., Paxinos G. The Mouse Brain in Stereotaxic Coordinates, Compact, 3rd Edition. Academic Press. 2008 [Google Scholar]
  17. Gao Y., Layritz C., Legutko B., Eichmann T.O., Laperrousaz E., Moullé V.S., Cruciani-Guglielmacci C., Magnan C., Luquet S., Woods S.C. Disruption of lipid uptake in astroglia exacerbates diet-induced obesity. Diabetes. 2017;66:2555–2563. doi: 10.2337/db16-1278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. García-Cáceres C., Quarta C., Varela L., Gao Y., Gruber T., Legutko B., Jastroch M., Johansson P., Ninkovic J., Yi C.-X. Astrocytic insulin signaling couples brain glucose uptake with nutrient availability. Cell. 2016;166:867–880. doi: 10.1016/j.cell.2016.07.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. García-Cáceres C., Balland E., Prevot V., Luquet S., Woods S.C., Koch M., Horvath T.L., Yi C.X., Chowen J.A., Verkhratsky A. Role of astrocytes, microglia, and tanycytes in brain control of systemic metabolism. Nat. Neurosci. 2019;22:7–14. doi: 10.1038/s41593-018-0286-y. [DOI] [PubMed] [Google Scholar]
  20. Gariano R.F., Nath A.K., D’Amico D.J., Lee T., Sierra-Honigmann M.R. Elevation of vitreous leptin in diabetic retinopathy and retinal detachment. Invest. Ophthalmol. Vis. Sci. 2000;41:3576–3581. [PubMed] [Google Scholar]
  21. Goncalves A.C.D.C., Tank J., Diedrich A., Hilzendeger A.M., Plehm R., Bader M., Luft F.C., Jordan J., Gross V. Diabetic hypertensive leptin receptor-deficient db/db mice develop cardioregulatory autonomic dysfunction. Hypertension. 2009;53:387–392. doi: 10.1161/HYPERTENSIONAHA.108.124776. [DOI] [PubMed] [Google Scholar]
  22. Grassi G., Seravalle G., Colombo M., Bolla G., Cattaneo B.M., Cavagnini F., Mancia G. Body weight reduction, sympathetic nerve traffic, and arterial baroreflex in obese normotensive humans. Circulation. 1998;97:2037–2042. doi: 10.1161/01.cir.97.20.2037. [DOI] [PubMed] [Google Scholar]
  23. Haim L.B., Rowitch D.H. Functional diversity of astrocytes in neural circuit regulation. Nat. Rev. 2017;18:31–41. doi: 10.1038/nrn.2016.159. [DOI] [PubMed] [Google Scholar]
  24. Han C., Wu W., Ale A., Kim M.S., Cai D. Central leptin and tumor necrosis factor-α (TNFα) in diurnal control of blood pressure and hypertension. J. Biol. Chem. 2016;291:15131–15142. doi: 10.1074/jbc.M116.730408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Harlan S.M., Morgan D.A., Agassandian K., Guo D.F., Cassell M.D., Sigmund C.D., Mark A.L., Rahmouni K. Ablation of the leptin receptor in the hypothalamic arcuate nucleus abrogates leptin-induced sympathetic activation. Circ. Res. 2011;108:808–812. doi: 10.1161/CIRCRESAHA.111.240226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hilzendeger A.M., Goncalves A.C.D.C., Plehm R., Diedrich A., Gross V., Pesquero J.B., Bader M. Autonomic dysregulation in ob/ob mice is improved by inhibition of angiotensin-converting enzyme. J. Mol. Med. (Berl) 2010;88:383–390. doi: 10.1007/s00109-009-0569-6. [DOI] [PubMed] [Google Scholar]
  27. Hoffmann A., Bredno J., Wendland M., Derugin N., Ohara P., Wintermark M. High and low molecular weight fluorescein isothiocyanate (FITC)-dextrans to assess blood-brain barrier disruption: technical considerations. Transl. Stroke Res. 2011;2:106–111. doi: 10.1007/s12975-010-0049-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Hoppe G., Yoon S., Gopalan B., Savage A.R., Brown R., Case K., Vasanji A., Chan E.R., Silver R.B., Sears J.E. Comparative systems pharmacology of HIF stabilization in the prevention of retinopathy of prematurity. Proc. Natl. Acad. Sci. USA. 2016;113:E2516–E2525. doi: 10.1073/pnas.1523005113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Horvath T.L., Sarman B., García-Cáceres C., Enriori P.J., Sotonyi P., Shanabrough M., Borok E., Argente J., Chowen J.A., Perez-Tilve D. Synaptic input organization of the melanocortin system predicts diet-induced hypothalamic reactive gliosis and obesity. Proc. Natl. Acad. Sci. USA. 2010;107:14875–14880. doi: 10.1073/pnas.1004282107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Hsuchou H., He Y., Kastin A.J., Tu H., Markadakis E.N., Rogers R.C., Fossier P.B., Pan W. Obesity induces functional astrocytic leptin receptors in hypothalamus. Brain. 2009;132:889–902. doi: 10.1093/brain/awp029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Huang Y.F., Yang C.H., Huang C.C., Tai M.H., Hsu K.S. Pharmacological and genetic accumulation of hypoxia-inducible factor-1 alpha enhances excitatory synaptic transmission in hippocampal neurons through the production of vascular endothelial growth factor. J. Neurosci. 2010;30:6080–6093. doi: 10.1523/JNEUROSCI.5493-09.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Hudson N., Powner M.B., Sarker M.H., Burgoyne T., Campbell M., Ockrim Z.K., Martinelli R., Futter C.E., Grant M.B., Fraser P.A. Differential apicobasal VEGF signaling at vascular blood-neural barriers. Dev. Cell. 2014;30:541–552. doi: 10.1016/j.devcel.2014.06.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Jais A., Solas M., Backes H., Chaurasia B., Kleinridders A., Theurich S., Mauer J., Steculorum S.M., Hampel B., Goldau J. Myeloid-cell-derived VEGF maintains brain glucose uptake and limits cognitive impairment in obesity. Cell. 2016;165:882–895. doi: 10.1016/j.cell.2016.03.033. [DOI] [PubMed] [Google Scholar]
  34. Kantzer C.G., Boutin C., Herzig I.D., Wittwer C., Reiß S., Tiveron M.C., Drewes J., Rockel T.D., Ohlig S., Ninkovic J. Anti-ACSA-2 defines a novel monoclonal antibody for prospective isolation of living neonatal and adult astrocytes. Glia. 2017;65:990–1004. doi: 10.1002/glia.23140. [DOI] [PubMed] [Google Scholar]
  35. Kietzmann T., Mennerich D., Dimova E.Y. Hypoxia-inducible factors (HIFs) and phosphorylation: impact on stability, localization, and transactivity. Front. Cell Dev. Biol. 2016;4:11. doi: 10.3389/fcell.2016.00011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Kim J.G., Suyama S., Koch M., Jin S., Argente-Arizon P., Argente J., Liu Z.W., Zimmer M.R., Jeong J.K., Szigeti-Buck K. Leptin signaling in astrocytes regulates hypothalamic neuronal circuits and feeding. Nat. Neurosci. 2014;17:908–910. doi: 10.1038/nn.3725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Langlet F., Levin B.E., Luquet S., Mazzone M., Messina A., Dunn-Meynell A.A., Balland E., Lacombe A., Mazur D., Carmeliet P. Tanycytic VEGF-A boosts blood-hypothalamus barrier plasticity and access of metabolic signals to the arcuate nucleus in response to fasting. Cell Metab. 2013;17:607–617. doi: 10.1016/j.cmet.2013.03.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lee Y.S., Kim J.W., Osborne O., Oh D.Y., Sasik R., Schenk S., Chen A., Chung H., Murphy A., Watkins S.M. Increased adipocyte O2 consumption triggers HIF-1α, causing inflammation and insulin resistance in obesity. Cell. 2014;157:1339–1352. doi: 10.1016/j.cell.2014.05.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Li B., Shi Z., Cassaglia P.A., Brooks V.L. Leptin acts in the forebrain to differentially influence baroreflex control of lumbar, renal, and splanchnic sympathetic nerve activity and heart rate. Hypertension. 2013;61:812–819. doi: 10.1161/HYPERTENSIONAHA.111.00518. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Lohmeier T.E., Iliescu R., Tudorancea I., Cazan R., Cates A.W., Georgakopoulos D., Irwin E.D. Chronic interactions between carotid baroreceptors and chemoreceptors in obesity hypertension. Hypertension. 2016;68:227–235. doi: 10.1161/HYPERTENSIONAHA.116.07232. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Ma Y.Y., Li K.Y., Wang J.J., Huang Y.L., Huang Y., Sun F.Y. Vascular endothelial growth factor acutely reduces calcium influx via inhibition of the Ca2+ channels in rat hippocampal neurons. J. Neurosci. Res. 2009;87:393–402. doi: 10.1002/jnr.21859. [DOI] [PubMed] [Google Scholar]
  42. Madisen L., Zwingman T.A., Sunkin S.M., Oh S.W., Zariwala H.A., Gu H., Ng L.L., Palmiter R.D., Hawrylycz M.J., Jones A.R. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat. Neurosci. 2010;13:133–140. doi: 10.1038/nn.2467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Mark A.L. Selective leptin resistance revisited. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2013;305:R566–R581. doi: 10.1152/ajpregu.00180.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Marsh A.J., Fontes M.A.P., Killinger S., Pawlak D.B., Polson J.W., Dampney R.A.L. Cardiovascular responses evoked by leptin acting on neurons in the ventromedial and dorsomedial hypothalamus. Hypertension. 2003;42:488–493. doi: 10.1161/01.HYP.0000090097.22678.0A. [DOI] [PubMed] [Google Scholar]
  45. Mathiisen T.M., Lehre K.P., Danbolt N.C., Ottersen O.P. The perivascular astroglial sheath provides a complete covering of the brain microvessels: an electron microscopic 3D reconstruction. Glia. 2010;58:1094–1103. doi: 10.1002/glia.20990. [DOI] [PubMed] [Google Scholar]
  46. Matthews D.R., Hosker J.P., Rudenski A.S., Naylor B.A., Treacher D.F., Turner R.C. Homeostasis model assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia. 1985;28:412–419. doi: 10.1007/BF00280883. [DOI] [PubMed] [Google Scholar]
  47. McCully B.H., Brooks V.L., Andresen M.C. Diet-induced obesity severely impairs myelinated aortic baroreceptor reflex responses. Am. J. Physiol. Heart Circ. Physiol. 2012;302:H2083–H2091. doi: 10.1152/ajpheart.01200.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. McMinn J.E., Liu S.-M., Liu H., Dragatsis I., Dietrich P., Ludwig T., Boozer C.N., Chua C.S., Jr. Neuronal deletion of Lepr elicits diabesity in mice without affecting cold tolerance or fertility. Am J Physiol Endocrinol Metab. 2005;289:403–411. doi: 10.1152/ajpendo.00535.2004. [DOI] [PubMed] [Google Scholar]
  49. Mori T., Tanaka K., Buffo A., Wurst W., Kühn R., Götz M. Inducible gene deletion in astroglia and radial glia--a valuable tool for functional and lineage analysis. Glia. 2006;54:21–34. doi: 10.1002/glia.20350. [DOI] [PubMed] [Google Scholar]
  50. Oishi J.C., Castro C.A., Silva K.A., Fabricio V., Cárnio E.C., Phillips S.A., de Duarte A.C.G.O., Rodrigues G.J. Endothelial dysfunction and inflammation precedes elevations in blood pressure induced by a high-fat diet. Arq. Bras. Cardiol. 2018;110:558–567. doi: 10.5935/abc.20180086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Ottaway N., Mahbod P., Rivero B., Norman L.A., Gertler A., D’Alessio D.A., Perez-Tilve D. Diet-induced obese mice retain endogenous leptin action. Cell Metab. 2015;21:877–882. doi: 10.1016/j.cmet.2015.04.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Pekny M., Levéen P., Pekna M., Eliasson C., Berthold C.H., Westermark B., Betsholtz C. Mice lacking glial fibrillary acidic protein display astrocytes devoid of intermediate filaments but develop and reproduce normally. EMBO J. 1995;14:1590–1598. doi: 10.1002/j.1460-2075.1995.tb07147.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Poirier P., Giles T.D., Bray G.A., Hong Y., Stern J.S., Pi-Sunyer F.X., Eckel R.H., American Heart Association, and Obesity Committee of the Council on Nutrition, Physical Activity, and Metabolism Obesity and cardiovascular disease: pathophysiology, evaluation, and effect of weight loss: an update of the 1997 American Heart Association Scientific Statement on Obesity and Heart Disease from the Obesity Committee of the Council on Nutrition, Physical Activity, and Metabolism. Circulation. 2006;113:898–918. doi: 10.1161/CIRCULATIONAHA.106.171016. [DOI] [PubMed] [Google Scholar]
  54. Rahmouni K., Morgan D.A. Hypothalamic arcuate nucleus mediates the sympathetic and arterial pressure responses to leptin. Hypertension. 2007;49:647–652. doi: 10.1161/01.HYP.0000254827.59792.b2. [DOI] [PubMed] [Google Scholar]
  55. Rask-Madsen C., King G.L. Vascular complications of diabetes: mechanisms of injury and protective factors. Cell Metab. 2013;17:20–33. doi: 10.1016/j.cmet.2012.11.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Roggendorf W., Opitz H., Schuppan D. Altered expression of collagen type VI in brain vessels of patients with chronic hypertension. A comparison with the distribution of collagen IV and procollagen III. Acta Neuropathol. 1988;77:55–60. doi: 10.1007/BF00688243. [DOI] [PubMed] [Google Scholar]
  57. Ryan H.E., Poloni M., McNulty W., Elson D., Gassmann M., Arbeit J.M., Johnson R.S. Hypoxia-inducible factor-1alpha is a positive factor in solid tumor growth. Cancer Res. 2000;60:4010–4015. [PubMed] [Google Scholar]
  58. Safran M., Kim W.Y., O’Connell F., Flippin L., Günzler V., Horner J.W., DePinho R.A., Kaelin W.G. Mouse model for noninvasive imaging of HIF prolyl hydroxylase activity: assessment of an oral agent that stimulates erythropoietin production. Proc. Natl. Acad. Sci. USA. 2006;103:105–110. doi: 10.1073/pnas.0509459103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Sato S., Hanada R., Kimura A., Abe T., Matsumoto T., Iwasaki M., Inose H., Ida T., Mieda M., Takeuchi Y. Central control of bone remodeling by neuromedn U. Nat Med. 2007;13:1234–1240. doi: 10.1038/nm1640. [DOI] [PubMed] [Google Scholar]
  60. Schüler R., Seebeck N., Osterhoff M.A., Witte V., Flöel A., Busjahn A., Jais A., Brüning J.C., Frahnow T., Kabisch S. VEGF and GLUT1 are highly heritable, inversely correlated and affected by dietary fat intake: consequences for cognitive function in humans. Mol. Metab. 2018;11:129–136. doi: 10.1016/j.molmet.2018.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Shi Z., Pelletier N.E., Wong J., Li B., Sdrulla A.D., Madden C.J., Marks D.L., Brooks V.L. Leptin increases sympathetic nerve activity via induction of its own receptor in the paraventricular nucleus. eLife. 2020;9 doi: 10.7554/eLife.55357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Simonds S.E., Cowley M.A. Hypertension in obesity: is leptin the culprit? Trends Neurosci. 2013;36:121–132. doi: 10.1016/j.tins.2013.01.004. [DOI] [PubMed] [Google Scholar]
  63. Simonds S.E., Pryor J.T., Ravussin E., Greenway F.L., Dileone R., Allen A.M., Bassi J., Elmquist J.K., Keogh J.M., Henning E. Leptin mediates the increase in blood pressure associated with obesity. Cell. 2014;159:1404–1416. doi: 10.1016/j.cell.2014.10.058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Skowronski A.A., LeDuc C.A., Foo K.S., Goffer Y., Burnett L.C., Egli D., Leibel R.L. Physiological consequences of transient hyperleptinemia during discrete developmental periods on body weight in mice. Sci. Transl. Med. 2020;12 doi: 10.1126/scitranslmed.aax6629. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Skrapari I., Tentolouris N., Perrea D., Bakoyiannis C., Papazafiropoulou A., Katsilambros N. Baroreflex sensitivity in obesity: relationship with cardiac autonomic nervous system activity. Obesity (Silver Spring) 2007;15:1685–1693. doi: 10.1038/oby.2007.201. [DOI] [PubMed] [Google Scholar]
  66. Suganami E., Takagi H., Ohashi H., Suzuma K., Suzuma I., Oh H., Watanabe D., Ojima T., Suganami T., Fujio Y. Leptin stimulates ischemia-induced retinal neovascularization: possible role of vascular endothelial growth factor expressed in retinal endothelial cells. Diabetes. 2004;53:2443–2448. doi: 10.2337/diabetes.53.9.2443. [DOI] [PubMed] [Google Scholar]
  67. Ternacle J., Wan F., Sawaki D., Surenaud M., Pini M., Mercedes R., Ernande L., Audureau E., Dubois-Rande J.L., Adnot S. Short-term high-fat diet compromises myocardial function: a radial strain rate imaging study. Eur. Heart J. Cardiovasc. Imaging. 2017;18:1283–1291. doi: 10.1093/ehjci/jew316. [DOI] [PubMed] [Google Scholar]
  68. Thaler J.P., Yi C.X., Schur E.A., Guyenet S.J., Hwang B.H., Dietrich M.O., Zhao X., Sarruf D.A., Izgur V., Maravilla K.R. Obesity is associated with hypothalamic injury in rodents and humans. J. Clin. Invest. 2012;122:153–162. doi: 10.1172/JCI59660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Tsilibary E.C. Microvascular basement membranes in diabetes mellitus. J. Pathol. 2003;200:537–546. doi: 10.1002/path.1439. [DOI] [PubMed] [Google Scholar]
  70. Williams L.M., Campbell F.M., Drew J.E., Koch C., Hoggard N., Rees W.D., Kamolrat T., Thi Ngo H., Steffensen I.L., Gray S.R., Tups A. The development of diet-induced obesity and glucose intolerance in C57BL/6 mice on a high-fat diet consists of distinct phases. PLoS One. 2014;9 doi: 10.1371/journal.pone.0106159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Wong T.Y., Cheung C.M., Larsen M., Sharma S., Simó R. Diabetic retinopathy. Nat. Rev. Dis. Primers. 2016;2:16012. doi: 10.1038/nrdp.2016.12. [DOI] [PubMed] [Google Scholar]
  72. Xu J.Y., Zheng P., Shen D.H., Yang S.Z., Zhang L.M., Huang Y.L., Sun F.Y. Vascular endothelial growth factor inhibits outward delayed-rectifier potassium currents in acutely isolated hippocampal neurons. Neuroscience. 2003;118:59–67. doi: 10.1016/s0306-4522(02)00948-x. [DOI] [PubMed] [Google Scholar]
  73. Yi C.X., Gericke M., Krüger M., Alkemade A., Kabra D.G., Hanske S., Filosa J., Pfluger P., Bingham N., Woods S.C. High calorie diet triggers hypothalamic angiopathy. Mol. Metab. 2012;1:95–100. doi: 10.1016/j.molmet.2012.08.004. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Video S1. 3D imaging of 3DISCO-cleared mouse brain vasculature, related to Figure 1
Download video file (27.9MB, mp4)
Document S1. Figures S1–S5
mmc1.pdf (32.5MB, pdf)
Document S2. Article plus supplemental information
mmc3.pdf (37.3MB, pdf)

Data Availability Statement

Not applicable.

RESOURCES