Abstract
Necroptosis is a lytic, inflammatory form of cell death that not only contributes to pathogen clearance but can also lead to disease pathogenesis. Necroptosis is triggered by RIPK3-mediated phosphorylation of MLKL, which is thought to initiate MLKL oligomerisation, membrane translocation and membrane rupture, although the precise mechanism is incompletely understood. Here, we show that K63-linked ubiquitin chains are attached to MLKL during necroptosis and that ubiquitylation of MLKL at K219 significantly contributes to the cytotoxic potential of phosphorylated MLKL. The K219R MLKL mutation protects animals from necroptosis-induced skin damage and renders cells resistant to pathogen-induced necroptosis. Mechanistically, we show that ubiquitylation of MLKL at K219 is required for higher-order assembly of MLKL at membranes, facilitating its rupture and necroptosis. We demonstrate that K219 ubiquitylation licenses MLKL activity to induce lytic cell death, suggesting that necroptotic clearance of pathogens as well as MLKL-dependent pathologies are influenced by the ubiquitin-signalling system.
Subject terms: Necroptosis, Ubiquitylation, Ubiquitylation
Necroptosis is a form of cell death characterized by membrane rupture via MLKL oligomerization, although mechanistic details remain unclear. Here, the authors show that MLKL ubiquitylation of K219 facilitates high-order membrane assembly and subsequent rupture, promoting cytotoxicity.
Introduction
Necroptosis is a caspase-independent, lytic form of programmed cell death that is triggered as host-defence mechanism for the elimination of pathogen-infected cells1. Infection-induced necroptosis not only deprives pathogens of a replicative niche, but also promotes an adaptive immune response2. Evasion of cell death is therefore crucial for successful propagation and dissemination of many pathogens, including intracellular bacteria and viruses1. Although necroptosis is an effective mechanism of pathogen clearance, unrestrained lytic cell death can also lead to tissue injury and severe illness, such as acute respiratory distress syndrome, inflammatory diseases and neurodegenerative diseases3–5.
The necroptotic pathway can be triggered by certain viruses, pathogen components, such as LPS, as well as by death ligands, including TNF and TRAIL6,7. Among these, TNF-mediated activation of TNF receptor 1 is the best-understood initiator of necroptosis signalling. Necroptosis depends on the activation of the mixed lineage kinase domain-like (MLKL) pseudokinase by receptor-interacting protein kinase 3 (RIPK3). RIPK3-mediated phosphorylation of mouse MLKL at S345 triggers a conformational change that facilitates the oligomerization, translocation to and disruption of cellular membranes, ultimately causing lytic cell death8–11. RIPK3 is activated by RHIM-domain containing proteins, such as RIPK1, TRIF or ZBP17. Importantly, the cysteine protease caspase-8 suppresses necroptotic cell death by cleaving and inactivating proteins that promote necroptosis, including RIPK1, RIPK3 and CYLD12. Thus, necroptosis predominantly occurs when caspase-8 activity is low, absent or suppressed, such as in response to viral inhibitors13,14, pharmacological inhibition15 and genetic or epigenetic loss6,16.
Mechanistically, MLKL functions as a molecular switch that exposes its membrane permeabilizing N-terminal 4-helix bundle (4HB) upon RIPK3-mediated phosphorylation in MLKL’s activation loop8,11,17–19. Phosphorylation in the activation loop results in the destabilisation of a critical hydrogen bond. Breakage of this bond results in the rearrangement of the pseudoactive site of the pseudokinase domain of MLKL8, which in turn is transmitted to the 4HB domain by two brace helices that link the pseudokinase domain to the 4HB20. These helices also provide an interface for oligomerization of MLKL, a requirement for its killing function20.
While phosphorylation of MLKL constitutes a key signalling step, and is a hallmark of necroptotic signalling, the precise mechanism of MLKL activation is incompletely understood. Here, we demonstrate that endogenous MLKL is readily conjugated with K63-linked Ub-signalling chains during necroptosis, and that ubiquitylation of K219 plays a critical role for the execution of MLKL-dependent cell death. Accordingly, MlklK219R/K219R knock-in mice are protected from necroptosis-induced tissue injury. Moreover, MlklK219R mutant cells are protected from necroptosis triggered by TNF or murine cytomegalovirus (MCMV), and fail to restrict viral growth. Mechanistically, we find that K219 ubiquitylation contributes to optimal oligomerisation at cellular membranes, facilitating the rupture of the plasma membrane and lytic cell death. Taken together, our observations are consistent with the notion that K219 ubiquitylation enhances the potential of phosphorylated MLKL to permeabilize the plasma membrane.
Results
MLKL is ubiquitylated during necroptosis
The molecular mechanism that regulates the cytotoxic potential of MLKL is not fully understood. To study the regulatory mechanism of MLKL-mediated necroptosis, we monitored the ubiquitylation status of MLKL in cells exposed to necroptotic triggers. While treatment with TNF/SMAC mimetic (SM)/z-VAD-FMK (TSZ) caused time- and RIPK1-dependent necroptosis in human colorectal cancer HT-29 cells, mouse dermal fibroblasts (MDFs) and murine L929 cells, TSZ also triggered ubiquitylation of endogenous MLKL in all these cell types (Fig. 1a–d and Supplementary Fig. 1a–c). Treatment with the non-specific deubiquitylase USP21 completely removed the smearing pattern of MLKL, demonstrating that MLKL is modified by Ub adducts in response to TSZ (Fig. 1c and Supplementary Fig. 1d). Intriguingly, the extent of MLKL ubiquitylation correlated with the extent of necroptosis. Accordingly, phosphorylation and ubiquitylation of MLKL occurred with a similar kinetics (Fig. 1c, d), and slowing down the kinetics of necroptosis also delayed the appearance of the phosphorylated and ubiquitylated forms of MLKL (Supplementary Fig. 1a–c). We also found that ubiquitylated MLKL was phosphorylated (Fig. 1d, second panel). Ubiquitylation of MLKL not only occurred in response to TNF-induced necroptosis, but also upon necroptosis triggered by TRAIL (Fig. 1e, f). This suggests that ubiquitylation of MLKL occurs in response to various necroptotic signalling events. Importantly, MLKL was not ubiquitylated during TNF-induced apoptosis (Fig. 1g, h). Taken together, these results indicate that MLKL is ubiquitylated in response to necroptotic stimuli.
Ubiquitylation of MLKL requires RIPK3-mediated phosphorylation
RIPK3 activates mouse MLKL via phosphorylation at S345, which causes a conformational change of MLKL that enables its trimerization and subsequent translocation to the plasma membrane where MLKL trimers form higher-order polymers, which permeabilize the plasma membrane (Fig. 2a)9,11,20. Next, we assessed whether RIPK1 > RIPK3 signalling is required for MLKL ubiquitylation. We found that pharmacological inhibition of RIPK1 and RIPK3, or genetic deletion of RIPK3 not only blocked necroptosis (Supplementary Fig. 2a, b), but also abrogated ubiquitylation of MLKL (Fig. 2b, c). These data demonstrate that MLKL ubiquitylation is highly dependent on the kinase activity of RIPK3. To corroborate this notion, we tested whether RIPK3-mediated phosphorylation of S345 is required for MLKL ubiquitylation. To this end, we reconstituted Mlkl−/− MDFs with wild type (WT) or a mutant form of MLKL (MLKLS345A) that cannot be phosphorylated by RIPK3, and hence fails to trigger necroptosis (Supplementary Fig. 2c)18. While WT MLKL was readily ubiquitylated upon treatment with TSZ, ubiquitylation of MLKLS345A was significantly suppressed (Fig. 2d). We observed that the appearance of the prominent, lower molecular weight ubiquitylation smearing pattern of MLKL was dependent on MLKL phosphorylation at S345. In contrast, the faint, higher molecular weight ubiquitylation smearing pattern occurred irrespective of MLKL phosphorylation at S345 (Fig. 2d and Supplementary Fig. 2d). This result is consistent with the notion that the active, phosphorylated form of MLKL is ubiquitylated.
We, therefore, assessed whether the ubiquitylated form of MLKL is also incorporated into oligomers, and, therefore, might influence plasma membrane disruption. Since intermolecular disulfide bonds stabilise trimeric, active MLKL9,10,21, we used non-reducing conditions to evaluate MLKL oligomerisation. While the treatment with TSZ caused trimerization of MLKL (Supplementary Fig. 2e)9,21,22, we found that MLKL oligomers were also ubiquitylated (Fig. 2e). Accordingly, incubation with USP21 abrogated the Ub smearing pattern, leading to the appearance of oligomeric, as well as monomeric forms of MLKL (Fig. 2f). Finally, adding a FLAG tag on MLKL’s N-terminus, which prevents higher-order assembly at the plasma membrane11, did not affect MLKL ubiquitylation (Supplementary Fig. 2f). Together, these data indicate that both phosphorylated monomers and oligomers are ubiquitylated, suggesting that ubiquitylation of P-MLKL is an early event, and occurs prior to its oligomerisation and membrane translocation.
MLKL is ubiquitylated prior to plasma membrane localisation
Following oligomerisation, active MLKL translocates to the plasma membrane where it accumulates to induce cell death9,10,23–25. To address whether ubiquitylation of MLKL occurs prior to plasma membrane trafficking, we used in situ proximity ligation assay (PLA) and subcellular fractionation approaches. Using primary antibodies against MLKL and Ub, we observed that treatment with TSZ caused prominent MLKL:Ub PLA speckles, while no such speckles were detected under untreated control conditions (Fig. 3a). Interestingly, these PLA speckles localised to the cytosol, suggesting that MLKL is ubiquitylated in the cytosol prior to its translocation to the plasma membrane. This was confirmed using subcellular fractionation approaches to separate the cytosolic content (C) from the membrane-containing fraction (M). By performing cellular fractionation followed by Ub enrichment, we found that TSZ treatment caused the appearance of ubiquitylated MLKL in the cytosolic and membrane-enriched fractions at 2 h (Fig. 3b). As time progressed, more ubiquitylated MLKL accumulated in the membrane-enriched fraction (Fig. 3b, compare lanes 9 with 15). Together, these results support the notion that MLKL is predominantly ubiquitylated in the cytosolic compartment before its translocation to the plasma membrane.
Next, we used a variety of Ub-linkage selective affinity reagents to determine the Ub chain type that is conjugated to MLKL. Using these reagents, we found that necroptotic stimuli triggered prominent K63-linked ubiquitylation of MLKL in MDFs and HT-29 (Fig. 3c, d). Under these conditions, no M1- or K48-linked chains were detectable. The presence of K63-linked Ub chains suggest that ubiquitylation of MLKL serves a signalling function and does not trigger its proteasomal degradation.
Endogenous MLKL is ubiquitylated on K51, K77, K172 and K219
To study the role of MLKL ubiquitylation in necroptosis signalling, we next identified the Ub acceptor lysine residues of MLKL. To this end, we used a quantitative mass spectrometry-based approach coupled to immunoprecipitation of K-ε-GG Ub-remnant peptides (Fig. 4a). This identified a TSZ-dependent increase in the abundance of site-specific ubiquitylation events for several proteins of the TNFR1 signalling pathway, including RIPK1, RIPK3, Casp8 and MLKL (Fig. 4a). Examination of the K-ε-GG Ub-remnant peptides of endogenous MLKL revealed TSZ-dependent ubiquitylation of K51, K77, K172 and K219 (Fig. 4b, c), in all three biological replicates. The ubiquitylated residues mapped to the 4HBD (K51 and K77), the second brace helix (K172) and the pseudokinase domain (K219). K219 is of particular interest as this residue forms a hydrogen bond with Q343 of the activation loop under resting condition (Fig. 4c)8. While the hydrogen bond between K219 and Q343 locks MLKL into an inactive conformation under resting conditions, RIPK3-medidated phosphorylation at S345 triggers a conformational change that destabilises this bond and re-arranges the pseudoactive site, leading to ‘activation’ of MLKL8. Thus, following phosphorylation at S345, the ε-amino group of K219 becomes available for ubiquitylation. This explains why only phosphorylated, active MLKL is subject to ubiquitylation. This also raises the possibility that ubiquitylation at K219 might stabilise the activated form of MLKL, and hence contributes to the necroptotic potential of MLKL.
Ubiquitylation at K219 contributes to the cytotoxic potential of MLKL
To examine the importance of MLKL ubiquitylation, we reconstituted Mlkl−/− MDFs with various Ub acceptor lysine mutants. To generate MLKL that cannot be ubiquitylated at K219, but resides in an inactive conformation, we exchanged K219 to arginine (R). Since Arg has a similar chemical structure to Lys, K219R is predicted to maintain the hydrogen bond with Q343 under resting conditions (Fig. 5a). Accordingly, MLKLK219R behaved comparably to MLKLWT under resting conditions, and their expression was well tolerated and non-cytotoxic in the absence of necroptotic stimuli (Fig. 5b). This was in contrast to MLKLK219M, which carries a K219 to M substitution mutation that disrupts the hydrogen bond with Q3438, and which was cytotoxic (Fig. 5a, b)8. Intriguingly, following treatment with TSZ, MLKLK219R was significantly less potent in inducing necroptosis than WT MLKL (Fig. 5c). The difference in necroptotic potency was not caused by differences in their protein stability or expression levels, since MLKLK219R and MLKLWT were expressed to similar levels and exhibited comparable protein thermal stability profiles (Supplementary Fig. 3a, b). This strongly suggests that ubiquitylation of K219 contributes to the cytotoxic potential of MLKL. Of note, K219 of mouse MLKL is conserved in human MLKL (hMLKL), and corresponds to K230. Intriguingly, hMLKL K230 was found to be ubiquitylated in a whole ubiquitinome-wide analysis26, and is mutated in cancer19. Since mutation of K230 renders hMLKL less potent19, this suggests that, like in the murine setting, ubiquitylation of K230 might contribute to hMLKL’s killing function.
In contrast to K219, mutating the Ub acceptor lysines K51 and K77, which are located in the 4HBD of MLKL (MLKLK51R,K77R), had no effect in MLKL’s killing potential, neither alone nor in combination (Fig. 5c and Supplementary Fig. 3b). Further, the triple mutant MLKLK51R,K77R,K219R had the same reduced killing potential as the single mutant MLKLK219R. Mutating the acceptor K172 to R (MLKLK172R) showed a modest protection (Fig. 5c and Supplementary Fig. 3b). Although this indicates that ubiquitylation of the brace (K172) may contribute to the killing potential of MLKL, our data suggest that K219 is the predominant site influencing necroptosis. Intriguingly, previous work indicates that MLKLK219M is less cytotoxic than MLKLQ343A, even though both mutations disrupt the hydrogen bond between K219 and Q3438. Since MLKLQ343A retains the K219 ubiquitylation site, it is possible that MLKLQ343A is more toxic than MLKLK219M because it profits from pro-necroptotic ubiquitylation of K219.
Next, we tested the contribution of K219 ubiquitylation on the cytotoxic potential of a constitutively active mutant form of MLKL (MLKLS345D). Induced expression of MLKLS345D, K219R was significantly less potent in inducing necroptosis than MLKLS345D (Fig. 5d and Supplementary Fig. 3c). This further demonstrates that ubiquitylation of K219 contributes to the pro-necroptotic potential of MLKL.
To help explain the mechanism by which ubiquitylation of K219 enhances cell death, we performed extensive all-atom molecular dynamics (MD) simulations of unmodified MLKL (WT), MLKL phosphorylated at S345 (S345phos), MLKL both phosphorylated at S345 and monoubiquitylated at K219 (K219ub S345phos), starting from the crystal structure of mMLKL (PBD: 4BTF)8. Although the hydrogen bond between K219 and Q343 was formed in the crystal structure, the conformation of the 4HB domain resembled a more open, active conformation. We found that even in the WT simulations, the hydrogen bond was not maintained throughout the simulations (present only in 14% of the simulated ensemble), and the 4HB domain conformation sampled both open and closed conformations (Fig. 5e, f and Supplementary Fig. 3d). In the WT simulations, S345 on the activation loop helix is pointed toward the adjacent helix and residue T235, but when S345 is phosphorylated, the phosphate group moves away to interact with solvent instead, disrupting both the structure and orientation of the activation loop helix (Fig. 5e–g and Supplementary Fig. 3d). This conformational change in the pseudokinase domain appears to have an allosteric effect on the 4HB domain conformation, which is more consistently in the open, active conformation in the S345phos simulations (Fig. 5e–h and Supplementary Fig. 3d). We also ran simulations with both S345 phosphorylated and a single Ub molecule covalently attached to the K219 sidechain (Fig. 5e–g). Although K219 is not a surface residue, attachment of the Ub moiety did not significantly disrupt the MLKL fold in our simulations. As in the S345phos simulations, the phosphorylated serine was more solvent exposed and disrupted the structure of the activation loop helix in the K219ub S345phos simulations (Fig. 5e). However, we did not see a significant difference between the activation loop helix position in the K219ub S345phos simulations compared to either the WT or S345phos simulations (p value > 0.4). Surprisingly, the K219ub S345phos simulations sampled on average a 4HB domain more closely packed against the pseudokinase domain than the S345phos simulations, but the position of this domain varied widely within the simulated ensemble (Fig. 5h–i and Supplementary Fig. 3e). Overall MD simulations indicate a conformational change in the activation loop helix and 4HB domain upon S345 phosphorylation, leading to MLKL activation. In addition, the conjugation of Ub to K219 seems to influence the 4HB domain flexibility of P-MLKL, which might be an important feature for MLKL polymerisation.
MlklK219R/K219R cells are protected from TNF- and MCMV-driven necroptosis
To examine the role of MLKL ubiquitylation at K219 in the regulation of necroptosis, viral infection and tissue injury, we generated knock-in mice expressing MlklK219R from the endogenous Mlkl genomic locus (Supplementary Fig. 4a). MlklK219R/K219R mice were born at the expected Mendelian frequency, reached adulthood without showing signs of pathology, and were indistinguishable from their MlklWT/WT littermates (Supplementary Fig. 4b). To study the effect of the knock-in mutation in necroptosis, we measured TSZ-induced cell death of bone marrow-derived macrophages (BMDMs) and MDFs, isolated from two different pairs of MlklWT/WT and MlklK219R/K219R mice. MlklK219R/K219R BMDMs and MDFs were protected from TSZ-induced necroptosis compared to WT cells (Fig. 6a, b). Under these conditions, MlklK219R/K219R cells were as resistant as WT cells treated with RIPK1i (GSK′963) or RIPK3i (GSK′843), suggesting that K219 ubiquitylation is important for the induction of necroptosis (Fig. 6a, b). These data somewhat contrast our findings from the reconstitution system, where we observed only a partial rescue upon transgene-mediated re-expression of MLKLK219R in Mlkl−/− MDFs. This might be due to the fact that transgene-mediated re-expression of MLKL may not accurately reflect the expression level of endogenous MLKL as observed in cells derived from MlklK219R/K219R animals. Of note, the expression levels of RIPK1, RIPK3 and MLKL were indistinguishable in WT and MlklK219R/K219R cells (Supplementary Fig. 4c). Further, phosphorylation and activation of MLKL was readily detected in the lysates of MlklK219R/K219R MDFs, even at a time point when no cell death was apparent (2.5 h; Fig. 6c), reinforcing the viewpoint that RIPK3-mediated phosphorylation of MLKL is unaffected in these cells. Analysis of K63-linked ubiquitylation on MlklK219R/K219R knock-in cells and Mlkl−/− MDFs reconstituted with MlklK51R,K77R,K172R,K219R mutant, showed a reduction in the Ub smear, when compared to the one in MlklWT/WT cells (Supplementary Fig. 4d, e), although the persistence of a Ub smear suggests that additional ubiquitylation sites might exist. Taken together, our results show that abolishing MLKL ubiquitylation at K219 protects from MLKL-mediated cell death.
Next, we evaluated whether ubiquitylation at K219 contributes to the formation of higher-order MLKL polymers at the plasma membrane during necroptosis. To this end, we performed Blue Native PAGE (BN-PAGE) on cytosolic and membrane fractions of WT and MlklK219R/K219R MDFs. While treatment with TSZ stimulated the formation of large MLKL polymers on membranes of WT cells (Fig. 6d)11,19, such polymers barely formed in MlklK219R/K219R MDFs (Fig. 6d), even though MLKLK219R/K219R was phosphorylated (Fig. 6c and Supplementary Fig. 4d). Our interpretation of these findings is that phosphorylation of MLKL at S345 is not sufficient to trigger necroptosis, and that ubiquitylation of K219 is additionally required for cell death. Our data are consistent with the notion that ubiquitylation at K219 contributes to the cytotoxic potential of MLKL by facilitating the formation of higher-order oligomers at the plasma membrane.
Cell death plays an important role in the defence against certain types of pathogens, such as viruses1,27. MCMV triggers both apoptosis and necroptosis in infected cells. However, the MCMV-encoded M36 and M45 proteins inhibit caspase-8 and RIPK3 signalling, respectively, thereby suppressing these antiviral responses13,14. In contrast to WT MCMV particles, MCMV variants that carry a mutation in the RHIM domain of M45 (MCMVM45mutRHIM), fail to block necroptosis, and cause cell death of the infected cell13,14. To explore the role of K219 ubiquitylation in MCMV-induced cell death, we infected cells with MCMVWT and MCMVM45mutRHIM. Infection with MCMVM45mutRHIM readily induced cell death in WT MDFs (Fig. 6e). In contrast, MlklK219R/K219R MDFs were protected from MCMV-induced necroptosis (Fig. 6e). To further investigate the effect of K219 ubiquitylation on virus growth, we determined the viral titres of infected cells. Consistent with the notion that MlklK219R/K219R MDFs failed to clear the MCMVM45mutRHIM infection via necroptosis, MlklK219R/K219R MDFs had a significantly higher viral titre than WT cells 72 h after infection (Fig. 6f). The failure of MlklK219R/K219R cells to clear MCMVM45mutRHIM infection phenocopies Ripk3−/−, Zbp1−/− and Zbp1ZBDmut infected cells13,14,28. Of note, MCMVWT did not induce cell death in either WT or MlklK219R/K219R MDFs (Fig. 6e), and replicated with the same efficiency in both WT and MlklK219R/K219R MDFs (Fig. 6f), corroborating that the K219 mutation does not affect viral infection per se. Taken together, these observations are consistent with the notion that ubiquitylation of K219 is required for TNF- and MCMV-induced necroptosis, and attenuation of viral growth.
MlklK219R/K219R knock-in mice are protected from necroptosis-induced tissue injury
Next, we tested MlklK219R/K219R knock-in mice for their sensitivity to necroptosis-induced tissue injury. Previous work established that subcutaneous injection of SM causes RIPK1-dependent cell death and tissue injury that mimics inflammatory disease seen in genetic models of IAP loss29. We used this system in combination with the clinical pan-caspase inhibitor emricasan to evaluate the effect of necroptosis in the skin of WT and MlklK219R/K219R knock-in animals. Mlkl−/− animals served as controls. Subcutaneous injection of the clinical IAP antagonist ASTX660 in combination with emricasan (AE treatment) caused substantial ulceration of the skin of MlklWT/WT animals at 72 h (Fig. 7a–c). In contrast, MlklK219R/K219R knock-in animals were significantly protected from AE-induced tissue injury, which was comparable to Mlkl−/− animals (Fig. 7a–i). The WT group treated with AE achieved the highest histological multivariant lesion score (HLS; Supplementary Fig. 5a) of mean 285 (range 242–356), while Mlkl−/− or knock-in animals reached an HLS mean 55.5 (range 15.20–160) and mean 82.50 (range 36.10–146.70), respectively (Fig. 7c). Subcutaneous injection of AE in WT animals caused ulceration of the epidermis with dense collagenous fibrous tissue formation in underlying dermis, that appeared extending to the hypodermis (Fig. 7b–i and Supplementary 6a). WT animals also showed clear evidence of cellular necrosis, including the presence of nuclear dust mostly at superficial or mid-dermis (Supplementary Fig. 6a magnification 1), together with scattered necrotic cells within the deep region of the dermis and hypodermis (Supplementary Fig 6b, magnification 2). Necrotic cells were also observed in the root-sheet epithelium of hair follicles located at the deeper hypodermis of AE-injected WT animals (Supplementary Fig. 6b, magnification 3). In contrast to WT animals, subcutaneous injection of AE into MlklK219R/K219R and Mlkl−/− animals did not result in any of the aforementioned features (Fig. 7b). Accordingly, MlklK219R/K219R and Mlkl−/− animals exhibited an epidermal layer without ulceration (Fig. 7b). Moreover, there was no evidence of necrosis in MlklK219R/K219R and Mlkl−/− mice (Fig. 7b). Although MlklK219R/K219R were significantly protected from the effects of subcutaneous injection of AE, such animals did show some irregular epidermis (Fig. 7d) due to thickening of the epidermis (Fig. 7e). Nevertheless, when compared to WT animals, subcutaneous injection of AE only caused relatively minor effects in MlklK219R/K219R animals (Fig. 7i). Importantly, quantification of immune cells within the spleens of MlklK219R/K219R knock-in mice and Mlkl−/− mice excluded any basal alteration within their immune landscape (Supplementary Fig. 5b). Lastly, to test whether subcutaneous injection of AE-induced RIPK1-dependent necroptosis, mice were fed chow-containing RIPK1 inhibitor (Ripk1i GSK′547) for 7 days prior to injection. As shown in Supplementary 7a–i, RIPK1 inhibition conferred significant protection in comparison to animals fed on a control diet. Together, these data demonstrate that subcutaneous injection of AE induces a RIPK1-driven necroptotic cell death phenotype, which is lost in MlklK219R/K219R mice. This suggests that conjugation of Ub to K219 contributes to necroptosis-mediated tissue damage of the skin.
Discussion
Necroptosis is a lytic, inflammatory form of cell death that not only contributes to pathogen clearance30, but can also lead to tissue injury and disease pathogenesis if aberrantly activated31–34. Despite the identification of key players of the necroptosis machinery, surprisingly little is known about how MLKL is activated and how this potentially catastrophic event is regulated. Here, we show that endogenous MLKL is ubiquitylated during necroptosis, and that ubiquitylation at K219 plays a critical role for the execution of MLKL-dependent cell death. Moreover, we demonstrate that K219 ubiquitylation is required for MLKL-dependent pathogenesis in vivo, and contributes to MLKL-mediated viral clearance. Mechanistically, we provide evidence that ubiquitylation of MLKL facilitates the formation of higher-order polymers required for membrane rupture and lytic cell death. Therefore, K219 ubiquitylation regulates the cytotoxic potential of MLKL.
We find that MLKL is ubiquitylated with K63-linked Ub chains during necroptosis, but not apoptosis. Accordingly, ubiquitylated forms of MLKL were only detected following treatment with necroptotic stimuli, such as TSZ and TRAIL/S/Z, but not under resting conditions or during TS-induced apoptosis. The prominent low molecular weight ubiquitylation events on MLKL were dependent on RIPK3-mediated phosphorylation of MLKL at S345. Interfering with MLKL phosphorylation, either via pharmacological inhibition of RIPK1 and RIPK3, or expression of a phospho-mutant form of MLKL (MLKLS345A), abrogated MLKL phosphorylation and Ub modifications of low molecular weight. Intriguingly, while the low molecular weight ubiquitylation events were phospho-dependent, higher molecular weight modifications appeared to be slightly elevated upon inhibition of S345 phosphorylation. Consistent with the requirement of MLKL phosphorylation for its ubiquitylation, we found that MLKL ubiquitylation directly correlated with the extent of MLKL phosphorylation and necroptosis.
The mechanism of MLKL activation helps to explain why only phosphorylated MLKL is ubiquitylated at K219. In its non-phosphorylated state, MLKL adopts a closed, inactive configuration. In mice, this inactive configuration is maintained by a critical hydrogen bond between K219 and Q343, which is located in the helix that forms the activation loop11. Upon phosphorylation of MLKL at S345, the K219::Q343 hydrogen bond is destabilised, which triggers a conformational switch that converts MLKL from a dormant cytoplasmic protein into oligomers that translocate to, and permeabilise, the plasma membrane to kill cells. Phospho-dependent breakage of the K219::Q343 hydrogen bond not only results in a conformational change of MLKL, but also frees the ε-amino group of K219 so that it can become available to serve as Ub acceptor. This explains why only the phosphorylated form of MLKL is ubiquitylated. It also explains why MLKL is exclusively ubiquitylated under necroptotic conditions, and not during apoptosis or resting conditions. Similar to RIPK1 (ref. 35) and RIPK3 (ref. 36), MLKL is also a client protein of heat shock protein 90 (Hsp90). This suggests that Hsp90 may also be involved in phosphorylation-mediated conformational changes of MLKL’s pseudokinase domain37–39. As such, Hsp90 might influence the availability of K219 as an Ub acceptor. Of note, K219 of mouse MLKL is conserved in hMLKL, corresponding to K230. Intriguingly, K230 of hMLKL is mutated in cancer19, suggesting that this residue is an important regulatory site. Moreover, like in the murine setting, K230 of hMLKL is ubiquitylated, which is evident as K230 was identified as an Ub acceptor K in a whole ubiquitinome analysis26, corroborating our findings in murine cells. Furthermore, mutation of K230 renders hMLKL less potent19, suggesting that, like in the murine setting, ubiquitylation of K230 might contribute to MLKL’s killing function. However, due to structural differences between mouse and hMLKL40, caution should be exercised when extrapolating to the human setting.
Our PLA is consistent with the notion that the conjugation of Ub to MLKL occurs in the cytoplasm. However, since the PLA technique relies on proximity, we cannot rule out the possibility that the obtained signal comes from Ub that is merely proximal, but not attached to MLKL. Nonetheless, cell fractionation experiments also supported that MLKL ubiquitylation is an early event during necroptosis, and occurs prior to plasma membrane localisation and membrane rupture. At present it remains unclear how ubiquitylation of K219 enhances MLKL polymer formation and cell death. It is possible that ubiquitylation helps to stabilise MLKL’s active conformation and consequently, facilitates polymer formation. Indeed, PTMs often control the dynamic toggling between the inactive and active states that are characteristic of protein kinases. Accordingly, Ub modifications frequently occur at sites that are important for kinase regulation41,42. For instance, computational simulation of ubiquitylation in key regulatory sites using MD shows that Ub can influence the structure and dynamics of ZAP-70 in a site-dependent manner, ultimately affecting its activation state43. These observations strengthen the hypothesis that Ub could be directly involved in the molecular switch mechanism of MLKL activation by altering the protein’s conformation or flexibility in a way that favours polymer formation and thus, kills more efficiently. Although ubiquitylation can affect protein function directly, the most common mode of regulation by Ub conjugation involves specific Ub receptors. This class of protein recognises and translates the Ub message into cellular phenotypes. Ub receptors carry specialised Ub-binding domains through which they interact with Ub-modified protein. Although Ub conjugation of active MLKL can potentially enhance its cytotoxic activity, it is likely that Ub-binding proteins also contribute to the transport or assembly of MLKL polymers. We would like to speculate that Ub conjugation of MLKL might provide cells with a mechanism of regulating MLKL’s pro-necroptotic potency. Therefore, Ub receptors may help to traffic MLKL to the plasma membrane, or control its localization and accumulation, thereby facilitating lytic cell death in response to necroptotic conditions25,44. Alternatively, ubiquitylation might enable the recruitment of known MLKL modulators, like TAM kinases, which reportedly phosphorylate MLKL at the plasma membrane to promote necroptosis45.
Recent studies indicate that cells can tolerate significant amounts of P-MLKL. However, little is known about how such cells establish a buffered threshold of active MLKL. Our observations are consistent with a model, in which the conjugation of Ub may also serve as potential ‘brake’ to sustain survival of the cell when MLKL activation is limited or reversed. Under such sub-lethal conditions, Ub receptors may help to traffic ubiquitylated MLKL into extracellular vesicles or lysosomes for safe disposal. In this respect it is interesting to note that the ESCRT machinery, which contains a plethora of Ub receptors, acts downstream of MLKL to regulate necroptotic cell death and inflammation46,47. Future work will investigate the potential cross-talk between MLKL ubiquitylation and ESCRT-mediated regulation of necroptosis.
While MLKL is robustly ubiquitylated during necroptosis, numerous candidate-based and unbiased approaches were unsuccessful in identifying E3 ligase(s) or Ub receptors that contribute to MLKL-mediated cell death. This may be due to redundancy and/or the involvement of multiple E3 ligases and Ub receptors. Furthermore, at least in MDFs, we could not find any role for Peli-1, an E3 ligase that reportedly influences MLKL-mediated necroptosis48,49 (Supplementary Fig. 8a–c). Future work will identify components of the Ub-signalling system that influence MLKL-mediated necroptotic cell death and its consequences.
In conclusion, our data indicate that the activity of MLKL is regulated through the combined effects of phosphorylation and ubiquitylation. These modifications are likely to fine-tune MLKL activation to enable a rapid response to diverse danger signals. In light of our findings, it is tempting to speculate that the magnitude and timing of the necroptotic response is influenced by the Ub-signalling system, such as E3 ligases, DUBs and Ub receptors. Given that aberrant lytic cell death can contribute to cytokine release syndrome, tissue damage and illness, a better understanding of how the Ub-signalling system influences MLKL activation and plasma membrane permeabilization might lead to the development of new therapeutic strategies to modulate necroptosis.
Methods
Reagents, chemicals and antibodies
The following reagents were used: complete mini EDTA free protease inhibitor cocktail tablets (Roche), PhosStop EasyPack (Roche), propidium iodide (PI, Sigma-Aldrich), digitonin 5% (Thermo Fisher Scientific), doxycycline (Clontech), Duolink in situ detection reagents green (Sigma-Aldrich), glutathione agarose beads (GE Healthcare), Pierce protein A/G plus agarose (ThermoFisher), Pierce streptavidin agarose (Thermo Fisher Scientific), K63-linkage ubiquitin interacting motif (K63 UIM) and K63-mutant UIM Ctrol (made in house), Met1-linkage-specific Ub-binder (M1-SUB) and GST Ctrol (Made in house), PR-619 (LifeSensors), PTMScan ubiquitin remnant motif (K-ε-GG, Cell signalling), puromycin (Invivogen), recombinant M-CSF (Peprotech), RIPK1 inhibitor GlaxoSmithKline GSK′963 (gift from GSK and Stratech Scientific), RIPK3 inhibitor GlaxoSmithKline GSK′843 (gift from GSK and Stratech Scientific), sequencing grade modified trypsin (Promega), SMAC mimetic (SM-164, kind gift from W. Shaomeng), TMT10plex isobaric label reagent set, 1 × 0.8 mg (ThermoFisher), TNFα (Recombinant human and mouse, Enzo), TRAIL (kind gift from H. Walczak), USP21 (kind gift from D. Komander), z-VAD-fmk (Enzo), ASTX660 (Gift from Astex Pharmaceuticals), emricasan (Medkoo). MCMVWT and MCMVM45mutRHIM virus (made in house by James Upton). A list of primers used in this study are supplied as a Supplementary Table 1.
The following plasmids were used: TUBE_Ubqx4_pGEX6P1 (kind gift from M. Gyrd-Hansen), pET104-DEST-UIM3x-(RAP80) WT and mutant (kind gift from N. Mailand), GST-M1-SUB (NEMO UBAN)_pGEX6P1 (kind gift from M. Gyrd-Hansen), pBluescript KS (Stratagene), pTRIPZ (Open Biosystem), psPAX2 (Addgene), pMD2.G (Addgene) and pBABE SV40 (large T antigen Δ89-97-missing Bub1 (kind gift from P. Jat), pLC-GFP (kind gift from B.C. Bornhauser).
The following antibodies were used: anti-actin (Santa Cruz Biotech, sc-1615, 1:2000), anti-caveolin-1 (Santa Cruz Biotech, sc-894, 1:1000), anti-Hsp90 (Santa Cruz Biotech, sc-7947, 1:1000), anti-K48-specific ubiquitin (Millipore, 05-1307, 1:1000), anti-K63-specific Ub (Millipore, 05-1313, 1:1000), anti-M1-specific Ub (gift from Genentech under MTA, 1F11, 1:1000), anti-MLKL (Millipore, MABC604, 1:1000 for immunoblot and 1:25 for PLA), anti-phospho-MLKL S345 (Abcam, ab196436, 1:1000), anti-phospho-MLKL S357/T358 (Abcam, ab187091, 1:1000), anti-RIPK1 (BD, 610459, 1:1000), anti-RIPK3 (Novus Biologicals, NBP1-77299, 1:1000), anti-ubiquitin (Dako, Z0458, 1:1000) and anti-ubiquitin (Novus Biologicals, NB300-129,1:25 for PLA). All secondary antibodies are from Jackson Immuno Research (1:10000). Anti-goat IgG (H + L)-HRP (305-035-003), anti-mouse IgG (H + L)-HRP (115-035-003), anti-rabbit IgG (H + L)-HRP (111-035-003), anti-rat IgG (H + L)-HRP (112-035-003), Phalloidin, Alexa Fluor 633 (ThermoFisher Scientific). The following antibodies were used for the spleen analysis: Fixable Viability Dye eFluor 780 (eBioscience 65-0865-14, 1:1000), Alexa Fluor 700 anti-mouse CD45 clone 30-F11 (BioLegend 103128, 1:200), PE/Cy7 anti-mouse CD3 clone 17A2 (BioLegend 100219, 1:100), PE/Dazzle 594 anti-mouse/human CD45R/B220 clone RA3-6B2 (BioLegend 103257, 1:100), BB515 rat anti-CD11b clone M1/70 (BD 564455, 1:100), BV421 anti-mouse NK-1.1 clone PK136 (BioLegend 108741, 1:100), PE anti-mouse CD11c clone N418 (BioLegend 117307, 1:100), PE/Cy5 anti-mouse F4/80 clone BM8 (BioLegend 123111, 1:100), BV650 anti-mouse Ly-6G clone 1A8 (BioLegend 127641) and BV510 anti-mouse I-A/I-E clone clone M5/114.15.2 (BioLegend 107636, 1:200).
Mice model generation
The generation of C57BL/6 MlklK219R animals was conducted in the Walter and Eliza Hall Institute of Medical Research (WEHI). Cas9 mRNA together with the ssDNA repair oligo and the sgRNA targeting the region surrounding K219 of the murine Mlkl gene was microinjected into the pro-nucleus of fertilised oocytes obtained from C57BL/6 mice. The injected embryos were transferred to foster mothers and allowed to develop to term. Mutations in the genome of progeny were determined by analysis of genomic DNA and sequencing. The sequence of the ssDNA oligo used as a repair template for the MlklK219R can be obtained upon request. MlklK219R animals were back-crossed to C57BL/6 mice for at least two generations prior analysis. Mlkl−/− mouse line was a kind gift from Prof. Henning Walczak. Mice were kept according to the UK Home Office regulations. In vivo experiments were conducted according to institutional, national and European animal regulations. Animal protocols were approved by the Ethics Committee of The Institute of Cancer Research.
Treatment and histological specimen preparation
All animal procedures were conducted within the guidelines of UK Home Office in accordance with the revised (2013) Animals (Scientific Procedures) Act (ASPA) and the institutional guidelines of The Institute of Cancer Research. The Animal Welfare Ethical Review Body (AWERB) reviewed the protocols within the project license. For the skin injection experiments, mice were injected subcutaneously in the flank region with 100 μl of a solution containing 3 mM ASTX660 and 1 mM emricasan. A solution of 12.5% captisol was used as a vehicle. MlklK219R and MlklWT and Mlkl−/− mice were injected with vehicle control or with ASTX660 and emricasan. On day 3 post injection, mice were culled and regions of injection were macroscopically assessed. After sacrificing the animals, the fur in the area of lesion and surrounding region was removed post-mortem with hair removal cream. A biopsy of the skin containing the affected area, as well as the lesion boundaries with inclusion of healthy-looking skin (~1.5 cm) was obtained. The skin was fixed in 10% neutral buffered formalin for 24 h, processed (using Sakura tissue processor) and paraffin embedded according to local SOP. A 3 µm thick sections revealing epidermal, dermal and subcutaneous layers were stained with haematoxylin and eosin (H&E) to visualise general tissue morphology. For in vivo study with RIPK1 inhibitor, mice were fed on normal chow (repelleted purina chow 5001, Resesarch Diets) or purina chow 5001 containing RIPK1i (GSK′547 at 0.83 g RIPK1i/Kg chow targeting a dose of ~100 mg/Kg/day, Research Diets)50 beginning seven days before the experiment was performed, as described above.
Splenocyte preparation and flow cytometry
To isolate splenocytes, mouse spleens were mashed through a cell strainer into a Falcon tube using the plunger end of a syringe and collected in 3 ml cold RPMI/10% foetal bovine serum (FBS). After centrifugation, pellets were resuspended in 1 ml 1× red blood cell lysis buffer (eBioscience, 00-4333-57) and incubated for 5 min at room temperature. Cells were washed twice in staining buffer (PBS/5% FBS) and counted. A total of 3 × 106 splenocytes were stained for each sample. Cells were resuspended in 40 µl of cold staining buffer containing Viability Dye and incubated for 10 min at room temperature. Cells were washed twice and resuspended in 40 µl of staining buffer containing the desired antibodies. Cells were kept on ice for 30 min. After two washes, cells were fixed in 150 µl 2% PFA for 20 min on ice, washed twice and resuspended in staining buffer. Cells were analysed the next day on a BD LSR II flow cytometer.
Tissue culture
MDFs, HT-29, L929, NIH3T3 cells (used for MCMV viral titration) and HEK293T (used for lentivirus production) were cultured in Dulbecco’s modified Eagle’s Medium (DMEM). All media were supplemented with 10% FBS and penicillin and streptomycin, under 10% CO2. Immortalised WT and Mlkl−/− MDFs were a kind gift from John Silke.
Isolation of primary cells
To generate BMDMs, the bone marrow from tibias and femurs of MlklK219R/K219R and MlklWT/WT mice were extracted by placing a needle into the bone and flushing some media with a syringe. After spinning the cells at 160 × g for 5 min, cells were seeded in non-coated petri dishes and cultured for 6 days in DMEM + 10% FBS supplemented with cytokine recombinant murine M-CSF (10 ng/ml). Primary MDF cells were isolated from the tail of littermate adult mice (6–8-week-old) harbouring MlklK219R/K219R and MlklWT/WT genotypes. To this end, the entire tail of the mouse was cut and placed in a dish containing ethanol for 1 min. A longitudinal incision of 5 mm was made at the top part of the tail and the skin was peeled off using thin tweezers. The tip of the tail was discarded and the skin was placed in a 10 cm dish containing 10 ml DMEM + 10% FBS + Pen/Strep. The skin of the tail was then chopped in small pieces (2 mm) and the pieces were collected in a 15 ml falcon tube. The tube was spin at 160 × g for 3 min at 4 °C. The media was removed and 10 ml of PBS was added. The tube was gently rocked for five times and then centrifuged at 160 × g for 3 min at 4 °C. The PBS was discarded and 3 ml of ice-cold trypsin + EDTA (Sigma) was added and incubated for 45 min at 37 °C. Following incubation, 6 ml of media was added and the tube was shaken vigorously (30×). The resuspended skin was filtered through a 100 μm strainer in a 50 ml falcon tube. The strained media containing the MDFs was placed in a 10 cm dish and incubated at 37 °C, 5% CO2. A couple of days later, MDFs were immortalised with pBABE SV40 (large T antigen Δ89-97-missing Bub1).
Constructs and transfections
Murine Mlkl constructs with the following mutations MlklS345D, MlklS345A, MlklK219M, MlklK219R, MlklK172R, MlklK51R, MlklK77R, MlklK51R,K77R, MlklK51R,K77R,K219R, MlklK51R,K77R,K219R,K172R and MlklK219R,S345D were generated and cloned into pTRIPZ plasmid. Lentiviral supernatants were produced and Mlkl−/− MDFs were infected, as described previously51. The information regarding the primers used in this study are supplied as a Supplementary Table. MlklN-FLAG lentiviral construct was a kind gift from John Silke. DNA dynamo software was used to verify the mutations of interest.
Cell death assay
A total of 2.5 × 104 BMDMs, 6 × 103 MDFs, 6 × 103 L929 cells and 8 × 103 HT-29 cells were seeded in 96-well plates and 24 h later were treated as indicated for the indicated times. Hoechst (0.5 μg/ml) and PI (1 μg/ml) were added and the % of dead cells was measured, using the Celigo S Cell Imaging Cytometer (Nexcelom Bioscience).
Generation of CRISPR Cells
Guide RNA for mRIPK3 and mPeli1 were designed using the following website tools, https://crispr.mit.edu and http://crispor.tefor.net, respectively. sgRNAs were cloned into pLenti-CRISPR-EGFP plasmid (kind gift from B.C. Bornhauser, Addgene #75159). WT MDFs were transfected with the plasmids using Viromer YELLOW transfection reagent (OriGene). Seventy-two hours after transfection GFP-positive clones were FACS sorted and single clones were screened for RIPK3 gene knockout. For Peli-1 deletion, a pool of cells was used instead of single clones. The indel efficiency for Peli-1 pools was calculated with the following website tool, https://www.synthego.com. RIPK3 sgRNA target sequence: GAGGGTTCGGAGTCGTGTTC, Peli-1 sgRNA1: CTTGTGATGCATCCACGTAA and Peli-1 sgRNA2: TCTCTCCCAAACGGTGATAG.
MCMV virus infections and determination of viral titres
Viral titres were determined by plaque assays performed on NIH3T3 fibroblasts. Viral growth in vitro was determined by infection of indicated cell lines at a multiplicity of infection (MOI) of 5 PFU per cell to measure single-step growth kinetics. Viruses were adsorbed for 2 h at 37 °C in a volume of 0.4 ml. Cells and supernatants for quantitation were harvested at indicated times post infection, and frozen at −80 °C. Samples were subjected to one round of freeze/thaw, and virus quantitated by plaque assay on NIH3T3 fibroblasts, as previously described13.
Cell viability assay following MCMV infection
Cell viability assay was performed as previously described13, using Promega CellTiter-Glo kit at 18–22 h post infection.
Western blot
Cells used for expression analyses were washed with ice-cold PBS and lysed using DISC lysis buffer (1 M Tris pH 7.8, 5 M NaCl, 0.5 M EDTA, 40% glycerol and 1% Triton X-100) containing protease inhibitor cocktail and phosphatase inhibitors. Cells were scraped using cell scrapers and lysates were cleared by centrifugation at 4 °C and 20,817 × g for 15 min. Protein concentrations were determined using a BioRad protein Bradford assay in accordance with the manufacturer’s instructions. After protein concentration was determined, 6× loading die (3 ml 20% SDS, 4 ml 100% glycerol, 3 ml β-ME and 1 g bromophenol blue) was added to 100 μg of protein diluted in a total volume of 100 μl. Samples were boiled at 100 °C for 10 min and then resolved by NuPAGE Novex 4–12% Bis-Tris 1.0 mm gels in MOPS buffer (ThermoFisher). After transfer onto polyvinylidene difluoride (PVDF), membranes were blocked with 5% BSA and then probed with antibodies as indicated. ImageJ software was used for protein bands quantification.
MLKL oligomerization assay (non-reducing SDS–PAGE)
The assay to visualise oligomeric forms of MLKL was performed, as previously described9,21. Briefly, cells of a 10-cm dish were washed with ice-cold PBS and lysed in DISC lysis buffer containing protease inhibitor cocktail and phosphatase inhibitors. For non-reducing conditions, β-ME was removed from the 6× loading die and samples were directly loaded into the gel.
Ubiquitin pulldown
Following treatment according to the experimental procedures, cells were washed with ice-cold PBS and lysed using DISC lysis buffer supplemented with protease and phosphatase inhibitors, 1 mM DTT, PR-619 (10 μM) and GST-TUBE52 (50 μg/ml; 50 μg TUBE/mg protein lysate). Cells were scraped using cell scrapers and lysates were cleared by centrifugation at 4 °C and 20,817 × g for 15 min. A total of 20 μl GSH beads were added to each sample and immunoprecipitations were performed o/n. Beads were washed four times in washing buffer (PBS 1% Triton X-100, PBS-Tx) supplemented with 10 μM PR-619 and bound proteins eluted by boiling in 60 μl 1× SDS loading dye. When USP21 DUB digestion was performed, each sample was split in two after the fourth wash. A total of 2 μM of USP21 in 20 μl of 1× DUB digestion buffer (10× buffer: 500 mM Tris (pH 7.5), 500 mM NaCl and 50 mM DTT) was added to the dried beads and digestion was performed for 1 h at 37 °C. For the TUBE experiments were MLKL oligomerization is shown, the TUBE pulldown was performed as described above, but without the DTT supplementation in the lysis buffer. In this case, proteins were eluted in non-reducing loading dye9 (3 ml 20% SDS, 4 ml 100% glycerol, 3 ml H2O and 1 g bromophenol blue). For K48-specific Ub pulldown, 20 μl protein A/G beads were preincubated with 1.5 μl of α-K48-specific Ub antibody. As a control α-V5 tag antibody was utilised. For K63-linked and M1-linked chains specific ubiquitin tools were utilised. To isolate K63-linked ubiquitin chains, the UIM domains of RAP80 were engineered in tandem (three UIMs)53. To isolate M1-linked polyubiquitin chains, a Met1-linkage-specific Ub-binder (M1-SUB) was utilised54,55. For the K63-linked Ub pulldown 20 μl streptavidin beads were preincubated with 4 μg K63 UIM recombinant protein or K63 UIM Mutant as a control. For the M1-linkage-specific ubiquitin pulldown 20 μl of GSH beads were mixed with 28.5 μg of M1-SUB or GST control. In all cases, beads were preincubated for 2 h at 4 °C. Following preincubation, equal amounts of clarified lysate were added to the beads and immunoprecipitation was performed o/n.
Proximity ligation assay
PLA was performed according to the manufacturer’s protocol using the Duolink Detection Kit (Sigma, DUO92014). Cells were examined with a confocal microscope (objective ×40, Zeiss LSM 710).
Cellular fractionation with Triton X-114
Cellular fractionation with Triton X-114 was performed, as previously described23. Briefly, cells of a 15-cm dish were washed with ice-cold PBS and scraped using 0.5 ml Triton X-114 lysis buffer (20 mM HEPES, pH 7.4, 150 mM NaCl and 2% Triton X-114) supplemented with protease inhibitor cocktail and phosphatase inhibitors. The cell lysate was centrifuged at 15,000 × g for 10 min at 4 °C. The supernatant was then harvested as the detergent-soluble fraction. This fraction was warmed at 30 °C for 3 min and subjected to centrifugation at 1500 × g for 5 min at RT. The aqueous layer was collected and recentrifuged at 1500 × g for 5 min at RT to remove the contamination from the detergent-soluble layer and kept as the cytoplasmic fraction (C). The detergent-enriched layer was diluted with basal buffer (20 mM HEPES, pH 7.4 and 150 mM NaCl) and recentrifuged at 1500 × g for 5 min at RT. The washed detergent-enriched layer was diluted with the basal buffer to the same volume as the cytoplasmic fraction and saved as the membrane-enriched fraction (M). Samples fractionated by this method were subjected to downstream processing including ubiquitin pulldown, SDS–PAGE and immunoblotting.
Blue native PAGE
For BN-PAGE cells were fractionated into cytoplasmic and membrane fractions, as previously described11,56. Briefly, cells are initially permeabilised using a buffer containing 0.025% digitonin (20 mM HEPES, pH 7.5, 100 mM KCl, 2.5 mM MgCl2, 100 mM sucrose, 0.025% digitonin and 2 μM N-ethylmaleimide). Cytosolic and crude membrane fraction were separated via centrifugation at 11,000 × g for 5 min at 4 °C. The cytosolic fraction (top fraction) was further solubilized in permeabilization buffer and digitonin was added to achieve a final concentration of 1% wt/vol. The detergent fraction (bottom fraction) was further permeabilized by adding permeabilization buffer containing 1% wt/vol of digitonin and clarified by centrifugation. Fractions were resolved by 4–16% Bis-Tris native PAGE gel (ThermoFisher) and then transferred onto PVDF for western blot analyses. Following transfer, PVDF membranes were de-stained by washing three times with 40% methanol, 10% acetic acid for 5 min/wash. Prior to immunoblotting, proteins were denatured by soaking the PVDF membrane in 6 M guanidine hydrochloride, 10 mM Tris·HCl pH 7.5 and 5 mM β-ME for 2 h at RT.
Thermal shift assay
Thermal shift assays were performed as described previously8,57–59, using a Rotor-Gene Q PCR (QIAGEN). Recombinant mouse MLKL pseudokinase domain (residues 179-464; WT or K219R) was diluted in 150 mM NaCl, 20 mM Tris pH 8.0, 1 mM DTT to a final concentration of 2.5 μM and assayed in the presence of up to 1 mM ATP in a total reaction volume of 25 μL. SYPRO Orange (Molecular Probes) was used as the fluorescence probe and detected at 550 nm.
Mass spectrometry sample preparation
Briefly, MDFs were treated with TNF (10 ng/ml), SM-164 (100 nM) and z-VAD-FMK (20 μM; TSZ) for 2 h, or left untreated and lysed in denaturing lysis buffer (8 M urea, 50 mM Tris pH 8, 50 mM NaCl and 5.5 mM chloroacetamide (ChloroAA)) supplemented with protease inhibitors and phosphatase inhibitor, and the lysate was incubated 20 min on ice. Samples were sonicated and clarified by centrifugation at 20,817 × g for 15 min at 4 °C. Protein concentration was quantified using Bradford protein assay (BioRad) and 20 mg of protein per sample was used as total starting material. Protein was precipitated by adding chloroform and methanol to the lysates. Briefly, lysates were mixed with 4× volumes of 100% methanol and vortexed. Next, 1× volume of chloroform was added to the samples followed by 3× volumes of HPLC H2O. Proteins were precipitated by centrifugation at 7431 × g at RT for 15 min. The pellet was washed by adding 100% methanol and swirling the tube multiple times. A total of three washes with methanol was performed and samples were centrifuged at 7431 × g for 3 min at RT between washes. During the last wash step, the pellet was vortexed for a couple of seconds in methanol to break it into small pieces. The methanol was carefully aspirated and the protein precipitate was re-dissolved in 7 ml denaturation buffer (6 M urea, 2 M thiourea and 50 mM Tris, pH 8). Samples were reduced by adding DTT to a final concentration of 1 mM and incubated 1 h at RT with rotation. ChloroAA (Sigma-Aldrich) was added to a final concentration of 5 mM and samples were incubated for 1 h at RT in the dark with rotation. Proteins were subsequently digested by adding 40 μg of Lysyl Endopeptidase Mass Spectrometry Grade (Lys-C; Alpha Labs), for 4 h. Subsequently, four volumes (28 ml) of 25 mM TRIS, pH 8 was added to the samples and they were subsequently digested by addition of with 100 μg of trypsin (Roche, 11418475001) and o/n incubation at RT with rotation. Digestion was stopped by adding trifluoroacetic acid (TFA) to a final concentration of 0.5% (1.75 ml of 10% TFA). Samples were incubated for 10 min at RT. Following digestion, peptides were desalted using Sep-Pak Vac tC18 cartridges (Waters). Briefly, cartridges were activated with 9 ml of acetonitrile (ACN, Fisher Scientific). The column was then equilibrated with 10 ml of 0.1% TFA and peptides were loaded into the column. Peptides were washed and desalted using 12 ml of 0.1% TFA and eluted with 5 ml of 50% ACN/0.1%TFA into a 12-ml Duran glass tube (Fisher Scientific). The eluate was frozen in liquid nitrogen and the peptides were dried in a freeze dryer. After drying was finished, dried peptides were collected at the bottom of the tube by centrifugation at 1646 × g 5 min at RT.
Immunoprecipitation of di-Gly containing peptides
Immunoprecipitation of di-Gly peptides was performed as previously described60, albeit with some modifications. Lyophilised peptides from 20 mg of digested proteins were resuspended in 1.3 ml of 1× IAP buffer (50 mM MOPS pH 7.4, 10 mM Na2HPO4 and 50 mM NaCl) by carefully pipetting up and down. The pH was adjusted to 7 by adding 30–90 μl 1 M Tris pH 10 to facilitate peptide resuspension. The resuspended peptides were centrifuged at 20,817 × g for 8 min at 4 °C to remove any insoluble material. The resuspended peptides were incubated with 40 μl of α-di-Gly antibody beads (Cell Signalling) previously washed three times with 750 μl of cold 1× IAP buffer. Immunoprecipitation was performed for 2.5 h at 4 °C with rotation. Following the immunoprecipitation, samples were centrifuged at 2700 × g for 1.5 min at 4 °C and the supernatant was removed. The beads were washed twice with 750 μl cold MilliQ H20. After the second wash, the beads were resuspended in 100 μl cold MilliQ H20 and placed in a Pierce Spin column placed in a 1.5 ml tube. The columns were spin at 2700 × g, 1.5 min at 4 °C to dry the beads and then they were transferred to a fresh 1.5 ml tube. Di-Gly peptides were eluted by addition of 80 μl of 0.15% TFA followed by centrifugation at 2700 × g for 1.5 min at 4 °C. A second elution was performed by adding another 80 μl of 0.15% TFA to the beads in the column and spin at 2700 × g for 1.5 min at 4 °C into the same tube as the first elution.
TMT labelling
The six samples from the di-Gly immunoprecipitation were labelled by TMT10plex Isobaric Mass Tag Labelling Reagents Set (ThermoFisher), according to manufacturer’s instructions. The six samples were combined in a new centrifuge tube and the labelled peptide sample was dried in SpeedVac.
LC–MS/MS analysis for di-Gly immunoprecipitation
The dried peptide mixture was resuspended in 0.1% NH4OH/100% H2O, and fractionated on an XBridge BEH C18 column (2.1 mm i.d. × 150 mm, Waters) with an initial 5 min loading then linear gradient from 5% ACN/0.1% NH4OH (pH 10) to 35% CH3CN/0.1% NH4OH in 30 min, then to 80% CH3CN/0.1% NH4OH in 5 min and stayed for another 5 min. The flow rate was at 200 µl/min. Fractions were collected ay every 30 s to a 96-well plate by column from retention time at 3–45 min, and then pooled by rows to eight concatenated fractions and dried in SpeedVac. The peptides were reconstituted in 20 µl of 0.1% FA/H2O and then injected for online LC–MS/MS analysis on the Orbitraip Fusion Lumos hybrid mass spectrometer coupled with an Ultimate 3000 RSLCnano UPLC system (both from ThermoFisher). Samples were first loaded and desalted on a PepMap C18 nano trap (100 µm i.d. × 20 mm, 100 Å, 5 µl) then peptides were separated on a PepMap C18 column (75 µm i.d. × 500 mm, 2 µm) over a linear gradient of 8–32% CH3CN/0.1% FA in 90 min, cycle time at 120 min at a flow rate at 300 nl/min. The MS acquisition used MS3 level quantification with synchronous precursor selection (SPS) with the top speed 3 s cycle time. Briefly, the Orbitrap full MS survey scan was m/z 375–1500 with the resolution 120,000 at m/z 200, with AGC set at 4e5 and 50 ms maximum injection time. Multiply charged ions (z = 2–5) with intensity threshold at 1e4 were fragmented in ion trap at 35% collision energy, with AGC at 1e4 and 50 ms maximum injection time, and isolation width at 0.7 Da in quadrupole. The top five MS2 fragment ions were SPS selected with the isolation width at 0.7 Da, and fragmented in HCD at 65% NCE, and detected in the Orbitrap to get the report ions’ intensities at a better accuracy.
The raw files were processed with Proteome Discoverer 2.2 (ThermoFisher), using both SequestHT and Mascot (V2.3) search engines to search against the reviewed Uniprot protein database of Mus musculus (2018) plus the crap database. The precursor mass tolerance was set at 25 p.p.m. and the fragment ion mass tolerance was set at 0.5 Da. Spectra were searched for fully tryptic peptides with maximum two miss-cleavages. Carbamidomethyl (C) and TMT6plex (peptide N-terminus) were set as static modifications, and the dynamic modifications included deamidation (N, Q), oxidation (M) and TMT6plex (K, GlyGlyK). Peptides were validated by percolator with q value set at 0.05 for the Decoy database search. The search result was filtered by the consensus step, where the protein FDR was set at 0.01 (strict) and 0.05 (relaxed). The TMT10plex reporter ion quantifier used 20 p.p.m. integration tolerance on the most confident centroid peak at the MS3 level. Both unique and razor peptides were used for quantification. Peptides with average reported S/N > 3 were used for protein quantification. Only master proteins were reported.
LC–MS/MS statistical analysis
To calculate the fold change in di-Gly peptide abundance, the data were first transformed to log base 2. This transformation normalises the data and allows for analysis using parametric statistical tests. To determine the statistical significance, the normalised abundance of di-Gly peptides were analysed via an unpaired, two-tailed Student’s t test using Perseus Software. Statistical significance is indicated via a volcano plot generated with Perseus Software, where the p value and the difference in peptide abundance is represented. For this analysis, the three replicates were taken into consideration.
Structural predictions of mutations
To predict the effect of mutating K219, Pymol Software (https://www.pymol.org) was utilised on the resolved structure of mMLKL (PBD: 4BTF)8.
Molecular dynamics simulations
We performed all-atom MD simulations starting from three different MLKL constructs: unmodified MLKL (WT), MLKL phosphorylated at S345 (S345phos), and MLKL monoubiquitylated at K219 and phosphorylated at S345 (K219ub S345phos). All three constructs were built from the crystal structure of mMLKL (PBD: 4BTF)8. There were three missing loops and a missing C-terminus in the crystal structure. Modeller was used to build in these missing residues so that all 464 residues of mMLKL were present in the structures used for MD simulations61. Missing residues 81–91 were modelled as a helix. We prepared the phosphorylated MLKL structures by modifying the PDB file manually to change the residue name from SER to SEP. We used previously published parameters to simulate the phosphorylated serine in Amber62,63. We prepared the ubiquitylated MLKL structure using a crystal structure of diUb, 3NS8 [75], as in refs. 43,64.
All simulations were run with Amber 18 using the Amber ff99sb forcefield65, and the CUDA version of pmemd in Amber 18 was used to run the simulations on GPUs66. All simulations were solvated with TIP3P-FB water such that the edge of the box was at least 16 Å away from the protein before equilibration67. Ions were added to neutralise the system: three chloride ions for the WT and K219ub S345phos simulations and one chloride ion for the S345phos simulations. All systems were subject to two rounds of energy minimisation of 1000 steps, where the first 500 steps were steepest descent and the second 500 steps conjugate gradient in both cases. The systems were then subject to heating from 100 to 300 K in the NVT ensemble (40 ps with harmonic restraints on the protein with a force constant of 10 kcal/mol), and two rounds of equilibration in the NPT ensemble (50 ps with harmonic restraints on the protein with a force constant of 10 kcal/mol and the Berendsen barostat, and 200 ps without restraints using a Monte Carlo barostat). Ten independent production simulations for each construct were then started with new random velocities. Bonds to hydrogen were constrained using the SHAKE algorithm during all simulations. The particle-mesh Ewald procedure was used to handle long-range electrostatic interactions with a non-bonded cut off of 9 Å for the direct space sum. Production simulations were run in the NPT ensemble at 300 K, using Langevin dynamics with a collision frequency of 1.0 ps−1, and 1.013 bar, using a Monte Carlo barostat with 100 steps between volume change attempts, with an integration step every 2 fs and coordinates stored every 10 ps. Each production simulation was run for 1 μs, for a total of 10 μs of simulation time for each construct.
We analysed the MD trajectories using the cpptraj module of Amber 18 tools66 and in-house python scripts. All histograms were computed by combining all independent simulations for a given construct (snapshots spaced every 10 ps) and binning over this total ensemble of structures. To determine p values comparing the distribution of various structural metrics for different constructs, we treated the mean value from each of the ten independent simulations as a single data point and used a permutation test with 1,000,000 permutations. Protein structure figures were created using VMD68.
Histopathological assessment of murine skin samples
For the purpose of histopathological sample analysis, skin sections were scanned at ×40 (0.23 μm/pixel), using a NanoZoomer-XR Hamamatsu Photonics (Japan). The analysis of digitised skin samples involved assessment of the vicissitudes in epidermal and dermal region of the skin identifiable on H&E-stained samples.
First, a HLS (multivariate) was used to assess the proportion and severity of histopathological changes. This assessment was performed on the entire length of the skin sample (epidermal and immediate dermal level). In order to increase precision of the assessment, each sample was divided using a grid with equal size of fields of view (FOV) (0.04 mm2/800 μm perimeter; Fig. 7i). Each FOV was assessed for presence of regular epidermis or any pathological changes to regular epidermis and dermis. A final calculation took into account the proportion [%] of given skin lesions within each sample, multiplied by a power score ranging from 0 to 4. Score 0 was associated with regular epidermis with no changes to any of the strata. Score 1 with thickening of the epidermis represented by any of the strata. Score 2 with epidermal erosion (partial loss of the epidermis), with the stratum basale left intact. Score 3 with ulcer-loss of epidermis, including the stratum basale. Score 4 with ulceration and dermal/hypodermal fibrosis. The final score (HLS) indicates the severity following the formula: [(0 × % Score 0) + (1 × % Score 1) + (2 × % Score 2) + (3 × % Score 3) + (4 × % Score 4)]. The lowest possible HLS is ‘0’ which is equal to 100% of normal/regular epidermis in the whole sample, and a maximum HLS of ‘400’ equal to 100% of deep ulceration. Supplementary Fig. 5a shows additional detail. NDP.view2 software was used for image visualisation.
Statistical analysis
Graphs and statistical analysis were performed using GraphPad Prism V7.0. The statistical analysis performed for each dataset is described in the correspondent figure legend.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
Supplementary information
Acknowledgements
The authors are indebted to J. Silke, H. Walczak, D. Komander, B.C. Bornhauser, M. Gyrd-Hansen, P. Jat, N. Mailand and S. Wang for reagents. We thank the WEHI MAGEC Facility for the generation of the knock-in mouse. K.A.B. thanks Michael Donnelly for computational support. K.A.B. thanks the MERCURY Consortium for mentoring support. We also thank members of the Meier lab for helpful discussions. Work in the Meier lab is funded by Breast Cancer Now as part of Programme Funding to the Breast Cancer Now Toby Robins Research Centre (CTR-QR14-007) and postgraduate studentships from Cancer Research UK (CRUK; CRM089X). We thank the Breast Cancer Now Toby Robins Research Centre Nina Barough Pathology Core Facility for pathology support. J.W.U. is supported by NIH AI135709, and J.M.M. is funded by NHMRC fellowship (1105754 and 1172929), project (1124735) and IRIISS (9000587) support and the Victorian Government Operational Infrastructure Support scheme. This work was supported by National Science Foundation (https://www.nsf.gov/) award MCB-1852677 to K.A.B. We acknowledge NHS funding to the NIHR Biomedical Research Centre.
Source data
Author contributions
L.R.G., K.A.B., J.W.U. and P.M. designed the research and wrote the paper. L.R.G. performed and analysed experiments in Figs. 1, 2, 3b, d, 4, 5a–d, 6a–d and Supplementary Figs. 1, 2, 3b, c, 4, 8. L.R.G. also generated the figures. T.T, R.N. and W.F. designed and performed experiments in Fig. 7 and Supplementary Fig. 7, and assisted with data analysis and experimental design. R.O.H. designed and performed experiments in Fig. 6e, f. G.L. designed, performed and analysed experiments in Fig. 3a. S.W.J. performed experiment in Fig. 3c, Supplementary Fig. 5b and assisted with cloning. A.A. assisted with the experimental design and the preparation of MDFs and BMDMs. L.Y. run and analysed the mass spec samples in Fig. 4a. N.G. assisted with histology tissue processing. H.K. assisted with CRISPR-mediated knockout in Supplementary Fig. 8. M.P. and J.S.C. assisted with data analysis in Fig. 4a. S.N.Y., C.F., L.-Y.L., I.S.L. and J.M.M. designed, performed and analysed experiment in Supplementary Fig. 3a. J.M.M. also contributed to the manuscript review. A.K. designed the strategy and generated the knock-in mouse. I.R. and P.G. assisted with analysis of the histological tissue sections. K.A.B. designed and performed experiments in Fig. 5e–j and Supplementary Fig. 3d, e. M.S, T.S. and G.W. advised on the in vivo application of ASTX660 compound. J.B., A.M.B. and B.G. developed the chow-containing RIPK1i (GSK′547).
Data availability
The mass spectrometry proteomics data (corresponding to Fig. 4a) that support the findings of this study have been deposited in the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD018857. All unique biological materials used are available upon reasonable request. Source data are provided with this paper.
Competing interests
The authors declare no competing interests.
Footnotes
Peer review information Nature Communications thanks Dragana Lagundžin, Tudor Moldoveanu, and other, anonymous, reviewers for their contributions to the peer review of this work. Peer review reports are available.
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Laura Ramos Garcia, Email: Laura.ramosgarcia@icr.ac.uk.
Tomoko Smyth, Email: tomoko.smyth@astx.com.
Pascal Meier, Email: pmeier@icr.ac.uk.
Supplementary information
The online version contains supplementary material available at 10.1038/s41467-021-23474-5.
References
- 1.Nailwal H, Chan FK. Necroptosis in anti-viral inflammation. Cell Death Differ. 2019;26:4–13. doi: 10.1038/s41418-018-0172-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Yatim N, Cullen S, Albert ML. Dying cells actively regulate adaptive immune responses. Nat. Rev. Immunol. 2017;17:262–275. doi: 10.1038/nri.2017.9. [DOI] [PubMed] [Google Scholar]
- 3.Pasparakis M, Vandenabeele P. Necroptosis and its role in inflammation. Nature. 2015;517:311–320. doi: 10.1038/nature14191. [DOI] [PubMed] [Google Scholar]
- 4.Matthay MA, Ware LB, Zimmerman GA. The acute respiratory distress syndrome. J. Clin. Investig. 2012;122:2731–2740. doi: 10.1172/JCI60331. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Yuan J, Amin P, Ofengeim D. Necroptosis and RIPK1-mediated neuroinflammation in CNS diseases. Nat. Rev. Neurosci. 2019;20:19–33. doi: 10.1038/s41583-018-0093-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Newton K, Manning G. Necroptosis and Inflammation. Annu. Rev. Biochem. 2016;85:743–763. doi: 10.1146/annurev-biochem-060815-014830. [DOI] [PubMed] [Google Scholar]
- 7.Vanlangenakker N, Vanden Berghe T, Vandenabeele P. Many stimuli pull the necrotic trigger, an overview. Cell Death Differ. 2012;19:75–86. doi: 10.1038/cdd.2011.164. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Murphy JM, et al. The pseudokinase MLKL mediates necroptosis via a molecular switch mechanism. Immunity. 2013;39:443–453. doi: 10.1016/j.immuni.2013.06.018. [DOI] [PubMed] [Google Scholar]
- 9.Cai Z, et al. Plasma membrane translocation of trimerized MLKL protein is required for TNF-induced necroptosis. Nat. Cell Biol. 2014;16:55–65. doi: 10.1038/ncb2883. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Chen X, et al. Translocation of mixed lineage kinase domain-like protein to plasma membrane leads to necrotic cell death. Cell Res. 2014;24:105–121. doi: 10.1038/cr.2013.171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Hildebrand JM, et al. Activation of the pseudokinase MLKL unleashes the four-helix bundle domain to induce membrane localization and necroptotic cell death. Proc. Natl Acad. Sci. USA. 2014;111:15072–15077. doi: 10.1073/pnas.1408987111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Schwarzer R, Laurien L, Pasparakis M. New insights into the regulation of apoptosis, necroptosis, and pyroptosis by receptor interacting protein kinase 1 and caspase-8. Curr. Opin. Cell Biol. 2020;63:186–193. doi: 10.1016/j.ceb.2020.02.004. [DOI] [PubMed] [Google Scholar]
- 13.Upton JW, Kaiser WJ, Mocarski ES. Virus inhibition of RIP3-dependent necrosis. Cell Host Microbe. 2010;7:302–313. doi: 10.1016/j.chom.2010.03.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Upton JW, Kaiser WJ, Mocarski ES. DAI/ZBP1/DLM-1 complexes with RIP3 to mediate virus-induced programmed necrosis that is targeted by murine cytomegalovirus vIRA. Cell Host Microbe. 2012;11:290–297. doi: 10.1016/j.chom.2012.01.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Degterev A, et al. Chemical inhibitor of nonapoptotic cell death with therapeutic potential for ischemic brain injury. Nat. Chem. Biol. 2005;1:112–119. doi: 10.1038/nchembio711. [DOI] [PubMed] [Google Scholar]
- 16.Peltzer, N., Darding, M. & Walczak, H. Holding RIPK1 on the ubiquitin leash in TNFR1 signaling. Trends Cell Biol.26, 445–461 (2016). [DOI] [PubMed]
- 17.Quarato G, et al. Sequential engagement of distinct MLKL phosphatidylinositol-binding sites executes necroptosis. Mol. Cell. 2016;61:589–601. doi: 10.1016/j.molcel.2016.01.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Rodriguez, D. A. et al. Characterization of RIPK3-mediated phosphorylation of the activation loop of MLKL during necroptosis. Cell Death Differ.23, 76–88 (2015). [DOI] [PMC free article] [PubMed]
- 19.Petrie EJ, et al. Conformational switching of the pseudokinase domain promotes human MLKL tetramerization and cell death by necroptosis. Nat. Commun. 2018;9:2422. doi: 10.1038/s41467-018-04714-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Davies, K. A. et al. The brace helices of MLKL mediate interdomain communication and oligomerisation to regulate cell death by necroptosis. Cell Death Differ.25, 1567–1580 (2018). [DOI] [PMC free article] [PubMed]
- 21.Liu S, et al. MLKL forms disulfide bond-dependent amyloid-like polymers to induce necroptosis. Proc. Natl Acad. Sci. USA. 2017;114:E7450–e7459. doi: 10.1073/pnas.1707531114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Cai Z, Liu ZG. Detection of MLKL oligomerization during programmed necrosis. Methods Mol. Biol. 2018;1857:85–92. doi: 10.1007/978-1-4939-8754-2_8. [DOI] [PubMed] [Google Scholar]
- 23.Wang H, et al. Mixed lineage kinase domain-like protein MLKL causes necrotic membrane disruption upon phosphorylation by RIP3. Mol. Cell. 2014;54:133–146. doi: 10.1016/j.molcel.2014.03.003. [DOI] [PubMed] [Google Scholar]
- 24.Sun L, et al. Mixed lineage kinase domain-like protein mediates necrosis signaling downstream of RIP3 kinase. Cell. 2012;148:213–227. doi: 10.1016/j.cell.2011.11.031. [DOI] [PubMed] [Google Scholar]
- 25.Samson AL, et al. MLKL trafficking and accumulation at the plasma membrane control the kinetics and threshold for necroptosis. Nat. Commun. 2020;11:3151. doi: 10.1038/s41467-020-16887-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Akimov V, et al. UbiSite approach for comprehensive mapping of lysine and N-terminal ubiquitination sites. Nat. Struct. Mol. Biol. 2018;25:631–640. doi: 10.1038/s41594-018-0084-y. [DOI] [PubMed] [Google Scholar]
- 27.Mocarski ES, Guo H, Kaiser WJ. Necroptosis: the Trojan horse in cell autonomous antiviral host defense. Virology. 2015;479-480:160–166. doi: 10.1016/j.virol.2015.03.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Maelfait J, et al. Sensing of viral and endogenous RNA by ZBP1/DAI induces necroptosis. EMBO J. 2017;36:2529–2543. doi: 10.15252/embj.201796476. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Anderton H, Rickard JA, Varigos GA, Lalaoui N, Silke J. Inhibitor of apoptosis proteins (IAPs) limit RIPK1-mediated skin inflammation. J. Investig. Dermatol. 2017;137:2371–2379. doi: 10.1016/j.jid.2017.05.031. [DOI] [PubMed] [Google Scholar]
- 30.Pearson, J. S. & Murphy, J. M. Down the rabbit hole: is necroptosis truly an innate response to infection? Cell. Microbiol.19, e12750 (2017). [DOI] [PubMed]
- 31.Balachandran, S. & Rall, G. F. The benefits and perils of necroptosis in influenza infection. J. Virol.94, e01101–e01119 (2020). [DOI] [PMC free article] [PubMed]
- 32.Newton K, et al. RIPK1 inhibits ZBP1-driven necroptosis during development. Nature. 2016;540:129–133. doi: 10.1038/nature20559. [DOI] [PubMed] [Google Scholar]
- 33.Lin J, et al. RIPK1 counteracts ZBP1-mediated necroptosis to inhibit inflammation. Nature. 2016;540:124–128. doi: 10.1038/nature20558. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Hildebrand JM, et al. A missense mutation in the MLKL brace region promotes lethal neonatal inflammation and hematopoietic dysfunction. Nat. Commun. 2020;11:3150. doi: 10.1038/s41467-020-16819-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Lewis J, et al. Disruption of hsp90 function results in degradation of the death domain kinase, receptor-interacting protein (RIP), and blockage of tumor necrosis factor-induced nuclear factor-kappaB activation. J. Biol. Chem. 2000;275:10519–10526. doi: 10.1074/jbc.275.14.10519. [DOI] [PubMed] [Google Scholar]
- 36.Li D, et al. A cytosolic heat shock protein 90 and cochaperone CDC37 complex is required for RIP3 activation during necroptosis. Proc. Natl Acad. Sci. USA. 2015;112:5017–5022. doi: 10.1073/pnas.1505244112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Zhao XM, et al. Hsp90 modulates the stability of MLKL and is required for TNF-induced necroptosis. Cell Death Dis. 2016;7:e2089. doi: 10.1038/cddis.2015.390. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Jacobsen AV, et al. HSP90 activity is required for MLKL oligomerisation and membrane translocation and the induction of necroptotic cell death. Cell Death Dis. 2016;7:e2051. doi: 10.1038/cddis.2015.386. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Bansal N, Sciabola S, Bhisetti G. Understanding allosteric interactions in hMLKL protein that modulate necroptosis and its inhibition. Sci. Rep. 2019;9:16853. doi: 10.1038/s41598-019-53078-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Petrie EJ, Czabotar PE, Murphy JM. The structural basis of necroptotic cell death signaling. Trends Biochem. Sci. 2019;44:53–63. doi: 10.1016/j.tibs.2018.11.002. [DOI] [PubMed] [Google Scholar]
- 41.Taylor SS, Kornev AP. Protein kinases: evolution of dynamic regulatory proteins. Trends Biochem. Sci. 2011;36:65–77. doi: 10.1016/j.tibs.2010.09.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Mobitz H. The ABC of protein kinase conformations. Biochim. Biophys. Acta. 2015;1854:1555–1566. doi: 10.1016/j.bbapap.2015.03.009. [DOI] [PubMed] [Google Scholar]
- 43.Ball KA, et al. Non-degradative ubiquitination of protein kinases. PLoS Comput. Biol. 2016;12:e1004898. doi: 10.1371/journal.pcbi.1004898. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Petrie EJ, et al. Identification of MLKL membrane translocation as a checkpoint in necroptotic cell death using Monobodies. Proc. Natl Acad. Sci. USA. 2020;117:8468–8475. doi: 10.1073/pnas.1919960117. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Najafov A, et al. TAM kinases promote necroptosis by regulating oligomerization of MLKL. Mol. Cell. 2019;75:457–468.e454. doi: 10.1016/j.molcel.2019.05.022. [DOI] [PubMed] [Google Scholar]
- 46.Gong YN, et al. ESCRT-III acts downstream of MLKL to regulate necroptotic cell death and its consequences. Cell. 2017;169:286–300.e216. doi: 10.1016/j.cell.2017.03.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Yoon S, Kovalenko A, Bogdanov K, Wallach D. MLKL, the protein that mediates necroptosis, also regulates endosomal trafficking and extracellular vesicle generation. Immunity. 2017;47:51–65.e57. doi: 10.1016/j.immuni.2017.06.001. [DOI] [PubMed] [Google Scholar]
- 48.Choi SW, et al. PELI1 selectively targets kinase-active RIP3 for ubiquitylation-dependent proteasomal degradation. Mol. Cell. 2018;70:920–935.e927. doi: 10.1016/j.molcel.2018.05.016. [DOI] [PubMed] [Google Scholar]
- 49.Wang H, et al. PELI1 functions as a dual modulator of necroptosis and apoptosis by regulating ubiquitination of RIPK1 and mRNA levels of c-FLIP. Proc. Natl Acad. Sci. USA. 2017;114:11944–11949. doi: 10.1073/pnas.1715742114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Wang W, et al. RIP1 kinase drives macrophage-mediated adaptive immune tolerance in pancreatic cancer. Cancer Cell. 2018;34:757–774.e757. doi: 10.1016/j.ccell.2018.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Tenev T, et al. The Ripoptosome, a signaling platform that assembles in response to genotoxic stress and loss of IAPs. Mol. Cell. 2011;43:432–448. doi: 10.1016/j.molcel.2011.06.006. [DOI] [PubMed] [Google Scholar]
- 52.Hjerpe R, et al. Efficient protection and isolation of ubiquitylated proteins using tandem ubiquitin-binding entities. EMBO Rep. 2009;10:1250–1258. doi: 10.1038/embor.2009.192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Sims JJ, et al. Polyubiquitin-sensor proteins reveal localization and linkage-type dependence of cellular ubiquitin signaling. Nat. Methods. 2012;9:303–309. doi: 10.1038/nmeth.1888. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Fiil BK, et al. OTULIN restricts Met1-linked ubiquitination to control innate immune signaling. Mol. Cell. 2013;50:818–830. doi: 10.1016/j.molcel.2013.06.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Rahighi S, et al. Specific recognition of linear ubiquitin chains by NEMO is important for NF-kappaB activation. Cell. 2009;136:1098–1109. doi: 10.1016/j.cell.2009.03.007. [DOI] [PubMed] [Google Scholar]
- 56.Tanzer, M. C. et al. Evolutionary divergence of the necroptosis effector MLKL. Cell Death Differ.23, 1185–1197 (2016). [DOI] [PMC free article] [PubMed]
- 57.Murphy JM, et al. Insights into the evolution of divergent nucleotide-binding mechanisms among pseudokinases revealed by crystal structures of human and mouse MLKL. Biochem. J. 2014;457:369–377. doi: 10.1042/BJ20131270. [DOI] [PubMed] [Google Scholar]
- 58.Lucet IS, Murphy JM. Characterization of ligand binding to pseudokinases using a thermal shift assay. Methods Mol. Biol. 2017;1636:91–104. doi: 10.1007/978-1-4939-7154-1_7. [DOI] [PubMed] [Google Scholar]
- 59.Murphy JM, et al. A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties. Biochem. J. 2014;457:323–334. doi: 10.1042/BJ20131174. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Kim W, et al. Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol. Cell. 2011;44:325–340. doi: 10.1016/j.molcel.2011.08.025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Sali A, Blundell TL. Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 1993;234:779–815. doi: 10.1006/jmbi.1993.1626. [DOI] [PubMed] [Google Scholar]
- 62.Homeyer N, Horn AH, Lanig H, Sticht H. AMBER force-field parameters for phosphorylated amino acids in different protonation states: phosphoserine, phosphothreonine, phosphotyrosine, and phosphohistidine. J. Mol. Modeling. 2006;12:281–289. doi: 10.1007/s00894-005-0028-4. [DOI] [PubMed] [Google Scholar]
- 63.Steinbrecher T, Latzer J, Case DA. Revised AMBER parameters for bioorganic phosphates. J. Chem. Theory Comput. 2012;8:4405–4412. doi: 10.1021/ct300613v. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Lai MY, Zhang D, Laronde-Leblanc N, Fushman D. Structural and biochemical studies of the open state of Lys48-linked diubiquitin. Biochim. Biophys. Acta. 2012;1823:2046–2056. doi: 10.1016/j.bbamcr.2012.04.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Hornak V, et al. Comparison of multiple Amber force fields and development of improved protein backbone parameters. Proteins. 2006;65:712–725. doi: 10.1002/prot.21123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Case DA, et al. AMBER 2018. University of California; 2018. [Google Scholar]
- 67.Wang LP, Martinez TJ, Pande VS. Building force fields: an automatic, systematic, and reproducible approach. J. Phys. Chem. Lett. 2014;5:1885–1891. doi: 10.1021/jz500737m. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Humphrey W, Dalke A, Schulten K. VMD: visual molecular dynamics. J. Mol. Graph. 1996;14:33–38. doi: 10.1016/0263-7855(96)00018-5. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
The mass spectrometry proteomics data (corresponding to Fig. 4a) that support the findings of this study have been deposited in the ProteomeXchange Consortium via the PRIDE partner repository with the dataset identifier PXD018857. All unique biological materials used are available upon reasonable request. Source data are provided with this paper.