Skip to main content
NCBI home page
Asian Pacific Journal of Cancer Prevention : APJCP logoLink to Asian Pacific Journal of Cancer Prevention : APJCP
. 2021 Jan;22(1):201–208. doi: 10.31557/APJCP.2021.22.1.201

Association between Genetic Polymorphisms of miR-1307, miR-1269, miR-3117 and Breast Cancer Risk in a Sample of South East Iranian Women

Sahel Sarabandi 1, Hedieh Sattarifard 1,2, Mohammad Kiumarsi 2, Shima Karami 1, Mohsen Taheri 3, Mohammad Hashemi 1,*, Gholamreza Bahari 1,4,*, Saeid Ghavami 2,5,6,*
PMCID: PMC8184203  PMID: 33507700

Abstract

Introduction:

MicroRNAs (miRNAs) play an essential role in the susceptibility and development of cancer cells.

Objective:

Examining the dependency of breast cancer risk with genetic polymorphisms of miR-1307, miR-1269, and miR-3117 in a sample of Iranian women (southeast region).

Methods:

The case-control study consisted of 520 individuals (260 diagnosed BC patients, 260 healthy individuals). The polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method was used for genotyping of miR-1307 rs7911488, miR-1269 rs73239138, and miR-3117 (rs4655646 and rs7512692) polymorphisms.

Results and Conclusion:

This study provided evidence that miR-1307 rs7911488 polymorphism significantly reduced the risk of BC in heterozygous AG genotype, as well as dominant (AG+GG) genotype and G allele. A significant correlation was found between dominant (AA+AG) genotype, the A allele and protection against BC due to miR-1269 rs73239138 in the sample of study. In contrast, our findings suggested that AG genotype and G allele of miR-3117 rs4655646 polymorphism could increase BC’s susceptibility among the southeastern Iranian females. The miR-3117 rs7512692 variant also increased the risk of BC in codominant, dominant and recessive models, as well as the T allele. The possible dependency of miR-1307, miR-1269, and miR-3117 variants with patients’ clinicopathological characteristics and BC was also studied. It was concluded that there is a correlation between miR-3117 rs7512692 variant and tumor grade (p=0.031); also, a correlation between miR-1269 rs73239138 variant and progesterone receptor status (p=0.006). The current investigation revealed that miR-1307, miR-1269, and miR-3117 polymorphisms might play a crucial role in the Iranian population’s vulnerability to BC.

Key Words: Breast cancer, microRNA, polymorphism, cancer susceptibility

Introduction

Breast cancer (BC), one of the most frequent carcinomas amongst women, is the second leading cancer-related cause of death in women worldwide (Bray et al., 2018). Breast cancer may occur in several parts of the breast, including lobules, ducts, and connective tissue. However, it commonly occurs in the inner lining of milk ducts or the lobules which produce milk. Out of control cell division in these tissues could invade other breast tissues and move to the lymph nodes and cause metastasis to other organs (Winer, 2001; Yu, 2019; Umami et al., 2020), including bones, lung, liver, and brain (Eckhardt et al., 2012; Vickers, 2017).

The breast cancer incidence rate ranges widely all over the world. According to GLOBOCAN 2018 report, the global average BC incidence rate was 46.3 per 100000 individuals, while Australia and New Zealand reported the highest rate (94.2) and South-Central Asia recorded the lowest rates (25.9) (Bray et al., 2018). Based on GLOBOCAN 2018, the Iranian BC incidence rate was 31.0 per 100,000 (Bray et al., 2018).

Screening of numerous BC patients demonstrated that the risk of BC might be associated with several factors, including genetic mutation, family history, lifestyle, alcohol consumption, level of estrogen and progesterone hormones, and physical activity (Jayasekara et al., 2016; Pizot et al., 2016; Dall and Britt, 2017; Shiyanbola et al., 2017; Bertoni et al., 2019; McTiernan et al., 2019). Numerous genetic mutations might occur in the human genome, responsible for the permanent alternation in DNA or RNA sequences. A Single Nucleotide Polymorphism (SNP) is a replacement of a nucleotide at several positions in the human genome (Kitts and Sherry, 2002). Studies by Dr. Hashemi’s research team showed that there had been relationships between SNPs and different diseases, including breast cancer (Hassanzarei et al., 2017), prostate cancer (Hassanzarei et al., 2017; Sattarifard et al., 2019), lung cancer (Moazeni-Roodi et al., 2019), colorectal cancer (Hashemi et al., 2018), bladder cancer (Sadeghi-Bojd et al., 2019), nephrotic syndrome (Sadeghi-Bojd et al., 2019), nonsyndromic cleft lip (Rafighdoost et al., 2015; Rafighdoost et al., 2017; Rafighdoost et al., 2018; Rafighdoost et al., 2019), and nonalcoholic fatty liver disease (Hashemi et al., 2013).

The transcriptome of genome and tiling array studies provided evidence that over 90 percent of humans’ genomic DNA is not translated to any proteins (Non-coding RNAs), and only two percent is expected to translate into functional proteins (Rinn and Chang, 2012). According to the original transcription size, non-coding RNAs are clustered into two main groups, the small Non-Coding RNAs (shorter than 200 nucleotides), including miRNAs and snoRNAs piwiRNAs, and siRNAs; and long non-coding RNAs which contain more than 200 nucleotides (Bhan and Mandal, 2015). It is shown that miRNAs have multiple functions, including gene regulation. Matured miRNA could bind to the 3′-untranslated section (3′UTR) of specific mRNAs, which might lead to regulating gene expression (Meijer et al., 2013; Peng and Croce, 2016). miRNAs are key regulators of the human’s transcriptome and function as oncogenes or tumor suppressor genes depending on their target genes’ function. Recent evidence showed that genetic variations in miRNA genes could affect the expression, biogenesis of miRNA, or target selection, which in turn affects their target genes’ expression and the cancer progress (Hu et al., 2008; Omrani et al., 2014, Liu et al., 2016; Wang et al., 2016; Sibin et al., 2017; Wu et al., 2018).

miR-1307-3p was recently recognized as a cancer-related miRNA. The studies showed that miR-1307-3p could be involved in critical biological pathways, including proliferation, differentiation, lymphocytes activation, nucleotide synthesis, and metabolism (Zhou et al., 2015; Qiu and Dou, 2017; Yang et al., 2018). The relation between miR-1307-3p and cancers, including renal cell carcinoma (RCC) (García-Donas et al., 2016), ovarian cancer (Zhou et al., 2015), colorectal cancer (Tang et al., 2015) and breast cancer (Shimomura et al., 2016) has been previously reported. Furthermore, recent BC research showed that the elevated level of miR-1307-3p in serum could be used to identify the BC patients in their early stages (Shimomura et al., 2016). miR-1269 is located at human chromosome 4, and recent studies suggested that it could act as an oncomir (ono miRNA) (Yang et al., 2014; Bu et al., 2015). The correlation between miR-1269 and prostate cancer metastasis and progression of primary hepatocellular carcinoma (HCC) has been approved in recent studies (Yang et al., 2014; Bu et al., 2015). Despite all these documents, other investigations show the controversial function of mir-1269 as a tumor suppressor gene in gastric cancer (Li et al., 2017) and HCC (Xion et al., 2015). miR-3,117 is located at human chromosome 1. The significant association between mir-3117 and many types of cancers, including colorectal cancer (Neerincx et al., 2015), HCC (Cui et al., 2017), and acute lymphoblastic leukemia (Gutierrez-Camino et al., 2018) was recently examined. No studies have investigated the susceptibility of BC risk with miR-3117 though.

In the current this investigation, the correlation between miR-3117 rs4655646, miR-3117 rs7512692, miR-1269 rs73239138, miR-1307-3p rs7911488 and the risk of BC in a sample of southeast Iranian women was evaluated.

Materials and Methods

Patients

Our population-based case-control study consists of 520 individuals, including 260 histologically confirmed BC patients and 260 age-matched population-based healthy women

with no history of any type of cancer and (samples are not related to the patients of the study). The protocol of this study has been designed based on previous investigations (Danesh et al., 2018; Hashemi et al., 2018; Karami et al., 2020). The Institutional Review Board approved this study to be conducted at the Zahedan University of Medical Sciences (IR.ZAUMS.REC.1397.385). Proper consent was obtained from all participants. The genomic DNA samples were extracted using the salting-out technique and were collected in separate special tubes containing EDTA (Hashemi et al., 2013).

Genotyping

Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) was used to genotype miR-1269, miR-1307, and miR-3117 genes polymorphisms. The protocol used for this research, previously used by Dr. Hashemi’s lab, is as follow (Hassanzarei et al., 2017; Payehghadr et al., 2018; Nazarian et al., 2019):

1. The volume for assembling 17 µl of the reaction solution in each PCR tube is presented in Table 1.

2. The sequences of primers used for detection of miR-1307, miR-1269 and miR-3117 polymorphisms are listed in Table 2.

3. PCR thermal cycling conditions, which were used for amplification of miR-1307, miR-1269 and miR-3117 polymorphisms, are listed in Table 3.

4. PCR products were digested with corresponding restriction endonucleases.

5. In the last pace, a UV transilluminator was used to detect and visualize the digested fragments, which were separated by agarose gel electrophoresis. Briefly, for miR-1307 rs7911488, the HhaI restriction enzyme digested the G allele and produced 18 and 176 base pair (bp) pattern, while the A allele was undigested (194 bp fragment) (Figure 1A), miR-1269 rs73239138 A allele was digested by BstXI restriction enzyme and produced a 58 and 237 bp fragments, while the G allele was undigested (295 bp fragment) (Figure 1B), miR-3117 rs4655646 G allele was digested by TaqI restriction enzyme and produced 39 and 143 bp fragments, while A allele was undigested (182 bp fragment) (Figure 2A), and Hpy1888III restriction enzyme digested miR-3117 rs7512692 C allele and produced 21 and 136 bp fragments, while T allele was undigested (157 bp fragment) (Figure 2B).

Figure 1.

Figure 1

Open in a new tab

Electrophoresis Pattern of: (A) miR-1307 rs7911488 (A>G) polymorphism. M: DNA marker; Lanes 1, 5, AG; Lanes 2, 4, AA; Lane 3, GG. (B) Electrophoresis pattern of miR-1269 rs73239138 (A/G) polymorphism. M, DNA marker; Lanes 1, 5, AG; Lanes 2, 4, GG; Lane 3, AA. M: DNA marker

Figure 2.

Figure 2

Open in a new tab

Electrophoresis Pattern of, (A) miR-3117 rs4655646 (A/G) polymorphism; M, DNA marker; Lanes 1, 5, AG; Lanes 2, 4, AA; Lane 3, GG. (B) Electrophoresis pattern of miR-3117 rs7512692 (C/T) polymorphism. M, DNA marker; Lanes 1, 6, TC; Lanes 2, 5, TT; Lanes 3, 4, CC

Statistical analysis

Statistical analyses were done using SPSS 22 software. To estimate the Hardy–Weinberg equilibrium (HWE) among the controls, the χ2 test was used. The correlation between the genotypes and risk of BC was measured by odds ratios (ORs) with 95% confidence intervals (Erdmann, Szymanski et al.). Unconditional logistic regression analysis was applied to assess the relationship between miR-1269, miR-1307 and miR-3117 genes polymorphisms and BC risk. The p-value of less than 0.05 was considered statistically significant.

Results

The present study included 520 participants. The study consisted of 260 females who were diagnosed with breast cancer with an age group of 48.09 ±10.59 and 260 healthy females with an age group of 46.26±10.72 recruited in the study. There was not a significant age difference between the patient and control groups (p=0.052). Frequency of alleles and genotyping of miR-1307, rs7911488, miR-1269, rs73239138, miR-3117, rs4655646 and rs7512692 polymorphisms among the study group and the control group are presented in Table 4./

Our findings show that miR-1307 rs7911488 polymorphism has significantly reduced the risk of BC in heterozygous genotype AG (OR=0.28, 95%CI=0.19-0.40, P<0.001, A/G vs A/A), dominant (OR=0.30, 95%CI=0.21-0.43, P<0.001, A/G+G/G vs A/A), and G allele (OR=0.50, 95%CI=0.38-0.67, P<0.001, G vs A). Similarly, the miR-1269 rs73239138 G>A polymorphism significantly decreased the risk of BC in dominant (OR=0.64, 95%CI=0.42-0.98, P=0.048, A/A+A/G vs G/G), and A allele (OR=0.66, 95%CI=0.45-0.93, p=0.041, A vs G). Our investigation also showed that miR-3117 rs4655646 is a risk factor for BC in heterozygous genotype AG (OR=1.93, 95%CI=1.05-3.51, P=0.030, A/G vs A/A), and G allele (OR=2.08, 95%CI=1.20-3.62, p=0.014, G vs A). So as miR-3117 rs7512692 C>T polymorphism increased the risk of BC in C/T heterozygous genotypes (OR=4.58, 95%CI=2.87-7.44, p<0.001, C/T vs C/C) and T/T homozygous (OR=12.80, 95%CI=6.72-24.12, p<0.001, T/T vs C/C), dominant (OR=5.70, 95%CI=3.58-9.06, p<0.001, C/T+T/T vs C/C), recessive (OR=4.27, 95%CI=2.55-7.22, p<0.001, T/T vs C/C+C/T) and T allele (OR=2.75, 95%CI=2.14-3.54, p<0.001, T vs C) genetic models.

Furthermore, the correlation between the variants and clinicopathological characteristics, including age, size of the tumor, lymph node, histology, tumor grade, the status of estrogen and progesterone receptors was examined. Our results showed that there was a significant association between miR3117 rs7512692 C>T and tumor grade (p=0.031) and miR-1269 rs73239138 G>A with progesterone receptor status (p=0.006) Table 5.

Table 1.

The Volumes for Assembling the Reaction Solution in Each PCR Tube for Detection of miR-1307, miR-1269 and miR-3117 Polymorphisms

Polymorphisms Reverse Primer Forward Primer 2X Taq
master mix		 H2O DNA
miR-1307
rs7911488		 1 µl 1 µl 8 µl 6 µl 1 µl
miR-1269 rs73239138 1 µl 1 µl 8 µl 6 µl 1 µl
miR-3117 rs4655646 1 µl 1 µl 8 µl 6 µl 1 µl
miR-3117 rs7512692 1 µl 1 µl 8 µl 6 µl 1 µl
Open in a new tab

Table 2.

The Sequences of Primers Used for Detection of miR-1307, miR-1269 and miR-3117 Polymorphisms

Polymorphisms Primer sequence (5`=>3`) Restriction Enzyme Fragment (bp)
miR-1307 F: TCTGGAAGAATATATAGCAAAGGCAGCTT HhaI Allele A=194 bp
rs7911488 R: CTCGACCGGCTCGTCTGCG Allele G=176+18 bp
miR-1269 F: ACAAACTATTGCTCTCTTTCTTGCTT BstXI Allele G=295 bp
rs73239138 R: GGAGGCTGAGAAGTCTCATGATA Allele A= 237+58 bp
miR-3117 F: TGGCATGTGAGGAAAGTTGGA TaqI Allele A=182 bp
rs4655646 R:AGATATTGGGCCTCTACCCGT Allele G=143+39 bp
miR-3117 F: TGGCAGTTGCTGGTACTCTT Hpy188III Allele T=157 bp
rs7512692 R: CTCAAGTCTCCTCCCCCATC Allele C=136+21 bp
Open in a new tab

Table 3.

PCR Thermal Cycling Conditions for Amplification of miR-1307,miR-1269 and miR-3117 Polymorphism

Polymorphism Denaturation Annealing Extension Cycles
Time Temp Time Temp Time Temp
miR-1307 rs7911488 30s 950C 30s 580C 30s 720C 30
miR-1269 rs73239138 30s 950C 30s 620C 30s 720C 30
miR-3117 rs4655646 30s 950C 30s 600C 30s 720C 30
miR-3117 rs7512692 30s 950C 30s 580C 25s 720C 30
Open in a new tab

Table 4.

The Association of miR-1307, miR-1269 and miR-3117 Polymorphisms and Breast Cancer Risk

Polymorphism Case n
(%)		 Control n (%) OR (95%CI) p
miR-1307 rs7911488
Codominant
AA 155 (59.6) 80 (30.8) 1 -
AG 90 (34.6) 167 (64.2) 0.28 (0.19-0.40) <0.001
GG 15 (5.8) 13 (5) 0.59 (0.28-1.30) 0.213
Dominant
AA 155 (59.6) 80 (30.8) 1 -
AG+GG 105 (40.4) 180 (69.2) 0.30 (0.21-0.43) <0.001
Recessive
AA+AG 245 (94.2) 247 (95) 1 -
GG 15 (5.8) 13 (5) 1.16 (0.53-2.41) 0.846
Allele
A 400 (76.92) 327 (62.88) 1 -
G 120 (23.08) 193 (37.12) 0.50 (0.38-0.67) <0.001
miR-1269 rs73239138
Codominant
GG 216 (83.1) 197 (75.8) 1 -
GA 39 (15) 55 (21.2) 0.65 (0.41-1.01) 0.067
AA 5 (1.9) 8 (3.0) 0.57 (0.21-1.82) 0.403
Dominant
GG 216 (83.1) 197 (75.8) 1 -
AA+AG 44 (16.9) 63 (24.2) 0.64 (0.42-0.98) 0.048
Recessive
GG+AG 255 (98.1) 252 (96.9) 1 -
AA 5 (1.9) 8 (3.1) 0.62 (0.19-1.91) 0.576
Allele
G 471 (90.58) 449 (86.35) 1 -
A 49 (9.42) 71 (13.65) 0.66 (0.45-0.93) 0.041
miR-3117 rs4655646
Codominant
AA 224 (86.1) 241 (92.7) 1 -
AG 34 (13.1) 19 (7.3) 1.93 (1.05-3.51) 0.03
GG 2 (0.8) 0 - -
Allele
A 482 (92.69) 501 (96.35) 1 -
G 38 (7.31) 19 (3.65) 2.08 (1.20-3.62) 0.014
rs7512692 Codominant
CC 28 (10.8) 106 (40.8) 1 -
CT 161 (61.9) 133 (51.2) 4.58 (2.87-7.44) <0.001
TT 71 (27.3) 21 (8.0) 12.80 (6.72-24.12) <0.001
Dominant
CC 28 (10.8) 106 (40.8) 1 -
CT+TT 232 (89.2) 154 (59.2) 5.70 (3.58-9.06) <0.001
Recessive
CC+CT 189 (72.7) 239 (91.9) 1 -
TT 71 (27.3) 21 (8.1) 4.27 (2.55-7.22) <0.001
Allele
C 217 (41.73) 345 (66.35) 1 -
T 303 (58.27) 175 (33.65) 2.75 (2.14-3.54) <0.001
Open in a new tab

Table 5.

The Association of miR-1307, miR-1269 and miR-3117 Polymorphisms with Clinicopathological Characteristics of Breast Cancer (BC) Patients

Characteristic of patients miR-1307 rs7911488 P-value miR-1269
rs73239138		 P-value miR-3117
rs4655646		 P-value miR-3117
rs7512692		 P-value
AA AG GG GG GA AA AA AG GG CC CT TT
Age, years 0.731 0.63 0.766 0.835
≤50 91 55 7 127 22 4 130 22 1 18 94 41
>50 63 35 7 88 16 1 92 12 1 10 65 70
Tumor size, cm 0.133 0.991 0.709 0.743
≤2 34 17 0 42 8 1 46 5 0 7 30 14
>2 100 66 11 145 28 4 155 20 2 18 112 47
Histology 0.924 0.064 0.694 0.057
Ductal carcinoma 126 74 12 180 29 3 187 23 2 28 123 61
Others 19 13 2 24 8 2 29 5 0 0 25 9
Lymph node metastasis 0.817 0.619 0.362 0.123
No 75 43 8 107 17 2 107 18 1 10 75 41
Yes 56 37 5 79 16 3 89 8 1 14 62 22
Grade 0.416 0.094 0.57 0.031
I 16 12 51 22 10 0 27 5 0 3 25 4
II 66 36 34 93 12 2 94 11 2 10 57 40
III+IV 51 5 4 73 14 2 78 11 0 14 53 22
Stage 0.155 0.368 0.67 0.299
I 9 5 0 13 1 0 13 1 0 0 7 7
II 69 38 3 87 20 3 96 14 0 11 70 29
III 36 25 5 56 10 0 58 7 1 8 43 15
IV 16 11 5 27 3 2 26 6 0 5 16 11
Estrogen receptor status 0.556 0.082 0.593 0.655
Positive 99 54 7 133 26 1 139 19 2 18 100 42
Negative 47 30 6 68 11 4 73 10 0 10 47 26
Progesterone receptor status 0.834 0.006 0.187 0.082
Positive 94 51 8 126 27 0 129 22 2 133 26 1
Negative 50 32 5 72 10 5 80 7 0 68 11 4
HER2 status 0.392 0.371 0.279 0.562
Positive 43 29 6 68 8 2 66 12 0 8 51 19
Negative 103 55 7 134 28 3 147 16 2 20 96 49
Open in a new tab

Discussion

Recent investigations showed that miRNAs are involved in regulating more than 30% of the human genome (Filipowicz et al., 2008). It is suggested that miRNAs may be involved in many biological pathways, including proliferation and metastasis. However, the primary function of miRNAs has not been identified yet (Bueno et al., 2008). Several studies have shown that there is a strong correlation between abnormal expression of miRNAs and risk of BC (Qi et al., 2015; Danesh et al., 2018; Moazeni-Roodi et al., 2019). Recently, Several investigations have been conducted on miR-1307, miR-1269, and miR-3117 polymorphisms to clarify the direct association of these variants in cancer susceptibility.

The association of microRNA’s such as miR-1307, miR-1269, and miR-3117 polymorphisms with risk of cancer has been demonstrated (Gan et al., 2015; Xiong et al., 2015; Cui et al., 2017; Bao et al., 2018; Wang and Zhu, 2018; Han et al., 2019).

The current investigation In this study, for the first time in Iran, has examined the possible association between miR-1307 rs7911488, miR-1269 rs73239138, miR-3117, rs4655646, rs7512692 and the risk of BC in a sample of women in southeast of Iran was studied.

Current findings proposed that the AG genotype, as well as the G allele of rs7911488 of miR-1307 polymorphism, significantly reduced the risk of BC among the sample group of southeast Iranian women. Only two studies have already investigated the impact of rs7911488 miR-1307 on cancer so far. For the first time, Tang et al., (2015) showed that miR-1307 is involved in the overexpression of Bcl2 and increasing the risk of colorectal cancer, which is contradictory to our results. The contradiction between these two findings could be due to the different ethnicities of samples and cancer types being studied.

Furthermore, Qi et al., (2017) showed that miR-1307 polymorphism is involved in capecitabine-based chemotherapy in patients who were diagnosed with colon cancer. Their results showed that the response rate of capecitabine-based treatment in the patients with TC genotype was the highest while CC genotype had the lowest chemotherapy response (Min et al., 2017). miR-1269 was identified as an ono miRNA, which could act as a tumor suppressor (Bu et al., 2015). miR-1269 is located at chromosome 4. So far, only three studies have examined the relation between miR-1269 rs73239138 and vulnerability to cancer. In 2015, Guanying et al., (2015) observed that the AG and AA genotype of miR-1269 rs732- 39138 decreased the risk of susceptibility to HCC in the southern Chinese population (Xiong et al., 2015). In contrast to the previous findings, Pei Min et al. showed that miR-1269 rs73239138 considerably increased the risk of HCC in the eastern Chinese population (Min et al., 2017). In 2017, the results of Wenshual Li et al. showed that the downregulating of Zinc Finger Protein70 (ZNF70) by miR-1269 variant rs73239138 was a protective factor against gastric cancer (Li et al., 2017). Our current results suggest that there is a significant correlation between dominant (AA+AG) genotype, the A allele and protection against BC due to miR-1269 rs73239138 in the Iranian population.

It is important to note that the study of the correlation between polymorphisms in a specific type of cancer and a certain genotype is heavily dependent on the type of cancer as well as and the ethnic population under investigation. This may cause possible contradictions among different research results.

miR-3117 is located at human chromosome 1. The association between the development and metastasis of colorectal cancer and miR-3117 was recently confirmed (Neerincx et al., 2015). The studies showed that overexpression of miR-3117 could promote cell proliferation in HCC (Cui et al., 2017). Few studies have been done about researched miR-3117 and susceptibility to cancer. No study has reported the role of miR-3117 rs4655646 and rs7512692 polymorphisms in cancer. Our investigations on miR-3117 rs4655646 polymorphism showed that the AG genotype, as well as G allele, increased the risk of BC in the sample of Iranian women. Similarly, our findings suggest that miR-3117 rs7512692 variant increased the risk of BC in CT and TT genotypes as well as T allele.

In conclusion, our findings suggest that miR-1307 rs7911488 and miR-1269 rs73239138 polymorphisms reduced the risk of BC in women within the southeast region of Iran. However, miR-3117 rs4655646 and miR-3117 rs7512692 variants increased the risk of developing BC in the sample of Iranian women. Our findings could help scientists better understand the pathways that cause the BC development of BC and possible new methods and biomarkers to predict and fight this deadly disease.

Acknowledgments

Our project was supported by Zahedan University of Medical Sciences, Zahedan, Iran as a dissertation grant (9104#SS).

Author Contribution

Sahel Sarabandi: preparation of the project’s proposal, sample collection and doing experiments on the bench (qPCR, genotyping).

Hedieh Sattarifard: preparation of the first draft of the manuscript, and statistical analysis of data, and preparation of the tables and figures for the manuscript

Mohammad Kiumarsi: preparation of the first draft of the paper, preparation of the second draft with Hedieh considering English development.

Shima Karami: sample preparation and doing benchwork with Sahel.

Mohsen Taheri and Gholamreza Bahari: co-supervision of students (Shima, Sahel) after Professor Hashemi passed away. They also gave scientific advice to Hedieh and Mohammad during manuscript preparation.

Professor Mohammad Hashemi: the primary supervisor of the project and co-designed the project with Dr. Saeid Ghavami. He was the primary supervisor of Shima and Sahel and finalized the proposal and arranged with the clinician to collect the samples and prepare the grant to support the project.

Dr. Saeid Ghavami: the leader of the team, did the final proofread of the manuscript (scientific language), interpreted the results with students, co-design the project with Professor Hashemi, and proofread .the thesis extracted from the project.

References

  1. Bao M, Song Y, Xia J, et al. miR-1269 promotes cell survival and proliferation by targeting tp53 and caspase-9 in lung cancer. Onco Targets Ther. 2018;11:1721. doi: 10.2147/OTT.S157715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Bertoni N, de Souza MC, Crocamo S, Szklo M, de Almeida LM. Is a family history of the breast cancer related to women’s cancer prevention behaviors? Int J Behav Med. 2019;26:85–90. doi: 10.1007/s12529-018-9737-9. [DOI] [PubMed] [Google Scholar]
  3. Bhan A, Mandal SS. LncRNA HOTAIR: A master regulator of chromatin dynamics and cancer. Biochim Biophys Acta. 2015;1856:151–64. doi: 10.1016/j.bbcan.2015.07.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2018;68:394–424. doi: 10.3322/caac.21492. [DOI] [PubMed] [Google Scholar]
  5. Bu P, Wang L, Chen K-Y, Rakhilin N, et al. miR-1269 promotes metastasis and forms a positive feedback loop with TGF-β. Nat Commun. 2015;6:1–12. doi: 10.1038/ncomms7879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bu P, Wang L, Chen K-Y, et al. miR-1269 promotes metastasis and forms a positive feedback loop with TGF-β. Nat Commun. 2015;6:6879. doi: 10.1038/ncomms7879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Bueno MJ, de Castro IP, Malumbres M. Control of cell proliferation pathways by microRNAs. Cell Cycle. 2008;7:3143–8. doi: 10.4161/cc.7.20.6833. [DOI] [PubMed] [Google Scholar]
  8. Cui X, Li Q, He Y. miR-3117 regulates hepatocellular carcinoma cell proliferation by targeting PHLPPL. Mol cell Biochem. 2017;424:195–201. doi: 10.1007/s11010-016-2855-2. [DOI] [PubMed] [Google Scholar]
  9. Dall GV, Britt KL. Estrogen effects on the mammary gland in early and late life and breast cancer risk. Front Oncol. 2017;7:110. doi: 10.3389/fonc.2017.00110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Danesh H, Hashemi M, Bizhani F, Hashemi SM, Bahari G. Association study of miR-100, miR-124-1, miR-218-2, miR-301b, miR-605, and miR-4293 polymorphisms and the risk of breast cancer in a sample of Iranian population. Gene. 2018;647:73–78. doi: 10.1016/j.gene.2018.01.025. [DOI] [PubMed] [Google Scholar]
  11. Eckhardt BL, Francis PA, Parker BS, Anderson RL. “Strategies for the discovery and development of therapies for metastatic breast cancer. Nat Rev Drug Discov. 2012;11:479–97. doi: 10.1038/nrd2372. [DOI] [PubMed] [Google Scholar]
  12. Erdmann VA, Szymanski M, Hochberg A, Groot Nd, Barciszewski J. Non-coding, mRNA-like RNAs database Y2K. Nucleic Acids Res. 2000;28:197–200. doi: 10.1093/nar/28.1.197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Filipowicz W, Bhattacharyya SN, Sonenberg N. “Mechanisms of post-transcriptional regulation by microRNAs: are the answers in sight? Nat Rev Genet. 2008;9:102–14. doi: 10.1038/nrg2290. [DOI] [PubMed] [Google Scholar]
  14. Gan T-Q, Tang R-X, He R-Q, et al. Upregulated MiR-1269 in hepatocellular carcinoma and its clinical significance. Int J Clin Exp Med. 2015;8:714. [PMC free article] [PubMed] [Google Scholar]
  15. García-Donas J, Beuselinck B, Inglada-Pérez L, et al. Deep sequencing reveals microRNAs predictive of antiangiogenic drug response. JCI Insight. 2016:1. doi: 10.1172/jci.insight.86051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gutierrez-Camino A, Martin-Guerrero I, Dolzan V, et al. “Involvement of SNPs in miR-3117 and miR-3689d2 in childhood acute lymphoblastic leukemia risk. Oncotarget. 2018;9:22907. doi: 10.18632/oncotarget.25144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Han S, Zou H, Lee J-W, et al. miR-1307-3p stimulates breast Cancer development and progression by targeting SMYD4. J Cancer. 2019;10:441. doi: 10.7150/jca.30041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hashemi M, Bahari G, Tabasi F, Moazeni-Roodi A, Ghavami S. Association between rs1862513 and rs3745367 genetic polymorphisms of resistin and risk of cancer: a meta-analysis. Asian Pac J Cancer Prev. 2018;19:2709. doi: 10.22034/APJCP.2018.19.10.2709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Hashemi M, Bojd HH, Nasab EE, et al. Association of adiponectin rs1501299 and rs266729 gene polymorphisms with nonalcoholic fatty liver disease. Hepat Mon. 2013:13. doi: 10.5812/hepatmon.9527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Hashemi M, Sanaei S, Hashemi SM, Eskandari E, Bahari G. Association of single nucleotide polymorphisms of the MDM4 gene with the susceptibility to breast cancer in a Southeast Iranian population sample. Clin Breast Cancer. 2018;18:883–91. doi: 10.1016/j.clbc.2018.01.003. [DOI] [PubMed] [Google Scholar]
  21. Hassanzarei S, Hashemi M, Sattarifard H, et al. Genetic polymorphisms of HOTAIR gene are associated with the risk of breast cancer in a sample of southeast Iranian population. Tumor Biol. 2017;39:1010428317727539. doi: 10.1177/1010428317727539. [DOI] [PubMed] [Google Scholar]
  22. Hu Z, Chen J, Tian T, et al. “Genetic variants of miRNA sequences and non–small cell lung cancer survival. J Clin Invest. 2008;118:2600–8. doi: 10.1172/JCI34934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Jayasekara H, MacInnis RJ, Hodge AM, et al. Is breast cancer risk associated with alcohol intake before first full-term pregnancy? Cancer Causes Control. 2016;27:1167–74. doi: 10.1007/s10552-016-0789-3. [DOI] [PubMed] [Google Scholar]
  24. Karami S, Sattarifard H, Kiumarsi M, et al. Evaluating the possible association between PD-1 (Rs11568821, Rs2227981, Rs2227982) and PD-L1 (Rs4143815, Rs2890658) polymorphisms and susceptibility to breast cancer in a sample of southeast Iranian women. Asian Pac J Cancer Prev. 2020;21:3115–23. doi: 10.31557/APJCP.2020.21.10.3115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Li W, Zhang H, Min P, et al. Downregulated miRNA1269a variant (rs73239138) decreases the susceptibility to gastric cancer via targeting ZNF70. Oncol Lett. 2017;14:6345–54. doi: 10.3892/ol.2017.7091. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Liu F, Dear K, Huang L, et al. Association between microRNA-27a rs895819 polymorphism and risk of colorectal cancer: A meta-analysis. Cancer Genet. 2016;209:388–94. doi: 10.1016/j.cancergen.2016.08.003. [DOI] [PubMed] [Google Scholar]
  27. McTiernan A, Friedenreich CM, Katzmarzyk PT, et al. Physical activity in cancer prevention and survival: A Systematic Review. Med Sci Sports Exerc. 2019;51:1252–61. doi: 10.1249/MSS.0000000000001937. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Meijer H, Kong Y, Lu W, et al. Translational repression and eIF4A2 activity are critical for microRNA-mediated gene regulation. Science. 2013;340:82–5. doi: 10.1126/science.1231197. [DOI] [PubMed] [Google Scholar]
  29. Min P, Li W, Zeng D, et al. A single nucleotide variant in microRNA-1269a promotes the occurrence and process of hepatocellular carcinoma by targeting to oncogenes SPATS2L and LRP6. Bull du Cancer. 2017;104:311–20. doi: 10.1016/j.bulcan.2016.11.021. [DOI] [PubMed] [Google Scholar]
  30. Moazeni-Roodi A, Ghavami S, Hashemi M. Association between miR-423 rs6505162 polymorphism and susceptibility to cancer: A Meta-Analysis. Arch Med Res. 2019;50:21–30. doi: 10.1016/j.arcmed.2019.04.002. [DOI] [PubMed] [Google Scholar]
  31. Moazeni-Roodi A, Ghavami S, Hashemi M. Lack of association between miR-605 rs2043556 polymorphism and overall cancer risk: a meta-analysis of case-control studies. MicroRNA. 2019;8:94–100. doi: 10.2174/2211536608666181204110508. [DOI] [PubMed] [Google Scholar]
  32. Nazarian A, Mohamadnia A, Danaee E, Bahrami N. Examining the expression of miR-205 and CEA mRNA in peripheral blood of patients with OSCC (Oral Squamous Cell Carcinomas) and comparing them with healthy people. Asian Pac J Cancer Biol. 2019;4:65–68. [Google Scholar]
  33. Neerincx M, Sie D, Van De Wiel M, et al. MiR expression profiles of paired primary colorectal cancer and metastases by next-generation sequencing. Oncogenesis. 2015;4:e170–e170. doi: 10.1038/oncsis.2015.29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Neerincx M, Sie D, Van De Wiel M, et al. MiR expression profiles of paired primary colorectal cancer and metastases by next-generation sequencing. Oncogenesis. 2015;4:e170. doi: 10.1038/oncsis.2015.29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Omrani M, Hashemi M, Eskandari-Nasab E, et al. hsa-mir-499 rs3746444 gene polymorphism is associated with susceptibility to breast cancer in an Iranian population. Biomarkers Med. 2014;8:259–267. doi: 10.2217/bmm.13.118. [DOI] [PubMed] [Google Scholar]
  36. Payehghadr S, Bahrami N, Mohammadi F, Naji T, Mohamadnia A. Detection of miR-21, MUC1mRNA and VEGF protein biomarkers expression changes in oral squamous cell carcinomas (OSCC) in peripheral blood. Asian Pac J Cancer Biol. 2018;3:59–64. [Google Scholar]
  37. Peng Y, Croce CM. The role of MicroRNAs in human cancer. Signal Transduct Target Ther. 2016;1:1–9. doi: 10.1038/sigtrans.2015.4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Pizot C, Boniol M, Mullie P, et al. Physical activity, hormone replacement therapy and breast cancer risk: A meta-analysis of prospective studies. Eur J Cancer. 2016;52:138–54. doi: 10.1016/j.ejca.2015.10.063. [DOI] [PubMed] [Google Scholar]
  39. Qi P, Wang L, Zhou B, et al. Associations of miRNA polymorphisms and expression levels with breast cancer risk in the Chinese population. Genet Mol Res. 2015;14:6289–96. doi: 10.4238/2015.June.11.2. [DOI] [PubMed] [Google Scholar]
  40. Qiu X, Dou Y. miR-1307 promotes the proliferation of prostate cancer by targeting FOXO3A. Biomed Pharmacotherapy. 2017;88:430–5. doi: 10.1016/j.biopha.2016.11.120. [DOI] [PubMed] [Google Scholar]
  41. Rafighdoost F, Rafighdoost A, Rafighdoost H, et al. The 19-bp deletion polymorphism of dihydrofolate reductase (DHFR) and nonsyndromic cleft lip with or without cleft palate: evidence for a protective role. J Appl Oral Sci. 2015;23:272–8. doi: 10.1590/1678-775720140473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Rafighdoost H, Hashemi M, Asadi H, Bahari G. “Association of single nucleotide polymorphisms in WNT genes with the risk of nonsyndromic cleft lip with or without cleft palate. Congenital Anomalies. 2018;58:130–5. doi: 10.1111/cga.12271. [DOI] [PubMed] [Google Scholar]
  43. Rafighdoost H, Hashemi M, Danesh H, et al. Association of single nucleotide polymorphisms in AXIN2, BMP4, and IRF6 with Non-Syndromic Cleft Lip with or without Cleft Palate in a sample of the southeast Iranian population. J Appl Oral Sci. 2017;25:650–6. doi: 10.1590/1678-7757-2017-0191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Rafighdoost H, Tabatabaei F, Bahari G, Hashemi M. “Association of single nucleotide polymorphisms in TPM1 rs11071720, rs3803499, rs12148828, and rs1972041 with the risk of nonsyndromic cleft lip with or without cleft palate in a sample of the Iranian population, a preliminary report. Ann Hum Genet. 2019;83:256–65. doi: 10.1111/ahg.12310. [DOI] [PubMed] [Google Scholar]
  45. Rinn JL, Chang HY. Genome regulation by long noncoding RNAs. Ann Rev Biochem. 2012;81:145–66. doi: 10.1146/annurev-biochem-051410-092902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Sadeghi-Bojd S, Falsafinejad F, Danesh H, et al. Macrophage migration inhibitory factor-173 G> C gene polymorphism is associated with increased risk of XNephrotic syndrome in children. Iran J Kidney Dis. 2019:13. [PubMed] [Google Scholar]
  47. Sattarifard H, Hashemi M, Hassanzarei S, et al. Long non-coding RNA POLR2E gene polymorphisms increased the risk of prostate cancer in a sample of the Iranian population. Nucleosides Nucleotides Nucleic Acids. 2019;38:1–11. doi: 10.1080/15257770.2017.1391394. [DOI] [PubMed] [Google Scholar]
  48. Shimomura A, Shiino S, Kawauchi J, et al. Novel combination of serum microRNA for detecting breast cancer in the early stage. Cancer Sci. 2016;107:326–34. doi: 10.1111/cas.12880. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Shiyanbola OO, Arao RF, Miglioretti DL, et al. Emerging trends in family history of breast cancer and associated risk. Cancer Epidemiol Prev Biomarkers. 2017;26:1753–60. doi: 10.1158/1055-9965.EPI-17-0531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Sibin M, Harshitha S, Narasingarao K, et al. Effect of rs11614913 polymorphism on mature miR196a2 expression and its target gene HOXC8 expression in human glioma. J Mol Neuroscience. 2017;61:144–51. doi: 10.1007/s12031-016-0855-z. [DOI] [PubMed] [Google Scholar]
  51. Tang R, Qi Q, Wu R, et al. The polymorphic terminal-loop of pre-miR-1307 binding with MBNL1 contributes to colorectal carcinogenesis via interference with Dicer1 recruitment. Carcinogenesis. 2015;36:867–75. doi: 10.1093/carcin/bgv066. [DOI] [PubMed] [Google Scholar]
  52. Umami A, Sudalhar S, Pratama TWY, Fitri I, Firmansyah A. Knowledge, barriers, and motivation related to breast and cervical cancer screening among women in Bojonegoro, East Java: A Qualitative Study. J Health Promot Behav. 2020;5:1–10. [Google Scholar]
  53. Vickers NJ. Animal communication: When i’m calling you, will you answer too? Curr Biol. 2017;27:713–5. doi: 10.1016/j.cub.2017.05.064. [DOI] [PubMed] [Google Scholar]
  54. Wang C, Li L, Yin Z, et al. An Indel Polymorphism within pre-miR3131 confers risk for hepatocellular carcinoma. Carcinogenesis. 2016;38:168–76. doi: 10.1093/carcin/bgw206. [DOI] [PubMed] [Google Scholar]
  55. Wang X, Zhu J. Mir-1307 regulates cisplatin resistance by targeting Mdm4 in breast cancer expressing wild type P53. Thoracic Cancer. 2018;9:676–83. doi: 10.1111/1759-7714.12607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Wu J, Wang Y, Shang L, Qi L, Song M. Five common functional polymorphisms in microRNAs and susceptibility to breast cancer: An Updated Meta-Analysis. Genet Testing Mol Biomarkers. 2018;22:350–8. doi: 10.1089/gtmb.2017.0270. [DOI] [PubMed] [Google Scholar]
  57. Xiong G, Wang Y, Ding Q, Yang L. Hsa-mir-1269 genetic variant contributes to hepatocellular carcinoma susceptibility through affecting SOX6. Am J Translat Res. 2015;7:2091. [PMC free article] [PubMed] [Google Scholar]
  58. Yang X-W, Shen G-Z, Cao L-Q, et al. MicroRNA-1269 promotes proliferation in human hepatocellular carcinoma via downregulation of FOXO1. BMC Cancer. 2014;14:909. doi: 10.1186/1471-2407-14-909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Yang Z, Li R, Ao J, et al. miR-1307-3p suppresses the chondrogenic differentiation of human adipose-derived stem cells by targeting BMPR2. Int J Mol Med. 2018;42:3115–24. doi: 10.3892/ijmm.2018.3891. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Yu D. The impact of exercise during radiation therapy for breast cancer patients. SAGE Open Med. 2019;8:1–21. [Google Scholar]
  61. Zhou Y, Wang M, Wu J, et al. The clinicopathological significance of miR-1307 in chemotherapy resistant epithelial ovarian cancer. J Ovarian Res. 2015;8:23. doi: 10.1186/s13048-015-0143-5. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Asian Pacific Journal of Cancer Prevention : APJCP are provided here courtesy of West Asia Organization for Cancer Prevention

RESOURCES