Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2021 Jun 10;11:12267. doi: 10.1038/s41598-021-91430-w

Cobalamin is present in cells of non-tuberculous mycobacteria, but not in Mycobacterium tuberculosis

Alina Minias 1,, Filip Gąsior 1,2, Anna Brzostek 1, Tomasz Jagielski 3, Jarosław Dziadek 1,
PMCID: PMC8192938  PMID: 34112827

Abstract

Cobalamin (vitamin B12) is a structurally complex molecule that acts as a cofactor for enzymes and regulates gene expression through so-called riboswitches. The existing literature on the vitamin B12 synthesis capacity in Mycobacterium tuberculosis is ambiguous, while in non-tuberculous mycobacteria (NTM) is rather marginal. Here we present the results of our investigation into the occurrence of vitamin B12 in mycobacteria. For detection purposes, immunoassay methods were applied to cell lysates of NTM and M. tuberculosis clinical and laboratory strains grown under different conditions. We show that whereas vitamin B12 is present in cells of various NTM species, it cannot be evidenced in strains of differently cultured M. tuberculosis, even though the genes responsible for vitamin B12 synthesis are actively expressed based on RNA-Seq data. In summary, we conclude that the production of vitamin B12 does occur in mycobacteria, with the likely exception of M. tuberculosis. Our results provide direct evidence of vitamin B12 synthesis in a clinically important group of bacteria.

Subject terms: Bacterial evolution, Bacterial pathogenesis, Bacterial physiology, Bacterial transcription, Cellular microbiology

Introduction

Cobalamin (vitamin B12) is a structurally complex molecule consisting of four linked pyrrole rings and the cobalt ion in the center. There are four chemical forms of cobalamin that differ in the upper ligand: hydroxocobalamin (OHB12), methylcobalamin (CH3B12), deoxyadenosylcobalamin (AdoB12), and most chemically stable, cyanocobalamin (CNB12).

The chemical synthesis of cobalamin involves approximately 70 reactions. Microbial synthesis, which can be aerobic or anaerobic, involves fewer steps (Fig. 1). De novo synthesis involves about 30 reactions starting from glutamate. The salvage pathway is shorter than de novo synthesis, and it involves 12 genes1, 2. Pseudomonas denitrificans, Propionibacterium shermanii, Sinorhizobium meliloti, Eschericha coli and Bacillus megaterium are the main producers of CNB12 at the industrial scale1. Organisms that use vitamin B12 in their metabolism, and at the same time do not have the gene repertoire enabling its biosynthesis, use exogenous cobalamin actively transported through dedicated ABC transporters3, 4.

Figure 1.

Figure 1

Synthesis of vitamin B12 in bacteria (figure adapted with permission from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5282855/ under the terms of the Creative Commons Attribution 4.0 International License).

Cobalamin influences cell metabolism via two mechanisms. It acts as a cofactor for enzymes, and regulates gene expression through so-called riboswitches. There are three major subfamilies of vitamin B12-dependent enzymes: AdoB12-dependent isomerases, CH3B12-dependent methyltransferases, and dehalogenases. The isomerases are the largest subfamily of B12-dependent enzymes. They play important roles in fermentation pathways. An example of B12-dependent isomerases is methylmalonyl-CoA mutase (MCM), found in bacteria and humans. Together with methylmalonyl-CoA epimerase, the enzyme is involved in converting propionate to succinate through the methylmalonyl-CoA pathway. Here, the enzyme catalyzes the reversible isomerization of l-methylmalonyl-CoA to succinyl-CoA using AdoCbl as a cofactor. Another common B12-dependent isomerase is ribonucleotide reductase (NrdZ). The enzyme catalyzes the conversion of ribonucleotides to deoxyribonucleotides for DNA replication and repair. AdoCbl adenosyl ribose is required to allow hydrogen transfer to the catalytic thiol group5. The B12-dependent methyltransferases play an important role in amino acid metabolism and CO2 fixation in anaerobic microorganisms. The most extensively studied B12-dependent methyltransferase is methionine synthase (MetH). This enzyme is responsible for the regeneration of methionine from homocysteine via the vitamin B12-dependent pathway and is involved in the folate pathway (Fig. 2). The methyl group of methylcobalamin is transferred to homocysteine forming methionine6. Vitamin B12-dependent dehalogenases are present in anaerobic bacteria. Reductive dehalogenases have a vital role in detoxifying aromatic and aliphatic chlorinated organic compounds7.

Figure 2.

Figure 2

Synthesis of methionine in M. tuberculosis. In the presence of vitamin B12 the riboswitch represses the translation of mRNA of metE. Cobalamin binds as a cofactor to MetH protein, and the latter provides methionine necessary for the cell. In turn, in the absence of vitamin B12, MetH is not functional. metE transcripts are efficiently transcribed to MetE protein, which provides methionine.

Riboswitches were first detected in E. coli (Nou and Kadner, 1998). They are metabolite binding domains in specific mRNAs. Although riboswitches were mostly identified in prokaryotes, they are also present in higher organisms. They react to changes in the environment, such as changes in temperature, pH, or cofactor presence. Ligand binding allows for allosteric rearrangement of the mRNA and results in post-transcriptional control of gene expression. Cobalamin riboswitches repress gene expression by binding the ligand and preventing the mRNA's binding to ribosomes8.

The genus Mycobacterium accommodates bacterial species that carry genes presumably involved in the synthesis of vitamin B12. Mycobacteria are split into five phylogenetic clades, namely “tuberculosis-simiae”, “terrae”, “triviale”, “fortuitum-vaccae”, and “abscessus-chelonae”. There are several important pathogens in these groups. The most infamous one is M. tuberculosis, a causative agent of tuberculosis. This is an obligatory intracellular human pathogen with a complex life cycle. As shown previously, nearly all genes required for aerobic cobalamin synthesis are identifiable in M. tuberculosis, except for the cobF coding for precorin-6a synthase9.

Further research on M. tuberculosis confirmed the presence of two vitamin B12-dependent riboswitches in its genome, encoded by the Rv1133c and Rv0256c genes10. Rv1133c encodes a riboswitch regulating the metE gene expression of the cobalamin-independent methionine synthase (Fig. 2)11. The second cobalamin sensitive riboswitch at Rv0256c affects the PPE2-cobQ1-cobU operon. Rv0256c (PPE2) encodes a PPE2 family protein, while CobQ1 and CobU are presumably involved in vitamin B12 synthesis.

The identification of genes involved in the uptake of vitamin B12 from the environment in M. tuberculosis was performed by random mutagenesis12. Deletion of the Rv1819c gene, encoding ABC transporter BacA, abolished the ability to transport vitamin B12. Moreover, deletion of the bacA did not affect the infectivity of tubercle bacilli, albeit virulence was reduced during prolonged infection4.

MetH, MutB, and NrdZ are the three cobalamin-dependent proteins of M. tuberculosis. Studies involving these proteins cast doubt whether the reference strain of M. tuberculosis H37Rv synthesizes cobalamin. Savvi et al. showed that M. tuberculosis H37Rv could not use propionate as a carbon source by using the methylmalonyl pathway without enriching the medium in vitamin B1213. Warner et al. showed that B12 supplementation is necessary for the growth of the ΔmetE mutant of M. tuberculosis H37Rv, which also requires the MetH cobalamin-dependent enzyme11. Both of these reports suggest that M. tuberculosis cannot synthesize cobalamin and relies on cobalamin scavenged from the host. In turn, the M. tuberculosis clinical strain CDC1551 was surmised to be able to synthesize cobalamin by demonstrating a truncated variant of MetH. It depends on MetE to synthesize cobalamin. Therefore, it is hyper susceptible to sulfonamides, which block the folate cycle where MetH is involved in the salvage pathway. When M. tuberculosis CDC1551 was carrying MetH of H37Rv in trans, the authors observed that the strain presented standard susceptibility to sulfonamides. They suspected that intracellular levels of cobalamin in M. tuberculosis CDC1551 allow for activation of MetH14. In 2018, we showed that genes presumably involved in vitamin B12 synthesis and metabolism are under purifying selective pressure, suggesting functionality of pathway15. Ignatov et al. showed that genes involved in vitamin B12 synthesis upregulate their expression during mycobacterial persistence, reached by growing bacteria in a medium deprived of K+16. In summary, information regarding the possibility of vitamin B12 synthesis in M. tuberculosis is chaotic. As for other mycobacteria, information is scarce. Vitamin B12 synthesis was confirmed in Mycolicibacterium smegmatis17, 18. One manuscript, published in 1977, currently not available for a full read online, reported the presence of vitamin B12 in the cells of M. smegmatis, Mycolicibacterium fortuitum, Mycobacterium asiaticum, Mycobacterium phlei, and Mycobacterium bovis BCG using Lactobacillus leichmannii ATCC7830 tube method19.

Here we present the results of our investigation on the presence of vitamin B12 in mycobacteria. The purpose of this study was to describe vitamin B12 production in phylogenetic order of Mycobacterium. We show that vitamin B12 is present in the cells of various non-tuberculous species. Interestingly, we could not identify vitamin B12 in several strains of M. tuberculosis cultured under different growth conditions, even though the genes responsible for vitamin B12 synthesis are actively expressed.

Results and discussion

Gene expression of vitamin B12 synthesis genes

We aimed to identify the genes involved in vitamin B12 synthesis in NTM included in this study (Table 1). We used whole-genome sequencing data and its annotation found in the major bioinformatics databases. The available data provided an incomplete indication of loci involved in the vitamin B12 biosynthesis pathway, as it is for M. tuberculosis. The precision of annotation, covering the entire extent of variability of proteins serving particular functions, is still to be developed.

Table 1.

Identification of genes involved in vitamin B12 metabolism in various mycobacteria species based on publicly available annotations in major databases.

Species M. tuberculosis H37Rv M. abscessus subsp. abscessus M. abscessus subsp. bolletii M. conspicuum M. fortuitum M. gastri M. gordonae M. innocens
Accession number NC_000962 NC_010397 CP014950 GCA_010730195 CP011269 LQOX1000000 CP059165 LS999933
Strain H37Rv ATCC 19977 FLAC 003 JCM 14738 CT6 DSM 43505 24T MK13
Life cycle Obligatory pathogen Opportunistic Opportunistic Opportunistic Opportunistic Opportunistic Opportunistic Opportunistic
Growth rate Slow growing Fast growing Fast growing Slow growing Fast growing Slow growing Slow growing Slow growing
Gene name Function
Aerobic pathway
Precorrin-3B methylase, predicted replacement for cobF Rv2067c
Bifunctional protein Rnase H/cobC Rv2228c
cobF Precorrin-6A synthase MCNS_43990 AWC07_18155 H0P51_RS23435 EET03_RS22025
cobA Probable cob(I)alamin adenosyltransferase CobO Rv2849c MCNS_15910 XA26_25280 AWC07_16325 H0P51_RS10520 EET03_RS08695
cobB Cobyrinic acid A,C-diamide synthase Rv2848c MAB_3155c MCNS_15900 AWC07_16320
cobC L-threonine 3-O-phosphate decarboxylase Rv2231c MAB_1902
cobD Adenosylcobinamide-phosphate synthase Rv2236c MAB_1898 MCNS_32370 AWC07_23980
cobG Precorrin-3B synthase Rv2064 MAB_2200c MCNS_30550 XA26_35740 AWC07_17760 H0P51_RS16405 EET03_RS14985
cobH Cobalt-precorrin-8 × methylmutase Rv2065 MAB_2199c MCNS_30560 AWC07_17765
cobIJ Cobalt-precorrin-2 C20-methyltransferase Rv2066 MCNS_30570 AWC07_17770
cobK Cobalt-precorrin-6 × reductase Rv2070c MAB_2197 MCNS_30570 AWC07_17795
cobL Cobalt-precorrin-6y C5-methyltransferase Rv2072c MAB_2195 MCNS_30630 AWC07_17805
cobM Cobalt-precorrin-4 C11-methyltransferase Rv2071c MAB_2196 MCNS_30620 XA26_35820 AWC07_17800 H0P51_RS16430 EET03_RS15035
cobN Cobalt chelatase Rv2062c MAB_2201 A3N95_10105 MCNS_30500 XA26_35720 AWC07_17750 H0P51_RS16365 EET03_RS14960
cobO Cob(I)alamin adenosyltransferase Rv2849c MAB_3156c MCNS_15890 XA26_25260 AWC07_16315 H0P51_RS10510 EET03_RS08685
cobP Adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase AWC07_21235
cobQ1 Cobyric acid synthase Rv0255c A3N95_14850 MCNS_15750
cobQ2 Putative amidotransferase similar to cobyric acid synthase Rv3713 MAB_0323c MCNS_50840
cobR
cobS Cobalamin synthase Rv2208 MAB_1952c MCNS_31810 AWC07_10855
cobT Nicotinate-nucleotide–dimethylbenzimidazole phosphoribosyltransferase Rv2207 MAB_1953c MCNS_31800 XA26_37260 AWC07_10860 H0P51_RS17060 EET03_RS15820
cobU Adenosylcobinamide-phosphate guanylyltransferase Rv0254c MAB_1954c MCNS_31790 AWC07_21235
cobV
pduO Cob(I)alamin adenosyltransferase Rv1314c XA26_43420 AWC07_13115
pduX
bluB 5,6-Dimethylbenzimidazole synthase Rv0306 MCNS_01070 XA26_53750 AWC07_19195 H0P51_RS03095 EET03_RS01545
Salvage pathway and transport
bacA Cobalamin transporter Rv1819c
btuB
btuC Iron ABC transporter permease Rv2060
btuD
btuF
Anaerobic pathway
cbiA CbiA domain-containing protein
cbiB
cbiC Precorrin-8X methylmutase AWC07_17765
cbiD
cbiE Precorrin-6Y C(5,15)-methyltransferase MCNS_30630 AWC07_17805 H0P51_RS16435
cbiF Precorrin-4 C(11)-methyltransferase AWC07_17800
cbiG -
cbiH ATP-binding protein AWC07_17770
cbiJ Cobalt-precorrin-6A reductase AWC07_17795
cbiK
cbiL ATP-binding protein AWC07_17770
cbiP
cbiT Precorrin-6Y-methylase AWC07_17805
cbiX Sirohydrochlorin ferrochelatase Rv0259c A3N95_07805 AWC07_14695
Urpoporfirynogen III pathway
cysG Multifunctional uroporphyrin-III C-methyltransferase/precorrin-2 oxidase/ferrochelatase Rv2847c MAB_3143c MCNS_15910 AWC07_16325
cysH Phosphoadenylyl-sulfate reductase Rv2392 MAB_1661c MCNS_35620 AWC07_21315
gltX Glutamyl-tRNA synthetase Rv2992c MAB_3298c AWC07_23235
hemA Glutamyl-tRNA reductase Rv0509 MAB_3993c MCNS_03960 AWC07_11800
hemB Probable delta-aminolevulinic acid dehydratase/porphobilinogen synthase Rv0512 MAB_3990c MCNS_03990 XA26_52000 H0P51_RS04270 EET03_RS02885
hemC Porphobilinogen deaminase Rv0510 MAB_3992c MCNS_03970 XA26_52020 AWC07_11795 H0P51_RS04260 EET03_RS02875
hemD Uroporphyrinogen III methyltransferase/synthase Rv0511 MCNS_03980 AWC07_14690
hemL Glutamate-1-semialdehyde 2,1-aminomutase Rv0524 MCNS_04110 XA26_51830 AWC07_11675 H0P51_RS04340 EET03_RS03025
hemY ChlI component of cobalt chelatase Rv2850c MAB_2985c MCNS_17540
Vitamin B12 dependent enzymes
metH 5-Methyltetrahydrofolate–homocysteine methyltransferase Rv2124c MAB_2129 MCNS_30990 AWC07_11205 H0P51_RS04340 EET03_RS15385
mutB Methylmalonyl-CoA mutase Rv1493 MAB_2711c MCNS_22010
nrdZ Ribonucleotide reductase of class II Rv0570 AWC07_08365
Species M. kansasii M. persicum M. phlei M. porcinum M. terrae M. xenopi M.szulgai M. smegmatis
Accession number GCA_000157895.1 GCA_002705835 GCA_001582015 NZ_MBDY01000007.1 GCA_900187145 NZ_AJFI01000095.1 NZ_LQPW01000016.1 CP000480
Strain ATCC 12478 H48 CCUG 21000 ACS 3670 NCTC 10856 RIVM700366 DSM 44166 mc2 155
Life cycle Opportunistic Opportunistic Opportunistic Opportunistic Opportunistic Opportunistic Pathogenic Non-pathogenic
Growth rate Slow growing Slow growing Fast growing Fast growing Slow growing Slow growing Slow growing Fast growing
Aerobic pathway
Precorrin-3B methylase, predicted replacement for cobF
Bifunctional protein Rnase H/cobC
cobF Precorrin-6A synthase MKAN_RS08645 A5717_31225 MXEN_19174 MSMEG_5548
cobA Probable cob(I)alamin adenosyltransferase CobO MKAN_RS09965 CDN37_RS24000 A5717_05685 MXEN_03569 AWC27_RS04140
cobB Cobyrinic acid A,C-diamide synthase A5717_05680 MXEN_03564 MSMEG_2617
cobC L-threonine 3-O-phosphate decarboxylase
cobD Adenosylcobinamide-phosphate synthase MKAN_03275 A5717_01680 MXEN_00720 MSMEG_4310
cobG Precorrin-3B synthase MKAN_RS01775 CDN37_RS01855 MPHLCCUG_RS13200 A5717_31635 MXEN_01317 AWC27_RS14575 MSMEG_3871
cobH Cobalt-precorrin-8 × methylmutase A5717_31640 MXEN_01322 MSMEG_3872
cobIJ Cobalt-precorrin-2 C20-methyltransferase A5717_31645 MXEN_01327 MSMEG_3873
cobK Cobalt-precorrin-6 × reductase A5717_31665 MXEN_01342 MSMEG_3875
cobL Cobalt-precorrin-6y C5-methyltransferase A5717_31675 MXEN_01352 MSMEG_3878
cobM Cobalt-precorrin-4 C11-methyltransferase MKAN_RS01815 CDN37_RS01895 MPHLCCUG_RS13225 A5717_31670 MXEN_01347 MSMEG_3877
cobN Cobalt chelatase MKAN_RS01760 CDN37_RS01840 MPHLCCUG_RS12530 A5717_31630 MXEN_01292 AWC27_RS14585 MSMEG_3864
cobO Cob(I)alamin adenosyltransferase MKAN_RS23620 CDN37_RS23990 MPHLCCUG_RS15725 A5717_05675 MXEN_03569 AWC27_RS04130 MSMEG_2616
cobP Adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase A5717_01465 MXEN_00460
cobQ1 Cobyric acid synthase MSMEG_2588
cobQ2 Putative amidotransferase similar to cobyric acid synthase MXEN_13996
cobR
cobS Cobalamin synthase A5717_01475 SAMEA4434518_01622 MXEN_00470 MSMEG_4277
cobT Nicotinate-nucleotide–dimethylbenzimidazole phosphoribosyltransferase MKAN_RS02865 CDN37_RS02735 MPHLCCUG_RS16365 A5717_01470 SAMEA4434518_01623 MXEN_00465 AWC27_RS19945 MSMEG_4275
cobU Adenosylcobinamide-phosphate guanylyltransferase A5717_01465 SAMEA4434518_00431 MXEN_00460 MSMEG_4274
cobV -
pduO Cob(I)alamin adenosyltransferase A5717_18045 MXEN_16843 MSMEG_1544
pduX -
bluB 5,6-Dimethylbenzimidazole synthase MKAN_RS16250 CDN37_RS16575 MPHLCCUG_RS02360 A5717_14585 MXEN_19875 AWC27_RS20945 MSMEG_6053
Salvage pathway and transport
bacA Cobalamin transporter
btuB
btuC Iron ABC transporter permease A5717_14615 MXEN_06686
btuD
btuF
Anaerobic pathway
cbiA CbiA domain-containing protein MXEN_04563
cbiB
cbiC Precorrin-8X methylmutase A5717_31640
cbiD
cbiE Precorrin-6Y C(5,15)-methyltransferase CDN37_RS01900 A5717_31675 MXEN_01352 AWC27_RS14545
cbiF Precorrin-4 C(11)-methyltransferase A5717_31670 MXEN_01347
cbiG
cbiH ATP-binding protein A5717_31645
cbiJ Cobalt-precorrin-6A reductase A5717_31665 MXEN_01342
cbiK
cbiL ATP-binding protein A5717_31645
cbiP
cbiT Precorrin-6Y-methylase A5717_31675 MXEN_01352
cbiX Sirohydrochlorin ferrochelatase - A5717_10190 SAMEA4434518_00227 MXEN_11286
Urpoporfirynogen III pathway
cysG Multifunctional uroporphyrin-III C-methyltransferase/precorrin-2 oxidase/ferrochelatase A5717_05685 MXEN_03559
cysH Phosphoadenylyl-sulfate reductase A5717_28590 SAMEA4434518_01414 MXEN_11291
gltX Glutamyl-tRNA synthetase A5717_14355 MXEN_16257 MSMEG_2383
hemA Glutamyl-tRNA reductase A5717_22190 SAMEA4434518_00496 MXEN_04673 MSMEG_0919
hemB Probable delta-aminolevulinic acid dehydratase/porphobilinogen synthase MKAN_RS17655 CDN37_RS17885 MPHLCCUG_RS22000 SAMEA4434518_00499 AWC27_RS21685 MSMEG_0956
hemC Porphobilinogen deaminase MKAN_RS17645 CDN37_RS17875 MPHLCCUG_RS22010 A5717_22195 SAMEA4434518_00497 MXEN_04668 AWC27_RS07580 MSMEG_0953
hemD Uroporphyrinogen III methyltransferase/synthase - A5717_10195 SAMEA4434518_00498 MXEN_04663 MSMEG_0954
hemL Glutamate-1-semialdehyde 2,1-aminomutase MKAN_RS17800 CDN37_RS18005 MPHLCCUG_RS21920 A5717_22280 SAMEA4434518_00514 MXEN_04593 AWC27_RS07655 MSMEG_0969
hemY ChlI component of cobalt chelatase SAMEA4434518_01694
Vitamin B12 dependent enzymes
metH 5-Methyltetrahydrofolate–homocysteine methyltransferase CDN37_RS02225 MPHLCCUG_RS15920 A5717_31970 SAMEA4434518_01721 MXEN_01507 AWC27_RS09650 MSMEG_0093
mutB Methylmalonyl-CoA mutase SAMEA4434518_02142 MSMEG_3159
nrdZ Ribonucleotide reductase of class II MKAN_19005 MXEN_17528

We used RNA-Seq data available at ENA Database to estimate gene expression through transcripts per million base pair (TPM) values for genes involved in vitamin B12 synthesis in M. tuberculosis, M. abscessus subsp. abscessus, and M. smegmatis (Table 2). TPM values inform about the level of basal transcription of genes, and are not to be confused with relative gene expression in different conditions. The average gene expression for M. abscessus and M. smegmatis was 201.88 ± 547.4 TPM and 147.33 ± 607.04 TPM, respectively. In comparison, the average expression of genes predicted to be involved in vitamin B12 synthesis was 94.943 ± 9.483 TPM and 76.669 ± 29.645 TPM, respectively. For M. tuberculosis we investigated gene expression level in cells grown in rich broth20, in medium supplemented with cholesterol21, and in human macrophages22. The above conditions' average gene expression was 256.02 ± 551.112 TPM, 256.01 ± 764.53 TPM, and 256.02 ± 1039.71 TPM, respectively. Simultaneously, the average expression of genes predicted to be involved in vitamin B12 aerobic synthesis was lower, 114.114 ± 77.666 TPM, 54.189 ± 35.772 TPM, 145.871 ± 159.664 TPM, respectively. Their overall expression level was comparable to DnaG primase, an essential protein involved in DNA replication (104.986 ± 2.321, 91.056 ± 42.023, and 118.236 ± 98.324, respectively)23.

Table 2.

Expression of genes involved in cobalamin metabolism in M. tuberculosis H37Rv based on RNA-Seq data.

Gene name Description M. abscessus subsp. abscessus M. smegmatis
Locus Average SD Locus Average SD
All genes 201.88 547.4 147.33 607.04
Reference genes
sigA RNA polymerase sigma factor SigA (sigma-A) MAB_3009 1213.5 31.5941962
dnaA Chromosomal replication initiator protein DnaA MAB_0001 285.34 4.39631664 MSMEG_0093 94.66 39.15167557
ftsZ Cell division protein FtsZ MAB_2009 624.6633333 540.8220485 MSMEG_4222 299.37 47.21376812
dnaG Probable DNA primase DnaG MAB_1708 154.3033333 9.405750014
rpoB DNA-directed RNA polymerase (beta chain) RpoB (transcriptase beta chain) (RNA polymerase beta subunit) MAB_3869c 2151.213333 32.03047351 MSMEG_1367 511.1433333 441.0141973
Aerobic pathway
Precorrin-3B methylase, predicted replacement for cobF
Bifunctional protein Rnase H/cobC
cobA Probable cob(I)alamin adenosyltransferase CobO
cobB Cobyrinic acid A,C-diamide synthase MAB_3155c 48.28333333 3.208899084 MSMEG_2617 45.33666667 37.90995428
cobC L-threonine 3-O-phosphate decarboxylase MAB_1902 35.61333333 2.020948622
cobD Adenosylcobinamide-phosphate synthase MAB_1898 30.22333333 2.78363671 MSMEG_4310 34.71333333 5.899494329
cobG Precorrin-3B synthase MAB_2200c 44.81333333 10.51069138 MSMEG_3871 43.05333333 9.251671921
cobH Cobalt-precorrin-8 × methylmutase MAB_2199c 53.07 1.728670009 MSMEG_3872 110.2366667 37.68649802
cobIJ Cobalt-precorrin-2 C20-methyltransferase MSMEG_3873 52.53333333 35.62759651
cobK Cobalt-precorrin-6 × reductase MAB_2197 118.63 8.898027871 MSMEG_3875 40.99 6.827935266
cobL Cobalt-precorrin-6y C5-methyltransferase MAB_2195 95.33 10.65838168 MSMEG_3878 33.24333333 4.282117856
cobM Cobalt-precorrin-4 C11-methyltransferase MAB_2196 190.0066667 34.70278423 MSMEG_3877 40.97333333 4.718308313
cobN Cobalt chelatase MAB_2201 78.53 3.401043957 MSMEG_3864 95.39333333 66.90839808
cobO Cob(I)alamin adenosyltransferase MAB_3156c 94.59 20.00465696 MSMEG_2616 150.34 26.29276136
cobQ1 Cobyric acid synthase MSMEG_2588 69.94666667 36.76729162
cobQ2 Putative amidotransferase similar to cobyric acid synthase MAB_0323c 79.06333333 7.416537827
cobS Cobalamin synthase MAB_1952c 98.49666667 3.519038694 MSMEG_4277 35.19666667 3.883160225
cobT Nicotinate-nucleotide–dimethylbenzimidazole phosphoribosyltransferase MAB_1953c 171.1133333 8.786639479 MSMEG_4275 34.59333333 4.231930214
cobU Adenosylcobinamide-phosphate guanylyltransferase MAB_1954c 191.44 15.12232456 MSMEG_4274 109.1266667 5.803363967
pduO Cob(I)alamin adenosyltransferase MSMEG_1544 233.6766667 151.377732
bluB 5,6-Dimethylbenzimidazole synthase MSMEG_6053 97.35333333 36.85650056
Salvage pathway and transport
bacA Cobalamin transporter
btuC Iron ABC transporter permease
Anaerobic pathway
cbiX Sirohydrochlorin ferrochelatase
Urpoporfirynogen III pathway
cysG Multifunctional uroporphyrin-III C-methyltransferase/precorrin-2 oxidase/ferrochelatase MAB_3143c 95.06666667 7.895709806
cysH Phosphoadenylyl-sulfate reductase MAB_1661c 174.4733333 18.36925783
gltX Glutamyl-tRNA synthetase MAB_3298c 287.6433333 11.14623853 MSMEG_2383 156.9933333 19.13254383
hemA Glutamyl-tRNA reductase MAB_3993c 268.16 8.943438936 MSMEG_0919 174.06 98.84548143
hemB Probable delta-aminolevulinic acid dehydratase/porphobilinogen synthase MAB_3990c 349.51 54.2694122 MSMEG_0956 201.9733333 27.76189895
hemC Porphobilinogen deaminase MAB_3992c 638.4233333 82.95156076 MSMEG_0953 374.95 313.6007022
hemD Uroporphyrinogen III methyltransferase/synthase MSMEG_0954 317.5766667 44.41745753
hemL Glutamate-1-semialdehyde 2,1-aminomutase MSMEG_0969 110.7066667 25.2243619
hemY ChlI component of cobalt chelatase MAB_2985c 196.3366667 1.652099674
Vitamin B12 dependent enzymes
metH 5-Methyltetrahydrofolate–homocysteine methyltransferase MAB_2129 605.9966667 39.45958101 MSMEG_0093 94.66 39.15167557
mutB Methylmalonyl-CoA mutase MAB_2711c 180.9466667 2.206928484
nrdZ Ribonucleotide reductase of class II
Gene name Description M. tuberculosis
Locus Rich 7H9 broth Cholesterol Macrophages
Average SD Average SD Average SD
All genes 256.0163876 551.1120531 256.01 764.53 256.0163722 1039.716894
Reference genes
sigA RNA polymerase sigma factor SigA (sigma-A) Rv2703 599.0566667 9.565264706 630.73 106.0339119 1776.92 403.8168363
dnaA Chromosomal replication initiator protein DnaA Rv0001 131.0233333 1.802615384 532.06 40.00305738 579.74 351.8220045
ftsZ Cell division protein FtsZ Rv2150c 691.0366667 72.64343069 200.9733333 88.35943501 548.8 187.4937259
dnaG Probable DNA primase DnaG Rv2343c 104.9866667 2.321354968 91.05666667 42.02332077 118.2366667 98.34518335
rpoB DNA-directed RNA polymerase (beta chain) RpoB (transcriptase beta chain) (RNA polymerase beta subunit) Rv0667 1650.64 35.26432853 701.45 81.97233192 438.5966667 130.3168532
Aerobic pathway
Precorrin-3B methylase, predicted replacement for cobF Rv2067c 104.4866667 4.4877339 32.90666667 33.05350242 283.67 60.07031935
Bifunctional protein Rnase H/cobC Rv2228c 91.63333333 0.241430919 36.25333333 20.75320752 0 0
cobA Probable cob(I)alamin adenosyltransferase CobO Rv2849c 77.32666667 3.099519676 74.58333333 10.26311302 507.9333333 458.6724143
cobB Cobyrinic acid A,C-diamide synthase Rv2848c 51.04333333 0.651783877 60.56666667 31.54769652 0 0
cobC L-threonine 3-O-phosphate decarboxylase Rv2231c 78.29 3.854279007 37.80333333 27.56415224 0 0
cobD Adenosylcobinamide-phosphate synthase Rv2236c 58.52333333 1.689108904 1.9 1.064831755 81.79333333 115.6732413
cobG Precorrin-3B synthase Rv2064 183.29 4.164956983 33.45 26.14527236 133.5466667 188.8635072
cobH Cobalt-precorrin-8 × methylmutase Rv2065 178.23 4.38254112 0.593333333 0.839100047 0 0
cobIJ Cobalt-precorrin-2 C20-methyltransferase Rv2066 150.18 9.995749096 74.32666667 8.916786915 72.98 58.51295412
cobK Cobalt-precorrin-6 × reductase Rv2070c 89.46666667 8.680419857 42.11333333 30.69800681 419.98 124.7825583
cobL Cobalt-precorrin-6y C5-methyltransferase Rv2072c 51.73666667 2.388616522 56.36333333 44.1996458 219.44 310.3350241
cobM Cobalt-precorrin-4 C11-methyltransferase Rv2071c 32.80333333 1.224100577 63.16666667 39.84209192 0 0
cobN Cobalt chelatase Rv2062c 101.4866667 3.59177146 46.24666667 13.10098554 167.3266667 118.4526528
cobO Cob(I)alamin adenosyltransferase Rv2849c 77.32666667 3.099519676 74.58333333 10.26311302 507.9333333 458.6724143
cobQ1 Cobyric acid synthase Rv0255c 83.46333333 4.16039528 60.76333333 17.12575124 0 0
cobQ2 Putative amidotransferase similar to cobyric acid synthase Rv3713 178.4833333 3.066206487 95.84333333 45.96082849 104.7666667 148.1624409
cobS Cobalamin synthase Rv2208 280.7333333 5.75070044 38.15 35.52983347 228.8033333 323.5767771
cobT Nicotinate-nucleotide–dimethylbenzimidazole phosphoribosyltransferase Rv2207 341.1866667 6.934096112 10.67 6.638649461 70.94666667 100.3337382
cobU Adenosylcobinamide-phosphate guanylyltransferase Rv0254c 46.93666667 5.12625486 171.9133333 89.37495001 138.89 196.4201217
pduO Cob(I)alamin adenosyltransferase Rv1314c 88.84 1.75789647 51.02 33.75337119 125.2866667 177.1821032
bluB 5,6-Dimethylbenzimidazole synthase Rv0306 50.93 3.946044433 74.76 42.37912772 0 0
Salvage pathway and transport
bacA Cobalamin transporter Rv1819c 112.5766667 3.598373089 27.63 21.66365312 82.66333333 59.02668455
btuC Iron ABC transporter permease Rv2060 191.76 5.638421765 296.6266667 162.4777085 106.7166667 150.9201573
Anaerobic pathway
cbiX Sirohydrochlorin ferrochelatase Rv0259c 12.73 1.498465882 0 0 0 0
Urpoporfirynogen III pathway
cysG Multifunctional uroporphyrin-III C-methyltransferase/precorrin-2 oxidase/ferrochelatase Rv2847c 68.92 5.318890862 36.77 10.84717782 63.26 89.46314996
cysH Phosphoadenylyl-sulfate reductase Rv2392 312.9333333 19.43125032 503.0566667 166.2576146 0 0
gltX Glutamyl-tRNA synthetase Rv2992c 170.96 11.21727537 89.43333333 42.90810128 107.7533333 76.94248949
hemA Glutamyl-tRNA reductase Rv0509 612.7766667 65.26401271 698.94 222.6659401 362.77 513.034254
hemB Probable delta-aminolevulinic acid dehydratase/porphobilinogen synthase Rv0512 279.2466667 19.95736511 165.0033333 36.41366075 160.32 114.4782576
hemC Porphobilinogen deaminase Rv0510 627.0233333 64.43651415 435.5433333 115.7868324 161.2566667 114.1554689
hemD Uroporphyrinogen III methyltransferase/synthase Rv0511 640.4733333 56.28158037 342.2533333 64.04123949 138.85 9.488702054
hemL Glutamate-1-semialdehyde 2,1-aminomutase Rv0524 437.8066667 25.11909809 114.9666667 72.38097832 391.8 135.6539762
hemY ChlI component of cobalt chelatase Rv2850c 135.66 6.78823001 38.01666667 3.454488224 81.53333333 115.3055458
Vitamin B12 dependent enzymes
metH 5-Methyltetrahydrofolate–homocysteine methyltransferase Rv2124c 155.78 9.823003614 311.4966667 16.31473431 128.15 45.50090622
mutB Methylmalonyl-CoA mutase Rv1493 48.83 1.851323851 139.7433333 70.5155852 38.08333333 53.8579665
nrdZ Ribonucleotide reductase of class II Rv0570 60.79333333 1.360890232 366.2433333 120.7928051 119.6 101.265619

Studies with Propionibacterium sp. showed the crucial role of cobA gene in regulating the level of synthesis of vitamin B12. Vitamin B12 was shown to regulate the cobA operon through a riboswitch in its 5′ untranslated region (5′ UTR)24. Similarly, M. tuberculosis contains a PPE2-cobQ1-cobU operon, containing vitamin B12 synthesis genes and controlled by a riboswitch. Taken the ubiquity of vitamin B12 riboswitches across Prokarytotes, the mechanisms where the level of vitamin B12 synthesis genes seem to be controlled by the synthesis product might be common25. Presented results show that cobQ1 and cobU of M. tuberculosis are actively expressed in a rich broth and in the presence of cholesterol. Expression of cobQ1 was not observed in macrophages. The level of reading coverage of the mycobacterial genome is relatively low. We assume that the low coverage results from natural technical difficulties of isolating mycobacterial RNA from the Eukaryotic cells that have RNA of their own26. Since reads of cobU are present, we suspect that the absence of cobQ1 reads in macrophages is due to too low coverage.

Vitamin B12 concentration in non-tuberculous mycobacteria

We measured the concentration of vitamin B12 per mg of protein in cell lysates obtained from 7H9 medium cultures of various species of NTM spread across the phylogenetic tree (Fig. 3A)27. On average, mycobacterial cells contained 33.044 ng of cobalamin per mg of protein. The median level of vitamin B12 across analyzed cells was 29.217 ng per mg of protein. The lowest concentration of vitamin B12 was detected for M. innocens (3.704 ± 0.643 ng/mg of protein). The highest concentration of vitamin B12 was detected in M. attenuatum (90.211 ± 13,769 ng/mg of protein). Results regarding relatively high production of vitamin B12 in M. phlei (77.712 ± 10.597 ng/mg of protein), when compared with other species of mycobacteria, are in line with previous findings from 197719. When vitamin B12 concentration was normalized to protein content, we detected a higher concentration of vitamin B12 in mycobacteria than it was previously detected in P. aeruginosa. There, analyses by HPLC–MS detected from 0.32 to 3.72 ng of vitamin B12 per mg of protein, depending on culture conditions and strain28.

Figure 3.

Figure 3

Cobalamin concentration in cell lysates of non-tuberculous mycobacteria. Cobalamin was detected in cell lysates of non-tuberculous mycobacteria by immunoassay. Cells were grown in 7H9 medium supplemented with OADC, Tween 80, and CoCl2. We cultured cells until the suspension reached OD600 = 1. Next, cells were harvested and washed with fresh medium without supplements to remove residual medium proteins from the surface. The pellet was re-suspended in Tris buffer and disrupted by beat-beating. The suspension was spinned. We used supernatant to estimate the concentration of vitamin B12 and protein content. Results were obtained from three independent cultures; each lysate was analyzed in two technical replicates. (A) cobalamin concentration in cell lysates of non-tuberculous mycobacteria, when normalized in ng per mg of protein, (B) cobalamin concentration in non-tuberculous mycobacteria cell lysates, when normalized in ng per ml of culture, (C) cobalamin concentration in cell lysates of clinical strains of M. abscessus complex. Whiskers represent SD.

There are different approaches to the normalization of vitamin B12 concentration in bacteria. To further compare our results with other bacterial species, we also normalized our data regarding vitamin B12 concentration to ml of culture (Fig. 3B). When calculated in such a way, we obtained from 0.049 to 1.2 ng of vitamin B12 per ml of culture. In comparison, Pseudomonas freudenreichii produced from 20 to 125 ng of vitamin B12/ ml of culture, depending on culture conditions29. B. megaterium produced from 0.26 ng/ml of culture to 204 ng/ml of culture, also depending on the culture conditions. Due to relatively low concentration of vitamin B12, expensive growth media, long culture time, and difficulties to disrupt the cells, we conclude that mycobacteria are not attractive alternative producers of vitamin B12 at the industrial scale.

Importantly, we show that NTM can produce vitamin B12, and synthesis is shared across the phylogenetic tree. The sensitivity of the immunoassay detection was suitable for the detection of vitamin B12 in mycobacterial cells. This observation is an important reference point for results obtained for M. tuberculosis.

The level of vitamin B12 concentration in the NTM cells is variable, and it depends on the cell line

M. abscessus complex is a group of non-tuberculous mycobacteria. It is an emerging human pathogen often associated with the infection of cystic fibrosis patients. It consists of three subspecies M. abscessus subsp. abscessus, M. abscessus subsp. massiliense and M. abscessus subsp. bolletii. We measured the concentration of vitamin B12 per mg of protein in cell lysates obtained from 7H9 medium cultures of various clinical strains of M. abscessus subsp. abscessus and M. abscessus subsp. bolletii (Fig. 3C). We detected vitamin B12 in cells of all of the analyzed strains. On average, cells contained 19.842 ng of cobalamin per mg of protein. The median level of vitamin B12 across analyzed cells was 18.121 ng per mg of protein. The lowest concentration of vitamin B12 was detected for M. abscessus subsp. abscessus strain A5 (14.861 ± 1.848). The highest concentration of vitamin B12 was detected in M. abscessus subsp. abscessus strain A7 (31.582 ± 1.071). The difference in concentration between the highest and the lowest producing strain was statistically significant (p < 0.01, t = 11.07, df = 3).

We observed up to a twofold difference in the level of vitamin B12 synthesis across distinct strains of the same species. Strain variability in cobalamin concentration was observed previously in Pseudomonas aeruginosa, where the concentration of vitamin B12 ranged from 0.84 to 3.72, hence changed four-fold, depending on a strain28. Possible sources of the variability in the production of vitamin B12 in different strains are mutations either in the promoter regions of genes involved in the synthesis or directly in coding sequences, resulting in enzymes with altered reaction rates30.

Strain variability in the level of vitamin B12 production is important in the context of M. tuberculosis. Data presented in previous manuscripts suggested indirectly that certain strains of M. tuberculosis may be capable of cobalamin synthesis, while others are probably not14, 31. As in other species, mycobacteria do show a certain spread in the level of vitamin B12 synthesis that probably can be attributed to the genetic background rather than the environmental factors or stage of the growth.

Increased concentration of vitamin B12 in mycobacterial cells under starvation results from accumulation rather than increased production

In our previous study, we showed that cells of M. smegmatis grown in a medium deprived of nutrients contain an approximately eightfold amount of vitamin B12 when compared to cultures grown in a rich broth. An increase in vitamin B12 concentration was also observed in stationary phase cultures17. A similar observation was made in P. aeruginosa. There, vitamin B12 concentration increased from non-detectable during exponential growth to 0.32–0.67 ng/mg of protein in stationary phase cultures, depending on a strain. The concentration further increased up to 3.72 in conditions of continuous-flow growth28.

Here, we show that the reason behind the increased concentration of vitamin B12 in starved cells of M. smegmatis mc2 probably results from accumulation rather than increased synthesis. We estimated the relative gene expression of genes involved in cobalamin synthesis in starved cells compared to cells in the logarithmic phase (Fig. 4). We observed that the expression of genes involved in vitamin B12 synthesis was either constitutive (0 to 1-fold change in relative expression to sigA) for cobG, cobL, cobO and cobD or repressed (> 3-fold change) for cobU and cobN.

Figure 4.

Figure 4

Relative gene expression of genes involved in cobalamin biosynthesis in M. smegmatis. Data across samples was normalized to sigA. Bars represent log fold change. Whiskers represent SD.

Accumulation of vitamin B12 in starved cells and old cultures of M. smegmatis is important in the context of cobalamin detection in M. tuberculosis. M. smegmatis is a model organism for studying the biology of mycobacteria, including M. tuberculosis32. Bacteria of the same phylogenetic order are likely to maintain the same biological pathways and mechanisms. Indeed, increased expression of cobalamin synthesis genes was reported in dormant cultures of M. tuberculosis16. Therefore, if cobalamin was to be present in the cells of M. tuberculosis, it was more likely to be identified in prolonged, starved, or dormant cultures.

Lack of observable vitamin B12 production in M. tuberculosis

We tested the contents of cells of M. tuberculosis for vitamin B12 by immunoassay (Table 3). We included laboratory strain of M. tuberculosis H37Rv and five clinical strains of M. tuberculosis, here grouped into a group of “clinical strains”. As a negative control strain, we used M. tuberculosis deficient in cobIJ gene. Predicted function of cobIJ is precorrin-2 C20-methyltransferase/precorrin-3B C17-methyltransferase. The gene product is required at the early stage of vitamin B12 synthesis (Fig. 1).

Table 3.

Types of cultures tested for cobalamin in cells of M. tuberculosis H37Rv, five clinical strains of M. tuberculosis, and ∆cobIJ.

Type of culture Growth medium Supplementation Vitamin B12
Logarytmic phase cultures 7H9 + OADC + Tween 80 + CoCl2 Negative
Stationary phase cultures 7H9 + OADC + Tween 80 + CoCl2 Negative
Acidified cultures 7H9 + OADC + Tween 80 + CoCl2, pH 5.5 Negative
Starved cultures 7H9 + Tween 80 + CoCl2 Negative
Persister cultures K + deficient Sauton medium + CoCl2 Negative
Hypoxic cultures 7H9 + OAD + Tween 80 + CoCl2 (+ methylene blue), 25% head ratio Negative
Logarytmic phase cultures 7H9 + OADC + Tween 80 + CoCl2 Uroporphyrinogen III Negative
Stationary phase cultures 7H9 + OADC + Tween 80 + CoCl2 Uroporphyrinogen III Negative
Persister cultures K + deficient Sauton medium + CoCl2 Uroporphyrinogen III Negative
Hypoxic cultures 7H9 + OAD + Tween 80 + CoCl2 (+ methylene blue), 25% head ratio Uroporphyrinogen III Negative

We screened M. tuberculosis cell lysates derived from cultures grown in various conditions. The growth conditions aimed to mimic the environments that can be found during M. tuberculosis infection cycle. All cultures were supplemented with cobalt to evade the blockade of synthesis due to insufficient cobalt concentration. First, we investigated the possibility of de novo synthesis of vitamin B12. We tested logarithmic phase cultures, stationary phase cultures, and acidified cultures that would mimic the infection's active stage. For granuloma conditions, we tested starved cultures, persister cultures, and hypoxic cultures. ELISA immunoassay detected less than one ng of vitamin B12 per one ml of lysate in all of the samples. The samples were considered negative for vitamin B12 based on the cut-off value of the sensitivity of the test. Taken that vitamin B12 tends to accumulate in the cells during prolonged growth, our results suggest that it is unlikely that there is an ongoing de novo synthesis of vitamin B12 inside M. tuberculosis cells.

Next, we wanted to see if M. tuberculosis might rely on substances widely present in the host to produce vitamin B12. We supplemented the growth medium with uroporphyrinogen III, which is a precursor of heme in the human body and a precursor of vitamin B12 in bacteria (Fig. 1). We tested cell lysates from logarithmic phase cultures, stationary phase cultures, persister cell cultures, and hypoxic cultures. ELISA immunoassay detected less than one ng of vitamin B12 per one ml of lysate in all of the samples. Hence, the samples were considered negative for vitamin B12 based on the cut-off value of the test's sensitivity.

M. tuberculosis metE promoter responds to vitamin B12 concentration present in the host

We used the GFP reporter system to see if the cells of M. tuberculosis could respond to vitamin B12 concentration found within the host (Fig. 5). Vitamin B12 concentration in the human body is between 0.2 and 0.9 μg/ml. We constructed a series of mutants, H37Rv::attB + rsB12, ∆bacA::attB + rsB12, ∆cobIJ::attB + rsB12, carrying the gene of GFP under the control of the metE promoter, controlled by a vitamin B12-dependent riboswitch. In our model, the presence of vitamin B12 in the cells prevents translation of gfp transcript, which results in diminished fluorescence. Of note, distinct clones of the same cell lines showed a different level of basal fluorescence without supplementation of medium without vitamin B12. Therefore, the fluorescence level could not be reliably compared between different cell lines due to the distinct basal expression of GFP in the clones. However, green fluorescence levels could be relatively compared within one clone of the cell line when considering different concentrations of vitamin B12 in the growth medium. We tested various concentrations of vitamin B12. We observed that supplementation of the growth medium with vitamin B12 gradually diminished gene expression of the green fluorescence protein of M. tuberculosis H37Rv and ∆cobIJ from 100 to 23.93% and 23.70%, respectively. In turn, the green fluorescence expression of ∆bacA was not affected, and it remained constant at approximately 100%. Similarly, the autofluorescence level was constant for the control strain M. tuberculosis H37Rv, which lacked the reporter system. M. tuberculosis H37Rv GFP expression diminished to 70.29% in the presence of 0.5 μg/ml of vitamin B12 (p = 0.01, t = 6.64, df = 3). Hence, M. tuberculosis metE promoter is responsive to vitamin B12 concentration found in the human body. Our results confirm the role of BacA as the transporter of vitamin B1233. Further, our results indirectly confirm the lack of vitamin B12 production in M. tuberculosis H37Rv, because the wild type strain and the knock-out strain similarly showed a decrease in fluorescence corresponding to increasing concentration of supplemented vitamin B12.

Figure 5.

Figure 5

The evaluation of the protein expression of gfp gene under the control of vitamin B12- dependent riboswitch, based on the green fluorescence. We used a Guava flow cytometer to evaluate the green fluorescence in cells of H37Rv::attB + rsB12, ∆bacA::attB + rsB12, ∆cobIJ::attB + rsB12, carrying the gene of GFP under the control of the metE promoter, controlled by a vitamin B12-dependent riboswitch. We observed that the green fluorescence of strains H37Rv::attB + rsB12 and ∆cobIJ::attB + rsB12 significantly differed from the control strains grown in medium without exogenous vitamin B12 supplementation. Each strain was analyzed in samples collected from three cultures. Statistical analysis was performed with paired t-test. Whiskers represent SD.

Previous reports suggested that the ability to synthesize vitamin B12 by M. tuberculosis was restricted in M. cannetti like ancestor9, 10. M. tuberculosis is an obligate pathogen with possible access to vitamin B12 from the host. It is, therefore, possible that the genes involved in vitamin B12 synthesis in the genome of M. tuberculosis are remnants from a more independent ancestor. The genes of the vitamin B12 biosynthesis pathway in Mycobacterium leprae, another obligate pathogen of Mycobacterium genus, evolved into pseudogenes10. The most probable explanation is that M. tuberculosis does not synthesize vitamin B12 anymore. However, there was still not enough time since the abrogation of the pathway to accumulate mutations that would entirely degrade the pathway, impede the expression of genes and convert them into pseudogenes. It seems that the disruption of the pathway might have taken place relatively recently, as cobF encoding region was found in two M. tuberculosis strains found in the African Great Lakes region, representing Lineage 8 of M. tuberculosis complex31. To be precise, it cannot be excluded that M. tuberculosis does synthesize vitamin B12, but the level of vitamin concentration is undetectable by the immunoassay we used. Finally, it remains to be established whether M. tuberculosis is able to synthesize cobamides other than vitamin B1234.

Summary

We conclude that mycobacteria are generally capable of vitamin B12 synthesis, with the likely exception of M. tuberculosis. Our results are direct evidence of vitamin B12 production in these clinically important group of bacteria.

Materials and methods

Bacterial strains

We analyzed the level of vitamin B12 in several type strains and clinical strains of non-tuberculous mycobacteria (Table 4). Mycolicibacterium porcinum, M. fortuitum, and Mycobacteroides abscessus complex were isolated and differentiated in Canada35. Further, we included a laboratory strain of M. tuberculosis H37Rv, its genetically modified derivatives ΔcobIJ and ΔbacA, and five clinical strains of M. tuberculosis isolated in Lodz, Poland, between 2006 and 2008. Each strain belonged to a different clade. We chose strains: 321 (spoligotype 35, clade H4), 404 (spoligotype 46, clade U (likely H)), 663 (spoligotype 50, clade H3), 216/8 (spoligotype 42, clade LAM9) and 218/8 (spoligotype 1253, clade S)36. We used Escherichia coli Top10 for cloning.

Table 4.

List of strains used in this study.

Species Strain Description
Non-tuberculous mycobacteria
M. smegmatis mc2 Type strain
M. attenuatum DSM 107153 Type strain
M. chelonae ATCC 35752 Type strain
M. conspicuum DSM 44136 Type strain
M. gastrii DSM 43505 Type strain
M. innocens DSM 107161 Type strain
M. kansasii ATCC12478 Type strain
M. persicum DSM 104278 Type strain
M. phlei JCM 5865 Type strain
M. pseudokansasii DSM 107152 Type strain
M. szulgai DSM 44166 Type strain
M. terrae JCM 12143 Type strain
M. fortuitum F1 Clinical isolate
M. gordonae G1 Clinical isolate
M. porcinum P1 Clinical isolate
M. xenopi X1 Clinical isolate
M. abscessus subsp. abscessus A2 Clinical isolate
M. abscessus subsp. abscessus A4 Clinical isolate
M. abscessus subsp. abscessus A5 Clinical isolate
M. abscessus subsp. abscessus A7 Clinical isolate
M. abscessus subsp. bolletii B1 Clinical isolate
M. abscessus subsp. bolletii B2 Clinical isolate
M. abscessus subsp. bolletii B3 Clinical isolate
M. abscessus subsp. bolletii B5 Clinical isolate
M. tuberculosis
M. tuberculosis H37Rv Type strain, wild type
M. tuberculosis 321 Clinical isolate
M. tuberculosis 404 Clinical isolate
M. tuberculosis 663 Clinical isolate
M. tuberculosis 216/8 Clinical isolate
M. tuberculosis 218/8 Clinical isolate
Genetically modified strains
M. tuberculosis SCO:bacA Single cross over mutant
M. tuberculosis SCO:cobIJ Single cross over mutant
M. tuberculosis bacA Deletion mutant
M. tuberculosis Deletion mutant
M. tuberculosis H37Rv::attB + rsB12 Wild type complemented with reporter system
M. tuberculosis bacA::attB + rsB12 Mutant complemented with reporter system
M. tuberculosis cobIJ::attB + rsB12 Mutant complemented with reporter system

Bacterial cultures

E. coli Top10

Bacteria were cultured at 37 °C for 18–20 h in liquid or solid Luria–Bertani broth. Where necessary, the media were supplemented with antibiotics or other supplements at the following concentrations: kanamycin (Bioshop) 50 μg/ml; ampicillin (Bioshop) 100 μg/ml, X-gal 40 μg/ml (BioShop), sucrose 2% (Sigma Aldrich) at 37 °C.

Non-tuberculous and tuberculous mycobacteria

Where necessary, media were supplemented with 10% oleic acid albumin dextrose catalase growth supplement (OADC) (Becton–Dickinson), 0.05% Tween 80 (Sigma), tyloxapol 0.015% (Sigma-Aldrich), cobalt chloride 12 μg/ml (Sigma Aldrich), kanamycin 25 μg/ml (BioShop); X-gal 40 μg/ml (BioShop), sucrose 2% (Sigma Aldrich), vitamin B12 (adenosylcobalamin) 10 μg/ml (Sigma Aldrich), uroporfirynogen III octamethyl ester 1 μg/ml (Sigma Aldrich) (dissolved in 25% DMSO), OAD (0.05% Oleic Acid, 5% bovine serum albumin, fraction V, 2% glucose, and 0.85% NaCl). All cultures were started at OD600 = 0.1.

Unless stated otherwise, cultures and seed cultures of non-tuberculous mycobacteria and M. tuberculosis were cultivated in 7H9 broth supplemented with OADC, Tween 80, and cobalt chloride. Cultures of non-tuberculous mycobacteria were started at OD600 = 0.05 and carried out until they reached OD600 = 1. M. tuberculosis cultures were started at OD600 = 0.1. For seeding, the appropriate amount of logarithmic phase culture (OD600 = 0.8) was spinned down, washed in fresh medium, spinned again, and re-suspended in fresh medium.

For testing vitamin B12 concentration, non-tuberculous mycobacteria were cultured in 7H9 broth supplemented with OADC, Tween 80, and cobalt chloride until they reached OD600 = 1. Starved cultures of M. smegmatis were cultured as described previously17.

We tested several types of cultures of M. tuberculosis for vitamin B12 concentration. Logarithmic phase cultures of M. tuberculosis were grown in 7H9 medium supplemented with OADC, Tween80, and cobalt chloride until they reached OD600 = 0.8. Stationary phase cultures were carried out in the same medium, and they were collected after 15 days of culture. Acidified cultures (pH 5.7) were carried out in 7H9 broth, supplemented with 5% bovine serum albumin, fraction V, 2% glucose, and 0.85% NaCl, Tween 80, and cobalt chloride. They were collected after 1 week of culture. Starved cultures were carried out in 7H9 broth supplemented with Tween 80, 0.5% glycerol, and cobalt chloride. They were collected after one week of culture. Hypoxic cultures were carried out as previously described37. In brief, starter cultures of M. tuberculosis grown on Dubos medium supplemented with OAD and cobalt chloride were tightly locked in flasks with 0.25 headspace ratio and cultured at 37 °C on a shaker for six weeks. Catalase is not recommended for use in hypoxia experiments because it influences redox balance, and redox stress is an important stress factor of hypoxia38. Methylene blue was added to control cultures as an indicator of oxygen depletion. After this time, the flasks were opened, cultures were spinned down and washed three times with 7H9 medium. A sample of the culture was plated as viability control, while the rest was lyzed. For persister cultures, we used a medium deprived of K+, as previously described16. Here, starter cultures grown on Sauton medium were spinned down and re-suspended in Sauton medium deficient in K+ supplemented with cobalt chloride. After two weeks, rifampicin was added to cultures at 5 μg ml−1 and the culture continued for the next four weeks at 37 °C.

Cloning strategy

All molecular cloning was performed in E. coli T10. Knock-out mutants of mycobacteria were obtained by the method of gene replacement through homologous recombination (Tables 5, 6; Fig. 6; Supplementary Figs. 1 and 2)39. Briefly, sequences flanking desired deletion were amplified by PCR. We used AccuPrime Pfx High Fidelity Polymerase (Invitrogen), and genomic DNA of M. tuberculosis H37Rv for the reaction. PCR products were introduced into pJET1.2 plasmid (Thermo Fisher Scientific) and sequenced. Following confirmation of cloning of proper sequence, we cut out flanking sequences using restriction enzymes, and sequentially introduced them into p2NIL plasmid, together with marker genes from pGOAL17. Plasmids were transformed into M. tuberculosis H37Rv thru electroporation. The cells underwent gene replacement by allelic exchange as described previously39. Similarly, episome plasmid containing green fluorescence protein (GFP) gene under the control of the riboswitch of M. tuberculosis metE gene was constructed with a similar procedure. We started with PCR amplification of products on genomic DNA of M. tuberculosis H37Rv and pJAM plasmid carrying gfp. Subsequently, we introduced sequences to pJET1.2, and we confirmed proper cloning by sequencing. Next, we used restriction digestion to cut out the sequences, and we introduced them into pMV306 episome plasmid. M. tuberculosis H37Rv and its derivative strains were transformed by electroporation.

Table 5.

List of primers used in this study.

Name Primer orientation Primer sequence 5′
Gene replacement
bacA first flank Forward CAGTACTAGGTTGGATCGGCGTGGATAAGC
Reverse CAAGCTTCACAGATGGCACTGATCGTCCAGG
bacA second flank Forward CAAGCTTGGCGAGCGGGTGGAAGGTACC
Reverse CGGTACCAATACCGCCCACCCCACC
cobIJ first flank Forward CAGTACTGCGACCCATTCTCCCGTACG
Reverse CAAGCTTCGTGTGGGGCGCTGTGATAG
cobIJ second flank Forward CAAGCTTGACTGGATGACACCGCAGAGCC
Reverse CGGTACCATCACCTGGCAGATCCGCG
Gene complementation
metE promoter region Forward CGGTACCCTCGGGAACCGGCTTTAACACGG
Reverse CTCTAGAGGTGTTCACCGGCACCGAGTCC
Green fluorescence protein Forward CTCTAGAATGAGTAAAGGAGAAGAACTTTTCACTGG
Reverse CAAGCTTCTATTTGTATAGTTCATCCATGCCATGTG
Southern blot
bacA probe Forward GCGGCGAGAACGAGACGATG
Reverse CGCCACCGAGTAGTTCGAGCTG
cobIJ probe Forward ATGAGCGCTCGGGGCACGC
Reverse TCAGTCGCTGTGGCGGCTCG
qPCR
cobG Forward CGCTCGTGTGTCGGTGACGG
Reverse AGTGCACCAGGCCGCTGACG
cobL Forward ACGCGCGACCGTGGTGTTC
Reverse TCGACACGTGCGGCAGCA
cobO Forward TCGTCGCTGCCGTGTTTGC
Reverse GGCGTTCGGGATGGCGTT
cobU Forward ACGGTCTGCCAGTGTGCGGG
Reverse CCGGGAAATCGCAGTGGGC
cobD Forward TGGCGCTGTTCGGTTCCGG
Reverse CCAGGTGTGGGCGGTTTCTGC
cobN Forward GTGGTCAGCGGCGAGCAGAC
Reverse AGGGGGCGTTCGAGGATGC
sigA Forward AGAAAGCCCCGGCCAAGCG
Reverse GCGTCGCGGCATCAGCTTCT
PCR confirmation of gene complementation
pMV306 Forward GTGGATAACCGTATTACCGC
Reverse AAGGCCCAGTCTTTCGACTGAG

Table 6.

List of plasmids used in this study.

Name Description Source
pJET1.2 Commercial plasmid Thermo Fisher Scientific
pJAM + gfp pJAM plasmid carrying green fluorescence protein gene Institute of Medical Biology
p2NIL Recombination vector, nonreplicating in mycobacteria Parish and Stocker, 2000
pGOAL17 Parish and Stocker, 2000
pMV306 Mycobacterial integrating vector Med-Immune Inc
pAM1 pJET1.2 carrying first flank of cobIJ gene This study
pAM2 pJET1.2 carrying second flank of cobIJ gene This study
pAM3 p2NIL carrying first flank of cobIJ gene This study
pAM4 p2NIL carrying first and second flank of cobIJ gene This study
pAM5 p2NIL plasmid carrying flanking sequences of deletion within cobIJ gene, and marker genes of pGOAL17 plasmid, KmR, lacZ+ This study
pAB1 pJET1.2 carrying first flank of bacA gene This study
pAB2 pJET1.2 carrying second flank of bacA gene This study
pAB3 p2NIL carrying first flank of bacA gene This study
pAB4 p2NIL carrying first and second flank of bacA gene This study
pAB5 p2NIL plasmid carrying flanking sequences of deletion within bacA gene, and marker genes of pGOAL17 plasmid, KmR, lacZ+ This study
pAM6 pJET1.2 carrying metE promoter region This study
pAM7 pJET1.2 carrying gfp This study
pAM8 pMV306 carrying metE promoter region This study
pAM9 pMV306 plasmid carrying green fluorescence protein (GFP) gene under the control of the riboswitch of M. tuberculosis metE gene This study

Figure 6.

Figure 6

Southern blots confirming deletion of genes cobIJ and bacA in M. tuberculosis H37Rv. We used a gene replacement method through homologous recombination to obtain unmarked genetic mutants with large deletions inside the genes. Single cross-over (SCO) describes an intermediate step of mutagenesis. The images are cropped, hence altered lane numbering. Full-size images can be found in the supplementary data.

Vitamin B12 ELISA

Bacterial cultures were spinned down, washed with fresh medium without supplements, spinned down again, and re-suspended in 0.01 M TRIS pH 7.5. The mixture was transferred to disruptor eppendorfs. Cells were disrupted twice using the MP disruptor system with the Quick prep adapter (MP Biomedicals) and 0.1 mm silica spheres (45 s, 6.0 m/s with 5 min intervals). Samples were spinned down, and lysates were transferred to new eppendorfs. As a principal, we normalized the results regarding vitamin B12 concentration to protein concentration in cell lysates. We wanted to avoid errors resulting from a different level of difficulty to disrupt mycobacterial cells of different species. Protein concentration in lysates was measured using Bradford reagent (BioShop) and estimated with a standard curve. In order to achieve a sufficient detection limit of vitamin B12, we only used the lysates that contained at least 0.5 mg of protein per ml, preferably between 1 and 2 mg of protein per ml.

Vitamin B12 ELISA (Demeditec) was performed according to manufacturer instructions. The test is based on the principle of the competitive enzyme-linked immunosorbent assay. The surface of a microtiter plate was covered with an antibody directed against vitamin B12 by the manufacturer. Samples and standards were mixed with a vitamin B12-peroxidase conjugate in the wells of the microtiter plate. Both enzyme-labeled and free vitamin B12 competed for the antibody binding sites. After one hour of incubation at room temperature, the wells were washed to remove the unbound material. A substrate solution was added, resulting in the development of a blue color. The color development was inhibited by the addition of a stop solution, and the color turned yellow. The yellow color was measured photometrically at 450 nm. The concentration of vitamin B12 was indirectly proportional to the color intensity of the test sample.

For each condition, we analyzed lysates from three independent cultures. Each sample was analyzed in duplicate wells, as recommended by the producer of the immunoassay. The minimum detection level of vitamin B12 was settled at 1 ng/ml based on our previous observations17, and all samples below this level were considered negative for vitamin B12. For purposes of enabling comparison with the results obtained from other species of bacteria, our results were also normalized to ml of culture.

Flow cytometer analysis

Samples of cultures were analyzed on the flow cytometer Guava EasyCyte Flow Cytometer with High Power Blue Laser (Merck) suitable for detection of bacteria. Unstained control samples were diluted to reach a concentration of 400–800 cells/μl. Cell suspensions were first run through the flow cytometer to set a population gate around the bacteria by using the forward-scatter versus side-scatter parameters. Next, the voltages in the green fluorescence channel were adjusted so that the fluorescence histogram of the unstained bacteria appeared within the first compartments of the logarithmic scale of fluorescence. Ten thousand events were collected at a set standard low event rate. We used Guava software to analyze the acquired data. For each strain, we analyzed data from three cultures.

qPCR

Bacterial cultures were spinned down, re-suspended in water, and three volumes of TriReagent was added (Bioshop). The mixture was transferred to disruptor eppendorfs. Cells were disrupted twice using the MP disruptor system with the Quick prep adapter (MP Biomedicals) and 0.1 mm silica spheres (45 s, 6.0 m/s with 5 min intervals). Samples were spinned down, and the supernatant was transferred to new eppendorfs. One volume of chloroform was added, samples were vigorously mixed and spinned down. The top phase was transferred to new eppendorfs and precipitated with 1 volume of isopropanol and 1/10 volume of sodium acetate. Following precipitation, samples were re-suspended in water and digested with Turbo DNase I (Invitrogen by Thermo Fisher Scientific) following the manufacturer's instructions. The RNA quantity was assessed using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). cDNA was obtained using SuperScript III First-Strand Synthesis Super Mix kit with random hexamers (Invitrogen). qPCR was performed using SG qPCR Master Mix (2×), plus ROX Solution (Eurx), and synthetic primers (Table 5) on a 7900HT real-time PCR system (Applied Biosystems). Real-time PCR conditions were as follows: initial activation at 95 °C for 10 min, followed by 40 cycles at 94 °C for 15 s (denaturation), 62 °C for 30 s (annealing), 72 °C for 30 s (extension). The melting curve analysis was performed at the end of each qPCR reaction to verify a single, specific product was generated. The threshold cycle (CT) value for each studied gene was normalized to the expression of msmeg_2758 (sigA) (ΔCT) and converted to linear form (2 − ΔCT). The RNA samples for each strain were isolated from three independently grown cultures. Each sample for qPCR was run in triplicate.

RNA Seq

Raw RNA Seq reads were downloaded from European Nucleotide Archive Database (ENA). We analyzed gene expression of M. abscessus subsp. abscessus grown in 7H9 medium supplemented with OADC40, M. smegmatis grown in 7H9 medium with glucose41, and three experiments performed with M. tuberculosis H37Rv grown in 7H9 broth supplemented with OADC20, in a medium supplemented with cholesterol as a sole carbon source21 and in human THP-1 derived macrophages three days post-infection. Each experiment contained data for three replicates. Raw sequences were uploaded and processed with Geneious Prime 2021 (Biomatters, New Zealand). Reads were mapped to M. tuberculosis H37Rv accession number NC_000962 using Bowtie2 Geneious plug-in42. Gene expression analysis, through estimation of transcripts per kilobase million (TPM), was performed with Geneious.

Identification of loci in the whole genome sequencing data based on the genome annotation

We identified genes involved in vitamin B12 metabolism in the following strains: M. tuberculosis H37Rv (NC_000962), M. abscessus subsp. abscessus ATCC19977 (NC_010397), M. abscessus subsp. bolletii FLAC 003 (CP014950), M. conspicuum JCM 14738 (GCA_010730195), M. fortuitum CT6 (CP011269), M. gastri DSM 43505 (LQOX1000000), M. gordonae 24T (CP059165), M. innocens MK13 (LS999933), M. kansasii ATCC 12478 (GCA_000157895.1), M. persicum H48 (GCA_002705835), M. phlei CCUG 21000 (GCA_001582015), M. porcinum ACS 3670 (NZ_MBDY01000007.1), M. terrae NCTC 10856 (GCA_900187145), M. xenopi RIVM700366 (NZ_AJFI01000095.1), M. szulgai DSM 44166 (NZ_LQPW01000016.1) and M. smegmatis mc2 155 (CP009494). We screened the following databases: National Center of Biotechnology Information, Nucleotide and Protein (NCBI), Mycobrowser, STRING, UniProt, and we manually screened the sequences thru Geneious Prime (Biomatters, New Zealand).

Statistical analysis

Statistical analysis was performed with Develve Statistical Software, with paired t-test. The level of statistical significance was p < 0.05. All results are reported as the means ± SD unless otherwise stated.

Supplementary Information

Supplementary Figures. (302.8KB, pdf)

Acknowledgements

This work was performed within the FATE research consortium (https://fate-consortium.org/). This work is part of the research project financed by the National Science Center of Poland, Grant No. 2015/19/D/NZ6/03011. We are grateful to Heather Adam for providing strains for this research.

Author contributions

A.M. and J.D. designed the study. A.M., F.G., A.B. carried out the experiments. T.J. provided strains. A.M. wrote the manuscript. F.G., T.J., and J.D. corrected the manuscript. A.M. and J.D. supervised the project.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Contributor Information

Alina Minias, Email: alinagorna@gmail.com.

Jarosław Dziadek, Email: jdziadek@cbm.pan.pl.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-021-91430-w.

References

  • 1.Acevedo-Rocha CG, Gronenberg LS, Mack M, Commichau FM, Genee HJ. Microbial cell factories for the sustainable manufacturing of B vitamins. Curr. Opin. Biotechnol. 2019;56:18–29. doi: 10.1016/j.copbio.2018.07.006. [DOI] [PubMed] [Google Scholar]
  • 2.Fang H, Kang J, Zhang D. Microbial production of vitamin B12: A review and future perspectives. Microb. Cell Fact. 2017;16:15. doi: 10.1186/s12934-017-0631-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Chimento DP, Kadner RJ, Wiener MC. The Escherichia coli outer membrane cobalamin transporter BtuB: Structural analysis of calcium and substrate binding, and identification of orthologous transporters by sequence/structure conservation. J. Mol. Biol. 2003;332:999–1014. doi: 10.1016/j.jmb.2003.07.005. [DOI] [PubMed] [Google Scholar]
  • 4.Domenech P, Kobayashi H, LeVier K, Walker GC, Barry CE. BacA, an ABC transporter involved in maintenance of chronic murine infections with Mycobacterium tuberculosis. J. Bacteriol. 2009;191:477–485. doi: 10.1128/JB.01132-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Larsson K-M, Logan DT, Nordlund P. Structural basis for adenosylcobalamin activation in AdoCbl-dependent ribonucleotide reductases. ACS Chem. Biol. 2010;5:933–942. doi: 10.1021/cb1000845. [DOI] [PubMed] [Google Scholar]
  • 6.Dorweiler JS, Finke RG, Matthews RG. Cobalamin-dependent methionine synthase: Probing the role of the axial base in catalysis of methyl transfer between methyltetrahydrofolate and exogenous cob(I)alamin or cob(I)inamide. Biochemistry. 2003;42:14653–14662. doi: 10.1021/bi035525t. [DOI] [PubMed] [Google Scholar]
  • 7.Banerjee R, Ragsdale SW. The many faces of vitamin B12: Catalysis by cobalamin-dependent enzymes. Annu. Rev. Biochem. 2003;72:209–247. doi: 10.1146/annurev.biochem.72.121801.161828. [DOI] [PubMed] [Google Scholar]
  • 8.Serganov A, Nudler E. A decade of riboswitches. Cell. 2013;152:17–24. doi: 10.1016/j.cell.2012.12.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Supply P, et al. Genomic analysis of smooth tubercle bacilli provides insights into ancestry and pathoadaptation of Mycobacterium tuberculosis. Nat. Genet. 2013;45:172–179. doi: 10.1038/ng.2517. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Young DB, Comas I, de Carvalho LPS. Phylogenetic analysis of vitamin B12-related metabolism in Mycobacterium tuberculosis. Struct. Biol. 2015;2:6. doi: 10.3389/fmolb.2015.00006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Warner DF, Savvi S, Mizrahi V, Dawes SS. A riboswitch regulates expression of the coenzyme B12-independent methionine synthase in Mycobacterium tuberculosis: Implications for differential methionine synthase function in strains H37Rv and CDC1551. J. Bacteriol. 2007;189:3655–3659. doi: 10.1128/JB.00040-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gopinath K, et al. A vitamin B12 transporter in Mycobacterium tuberculosis. Open Biol. 2013 doi: 10.1098/rsob.120175. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Savvi S, et al. Functional characterization of a vitamin B12-dependent methylmalonyl pathway in Mycobacterium tuberculosis: Implications for propionate metabolism during growth on fatty acids. J. Bacteriol. 2008;190:3886–3895. doi: 10.1128/JB.01767-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Guzzo MB, et al. Methylfolate trap promotes bacterial thymineless death by sulfa drugs. PLoS Pathog. 2016;12:e1005949. doi: 10.1371/journal.ppat.1005949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Minias A, Minias P, Czubat B, Dziadek J. Purifying selective pressure suggests the functionality of a vitamin B12 biosynthesis pathway in a global population of Mycobacterium tuberculosis. Genome Biol. Evol. 2018 doi: 10.1093/gbe/evy153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ignatov DV, et al. Dormant non-culturable Mycobacterium tuberculosis retains stable low-abundant mRNA. BMC Genomics. 2015;16:954. doi: 10.1186/s12864-015-2197-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Czubat B, et al. Functional disassociation between the protein domains of MSMEG_4305 of Mycolicibacterium smegmatis (Mycobacterium smegmatis) in vivo. Front. Microbiol. 2020;11:2008. doi: 10.3389/fmicb.2020.02008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kipkorir T, et al. De novo cobalamin biosynthesis, transport and assimilation and cobalamin-mediated regulation of methionine biosynthesis in Mycobacterium smegmatis. J. Bacteriol. 2021 doi: 10.1128/JB.00620-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Karasseva V, Weiszfeiler JG, Lengyel Z. Synthesis of vitamin B12 by various species of mycobacteria. Zentralbl Bakteriol Orig. A. 1977;239:514–520. [PubMed] [Google Scholar]
  • 20.Płociński P, et al. Proteomic and transcriptomic experiments reveal an essential role of RNA degradosome complexes in shaping the transcriptome of Mycobacterium tuberculosis. Nucleic Acids Res. 2019;47:5892–5905. doi: 10.1093/nar/gkz251. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Talwar S, et al. Role of VapBC12 toxin-antitoxin locus in cholesterol-induced mycobacterial persistence. mSystems. 2020;5:e00855. doi: 10.1128/mSystems.00855-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Coskun FS, et al. sncRNA-1 is a small noncoding RNA produced by mycobacterium tuberculosis in infected cells that positively regulates genes coupled to oleic acid biosynthesis. Front. Microbiol. 2020;11:1631. doi: 10.3389/fmicb.2020.01631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kuron A, et al. Evaluation of DNA primase DnaG as a potential target for antibiotics. Antimicrob. Agents Chemother. 2014;58:1699–1706. doi: 10.1128/AAC.01721-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Li J, Ge Y, Zadeh M, Curtiss R, Mohamadzadeh M. Regulating vitamin B12 biosynthesis via the cbiMCbl riboswitch in propionibacterium strain UF1. PNAS. 2020;117:602–609. doi: 10.1073/pnas.1916576116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Nahvi A, Barrick JE, Breaker RR. Coenzyme B12 riboswitches are widespread genetic control elements in prokaryotes. Nucleic Acids Res. 2004;32:143–150. doi: 10.1093/nar/gkh167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Pisu D, Huang L, Grenier JK, Russell DG. Dual RNA-Seq of Mtb-infected macrophages in vivo reveals ontologically distinct host–pathogen interactions. Cell Rep. 2020;30:335–350.e4. doi: 10.1016/j.celrep.2019.12.033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Bachmann NL, et al. Key transitions in the evolution of rapid and slow growing mycobacteria identified by comparative genomics. Front. Microbiol. 2020;10:3019. doi: 10.3389/fmicb.2019.03019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Crespo A, Blanco-Cabra N, Torrents E. Aerobic vitamin B12 biosynthesis is essential for Pseudomonas aeruginosa class II ribonucleotide reductase activity during planktonic and biofilm growth. Front. Microbiol. 2018;9:986. doi: 10.3389/fmicb.2018.00986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Deptula P, et al. Food-like growth conditions support production of active vitamin B12 by Propionibacterium freudenreichii 2067 without DMBI, the lower ligand base, or cobalt supplementation. Front. Microbiol. 2017;8:368. doi: 10.3389/fmicb.2017.00368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Arnold FH. Design by directed evolution. Acc. Chem. Res. 1998;31:125–131. doi: 10.1021/ar960017f. [DOI] [Google Scholar]
  • 31.Ngabonziza JCS, et al. A sister lineage of the Mycobacterium tuberculosis complex discovered in the African Great Lakes region. Nat. Commun. 2020;11:2917. doi: 10.1038/s41467-020-16626-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Reyrat JM, Kahn D. Mycobacterium smegmatis: an absurd model for tuberculosis? Trends Microbiol. 2001;9:472–474. doi: 10.1016/S0966-842X(01)02168-0. [DOI] [PubMed] [Google Scholar]
  • 33.Rempel S, et al. A mycobacterial ABC transporter mediates the uptake of hydrophilic compounds. Nature. 2020;580:409–412. doi: 10.1038/s41586-020-2072-8. [DOI] [PubMed] [Google Scholar]
  • 34.Sokolovskaya OM, Shelton AN, Taga ME. Sharing vitamins: Cobamides unveil microbial interactions. Science. 2020;369:eaba0165. doi: 10.1126/science.aba0165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Minias A, et al. Subspecies-specific sequence detection for differentiation of Mycobacterium abscessus complex. Sci. Rep. 2020;10:16415. doi: 10.1038/s41598-020-73607-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Krawczyk M, et al. Epidemiological analysis of Mycobacterium tuberculosis strains isolated in Lodz. Poland. Int. J. Tuberc. Lung Dis. 2011;15:1252–1258. doi: 10.5588/ijtld.10.0718. [DOI] [PubMed] [Google Scholar]
  • 37.Tan MP, et al. Nitrate respiration protects hypoxic Mycobacterium tuberculosis against acid- and reactive nitrogen species stresses. PLoS One. 2010;5:e13356. doi: 10.1371/journal.pone.0013356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Mavi PS, Singh S, Kumar A. Reductive stress: new insights in physiology and drug tolerance of mycobacterium. Antioxid. Redox Signal. 2020;32:1348–1366. doi: 10.1089/ars.2019.7867. [DOI] [PubMed] [Google Scholar]
  • 39.Parish T, Stoker NG. Use of a flexible cassette method to generate a double unmarked Mycobacterium tuberculosis tlyA plcABC mutant by gene replacement. Microbiology (Reading, England) 2000;146(Pt 8):1969–1975. doi: 10.1099/00221287-146-8-1969. [DOI] [PubMed] [Google Scholar]
  • 40.Miranda-CasoLuengo AA, Staunton PM, Dinan AM, Lohan AJ, Loftus BJ. Functional characterization of the Mycobacterium abscessus genome coupled with condition specific transcriptomics reveals conserved molecular strategies for host adaptation and persistence. BMC Genomics. 2016;17:553. doi: 10.1186/s12864-016-2868-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Oh Y, et al. The partner switching system of the SigF sigma factor in Mycobacterium smegmatis and induction of the SigF regulation under respiration-inhibitory conditions. Front. Microbiol. 2020;11:588487. doi: 10.3389/fmicb.2020.588487. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat. Methods. 2012;9:357–359. doi: 10.1038/nmeth.1923. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Figures. (302.8KB, pdf)

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES