Abstract
Di-isononyl phthalate (DIP) is considered a high molecular weight subtype of phthalates that are commonly used (to make plastics more durable) and could easily affect the gastrointestinal tract (GIT). Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) are the main active components of fish oil (FO), and their antiinflammatory potential was previously documented. The current study was designed to investigate the protective potential of fish oil against the impact of DIP exposure on the colon of albino Wistar rats. Sixty albino Wistar rats were divided into control group received corn oil for ten days. DIP treated group received DIP. Diisononyl phthalate + fish oil treated group received both DIP and FO three groups: the control group received corn oil for ten days, the DIP treated group received DIP, and the DIP + FO treated group received both DIP and FO.. FO was found to preserve the histological architecture, tight junction, and cell cycle of the colon. In conclusion, the current study provided an evidence that FO has a protective potential against DIP, and further examination are suggested to fully understand the molecular basis of this potential as a step for further clinical applications.
Key words: Di-isononyl phthalate, gastrointestinal tract, fish oil, tight junction, apoptosis
Introduction
Phthalate is one of the commonly used petroleum derivatives that was introduced since 1925 for commercial purposes.1 It is used as plasticizers (increasing the flexibility of plastic products) that are further used for food packaging or as solvents that are used in daily personal care products. As phthalates are commonly used in modern daily life, they could be inhaled or digested.2 Di-isononyl phthalate (DIP) is considered a high molecular weight subtype of phthalates. Previous studies had reported the toxic effect of DIP on various body organs such as reproductive and gastrointestinal tract (GIT).3,4 Fish oil (FO) is extracted from salmon, sardines, and mackerel and marketed as a dietary supplement that could protect against cardiovascular diseases, hypertension, Alzheimer disease, and Crohn’s disease.5 It is very rich in eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) with their known anti-inflammatory potential that could protect the epithelial lining.6,7 The current study was designed to investigate the protective potential of fish oil against the impact of DIP exposure on the colon of albino Wistar rats.
Materials and Methods
Chemicals
DIP (product # 376663), FO (product # F8020) and corn oil (vehicle) (product # C8267) were purchased from Sigma-Aldrich (St. Louis, MO, USA). All other chemicals and reagents were purchased from China National Pharmaceutical Group Co., Ltd. (Sinopharm) (Beijing, China).
Animals and experimental design
Sixty albino Wistar rats were used (eight weeks old, regardless of sex). Average weight was 200 g. Animals were individually housed as per the following conditions: Free access to food (El- Nasr pharmaceutical company, Egypt) and water, 12 light/dark cycles, temperature 25°C and humidity 55% (in accordance with national and institutional guidelines), all animal experiments were done in compliance with the ARRIVE guidelines. Chow and water consumption in addition to mortality and health status were recorded daily. At the end of the 7th day, the rats were divided into three groups (n=20). Control group (C-group) received corn oil vehicle (0.2 mL) on a daily basis for ten days by oral gavage, DIP treated group (DIP-group) received DIP (200 mg/kg b.w.)8 on a daily basis for ten days by oral gavage and DIP +FO treated group (DIP-FOgroup) received DIP (200 mg/kg b.w.) in addition to FO (0.2 ml) on a daily basis for ten days by oral gavage.9 At the end of the 10th day, all rats were euthanized by intraperitoneal injection of sodium pentobarbital (60 mg / kg b.w.).10 Anterior abdominal wall was opened, and the colon was dissected and cut into two halves. The first half was fixed in 10% formalin for histopathological examination, while the other one was homogenized in phosphate buffered saline and preserved in - 80°C for further biochemical studies.
Histological examination
Hematoxylin and eosin staining was done in accordance with Slaoui and Fiette.11 Briefly, fresh colon tissue was cut into 0.5 cm3 pieces and placed in fixative 10% formalin for 48 h. After dehydrated tissue was immersed in paraffin that were cut into 5 μm thick sections. Tissue sections were stained with hematoxylin and eosin. Ten nonoverlapping fields per section were examined by two expert histopathologists blinded to the study and then scoring was done as per lesion severity as shown in (Table 1).
Terminal deoxynucleotidyl transferase biotin-dUTP nick end labeling (TUNEL) assay
After dilution with antibody diluent, TUNEL Assay Kit - HRPDAB (ab206386; dilution 1:1000 was mounted on the tissue as per the manufacturer protocol and incubated for 12 h at 4°C. Slides were washed by wash buffer for 3 min and then covered with 2 drops of signal stain boost detection reagent followed by incubation at room temperature in a humidified chamber for 30 min. 200 μL of SignalStain® DAB (Biocompare, San Francisco, CA, USA) were applied to each section.12 After staining, the slides were immersed in distilled water and then counterstained with hematoxylin to stain nuclei in blue for better visualization. Coverslips were applied. Images were analyzed by Image J 1.24 software and the percentage of TUNEL positive nuclei in ten non-overlapping fields per section was assessed (both the villi-lining epithelium and connective tissue were considered for scoring).
Real-time quantitative PCR analysis
Real-time PRC (Model: 7900HT; Thermo Fisher, Waltham, MA, USA) was used for quantification of inflammatory gut integrity and cell regulator related genes. Colon samples were lysed by the help of SE-Quoia Kit (Bio-Rad, Hercules, CA, USA),13 then transcription of RNA to cDNA was performed. PCR conditions were [initial denaturation at 96°C (4 min.), forty cycles of 96°C (20 s), 63°C (30 s), and 72°C (30 s)]. The primer sequences for each gene were summarized in Table 2.
Statistical analysis
Statistical Package for Social Sciences (SPSS) software, 20 V. (SPSS Inc., USA) was used for data analysis. The statistical significance of differences between groups was validated using one-way analysis of variance (ANOVA). Newman-Keuls post-hoc test was used for group comparison. Data were expressed in mean ± standard deviation (SD) and the probability value was considered significant if <0.05.
Results
Effect of FO supplement on the histopathological architecture of the colon after DIP ingestion
Light microscope examination of tissue stained with hematoxylin and eosin revealed a severe disturbance of histopathological architecture in DIP-group; it appeared in the form of oedema, sloughing with inflammatory cells infiltration. While C-group and DIP-FO-group showed a normal architecture. Histopathological scoring revealed a significant increase in DIP-group compared to C-group, while the scoring was comparable in DIP-FO-group and C-group (Figure 1).
Effect of FO supplement on the apoptotic scoring of the
Table 1.
Histopathological scoring of colon.
| Score | Histopathological finding |
|---|---|
| 0 | Normal architecture |
| 1 | Inflammatory cells infiltration |
| 2 | Colon wall oedema and sloughing |
| 3 | Abberant colon wall |
Table 2.
List of primers sequences used for the analysis of gene expression.
| Gene | Forward primer sequence | Reverse primer sequence | |
|---|---|---|---|
| Inflammation | Interleukin 17 A (IL-17A) | GCCCTCAGACTACCTCAACC | CAGCTTTCCCTCCGCATTGA |
| Interleukin 13 (IL-13) | CTCTTGCTTGCCTTGGTGGT | CTCCATACCATGCTGCCGTT | |
| Interleukin 6 (IL-6) | ACAAAGCCAGAGTCCTTCAG | AGAGCATTGGAAATTGGGT | |
| Interleukin 5 (IL-5) | TGACTCTCAGCTGTGTCTGG | AAGCCTCATCGTCATTGCAA | |
| Interleukin 4 (IL-4) | CTCGAATGTACCAGGAGCA | GTGGTGTTCTTCGTTGCTGT | |
| Tumor necrosis factor (TNF) | AGAGGCAGACCATTGTTCA | CCTTGGTGGTGGAAATCCG | |
| Interferon gamma (IFNG) | CTACCTAGAGCGTTCTGGT | GCATTAAGCCATACCTCAGA | |
| Gut integrity | Zonula occludens-1 (ZO-1) | ATGTTTATGCGGACGGTGG | TTTCCTCCATTGCTGTGCTCTTA |
| Zonula occludens-2 (ZO-2) | GCAGCTTGTAGTTCTGAGCCG | ACTGCTCCCATATCACCTCCT | |
| Zonula occludens-3 (ZO-3) | AAGTGGGGGCTGATTGTTTCCA | AGTGTGGCTGTGTGTTGTTCC | |
| Occludin (OCLN) | GGTCCTCCTGGCTCAGTTG | AAGATAAGCGAACCTTGGCGG | |
| Claudin 1 (CLDN-1) | CTACGAGGGACTGTGGATGT | ATTACCATCAAGGCTCGGGT | |
| Claudin 4 (CLDN-4) | AGCAAACGTCCACTGTCCTT | GGGGCGTAATGGCAAGAGTA | |
| Cell regulators | B-cell lymphoma 2 (BCL2) | ATGCCTTTGTGGAACTATATGGC | GGTATGCACCCAGAGTGATGC |
| Apoptosis-inducing factor 1 (AIFM1) | AGGACGGTGAGCAACATGAA | GTTCTATCCACCCATCCCGC | |
| B-cell lymphoma 2 like 10 (BCL2L10) | CGCTACACACACTGACTGGA | CTTTAGGATCCCCTGCCCTG | |
| Cyclin B1 (CCNB1) | TGCATTCTCTCAGTGCCCTCCACA | AGACAGGAGTGGCGCCTTGGT | |
| Cyclin D2 (CCND2) | CCTTTGACGCAGGCTCCCTTCT | ACCCTGGTGCACGCATGCAAA | |
| Cyclin A2 (CCNA2) | GCTCTACTGCCCGGAGGCTGA | TGGCCTACATGTCCTCTGGGGAA | |
| Cyclin E1 (CCNE1) | GGTGTCCTCGCTGCTTCTGCTT | CCGGATAACCATGGCGAACGGA | |
| Cyclin dependent kinase inhibitor 1A (CDKN1A) | TTAGGCAGCTCCAGTGGCAACC | ACCCCCACCACCACACACCATA | |
| Cyclin dependent kinase 4 (CDK4) | AGAAACCCTCGCTGAAGCGGCA | TGGGGGTGAACCTCGTAAGGAGA | |
| Control | Actin, beta | GGGCACAGTGTGGGTGAC | CTGGCACCACACCTTCTAC |
Figure 1.

Photomicrographs of colon stained with hematoxylin and eosin (400x), (n=20).(A) Represents C-group with normal histological arrangement. B) Represents DIP-group with inflammatory cells infiltration (green arrow) in addition to wall oedema. C) Represents DIP-FO-group with regain of normal histological architecture. D) Represents histopathological scoring. DIP-group shows a significant (p<0.05) increase of the scoring if compared with C-group, while DIP-FO-group shows a significant (p<0.05) decrease of the scoring if compared to DIP-group. *Significant (p<0.05) difference in comparison to C-group; #significant (p<0.05) difference in comparison to DIP-group. Data are presented as mean ± SD.
colon after DIP ingestion
Light microscope examination of tissue stained with TUNEL revealed a strong positive reaction in DIP-group. While C-group and DIP-FO-group showed negative and weak reaction respectively (Figure 2).
Effect of FO supplement on cell cycle, inflammation, and tight junction regulating genes expression of the colon after DIP ingestion
DIP-group showed a significant decrease of cell cycle regulating genes [cyclin A2 (CCNA2), cyclin B1 (CCNB1), cyclin D2 (CCND2), cyclin E1 (CCNE1), cyclin Dependent Kinase 4 (CDK4), cyclin Dependent Kinase Inhibitor 1A (CDKN1A)] if compared to C-group. On the other hand, these gene expressions were comparable in both C-group and DIP-FO-group (Figure 3). Additionally, DIP-group showed a significant decrease of B-cell lymphoma 2 (BCL2) associated with a significant increase of apoptosis Inducing Factor Mitochondria Associated 1 (AIFM1) and BCL2 Like 10 (BCL2L10) If compared to C-group (Figure 3). DIP-group showed a significant increase of inflammation regulating genes [interleukin 4 (IL4), interleukin 5 (IL5), interleukin 6 (IL6), interleukin 13 (IL13), interleukin 17A (IL17A), tumor necrosis factor (TNF), interferon Gamma (IFNG)] if compared to C-group. On the other hand, these gene expressions were comparable in both C-group and DIP-FO-group (Figure 4). DIP-group showed a nonsignificant change of gene expression responsible for tight junctions (zonula occludens-1 (ZO-1), zonula occludens-2 (ZO-2), claudin 1 (CLDN1), claudin 4 (CLDN4), occludin (OCLN) associated with a significant decrease of zonula occludens- 3 (ZO-3) gene expression if compared to C-group. On the other hand, these gene expressions were comparable in both Cgroup and DIP-FO-group (Figure 5).
Discussion
DIP is commonly used in modern life in food packaging or cosmetics, so it could be easily ingested causing pathological changes in the GIT. In a previous study,14 FO was found to protect against enterocolitis in a rat model. Herein, we explore the potential of FO supplementation to protect the colon against changes caused by DIP ingestion.
Current study showed a severe oedema and sloughing of the colon wall with inflammatory cells infiltration in DIP-group. This comes in consistent with Yu et al.,15 who reported the same changes in the small intestine. The antioxidant effect of FO was well documented,16 due to its content of EPA and DHA, which may provide an explanation to the normal histological architecture noticed in DIP-FO-group. As estradiol (E) is synthesized in Peyer’s patches,17 DIP was also reported to decrease the E level,18 which may shed light on the potential of DIP to affect both the structure and endocrine function of GIT.
Figure 2.

Photomicrographs of colon stained with TUNEL (400x), (n=20). A) Represents C-group with negative reaction. B) Represents DIP-group with strong positive reaction. C) Represents DIP-FO-group with weak positive reaction. D) TUNEL scoring. DIP-group shows a significant (p<0.05) increase of the scoring if compared with C-group, while DIP-FO-group shows a significant (p<0.05) decrease of the scoring if compared to DIP-group. *Significant (p<0.05) difference in comparison to C-group; #significant (p<0.05) difference in comparison to DIP-group. Data are presented as mean ± SD.
In the current study, DIP-group showed a significant decrease of cell cycle regulating genes (CCNA2, CCNB1, CCND2, CCNE1, CDK4, CDKN1A),19 if compared to C-group. On the other hand, these gene expressions were comparable in both Cgroup and DIP-FO-group. Additionally, DIP-group showed a significant decrease of BCL2 associated with a significant increase of AIFM1 and BCL2L10 if compared to C-group. This is consistent with a previous study,20 which reported that the balance between pro- and anti-apoptotic factors did change in the ovary after phthalate exposure, depending on the concentration used; those findings may explain the increased apoptotic activity we noticed in the colon after DIP ingestion and provides a clue for the anti-apoptotic potential of FO.
DIP-group showed a significant increase of inflammation regulating genes (IL4, IL5, IL6, IL13, IL17A, TNF, IFNG),21,22 if compared to C-group. These inflammatory mediators could play a crucial role in the extrinsic pathway of apoptosis,23 which may explain the increased TUNEL reaction in DIP-group. On the other hand, these genes expression were comparable in both C-group and DIP-FO-group.
The essential role of colon epithelium tight junction in immunity was reported previously. Al-Sadi et al.24 had shown disturbed permeability of small intestine in response to phthalate ingestion. In the current results, DIP-group showed a nonsignificant change of gene expression responsible for tight junctions (ZO-1, ZO-2, CLDN1, CLDN4, OCLN)25 associated with a significant decrease of ZO-3 gene expression if compared to C-group which may allow pathogens to penetrate into colon wall causing further inflammation. 26 On the other hand, these gene expressions were comparable in both C-group and DIP-FO-group. Which could prove the ability of FO to maintain the tight junction integrity between colon cells, enhancing its immunity role.27
Figure 3.

Cell cycle regulation genes expression estimated in the colon by real-time quantitative PCR. DIP-group showed a significant (p<0.05) decrease of cell cycle regulating genes (CCNA2, CCNB1, CCND2, CCNE1, CDK4, CDKN1A) if compared to Cgroup. On the other hand, these genes expression were comparable in both C-group and DIP-FO-group. Additionally, DIPgroup showed a significant (p<0.05) decrease of BCL2 associated with a significant (p<0.05) increase of AIFM1 and BCL2L10 If compared to C-group. *Significant (p<0.05) difference in comparison to C-group; #significant (p<0.05) difference in comparison to DIP-group. Data are presented as mean ± SD.
Figure 4.

Inflammation regulating genes expression estimated in the colon by real-time quantitative PCR. DIP-group showed a significant (p<0.05) increase of inflammation regulating genes (IL4, IL5, IL6, IL13, IL17A, TNF, IFNG) if compared to Cgroup. On the other hand, these genes expression were comparable in both C-group and DIP-FO-group. *Significant (p<0.05) difference in comparison to C-group; #significant (p<0.05) difference in comparison to DIP-group. Data are presented as mean ± SD.
Figure 5.

Tight junction regulating genes expression estimated in the colon by real-time quantitative PCR. DIP-group showed a non-significant change of gene expression responsible for tight junction (ZO-1, ZO-2, CLDN1, CLDN4, OCLN) associated with a significant (p<0.05) decrease of ZO-3 gene expression if compared to C-group. On the other hand, these genes expression were comparable in both C-group and DIP-FO-group. *Significant (p<0.05) difference in comparison to C-group; #significant (p<0.05) difference in comparison to DIP-group. Data are presented as mean ± SD.
The current study used albino Wistar rats; further studies are needed on different species with different dosages before the clinical application. In addition, further studies are needed to explore the potential of FO to preserve the E level, which may reflect its potential to restore the endocrine functions of GIT after DIP ingestion.
In conclusion, the current study provided an evidence that FO could preserve the histological architecture, tight junction, and cell cycle of the colon in adult albino Wistar rats after ingestion of DIP for further examinations to be done to fully understand the molecular basis of this potential as a step for further clinical applications.
References
- 1.Zhang H, Hua Y, Chen J, Li X, Bai X, Wang H. Organismderived phthalate derivatives as bioactive natural products. J Environ Sci Health C Environ Carcinog Ecotoxicol Rev 2018;36:125-44. [DOI] [PubMed] [Google Scholar]
- 2.Bølling AK, Sripada K, Becher R, Bekö G. Phthalate exposure and allergic diseases: Review of epidemiological and experimental evidence. Environ Int 2020;139:105706. [DOI] [PubMed] [Google Scholar]
- 3.Chiu K, Bashir ST, Nowak RA, Mei W, Flaws JA. Subacute exposure to di-isononyl phthalate alters the morphology, endocrine function, and immune system in the colon of adult female mice. Sci Rep 2020;10:18788. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Forner-Piquer I, Maradonna F, Gioacchini G, Santangeli S, Allarà M, Piscitelli F, et al. Dose-specific effects of Diisononyl phthalate on the endocannabinoid system and on liver of female zebrafish. Endocrinology 2017;158:3462-76. [DOI] [PubMed] [Google Scholar]
- 5.Tummala R, Ghosh RK, Jain V, Devanabanda AR, Bandyopadhyay D, Deedwania P, Aronow WS. Fish oil and cardiometabolic diseases: recent updates and controversies. Am J Med 2019;132:1153-9. [DOI] [PubMed] [Google Scholar]
- 6.Harris WS. Understanding why REDUCE-IT was positive - Mechanistic overview of eicosapentaenoic acid. Prog Cardiovasc Dis 2019;62:401-5. [DOI] [PubMed] [Google Scholar]
- 7.Trivedi K, Le V, Nelson JR. The case for adding eicosapentaenoic acid (icosapent ethyl) to the ABCs of cardiovascular disease prevention. Postgrad Med 2021;133:28-41. [DOI] [PubMed] [Google Scholar]
- 8.Ma P, Yan B, Zeng Q, Liu X, Wu Y, Jiao M, et al. Oral exposure of Kunming mice to diisononyl phthalate induces hepatic and renal tissue injury through the accumulation of ROS. Protective effect of melatonin. Food Chem Toxicol 2014;68:247-56. [DOI] [PubMed] [Google Scholar]
- 9.Albert BB, Vickers MH, Gray C, Reynolds CM, Segovia SA, Derraik JGB, et al. Fish oil supplementation to rats fed highfat diet during pregnancy prevents development of impaired insulin sensitivity in male adult offspring. Sci Rep 2017;7:5595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Laferriere CA, Pang DS. Review of intraperitoneal injection of sodium pentobarbital as a method of euthanasia in laboratory rodents. J Am Assoc Lab Anim Sci 2020;59:254-63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Slaoui M, Fiette L. Histopathology procedures: from tissue sampling to histopathological evaluation. Methods Mol Biol 2011;691:69-82. [DOI] [PubMed] [Google Scholar]
- 12.Winston B, Nalesnik M, Bazaz R. TUNEL assay for identifying ablated myocardium. Pacing Clin Electrophysiol 2010;33:1548-9. [DOI] [PubMed] [Google Scholar]
- 13.Singh C, Roy-Chowdhuri S. Quantitative Real-Time PCR: Recent advances. Methods Mol Biol 2016;1392:161-76. [DOI] [PubMed] [Google Scholar]
- 14.Ahmed AS. Potential protective effect of eicosapentaenoic and docosahexaenoic acids versus necrotizing enterocolitis, mitochondrial and rough endoplasmic reticulum stress mediated pathway. Eur J Anat 2021;25:65-73. [Google Scholar]
- 15.Yu J, Wang W, Wang J, Wang C, Li C. Short-term toxicity of dibutyl phthalate to mice intestinal tissue. Toxicol Ind Health 2019;35:20-31. [DOI] [PubMed] [Google Scholar]
- 16.Sadeghi N, Paknezhad F, Rashidi Nooshabadi M, Kavianpour M, Jafari Rad S, Khadem Haghighian H. Vitamin E and fish oil, separately or in combination, on treatment of primary dysmenorrhea: a double-blind, randomized clinical trial. Gynecol Endocrinol 2018;34:804-8. [DOI] [PubMed] [Google Scholar]
- 17.Park CJ, Kim H, Jin J, Barakat R, Lin PC, Choi JM, Ko CJ. Porcine intestinal lymphoid tissues synthesize estradiol. J Vet Sci 2018;19:477-82. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Long SE, Kahn LG, Trasande L, Jacobson MH. Urinary phthalate metabolites and alternatives and serum sex steroid hormones among pre- and postmenopausal women from NHANES, 2013-16. Sci Total Environ 2021;769:144560. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Ma Q. MiR-219-5p suppresses cell proliferation and cell cycle progression in esophageal squamous cell carcinoma by targeting CCNA2. Cell Mol Biol Lett 2019;24:4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Meling DD, Warner GR, Szumski JR, Gao L, Gonsioroski AV, Rattan S, Flaws JA. The effects of a phthalate metabolite mixture on antral follicle growth and sex steroid synthesis in mice. Toxicol Appl Pharmacol 2020;388:114875. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Dos Santos TM, Righetti RF, Camargo LDN, Saraiva-Romanholo BM, Aristoteles LRCRB, de Souza FCR, et al. Effect of Anti-IL17 antibody treatment alone and in combination with rho-kinase inhibitor in a murine model of asthma. Front Physiol 2018;9:1183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Furue K, Ito T, Tsuji G, Ulzii D, Vu YH, Kido-Nakahara M, Nakahara T, Furue M. The IL-13-OVOL1-FLG axis in atopic dermatitis. Immunology 2019;158:281-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Jost PJ, Vucic D. Regulation of cell death and immunity by XIAP. Cold Spring Harb Perspect Biol 2020;12:a036426. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Al-Sadi R, Boivin M, Ma T. Mechanism of cytokine modulation of epithelial tight junction barrier. Front Biosci (Landmark Ed) 2009;14:2765-78. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Murphy EF, Jewell C, Hooiveld GJ, Muller M, Cashman KD. Conjugated linoleic acid enhances transepithelial calcium transport in human intestinal-like Caco-2 cells: an insight into molecular changes. Prostaglandins Leukot Essent Fatty Acids 2006;74:295-301. [DOI] [PubMed] [Google Scholar]
- 26.Siti Sarah CO, Md Shukri N, Mohd Ashari NS, Wong KK. Zonula occludens and nasal epithelial barrier integrity in allergic rhinitis. Peer J 2020;8:e9834. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Chien YW, Peng HC, Chen YL, Pai MH, Wang HY, Chuang HL, et al. Different dietary proportions of fish oil regulate inflammatory factors but do not change intestinal tight junction ZO-1 expression in ethanol-fed rats. Mediators Inflamm 2017;2017:5801768. [DOI] [PMC free article] [PubMed] [Google Scholar]
