Skip to main content
Gut Pathogens logoLink to Gut Pathogens
. 2021 Jun 15;13:39. doi: 10.1186/s13099-021-00434-4

Geographic distribution of the cagA, vacA, iceA, oipA and dupA genes of Helicobacter pylori strains isolated in China

Zhijing Xue 1,#, Hong Yang 2,#, Dongxing Su 3, Xiangfeng Song 4, Xin Deng 5, Changhong Yu 6, Chunhua Sun 7, Lihua He 1, Yuanhai You 1, Yanan Gong 1, Dongjie Fan 1, Lu Sun 1, Xiurui Han 1, Ruyue Fan 1, Maojun Zhang 1, Xiaomei Yan 1, Jiaming Qian 2,, Jianzhong Zhang 1,
PMCID: PMC8207754  PMID: 34130751

Abstract

Background

There are geographic variations in the genotypes of Helicobacter pylori (H. pylori) cagA, vacA, iceA, oipA and dupA. The aim of the study was to investigate the distribution of these genotypes among H. pylori strains from five regions of China and their association with clinical outcomes.

Materials and methods

Gastric biopsy specimens were obtained from 348 patients with different gastrointestinal diseases in the five regions of China. The regional distribution was 89 patients from Shandong, 91 from Guangxi, 57 from Hunan, 58 from Qinghai and 53 from Heilongjiang. The presence of cagA, vacA, iceA, oipA and dupA genotypes was determined by polymerase chain reaction (PCR) from H. pylori DNA.

Results

A total of 269 H. pylori isolates were obtained, of which 74 isolates were from Shandong, 78 from Guangxi, 46 from Hunan, 33 from Qinghai and 38 from Heilongjiang. The cagA-positive status was predominant in the five regions. The predominant vacA genotypes were s1c (73.4%), m2 (70.6%) and i1 (92.9%). In strains from Shandong, s1a and m1 were dominant. By contrast, s1c was dominant in Guangxi and i1 was dominant in Hunan and Heilongjiang. The prevalence of m2 subtype in Qinghai (78.8%) was significantly higher than that in other regions (P < 0.05). The predominant iceA genotype was iceA1 and the frequency of iceA1 was significantly more prevalent in Hunan than in other regions (P < 0.05). The oipA status “on” gene was more frequent in Shandong (91.9%) and Guangxi (91%) than in Heilongjiang (71.7%) (P < 0.05). Conversely, the dupA-positive status was less than half in Shandong (31.1%) and Guangxi (15.4%), whereas it was 73.9% in Hunan and 81.8% in Qinghai (P < 0.001). There were no significant associations between the cagA, vacA, iceA, oipA genotypes and clinical outcomes. The dupA-positive strains were more common in peptic ulcer disease (PUD) patients than in non-ulcer dyspepsia (NUD) patients in Shandong and Guangxi (P < 0.05), but the association was not observed in other geographic regions.

Conclusions

There was significant geographic diversity of H. pylori genotypes in different regions of China and the presence of dupA gene can be considered as a marker for the development of gastroduodenal diseases. However, the cagA, iceA, vacA and oipA genes cannot be regarded for prediction of the clinical presentation of H. pylori infection in China.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13099-021-00434-4.

Keywords: Helicobacter pylori, Genotype, Virulence genes, PCR, China

Background

Helicobacter pylori (H. pylori) is a chronic infectious pathogen that can lead to gastroduodenal diseases such as chronic gastritis, peptic ulcer disease (PUD), gastric carcinoma (GC) and mucosa associated lymphoid tissue (MALT) lymphoma [41]. Owing to the carcinogenicity of H. pylori, it was classified as a grade I carcinogen by the World Health Organization [3]. It has been proved that more than half of the world’s population are infected with H. pylori and the prevalence of H. pylori has been declining in Western countries, whereas the prevalence has plateaued at a high level in developing countries [21]. H. pylori is characterized by genetic diversity, but the clinical symptoms caused by different strains are variable and considered to be related to the genetic susceptibility and living environment of the host, mainly due to the bacterial virulence factors [40].

Several H. pylori virulence factors, such as cagA, vacA, iceA, oipA and dupA have been identified to play an important role in the pathogenicity of H. pylori [24]. The CagA (cytotoxin-associated gene A) has been considered as an important carcinogen and cagA-positive strains can increase the risk of PUD or GC. There are EPIYA segments in the CagA C-terminal region, which are the tyrosine phosphorylation sites of CagA protein. According to the difference of the amino acid sequences flanking the EPIYA motifs, CagA C-terminal region can be divided into four different segments: EPIYA-A, EPIYA-B, EPIYA-C and EPIYA-D [20].

VacA (vacuolating cytotoxin A), which can induce vacuolation and multiple cellular activities, is encoded by vacA gene, which has distinct alleles [13]. Although vacA is present in all H. pylori strains, it shows allelic variation in three main regions: the signal (s) region (s1a, s1b and s1c, s2), the intermediate (i) region (i1 and i2) and the middle (m) region (m1 and m2) [37]. The different combination of s and m regions determines the production of cytotoxic activity and constitutes mosaic gene structure. Strains with the genotype s1m1 produce high levels of toxin in vitro, followed by s1m2, while s2m1 strains produce low toxicity and s2m2 strains produce little or no toxin [8]. It has been shown that s1m2 strains that contain the i1 allele are vacuolating, whereas strains that contain the i2 allele are non-vacuolating [17]. Studies have shown that s1m1 subtype is highly correlated with PUD and GC [19, 31, 38]. Additional studies also found strains containing the vacA i1 allele can increase the risk of GC [32]. There are geographic variations in the distribution of vacA genotypes in different regions. Many researches have shown that vacA s1a and s1c are predominant in Asia and northern Europe, whereas s1b is common in South America, Southern Europe and South Africa [14, 47]. These differences may lead to diversity in prevalence of gastroduodenal diseases in different geographic regions.

The iceA (induced by contact with epithelium) has two main allelic variants: iceA1 and iceA2, which also has a particular geographic distribution [22]. The iceA1 was common in Japan and Korea while the iceA2 was predominant in the America, Colombia and Europe [35]. The OipA (outer inflammatory protein A) increases inflammatory response by affecting interleukin 8 (IL-8) production. The oipA functional status is regulated by slipped-strand mispairing that is based on the number of CT dinucleotide repeats in the signal sequences of the gene (switch “on” = functional and switch “off” = nonfunctional) [45]. Studies have shown that the prevalence of oipA in duodenal ulcer (DU) and GC is higher, suggesting that oipA is not only associated with inflammation, but also the development of GC [46]. The dupA (duodenal ulcer promoting gene A), first recognized as a marker of H. pylori specific disease, can induce DU and inhibit GC [2].

China is a country with large population, wide area and high incidence of H. pylori infection. In addition, the incidence rate of GC in China is higher than that in the Western countries. Heilongjiang and Qinghai provinces are high risk areas of GC, which are located in the northeast and northwest of China respectively, the mortality rate of GC ranges from 40 to 70 per 100,000 persons, compared to 10 to 20 per 100,000 persons in Guangxi and Hunan, low risk areas of GC, which are located in the South and Central South of China respectively [10]. Shandong province is located in the east of China and the crude mortality rate of GC was 49 per 100,000 persons, accounting for 21% of all malignant cancers [28]. At present, there are many studies focusing on the relationship between H. pylori virulence factors and clinical outcomes in China. However, only a few studies regarded information on the relationship between H. pylori virulence genotypes and different geographic regions. We therefore investigated the distribution of vacA, cagA, iceA, oipA and dupA genotypes in different regions of China and their association with clinical outcomes.

Results

A total of 269 H. pylori isolates out of 348 gastric biopsy specimens from five geographic regions of China were obtained, of which 74 isolates were from Shandong, 78 from Guangxi, 46 from Hunan, 33 from Qinghai and 38 from Heilongjiang. At endoscopy 21 patients presented with PUD. The remaining 248 patients were diagnosed as having non-ulcer dyspepsia (NUD). No patients with GC were included in the study. H. pylori virulence genes cagA, vacA, iceA, oipA and dupA were detected by polymerase chain reaction (PCR) in all isolates and H. pylori genotypes results were summarized in Table 1.

Table 1.

Distribution of virulence genotypes among 269 H. pylori-positive patients with different geographic regions

Genetypes No. of isolates
SD (n = 74) GX (n = 78) HN (n = 46) QH (n = 33) HL (n = 38) Total (n = 269)
cagA 70(94.6) 74(94.9) 46(100) 33(100) 38(100) 261(97)
vacA
 s1 72(97.3) 78(100) 45(97.8) 30(90.9) 38(100) 263(97.8)
 s2 2(2.7) 0 1(2.2) 3(9.1) 0 6(2.2)
 m1 30(40.5) 14(17.9) 10(21.7) 6(18.2) 12(31.6) 72(26.8)
 m2 43(58.1) 61(78.2) 35(76.1) 26(78.8) 25(65.8) 190(70.6)
 i1 66(89.2) 71(91) 46(100) 29(87.9) 38(100) 250(92.9)
 i2 8(10.8) 7(9) 0 4(12.1) 0 19(7.1)
 s1i1m1 22(29.7) 12(15.4) 10(21.7) 6(18.2) 12(31.6) 62(23)
 s1i1m2 42(56.8) 53(67.9) 34(73.9) 22(66.7) 25(65.8) 176(65.4)
 s1i2m1 7(9.6) 2(2.6) 0 0 0 9(3.3)
 s1i2m2 0 5(6.4) 0 1(3) 0 6(2.2)
 s2i1m1 0 0 0 0 0 0
 s2i1m2 1(1.4) 0 1(2.2) 0 0 2(0.7)
 s2i2m1 1(1.4) 0 0 0 0 1(0.4)
 s2i2m2 0 0 0 3(9.1) 0 3(1.1)
iceA1 49(66.2) 50(64.1) 38(82.6) 24(72.7) 26(68.4) 187(69.5)
iceA2 12(16.2) 20(25.6) 8(17.4) 6(18.2) 8(21.1) 54(20.1)
oipA"on" 68(91.9) 71(91) 41(89.1) 30(90.9) 27(71.1) 237(88.1)
oipA"off" 3(4.1) 2(2.6) 0 0 0 5(1.9)
dupA 23(31.1) 12(15.4) 34(73.9) 27(81.8) 25(65.8) 121(45)

Isolates were from five regions of China: Shandong (SD), Guangxi (GX), Hunan (HN), Qinghai (QH) and Heilongjiang (HL)

Values in parentheses are percentages

Numbers in boldface type indicate a significant difference compared with other regions

cagA genotypes

Overall, 261(97%) patients were infected with cagA-positive strains (Table 1). Of these cagA-positive strains, 70(94.6%) strains were isolated from Shandong, 74 (94.9%) from Guangxi, 100% from Hunan, Qinghai and Heilongjiang. 96.6% (252/261) of the cagA genes detected were East Asian type, whereas only 9 strains were Western type. 55.6% (5/9) Western strains were from Heilongjiang and there was a significant correlation between the type ABC and Heilongjiang isolates (χ2 = 15.512, P < 0.01). The distribution of CagA sequence types was shown in Table 2. There were 2–4 EPIYA motifs in CagA C-terminus, and 94.3% [(238 + 8)/261] of the strain sequences had three EPIYA segments. There were obvious differences between segment EPIYA-C and EPIYA-D when analyzed using the WebLogo 3 (Fig. 1).

Table 2.

Distribution of CagA sequence types in different geographic regions of China

Regions CagA sequence types Total
AB ABD AABD ABC ABCC
SD 9 59 1 1 0 70
GX 0 71 1 1 1 74
HN 0 46 0 0 0 46
QH 0 32 0 1 0 33
HL 3 30 0 5 0 38
Total 12(4.6) 238(91.2) 2(0.8) 8(3) 1(0.4) 261

Isolates were from five regions of China: Shandong (SD), Guangxi (GX), Hunan (HN), Qinghai (QH) and Heilongjiang (HL)

Values in parentheses are percentages

Number in boldface type indicates a significant difference compared with other regions

Fig. 1.

Fig. 1

EPIYA segment types in East Asian-type and Western-type CagA from Chinese strains

The phylogenetic tree was constructed from cagA 3’ variable region sequences. As shown in the Additional file 1, the phylogenetic tree diverged into two lineages. In the lineage one, H. pylori 26695 was clustered with 9 Western type strains from different regions. In the second lineage, H. pylori GZ27 was clustered with East Asian strains from five regions. The phylogenetic analysis did not reveal any association between a particular disease and a specific cagA sequence. The cagA gene was present in 97.2% and 95.2% of H. pylori strains isolated from patients with NUD and PUD, respectively (Table 3). There was no statistical difference between the cagA genotypes and clinical outcomes irrespective of the different geographic regions (χ2 = 0.669, P > 0.05).

Table 3.

Frequency of 269 H. pylori virulence genotypes in patients with NUD and PUD

Genetypes No. of isolates
SD (n = 74) GX (n = 78) HN (n = 46) QH (n = 33) HL (n = 38) Total (n = 269)
NUD (61) PUD (13) NUD (75) PUD (3) NUD (42) PUD (4) NUD (32) PUD (1) NUD (38) PUD (0) NUD (248) PUD (21)
cagA 58(95.1) 12(92.3) 71(94.7) 3(100) 42(100) 4(100) 32(100) 1(100) 38(100) 0 241(97.2) 20(95.2)
vacA
 s1 60(98.4) 12(92.3) 75(100) 3(100) 41(97.6) 4(100) 30(93.8) 0 38(100) 0 244(98.4) 19(90.5)
 s2 1(1.6) 1(7.7) 0 0 1(2.4) 0 2(6.6) 1(100) 0 0 4(1.6) 2(9.5)
 m1 26(42.6) 4(30.8) 13(17.3) 1(33.3) 10(23.8) 0 6(18.8) 0 12(31.6) 0 67(27) 5(23.8)
 m2 34(55.7) 9(69.2) 59(78.7) 2(66.7) 31(73.8) 4(100) 25(78.1) 1(100) 25(65.8) 0 174(70.2) 16(76.2)
 i1 56(91.8) 10(76.9) 68(90.7) 3(100) 42(100) 4(100) 29(90.6) 0 38(100) 0 233(94) 17(81)
 i2 5(8.2) 3(23.1) 7(9.3) 0 0 0 3(9.4) 1(100) 0 0 15(6) 4(19)
 s1i1m1 21(34.4) 1(7.7) 11(14.7) 1(33.3) 10(23.8) 0 6(18.8) 0 12(31.6) 0 60(24.2) 2(9.5)
 s1i1m2 33(54.1) 9(69.2) 51(68) 2(66.7) 30(71.4) 4(100) 22(68.8) 0 25(65.8) 0 161(64.9) 15(71.4)
 s1i2m1 5(8.2) 2(15.4) 2(2.7) 0 0 0 0 0 0 0 7(2.8) 2(9.5)
 s1i2m2 0 0 5(6.7) 0 0 0 1(3.1) 0 0 0 6(2.4) 0
 s2i1m1 0 0 0 0 0 0 0 0 0 0 0 0
 s2i1m2 1(1.6) 0 0 0 1(2.4) 0 0 0 0 0 2(0.8) 0
 s2i2m1 0 1(7.7) 0 0 0 0 0 0 0 0 0 1(4.8)
 s2i2m2 0 0 0 0 0 0 3(9.4) 0 0 0 0 0
iceA1 40(65.6) 9(69.2) 48(64) 2(66.7) 35(83.3) 3(75) 23(69.7) 1(100) 26(68.4) 0 172(69.4) 15(71.4)
iceA2 9(14.8) 3(23.1) 19(25.3) 1(33.3) 7(16.7) 1(25) 6(18.2) 0 8(21.1) 0 49(19.8) 5(23.8)
oipA"on" 55(90.2) 13(100) 68(90.7) 3(100) 37(88.1) 4(100) 29(87.9) 1(100) 27(71.1) 0 216(87.1) 21(100)
oipA"off" 3(4.9) 0 2(2.7) 0 0 0 0 0 0 0 5(2) 0
dupA 15(24.6) 8(61.5) 10(13.3) 2(66.7) 32(76.2) 2(50) 26(78.8) 1(100) 25(65.8) 0 108(43.5) 13(61.9)

Isolates were from five regions of China: Shandong (SD), Guangxi (GX), Hunan (HN), Qinghai (QH) and Heilongjiang (HL)

Values in parentheses are percentages

Numbers in boldface type indicate a significant difference compared clinical outcomes (NUD and PUD) in each geographic region group with respect to H. pylori genotype

vacA subtypes

The most common vacA s region genotype was s1 (97.8%): 97.3% of strains from Shandong, 97.8% from Hunan, 90.9% from Qinghai, 100% from Guangxi and Heilongjiang. Regardless of geographic origins and clinical outcomes, most of the vacA s1 strains were of the s1c subtype (73.4%), while the s1a subtype was detected in 70 (26.6%) and the s1b subtype was not detected in our study (Table 1; Fig. 2). The prevalence of s1a in the isolates from Shandong was 40.3%, significantly higher (χ2 = 15.930, P < 0.01) than that in Guangxi (12.8%), Hunan (33.3%), Qinghai (30%) and Heilongjiang (18.4%). Conversely, the s1c subtype was significantly (χ2 = 19.806, P < 0.01) more frequent in isolates from Guangxi (87.2%) than the other four regions. For the vacA m region, 190 patients (70.6%) were infected with m2 strains and 72 (26.8%) were infected with m1 strains. The frequency of the m2 subtype in Qinghai (78.8%) was significantly higher (χ2 = 9.900, P < 0.05) than in Shandong (58.1%). In contrast, the frequency of m1 subtype in Shandong (40.5%) was significantly higher (χ2 = 12.539, P < 0.05) than the other four regions. All the H. pylori-infected patients were successfully detected for the vacA i region, in which 250 (92.9%) patients were infected with i1 strains, while the remaining 19 (7.1%) patients were infected with i2 strains (Table 1). The prevalence of i1 allele was significantly higher (χ2 = 9.687, P < 0.05) in Hunan and Heilongjiang than in other regions. We also examined the different combinations of vacA s, m and i alleles in patients. The dominant vacA subtype combination was s1i1m2 (65.4%) in the five regions, but no statistical significance was noted (χ2 = 4.168, P > 0.05). There were also no statistical differences between the vacA subtypes and clinical outcomes (Table 3).

Fig. 2.

Fig. 2

Distribution of vacA s, m and i region genotypes of H. pylori strains from different regions of China. The prevalence of each type (s1a, s1c, s2, m1, m2, i1 and i2) is given as a percentage of the total number of strains (shown in parentheses)

iceA status

Overall, iceA1 was detected in 187 (69.5%) of all 269 isolates examined and iceA2 was found in 54 isolates (20.1%) (Table 1). The iceA1 frequency was significantly more prevalent in Hunan (82.6%) than in the other four regions (χ2 = 11.358, P < 0.05). The iceA2 was present in 25.6% and 21.1% of H. pylori strains isolated from Guangxi and Heilongjiang, respectively, whereas only 16.2% of isolates from Shandong were infected with iceA2-positive strains. However, the difference was not statistically significant (χ2 = 3.204, P > 0.05). There was also no association between the iceA status and clinical outcomes in the five regions of China (Table 3).

oipA status

242 (90%) isolates were positive with oipA set primers, and, overall, 88.1% had a functional status “on” (Table 1). A total of 10 oipA CT repeat patterns were identified (Table 4). The pattern containing (3 + 1) CT repeats was the most frequently associated with the “on” status (125/237, 52.7%), and the pattern with 5 CT repeats was the most prevalent for a nonfunctional (“off”) oipA gene (3/5, 60%). The oipA functional status “on” was more prevalent in Shandong isolates than in Heilongjiang isolates (χ2 = 8.060, P < 0.05). Overall, 87.1% of NUD patients and 100% of PUD patients were infected with oipA functional status “on” strains, the difference was not statistically significant (χ2 = 3.561, P > 0.05) (Table 3). When the analyses were carried out in each geographic region, the differences were also not statistically significant.

Table 4.

Frequency of the oipA CT repeat patterns

Sequence of signal peptide encoding region of oipA No. of CT No. of isolates
“On” status
ATGAAAAAAGCTCTCTTACTAACTCTCTTTTTCTCGTTTTGGCTCCACGCTGAA 3 + 1 125
M K K A L L L T L F F S F W L H A E
ATGAAAAAAACCCTTTTACTCTTTCTGTCTTTCTCGTTTTGGCTCCACGCTGAA 2 + 1 + 1 82
M K K T L L L F L S F S F W L H A E
ATGAAAAAAGCTCTCTTACTAACTCTCTTTCTCTCGTTTTGGCTCCACGCTGAA 3 + 2 14
M K K A L L L T L F L S F W L H A E
ATGAAAAAAACCCTTTTACTCACTCTTTCTCTCTCGTTTTGGCTCCACGCTGAA 2 + 3 1
M K K T L L L T L S L S F W L H A E
ATGAAAAAAACCCTTTTACTCTTTCTGTCTCTCTCGTTTTGGCTCCACGCTGAA 1 + 3 5
M K K T L L L F L S L S F W L H A E
ATGAAAAAAGCTCTCTTACTAATTCTCTTTTTCTCGTTTTGGCTCCACGCTGAA 2 + 1 1
M K K A L L L I L F F S F W L H A E
ATGAAAAAAGCTCTCTTACTAACTCTCTCTCTCTCGTTCTGGCTCCACGCTGAA 6 9
M K K A L L L T L S L S F W L H A E
“Off” status
ATGAAAAAAGCTCTCTTACTAACTCTCTCTCTCGTTTTGGCTCCACGCTGA 5 3
M K K A L L L T L S L V L A P R *
ATGAAAAAAGCTCTCTTACTCTCTCTCTCTCTCGTTCTGGCTCCATGCTGA 7 1
M K K A L L L S L S L V L A P C *
ATGAAAAAAGCTCTCTTACTAACTCTCTCTCTCTCTCTCGTTTTGGCTCCACGCTGA 8 1
M K K A L L L T L S L S L V L A P R*

The underline represents the sequences of oipA CT repeat patterns

⁎Indicates stop codon

dupA status

121 (45%) patients were infected with dupA-positive strains (Table 1). The dupA-positive strains were present in 73.9% of Hunan, 81.8% of Qinghai and 65.8% of Heilongjiang. In contrast, only 31.1% of Shandong and 15.4% of Guangxi strains were infected with dupA-positive H. pylori2 = 72.497, P < 0.001). Overall, 43.5% of patients with NUD and 61.9% of those with PUD were infected with dupA-positive strains (Table 3). The dupA-positive strains were significantly more common in PUD patients than in NUD patients in Shandong (χ2 = 6.830, P < 0.01) and Guangxi (χ2 = 4.254, P < 0.05). In contrast, the dupA-positive strains were more common in NUD patients (76.2%) than in PUD patients (50%) in Hunan, but the difference was not statistically significant (χ2 = 1.299, P > 0.05).

Discussion

Geographic distribution versus genotypes

The present study investigated the cagA, vacA, iceA, oipA and dupA genotypes of H. pylori isolated from patients living in different geographic regions of China. Our study demonstrated that there was obvious geographic diversity of H. pylori genotypes in China, emphasizing that even within a country genetic diversity still existed. There are at least two reasons for the difference in H. pylori strains among different geographic regions. One is the accumulation of mutations in H. pylori strains in different regions, and the other is that there may be adaptive evolutionary selection between H. pylori strains and their hosts.

In China, more than 90% of H. pylori strains carry cagA gene, which may be the reason why the incidence rate of GC in China is higher than that in Western countries. In the present study, 97% patients were infected with cagA-positive strains. This result was similar to studies in other Asian countries and some regions of China where the prevalence of cagA-positive strains was above 90% ([34, 48]. However, this was different from reports in some European and American countries where the prevalence of cagA-positive strains ranged from 50 to 70% [15]. Furthermore, we found that the majority of CagA types were East Asian type, only 3.4% were Western type. Some studies have shown that Western type CagA was the most frequent type in Mongolian and Russia patients and all H. pylori strains from GC patients possessed Western type CagA [36, 42]. In our study, 55.6% (5/9) of the Western CagAs were from Heilongjiang, which may be due to human migration or direct transmission.

In the present study, there was a high prevalence of s1c 73.4% in the vacA-positive strains, similar to previous study in other regions of China [43]. However, the result was slightly different from some reports in which the prevalence of s1c was a little lower [14, 43]. The vacA s1b was not detected in our study, whereas the prevalence of s1b subtype was almost 100% in South America, 80% in Spain and Portugal strains, very few in East Asia [14]. The vacA s2 was prevalent in Africa and consistent with studies in some European and American countries [5, 14], but the s2 detected in this study was very low, further revealing the geographic diversity of vacA gene. The presence of vacA m1 strains was significantly higher in Shandong, which may be the reason for the high incidence of gastric cancer. These findings were different from some countries such as Japan, Korean, Singapore and some European and American strains [14, 47, 50], suggesting the differences between Chinese and foreign strains. In the vacA i region, the i1 subtype was dominant in the five regions and this result was consistent with those of studies that include patients from some countries, such as Japan and South Korea, where the prevalence of i1 subtype was over 95% [12, 26].

The prevalence of iceA1 was 69.5% in our study, consistent with studies reported from Thailand and Korea [11, 27]. The oipA status was regulated by strip strand repairing based on the number of CT nucleotide repeats in the signal sequences. The present study revealed a high prevalence of strains with oipA status “on” genes (88.1%) regardless of the geographic origins and clinical outcomes, which was similar to previous studies [49].The presence of dupA gene was different in distinct geographic regions, such as 84.8% in the South Africa, 43.7% in the Belgium and 70% in the United States [4]. Similarly, in the present study, the prevalence of the dupA was also different in distinct geographic regions of China. We detected 81.8% dupA-positive isolates in Qinghai, while the lower prevalence of dupA (15.4%) was in Guangxi and 31.1% in Shandong. The reasons for the difference in prevalence of dupA gene in the five geographic regions of China are unclear.

Clinical outcome versus genotypes

The present study did not reveal any associations between the cagA, vacA, iceA and oipA genotypes and clinical outcomes. These results were consistent with other reports from China [43, 44], but was different from many studies in Western countries [7]. One important reason for the difference might be due to large genomic difference of the H. pylori. Some researchers considered that the iceA1 was more common in patients with PUD while the iceA2 was most frequently isolated from NUD patients [18, 33]. However, our study showed that the presence of the iceA gene was not associated with clinical outcomes. OipA is an important outer membrane protein that is closely related to severe inflammatory response and the induction of IL-8 secretion. Studies showed that the oipA status “on” was expressed in most strains isolated from patients with PUD, suggesting that it could be helpful in predicting the clinical presentation of H. pylori infection in different regions [46]. In this study, the presence of oipA status “on” had no correlation with clinical outcomes. Other outer membrane proteins, such as BabA, SabA and HomB, widely exist in different strains, which might play a vital role in the pathogenesis of H. pylori [1]. These virulence factors need further study.

Surprisingly, the dupA-positive strains were significantly more common in PUD patients than in NUD patients in Shandong and Guangxi (P < 0.05). The results were different from previous studies in which there was no association between the presence of dupA and clinical diseases [39]. Conversely, the prevalence of the dupA-positive strains was more common in NUD patients (76.2%) than in PUD patients (50%) in Hunan, but the difference was not statistically significant. Therefore, further molecular epidemiology researches in other populations will help to study the association between dupA gene and clinical outcomes.

Conclusions

The present study investigated the distribution of H. pylori virulence genotypes in five regions of China and their association with clinical outcomes. There was a reverse correlation between the dupA gene and PUD. However, we could not reveal clear associations of the cagA, iceA, oipA and vacA genotypes with clinical outcomes in any of the studied regions.

Materials and methods

Study subjects

A total of 348 patients were involved in this study including 89 patients from Rushan People’s Hospital (Weihai, Shandong Province, China), 91 from the Second Nanning People’s Hospital (Nanning, Guangxi Province, China), 57 from Yiyang Central Hospital (Yiyang, Hunan Province, China), 58 from the People’s Hospital of Huzhu Tu Ethnic Autonomous County (Haidong, Qinghai Province, China) and 53 from The First Affiliated Hospital of Jiamusi University (Jiamusi, Heilongjiang Province, China). Their gastric biopsy specimens were obtained during upper gastrointestinal endoscopy with informed consent. This study was approved by Ethical Committee of National Institute for Communicable Disease Control and Prevention Chinese Center for Disease Control and Prevention (approval No. ICDC-2013001).

H. pylori culture and DNA extraction

Gastric biopsy specimens were homogenized thoroughly in brain heart infusion (BHI) broth and then streaked onto the Karmali blood agar base plates under a biological safety cabinet (Thermo Scientific). The Karmali Agar base (Oxoid, CM 0935) was supplemented with 5% defibrinated sheep blood and 1% combined antibiotics comprising of trimethoprim (150 mg/L), vancomycin (125 mg/L), amphotericin B (100 mg/L) and polymyxin B (100 mg/L). The plates were incubated at 37 °C under microaerobic conditions (5% O2, 10% CO2 and 85% N2) for 3–5 days. H. pylori colonies were identified according to its morphological characteristics, negative Gram staining and positive for catalase, oxidase, and urease. The identified H. pylori was subcultured to single colonies and then preserved in sterile BHI broth with 20% glycerol and frozen at − 80 °C until the genomic DNA was extracted with the QIAamp DNA Mini Kit (Qiagen, Germany) according to the manufacturer’s instructions. The extracted DNA was stored at − 20℃ and used directly for PCR.

PCR amplification

The PCR reaction was carried out in a total volume of 25 μL containing forward and reverse primers (0.2 μM each), 2 ng/μL DNA template, 12.5 μL Go Taq® Green Master Mix (Promega, USA) and 9.5 μL nuclease-free water. The amplification was as follows: initial denaturation at 94 °C for 5 min and then denaturation at 94 °C for 30 s, primer annealing at 54, 56, 60, 56 and 62 °C for cagA, iceA, dupA, vacA (s1/s2, s1a, s1b, s1c, m1, m2 and i1, i2) and oipA, respectively, for 30 s and extension at 72 °C for 40 s. All reactions were performed through 35 cycles. The final cycle included a final extension at 72 °C for 10 min. The presence of the cagA, iceA and dupA genes was determined by PCR as previously described [9, 23, 30]. The genotypes of vacA s1/s2, s1a, s1b, s1c, m1, m2 and i1, i2 were also determined by PCR as previously described [6, 16, 29, 37]. The oipA gene was detected by PCR, which was additionally sequenced in order to define its functional status as either “on” or “off”. The signal sequences of oipA gene including the CT repeats were amplified by using primer pairs as described previously [25]. The primers used to amplify the targeted genes were summarized in Table 5. The amplified products were analyzed in 1% agarose gel containing 1 × TAE, stained with GelStain and visualized by electrophoresis at 110 V for 30 min using the gel documentation system (Bio-Rad, USA).

Table 5.

Primers used for PCR amplification of cagA, vacA, iceA, oipA and dupA genes

Gene Primer Primer sequence (5'–3') Product size (bp)
cagA cagA3'-F TGCGTGTGTGGCTGTTAGTAG 593–752
cagA3'-R CCTAGTCGGTAATGGGTTGT
vacA
 s1/s2 Vs-F ATGGAAATACAACAAACACAC 259/286
VA-R CTGCTTGAATGCGCCAAAC
 s1a Vs1a-F GTCAGCATCACACCGCAAC 190
VA-R CTGCTTGAATGCGCCAAAC
 s1b Vs1b-F AGCGCCATACCGCAAGAG 187
VA-R CTGCTTGAATGCGCCAAAC
 s1c Vs1c-F CTCTCGCTTTAGTGGGGYT 213
VA-R CTGCTTGAATGCGCCAAAC
 m1 Vm1-F GGCCCCAATGCAGTCATGGAT 240
Vm1-R GCTGTTAGTGCCTAAAGAAGCAT
 m2 Vm2-F GGAGCCCCAGGAAACATTG 352
Vm2-R CATAACTAGCGCCTTGCAC
 i1 Vi-F GTTGGGATTGGGGGAATGCCG 495
Vi1-R TTAATTTAACGCTGTTTGAAG
 i2 Vi-F GTTGGGATTGGGGGAATGCCG 495
Vi2-R GATCAACGCTCTGATTTGA
iceA1 iceA1-F GTGTTTTTAACCAAAGTATC 246
iceA1-R CTATAGCCAGTCTCTTTGCA
iceA2 iceA2-F GTTGGGTATATCACAATTTAT 229
iceA2-R TTGCCCTATTTTCTAGTAGGT
oipA oipA-F CGCGGAAAGGAACGGGTTTT 519
oipA-R TTAGCGTCTAGCGTTCTGCC
dupA dupA-F GACGATTGAGCGATGGGAATAT 971
dupA-R CTGAGAAGCCTTATTATCTTGTTGG

Sequencing and bioinformatics analysis

Positive PCR products were sent to the Beijing Genomics Institute (BGI) for purification and sequencing. The nucleotide sequences of the cagA 3’ variable region and oipA were submitted to China National Microbiological Data Center. The accession numbers are NMDCN0000M60 to NMDCN0000ME4 and NMDCN0000ME5 to NMDCN0000MLM, respectively. DNA sequences were edited by EditPlus version 5.3.0 and the edited nucleotide sequences were subjected to translation using BioEdit version 7.2.5. The EPIYA segment types of CagA were analyzed using the program WebLogo 3 (http://weblogo.threeplusone.com/). Neighbor-Joining phylogenetic tree was constructed from cagA 3’ variable region nucleotide sequences using MEGA version 7.0.18 and bootstrap analysis was performed with 1000 replications. The Western strain 26695 (GenBank No. CP003904) and the East Asian strain GZ27 (GenBank No. KR154756) were used as reference sequences.

Statistical analysis

Statistical data were analyzed by SPSS software version 20. The chi-square test and Fisher’s exact test were used to assess the relationship between specific genotype and geographic origins and clinical outcomes. P-value < 0.05 was considered of a statistically significant difference.

Supplementary Information

13099_2021_434_MOESM1_ESM.xlsx (30.5KB, xlsx)

Additional file 1: The phylogenetic tree of cagA gene.

Acknowledgements

Not applicable.

Abbreviations

H. pylori

Helicobacter pylori

PCR

Polymerase chain reaction

GC

Gastric carcinoma

PUD

Peptic ulcer disease

NUD

Non-ulcer dyspepsia

MALT

Mucosal-associated lymphoid tissue

cagA

Cytotoxin-associated gene A

vacA

Vacuolating cytotoxin A

iceA

Induced by contact with epithelium

oipA

Outer inflammatory protein A

dupA

Duodenal ulcer promoting gene A

Authors’ contributions

ZX and HY developed the idea, designed the study, analyzed the data and drafted the manuscript. DS, XS, XD, CY and CS collected the samples. LH, YY, YG, DF and LS performed the DNA extraction. XH and RF analyzed the data, MZ and XY designed the study and analyzed the results. JQ and JZ designed the study, reviewed and revised the manuscript. All authors read and approved the final manuscript.

Funding

This work was supported by the Health Research and Special Projects Grant of China (No. 201002020, No.201502005) and the National Science and Technology Major Project of China (2018ZX10712-001).

Availability of data and materials

The Western strain 26695 and East Asian strain GZ27 were downloaded from NCBI (https://www.ncbi.nlm.nih.gov/).

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Full consent is given for publication in Gut Pathogens.

Competing interests

The authors declare that they have no competing interests.

Footnotes

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Zhijing Xue and Hong Yang contributed equally for this work

Contributor Information

Jiaming Qian, Email: qianjiaming1957@126.com.

Jianzhong Zhang, Email: zhangjianzhong@icdc.cn.

References

  • 1.Adrian J, Bonsignore P, Hammer S, Frickey T, Hauck CR. Adaptation to host-specific bacterial pathogens drives rapid evolution of a human innate immune receptor. Curr Biol. 2019;29(4):616–630. doi: 10.1016/j.cub.2019.01.058. [DOI] [PubMed] [Google Scholar]
  • 2.Alam J, Sarkar A, Karmakar BC, Ganguly M, Paul S, Mukhopadhyay AK. Novel virulence factor dupA of Helicobacter pylori as an important risk determinant for disease manifestation: An overview. World J Gastroenterol. 2020;26(32):4739–4752. doi: 10.3748/wjg.v26.i32.4739. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ansari S, Yamaoka Y. Helicobacter pylori virulence factors exploiting gastric colonization and its pathogenicity. Toxins. 2019;11(11):677–683. doi: 10.3390/toxins11110677. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Argent RH, Burette A, Miendje VY, Atherton JC. The presence of dupA in Helicobacter pylori is not significantly associated with duodenal ulceration in Belgium, South Africa, China, or North America. Clin Infect Dis. 2007;45(9):1204–1206. doi: 10.1086/522177. [DOI] [PubMed] [Google Scholar]
  • 5.Assumpcao MB, Martins LC, Barbosa M, Antonia K, Santos D, Sintia B, et al. Helicobacter pylori in dental plaque and stomach of patients from Northern Brazil. World J Gastroenterol. 2010;16(4):3033–3039. doi: 10.3748/wjg.v16.i24.3033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Atherton JC, Cao P, Peek RM, Jr, Tummuru MK, Blaser MJ, Cover TL. Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration. J Biol Chem. 1995;270(30):17771–17777. doi: 10.1074/jbc.270.30.17771. [DOI] [PubMed] [Google Scholar]
  • 7.Blaser MJ. Intrastrain differences in Helicobacter pylori: a key question in mucosal damage? Ann Med. 1995;27(5):559–563. doi: 10.3109/07853899509002469. [DOI] [PubMed] [Google Scholar]
  • 8.Chauhan N, Tay ACY, Marshall BJ, Jain U. Helicobacter pylori vacA, a distinct toxin exerts diverse functionalities in numerous cells: an overview. Helicobacter. 2019;24(1):e12544. doi: 10.1111/hel.12544. [DOI] [PubMed] [Google Scholar]
  • 9.Chen CY, Wang FY, Wan HJ, Jin XX, Wei J, Wang ZK, et al. Amino acid polymorphisms flanking the EPIYA-A motif of Helicobacter pylori CagA C-terminal region is associated with gastric cancer in east China: experience from a single center. J Dig Dis. 2013;14(7):358–365. doi: 10.1111/1751-2980.12056. [DOI] [PubMed] [Google Scholar]
  • 10.Chen W, Zheng R, Zhang S, Zeng H, Xia C, Zuo T, Yang Z, Zou X, He J. Cancer incidence and mortality in China, 2013. Cancer Lett. 2017;401(4):63–71. doi: 10.1016/j.canlet.2017.04.024. [DOI] [PubMed] [Google Scholar]
  • 11.Chomvarin C, Namwat W, Chaicumpar K, Mairiang P, Sangchan A, Sripa B, et al. Prevalence of Helicobacter pylori vacA, cagA, cagE, iceA and babA2 genotypes in Thai dyspeptic patients. Int J Infect Dis. 2008;12(5):30–36. doi: 10.1016/j.ijid.2007.03.012. [DOI] [PubMed] [Google Scholar]
  • 12.Chung C, Olivares A, Torres E, Yilmaz O, Cohen H, Perez-Perez G. Diversity of vacA intermediate region among Helicobacter pylori strains from several regions of the world. J Clin Microbiol. 2010;48(3):690–696. doi: 10.1128/JCM.01815-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ciara U, Rainer H. vacA's induction of vacA-containing vacuoles (VCVs) and their immunomodulatory activities on human T cells. Toxins. 2016;8(6):190–194. doi: 10.3390/toxins8060190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Doorn LJ, Figueiredo C, Francis M, Pena S, Quint WGV. Geographic distribution of vacA allelic types of Helicobacter pylori. Gastroenterol. 1999;116(4):823–830. doi: 10.1016/S0016-5085(99)70065-X. [DOI] [PubMed] [Google Scholar]
  • 15.Doorn LJ, Figueiredo C, Sanna R, Plaisier A, Quint W. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterol. 1998;115(1):58–62. doi: 10.1016/S0016-5085(98)70365-8. [DOI] [PubMed] [Google Scholar]
  • 16.Falush D, Wirth T, Linz B, Pritchard JK, Stephens M, Kidd M, et al. Traces of human migrations in Helicobacter pylori populations. Science. 2003;299(5612):1582–1585. doi: 10.1126/science.1080857. [DOI] [PubMed] [Google Scholar]
  • 17.Ferreira RM, Machado JC, Letley D, Atherton JC, Pardo ML, Gonzalez CA, et al. A novel method for genotyping the Helicobacter pylori vacA intermediate region directly in gastric biopsy specimens. J Clin Microbiol. 2012;50(12):3983–3989. doi: 10.1128/JCM.02087-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gatti LL, Módena JL, Payão SL, Smith Mde A, Fukuhara Y, Módena JL, et al. Prevalence of Helicobacter pylori cagA, iceA and babA2 alleles in Brazilian patients with upper gastrointestinal diseases. Acta Trop. 2006;100(3):232–240. doi: 10.1016/j.actatropica.2006.08.014. [DOI] [PubMed] [Google Scholar]
  • 19.González CA, Figueiredo C, Lic CB, Ferreira RM, Pardo ML, Ruiz Liso JM, et al. Helicobacter pylori cagA and vacA genotypes as predictors of progression of gastric preneoplastic lesions: a long-term follow-up in a high-risk area in Spain. Am J Gastroenterol. 2011;106(5):867–874. doi: 10.1038/ajg.2011.1. [DOI] [PubMed] [Google Scholar]
  • 20.Hatakeyama M. Anthropological and clinical implications for the structural diversity of the Helicobacter pylori CagA oncoprotein. Cancer Sci. 2011;102(9):36–43. doi: 10.1111/j.1349-7006.2010.01743.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hooi JKY, Lai WY, Ng WK, Suen MMY, Underwood FE, Tanyingoh D, et al. Global prevalence of Helicobacter pylori infection: systematic review and meta-analysis. Gastroenterol. 2017;23(4):420–429. doi: 10.1053/j.gastro.2017.04.022. [DOI] [PubMed] [Google Scholar]
  • 22.Huang X, Deng Z, Zhang Q, Li W, Wang B, Li M. Relationship between the iceA gene of Helicobacter pylori and clinical outcomes. Ther Clin Risk Manag. 2016;12(2):1085–1092. doi: 10.2147/TCRM.S107991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Peek RM, Jr, Thompson SA, Donahue JP, Tham KT, Atherton JC, Blaser MJ, et al. Adherence to gastric epithelial cells induces expression of a Helicobacter pylori gene iceA, that is associated with clinical outcome. P Assoc Am Physician. 1998;110(6):531–544. [PubMed] [Google Scholar]
  • 24.Kao CY, Sheu BS, Wu JJ. Helicobacter pylori infection: an overview of bacterial virulence factors and pathogenesis. Biomed J. 2016;39(1):14–23. doi: 10.1016/j.bj.2015.06.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kauser F, Hussain MA, Ahmed I, Ahmad N, Habeeb A, Khan AA, et al. Comparing genomes of Helicobacter pylori strains from the high-altitude desert of Ladakh, India. J Clin Microbiol. 2005;43(4):1538–1545. doi: 10.1128/JCM.43.4.1538-1545.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Kim JY, Kim N, Nam RH, Suh JH, Chang H, Lee JW, et al. Association of polymorphisms in virulence factor of Helicobacter pylori and gastroduodenal diseases in South Korea. J Gastroenterol Hepatol. 2014;29(5):984–991. doi: 10.1111/jgh.12509. [DOI] [PubMed] [Google Scholar]
  • 27.Kim SY, Woo CW, Lee YM, Son BR, Kim JW, Chae HB, et al. Genotyping cagA, vacA subtype, iceA1, and babA of Helicobacter pylori isolates from Korean patients, and their association with gastroduodenal diseases. J Korean Med Sci. 2001;16(4):579–584. doi: 10.3346/jkms.2001.16.5.579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Li WQ, Zhang JY, Ma JL, Li ZX, Zhang L, Zhang Y, et al. Effects of Helicobacter pylori treatment and vitamin and garlic supplementation on gastric cancer incidence and mortality: follow-up of a randomized intervention trial. BMJ. 2019;366(2):l5016. doi: 10.1136/bmj.l5016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Liao YL, Guo G, Mao XH, Xie QH, Zhang WJ, Liu XF, et al. Core genome haplotype diversity and vacA allelic heterogeneity of Chinese Helicobacter pylori strains. Curr Microbiol. 2009;59(2):123–129. doi: 10.1007/s00284-009-9407-x. [DOI] [PubMed] [Google Scholar]
  • 30.Lu H, Hsu PI, Graham DY, Yamaoka Y. Duodenal ulcer promoting gene of Helicobacter pylori. Gastroenterol. 2005;128(4):833–848. doi: 10.1053/j.gastro.2005.01.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Matos JI, de Sousa HA, Marcos-Pinto R, Dinis-Ribeiro M. Helicobacter pylori cagA and vacA genotypes and gastric phenotype: a meta-analysis. Eur J Gastroenterol Hepatol. 2013;25(12):1431–1441. doi: 10.1097/MEG.0b013e328364b53e. [DOI] [PubMed] [Google Scholar]
  • 32.Memon AA, Hussein NR, Miendje Deyi VY, Burette A, Atherton JC. Vacuolating cytotoxin genotypes are strong markers of gastric cancer and duodenal ulcer-associated Helicobacter pylori strains: a matched case-control study. J Clin Microbiol. 2014;52(8):2984–2989. doi: 10.1128/JCM.00551-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Momenah AM, Tayeb MT. Relationship between Helicobacter pylori vacA genotypes status and risk of peptic ulcer in Saudi patients. Saudi Med J. 2006;27(6):804–807. [PubMed] [Google Scholar]
  • 34.Pan ZJ, Berg DE, van der Hulst RW, Su WW, Raudonikiene A, Xiao SD, et al. Prevalence of vacuolating cytotoxin production and distribution of distinct vacA alleles in Helicobacter pylori from China. J Infect Dis. 1998;178(1):220–226. doi: 10.1086/515601. [DOI] [PubMed] [Google Scholar]
  • 35.Podzorski RP, Podzorski DS, Wuerth A, Tolia V. Analysis of the vacA, cagA, cagE, iceA, and babA2 genes in Helicobacter pylori from sixty-one pediatric patients from the Midwestern United States. Diagn Microbiol Infect Dis. 2003;46(9):83–88. doi: 10.1016/S0732-8893(03)00034-8. [DOI] [PubMed] [Google Scholar]
  • 36.Reva I, Takano T, Higuchi W, Iwao Y, Taneike I, Nakagawa S, et al. Virulence genotypes and drug resistance of Helicobacter pylori from Vladivostok, Russia: another feature in the Far East. Microbiol Immunol. 2012;56(3):198–202. doi: 10.1111/j.1348-0421.2011.00425.x. [DOI] [PubMed] [Google Scholar]
  • 37.Rhead JL, Letley DP, Mohammadi M, Hussein N, Mohagheghi MA, Eshagh HM, et al. A new Helicobacter pylori vacuolating cytotoxin determinant, the intermediate region, is associated with gastric cancer. Gastroenterology. 2007;133(3):926–936. doi: 10.1053/j.gastro.2007.06.056. [DOI] [PubMed] [Google Scholar]
  • 38.Sheikh AF, Yadyad MJ, Goodarzi H, Hashemi SJ, Aslani S, Assarzadegan MA, et al. cagA and vacA allelic combination of Helicobacter pylori in gastroduodenal disorders. Microb Pathog. 2018;122(34):144–150. doi: 10.1016/j.micpath.2018.06.023. [DOI] [PubMed] [Google Scholar]
  • 39.Shiota S, Matsunari O, Watada M, Hanada K, Yamaoka Y. Systematic review and meta-analysis: the relationship between the Helicobacter pylori dupA gene and clinical outcomes. Gut Pathog. 2010;2(1):13–17. doi: 10.1186/1757-4749-2-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Sterbenc A, Jarc E, Poljak M, Homan M. Helicobacter pylori virulence genes. World J Gastroenterol. 2019;25(33):4870–4884. doi: 10.3748/wjg.v25.i33.4870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Sukri A, Hanafiah A, Mohamad ZN, Kosai NR. Epidemiology and role of Helicobacter pylori virulence factors in gastric cancer carcinogenesis. APMIS. 2020;128(2):150–161. doi: 10.1111/apm.13034. [DOI] [PubMed] [Google Scholar]
  • 42.Tserentogtokh T, Gantuya B, Subsomwong P, Oyuntsetseg K, Bolor D, Erdene-Ochir Y, et al. Western-type Helicobacter pylori CagA are the most frequent type in Mongolian patients. Cancers. 2019;11(5):725–729. doi: 10.3390/cancers11050725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Wang J, van Doorn LJ, Robinson PA, Ji X, Wang D, Wang Y, et al. Regional variation among vacA alleles of Helicobacter pylori in China. J Clin Microbiol. 2003;41(5):1942–1945. doi: 10.1128/JCM.41.5.1942-1945.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Wei GC, Chen J, Liu AY, Zhang M, Liu XJ, Liu D, et al. Prevalence of Helicobacter pylori vacA, cagA and iceA genotypes and correlation with clinical outcome. Exp Ther Med. 2012;4(6):1039–1044. doi: 10.3892/etm.2012.704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Yamaoka Y, Kwon DH, Graham DY. A M(r) 34,000 proinflammatory outer membrane protein (oipA) of Helicobacter pylori. Proc Natl Acad Sci USA. 2000;97(13):7533–7538. doi: 10.1073/pnas.130079797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Yamaoka Y. Helicobacter pylori outer membrane proteins and gastroduodenal disease. Gut. 2006;55(6):775–781. doi: 10.1136/gut.2005.083014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Yamaoka Y. Relationship between Helicobacter pylori iceA, cagA, and vacA status and clinical outcome: studies in four different countries. J Clin Microbiol. 1999;37(7):2274–2279. doi: 10.1128/JCM.37.7.2274-2279.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Yang H, Wu SV, Pichuantes S, Song M, Wang J, Zhou D, et al. High prevalence of cagA-positive strains in Helicobacter pylori-infected, healthy, young Chinese adults. J Gastroenterol Hepatol. 1999;14(5):476–480. doi: 10.1046/j.1440-1746.1999.01892.x. [DOI] [PubMed] [Google Scholar]
  • 49.Zhao Q, Song C, Wang K, Li D, Yang Y, Liu D, et al. Prevalence of Helicobacter pylori babA, oipA, sabA, and homB genes in isolates from Chinese patients with different gastroduodenal diseases. Med Microbiol Immunol. 2020;209(5):565–577. doi: 10.1007/s00430-020-00666-2. [DOI] [PubMed] [Google Scholar]
  • 50.Zheng PY, Hua J, Yeoh KG, Ho B. Association of peptic ulcer with increased expression of Lewis antigens but not cagA, iceA, and vacA in Helicobacter pylori isolates in an Asian population. Gut. 2000;47(1):18–22. doi: 10.1136/gut.47.1.18. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

13099_2021_434_MOESM1_ESM.xlsx (30.5KB, xlsx)

Additional file 1: The phylogenetic tree of cagA gene.

Data Availability Statement

The Western strain 26695 and East Asian strain GZ27 were downloaded from NCBI (https://www.ncbi.nlm.nih.gov/).


Articles from Gut Pathogens are provided here courtesy of BMC

RESOURCES