Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2021 May 11;87(11):e00392-21. doi: 10.1128/AEM.00392-21

Stable Recombinant-Gene Expression from a Ligilactobacillus Live Bacterial Vector via Chromosomal Integration

Ben Vezina a,b,c,d, Theo Allnutt b,e, Anthony L Keyburn b,c, Ben Wade a,b,d, Thi Thu Hao Van d, Priscilla Johanesen a,b, Dena Lyras a,b, Robert J Moore a,b,c,d,✉
Editor: Charles M Dozoisf
PMCID: PMC8208147  PMID: 33741626

Therapeutic proteins such as antigens can be used to prevent infectious diseases in poultry. However, traditional vaccine delivery by intramuscular or subcutaneous injection generally has not proven effective for mucosa-dwelling microorganisms that live within the gastrointestinal tract.

KEYWORDS: Ligilactobacillus agilis, chromosomal integration, live bacterial vector, stable expression, transcriptomics

ABSTRACT

Disease control in animal production systems requires constant vigilance. Historically, the application of in-feed antibiotics to control bacteria and improve performance has been a much-used approach to maintain animal health and welfare. However, the widespread use of in-feed antibiotics is thought to increase the risk of antibiotic resistance developing. Alternative methods to control disease and maintain productivity need to be developed. Live vaccination is useful in preventing colonization of mucosa-dwelling pathogens by inducing a mucosal immune response. Native poultry isolate Ligilactobacillus agilis La3 (previously Lactobacillus agilis) has been identified as a candidate for use as a live vector to deliver therapeutic proteins such as bacteriocins, phage endolysins, or vaccine antigens to the gastrointestinal tract of chickens. In this study, the complete genome sequence of L. agilis La3 was determined and transcriptome analysis was undertaken to identify highly expressed genes. Predicted promoter regions and ribosomal binding sites from constitutively expressed genes were used to construct recombinant protein expression cassettes. A series of double-crossover shuttle plasmids were constructed to facilitate rapid selectable integration of expression cassettes into the L. agilis La3 chromosome via homologous recombination. Inserts showed 100% stable integration over 100 generations without selection. A positive relationship was found between protein expression levels and the predicted strength of the promoters. Using this system, stable chromosomal expression of a Clostridium perfringens antigen, rNetB, was demonstrated without selection. Finally, two recombinant strains, L. agilis La3::Peft-rnetB and L. agilis La3::Pcwah-rnetB, were constructed and characterized, and they showed potential for future application as live vaccines in chickens.

IMPORTANCE Therapeutic proteins such as antigens can be used to prevent infectious diseases in poultry. However, traditional vaccine delivery by intramuscular or subcutaneous injection generally has not proven effective for mucosa-dwelling microorganisms that live within the gastrointestinal tract. Utilizing live bacteria to deliver vaccine antigens directly to the gut immune system can overcome some of the limitations of conventional vaccination. In this work, Ligilactobacillus agilis La3, an especially effective gut colonizer, has been analyzed and engineered with modular and stable expression systems to produce recombinant proteins. To demonstrate the effectiveness of the system, expression of a vaccine antigen from poultry pathogen Clostridium perfringens was monitored over 100 generations without selection and found to be completely stable. This study demonstrates the development of genetic tools and novel constitutive expression systems and further development of L. agilis La3 as a live delivery vehicle for recombinant proteins.

INTRODUCTION

With a rapidly expanding human population, projected to reach 9.3 to 10.2 billion in 2050 (1, 2), economical and sustainable nutrient sources are vital. Poultry is a source of high-quality protein that can help meet these needs. Broiler chickens have many favorable characteristics, including efficient feed conversion ratio and lower ecological, water, feed, and space requirements than other production animals (3, 4). However, intensively farmed animals must be protected from the ever-present threat of infectious diseases. Broilers are colonized by a variety of chicken and human pathogens, such as Salmonella enterica (5), Campylobacter jejuni (6), and Clostridium perfringens (7, 8), posing challenges for the raising of productive, healthy, and food-safe birds. These bacteria have been controlled with antibiotics (8, 9); however, alternative strategies are required, as antibiotic use is driving the emergence of antibiotic resistance, which is posing a serious threat to human health. This has led to an industry-wide effort to find alternatives, driven by both regulatory requirements and consumer pressure to reduce antibiotic use (10).

For animal applications, conventional bacterin (whole killed cells) and toxoid (culture supernatant) vaccines, delivered by subcutaneous and intramuscular routes, have been widely used and are effective against many pathogens. However, they have been less successful against mucosa-dwelling pathogens. For example, only partial protection of poultry has been shown via the use of toxoid and bacterin vaccines against C. perfringens (11–13) and C. jejuni (14). Alternative vaccination methods are likely to be more effective, such as live bacterial delivery of vaccine antigens (15–17), which induces a mucosal IgA immune response (17–20) rather than systemic IgY and IgM responses (21). Another strategy to control mucosal pathogens involves the use of therapeutic molecules such as bacteriocins (22–25), host immune factors (26–28), and phage endolysins (29, 30).

Appropriately selected live bacterial vectors can colonize the mucosal layer and deliver therapeutic compounds directly to the ecological niche occupied by mucosal-dwelling pathogens. Live vectors have been administered orally, nasally, or via the lungs (16, 31, 32), making administration inexpensive and rapid. Delivery of vaccine antigens by live vectors, directly to the host immune system within the mucosal layer, can induce the production of secreted IgA antibodies against the vaccination target (33, 34).

Development of a successful live vector ideally requires stable expression of recombinant protein (20, 35). Given the proportional relationship between antigen dose and host immune responses (33, 36), expression stability is likely an important factor in determining vaccine efficacy. Dosage of antigen can be optimized at several levels, including choice of live bacterial vector, stable replication/maintenance of the expression cassette, and expression level of antigens (37–39), but maximizing expression while not reducing genetic fitness of the bacterial vector can be challenging. We hypothesize that the most effective live delivery bacteria are ones isolated from the commensal microbiota of the target host that can colonize and persist and are genetically tailored for constitutive antigen delivery.

The Gram-positive bacterial strain Ligilactobacillus agilis La3 (previously Lactobacillus agilis) (40) has properties that make it an excellent candidate for use as a live bacterial vector. This specific strain of L. agilis is a highly persistent colonizer of broiler chickens (41) and is readily culturable, transformable, and capable of heterologous protein expression (37). It is a non-spore-forming bacillus (42, 43) and is generally regarded as safe. L. agilis is commonly found in chickens (41, 44), with chicken isolates L. agilis JCM 1048 and L. agilis BCRC 10436 demonstrating potential as chicken probiotics (44–46).

The aim of the work reported here was to develop stable gene expression systems within L. agilis La3 to enhance its potential for use as a live vector to deliver therapeutic proteins to the gut mucosa of chickens. The L. agilis La3 genome and transcriptome were characterized, and genetic tools were generated for heterologous protein expression, including a method to insert expression cassettes in the L. agilis La3 genome. Constitutively expressed native promoters from highly transcribed genes were identified, cloned, and used to direct expression of recombinant protein.

RESULTS

The L. agilis La3 genome.

The 2,211,023-bp L. agilis La3 chromosomal genome was assembled using 88,005,605 bp (39.8× coverage). After polishing with PacBio reads and short-read error correction, the assembled L. agilis La3 genome produced a single, circularized 2,187,209-bp chromosomal genomic sequence with 41.3% GC content. L. agilis La3 also contains four plasmids, pLa3_1 (7,541 bp), pLa3_2 (4,743 bp), pLa3_3 (3,690 bp), and pLa3_4 (2,676 bp) (see Table S3 in the supplemental material).

The NCBI Prokaryotic Annotation Pipeline produced 2,055 coding sequences (CDS), whereas RAST produced 2,090 (Data Set S1). Within the SEED subsystem, 48% of CDS (990) could be assigned a broad gene function (Table S6). Closer analysis of the “virulence, disease and defense” group showed no known virulence or superantigen genes but mainly genes in the “resistance to antibiotics and toxic compounds” (27), “invasion and intracellular resistance” (11), and “adhesion” (2) groups. The genome also has a number of motility genes (43). The genome was found to contain eight rRNA gene operons. No known bacteriocins were present within the genome. Eight prophage regions within the L. agilis La3 genome were identified, only one of which appeared to encode an intact prophage.

The sequenced L. agilis La3 is similar to the other two published L. agilis strain genome sequences in terms of genome size, number of genes, and GC content (Table S4), despite differing isolation sources. The large core genome (73.48% of total gene content) is partially explained by the low number of genome sequences available for the analysis. The unique genes of L. agilis La3 (303) represent 14.74% of the coding sequences and consist of genes of unknown function, phage genes, integrases, and transposases.

RNA sequencing identified constitutively expressed genes.

RNA sequence analysis was undertaken on both mid-logarithmic and early-stationary growth phases (Fig. S1) to identify constitutively, highly expressed genes (Fig. 1). The promoters of the most abundantly transcribed genes were targeted for use in recombinant expression systems tailored for use in L. agilis La3. These genes likely represent housekeeping genes for which expression occurs constantly throughout the growth cycle. The most abundant transcripts across both mid-logarithmic and early stationary phases were from the genes encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH), triosephosphate isomerase, elongation factor Tu, phosphoglycerate kinase, enolase, and a putative secreted protein.

FIG 1.

FIG 1

Graph showing the transcripts per million reads (TPM) of the most abundant gene transcripts present in L. agilis La3 when grown anaerobically at 42°C in MRS. Red bars represent logarithmic transcript abundance, and blue bars represent stationary transcript abundance.

Promoters were identified upstream of the abundantly transcribed genes.

Putative promoter sequences were identified from a range of genes that were most actively transcribed (Table 1). For some of the genes, promoter sequences could not be identified, as the genes were embedded within operons, or the promoter sequence was not homologous enough to the consensus sequence to be identifiable

TABLE 1.

Putative promoter sequences identified based on the Lactobacillus consensus sequence and PPP online portal

Operon/ORF −35 region TG region −10 region RBS Start codon Note Source
Consensus sequence TTGACA Variable (15–20 bp) TATAAT Variable (GA rich) AUG/GUG Lactobacillus consensus sequences 109
GAPDH TTGAAA TTCAAAGTTAGAGATTATTT GTTAAT…286 bp… AAAGAGG…7 bp… AUG 4 potential upstream promoters, start of gap operon This study
TTGAAA GGAAGCAAGTTTAAAG TAAAAT…222 bp…
CTTGCA AAATATTTCTTTTGTTGCTAT AATCTT…116 bp…
TTAACT GATAGGTAGCGATTGT TATTAT…62 bp…
Elongation factor Tu TTTACA AAGTTAATTAGCCTCTA TATAAT…130 bp… CAGGAGG…10 bp… AUG 2 possible upstream promoters This study
TTGGTT TTCTCTTAGGAAAGTAG TATAAT…55 bp…
Enolase TTGAAA GTCTAAAGGAAAACCTT TAGAAT…37 bp… AAGGAGA…9 bp… AUG Inside gap operon This study
Putative secreted protein TGGTAA ATTGGGAGAAAATTATAAT TATAAT…307 bp… AGAAGGA…12 bp… GUG 2 possible upstream promoters and inside operon This study
CTGACA AGCCGGATCCAACGGTTA AAGACA…88 bp…
Cell wall-associated hydrolase TTGTAA CCTTTTTTGTACCCTAATGCAA TATTAA…37 bp… GGGAGTGAA…6 bp… TTG This study

Chromosomal insertion of expression cassettes via homologous recombination.

In recombinant protein production systems, expression cassettes are commonly located on plasmids due to the ease of construction, ability to move between strains, and the possibility of high copy number. We first tested the suitability of a previously developed Escherichia coli/LAB shuttle vector, pTRKH2, as a platform for expression but found it to be very unstable in L. agilis La3. Therefore, a new E. coli/L. agilis shuttle vector was constructed by fusing the native L. agilis La3 plasmid, pLa3_4, with the E. coli plasmid, pGEM-T Easy, to produce the plasmid pVEcLa4. Passaging L. agilis La3-carrying plasmids, without antibiotic selection, was used to compare the plasmid stability of pVEcLa4 to the previously used shuttle plasmid pTRKH2 through ≥100 bacterial generations. The new shuttle plasmid, pVEcLa4, was significantly more stable (52.48% ± 19.19%) than pTRKH2 (7.45% ± 1.5%) (P < 0.01). Although pVEcLa4 was significantly more stable than pTRKH2, it still exhibited some instability; hence, it, too, would be less than ideal as a basis for stable recombinant gene expression in L. agilis.

To test the identified promoters and ensure stable replication of expression cassettes independent of selection markers, insertion into the chromosome of L. agilis was investigated. Candidate recombination sites in the chromosome were identified based on minimizing the impact on normal cell function and, thus, reducing the likelihood of gene integration events altering the key colonization and persistence characteristics of L. agilis La3. An integration site was identified, consisting of a 21-bp noncoding region between two converging transcribed genes, and a hypothetical protein (locus tag BEN83_08880) and a GMP synthase gene (locus tag BEN83_08885) were selected. This was between bp 1766620 and 1766640 within the L. agilis La3 chromosome (GenBank accession number CP016766.1) and did not disrupt any CDS. Insertion at this site would be unlikely to disrupt the upstream regulation of these CDS or impact expression of the surrounding genes. The RNA sequence analysis also revealed low transcriptional abundance across the site (data not shown), indicating that it was unlikely to be involved in production of any regulatory RNAs. The genomic and transcriptomic analyses supported the conclusion that this location was a suitable site for chromosomal integration.

The plasmid pTRKH2-LCER (Fig. 2) and subsequent pVEcXLa-based plasmids were constructed (Table S1) to facilitate chromosomal insertion of expression cassettes by homologous recombination. The pTRKH2 backbone demonstrated low stability within L. agilis. This was utilized to drive selection for chromosomal recombination. By passaging L. agilis transformed with pTRKH2 derivatives carrying chromosomal integration cassettes in the presence of chloramphenicol, the antibiotic resistance encoded within the integration cassettes was selected, while selection for the plasmid backbone, marked with a different antibiotic resistance gene (erythromycin resistance), was not maintained and was rapidly lost. After chromosomal insertional mutants were generated, both resistance phenotyping (chloramphenicol and erythromycin sensitivity) and PCR (Fig. S2) were used to screen colonies for those carrying the expected chromosomal inserts. The population was usually dominated by bacteria in which chromosomal recombination had occurred within one to three subcultures. Chromosomal integration was confirmed to occur through homologous recombination via double crossover, as opposed to single crossover, by using a PCR primer pair 5 (Fig. 2). Chromosomal integration resulted in production of the strain L. agilis La3::PldhL-EGFP. Southern blot hybridization was performed to confirm recombination into the intended recombination site and to confirm that there had been no off-target integration. This was performed using DNA isolated from independent L. agilis La3::PldhL-EGFP colonies before and after they were passaged for ≥100 generations to confirm stable insertion (Fig. 2). Southern blot analysis demonstrated a single 2,856-bp band of the expected size. The probe did not hybridize to the negative L. agilis La3 wild-type control. Hybridization of the double-crossover insertion mutants before and after ≥100 generations under no selection indicated completely stable insertion at the targeted location within the chromosome. Figure S3 shows additional Southern blots proving recombination occurred at a single location within the chromosome.

FIG 2.

FIG 2

Schematic representation demonstrating the double-crossover event in L. agilis La3 using pTRKH2-LCER to generate insertional mutant L. agilis La3::PldhL-EGFP via homologous recombination and the corresponding Southern blot. (A) Plasmid map showing the left and right flanks (dark blue) allowing recombination of the catP and egfp genes into the chromosome, replacing 21 bp of noncoding DNA (between bp 1766620 and 1766640). The BEN83_08880 locus tag corresponds to a hypothetical protein while BEN83_08885 corresponds to a GMP synthase, both from the L. agilis La3 chromosome. The new mutant was resistant to chloramphenicol at 10 μg/ml but erythromycin sensitive, as the erythromycin resistance gene (Ermr) was not integrated. The purple text shows the primer sites (spans integration site using primer pair 7 [Table S2], made up of Crossover F and R Flank R Plas Clone), which allowed identification of L. agilis La3 chromosomal recombinants via PCR. (B) Overlay image of Southern blot to agarose gel electrophoresis image of the L. agilis La3 chromosomal digested with HindIII performed in biological triplicate. Lane 1, Generuler 1 kb Plus; lanes 2 and 3, L. agilis La3 WT; lane 4, L. agilis La3::PldhL-EGFP #1; lane 5, L. agilis La3::PldhL-EGFP #1, passaging ≥100 generations; lane 6, L. agilis La3::PldhL-EGFP #2; lane 7, L. agilis La3::PldhL-EGFP #2, passaging ≥100 generations; lane 8, L. agilis La3::PldhL-EGFP #3; lane 9, L. agilis La3::PldhL-EGFP #3, passaging ≥100 generations. The probe annealed to a band consistent with the expected size of 2,856 bp.

Positive relationship between promoter strength and protein expression levels.

The stable expression system for chromosomal integration was used to evaluate the predicted promoters. The first group of expression constructs that were made to assess promoter strength used the enhanced green fluorescent protein (EGFP) gene as the reporter. However, it was found that random nonsense mutations spontaneously arose at high frequency, indicating that high-level expression of EGFP was toxic to L. agilis La3 (data not shown). Therefore, an alternative fluorescent protein, CreiLOV (47), was chosen as a reporter to demonstrate activity of the selected promoters. CreiLOV has the added advantage of fluorescing without the need for oxygen and, hence, is particularly useful as it also has the potential for in vivo use in the anaerobic environment of the lower gut, the region where L. agilis La3 colonizes and where functional antigen delivery will be directed. The creiLOV sequence was codon optimized for L. agilis La3 (https://figshare.com/articles/Genbank_files_of_Lactobacillus_agilis_La3_genetic_tools/12111015) and cloned into pTRKH2-LCER to construct the pVEcXLa base plasmid (Fig. 3A).

FIG 3.

FIG 3

Visualization of the pVEcXLa plasmid and relationship between relative fluorescent units (RFUs) and transcripts per million reads (TPM) of identified promoters. RFUs are a proxy for protein production, while TPMs correspond to the promoter strength of the identified putative promoters. Colored dots show promoters associated with a TPM value: promoter-less pVEcXLa (pink), pVEcXLa-Ppsp (yellow), pVEcXLa-Pgap (dark blue), pVEcXLa-Peno (green), pVEcXLa-Peft (light blue), and pVEcXLa-Pcwah (orange). (A) pVEcXLa contains a left and right flank allowing 100% stable, site-directed recombination into the L. agilis La3 chromosome. The chromosomal insertion cassette includes a codon-optimized creiLOV gene that is surrounded by unique restriction sites for cloning and the catP gene to select for chromosomal recombinants on chloramphenicol. Promoters were cloned upstream of CreiLOV to test their impact on protein expression levels. (B) E. coli expressing CreiLOV under different L. agilis La3 promoters showed a strong, positive relationship (r = 0.9657, P  = 0.0017, r2 = 0.9325). Error bars, ± standard errors of the means (SEM). (C) L. agilis La3 expressing CreiLOV did not show a distinct linear relationship (r = 0.6809, P = 0.1365, r2 = 0.4637). For all experiments, n = 3, performed in biological triplicate. Error bars, ±SEM.

The relative expression levels of CreiLOV directed by the five selected strong, constitutive promoters (Ppsp, Pgap, Peno, Peft, and Pcwah) within the pVEcXLa plasmid system were measured by relative fluorescence units (RFUs) in both E. coli and L. agilis La3 as a proxy for protein production levels. Constructs pVEcXLa-Ppsp, pVEcXLa-Pgap, pVEcXLa-Peno, pVEcXLa-Peft, and pVEcXLa-Pcwah were used for this experiment (Table S1). RFUs were measured in both E. coli JM109 (expression cassettes on pVEcXLa plasmids) and in L. agilis La3 (chromosomally integrated expression cassettes). Protein production in an E. coli system was determined, as this provided a promoter screening step before transformation into L. agilis La3. The pVEcXLa plasmids were introduced into L. agilis La3, and transformants were passaged until chromosomal recombination occurred. Surprisingly, the pVEcXLa-Ppsp construct never recombined into the L. agilis La3 chromosome, despite the only difference between it and the other recombining plasmids being the promoter sequence. Therefore, for the L. agilis La3 fluorescence experiment, the plasmid-based expression cassette for the pVEcXLa-Ppsp construct was used for analysis. When the effect size and relationship between protein expression levels (indicated by number of RFUs) and promoter strength (indicated by relative transcript abundance, or TPM) was examined, there was a strong positive relationship in E. coli JM109 (r = 0.9657, P  = 0.0017, r2 = 0.9325) when expressed from the pVEcXLa plasmids (Fig. 3C). The relationship between TPM and RFU was not strictly linear in L. agilis La3 (r = 0.6809, P = 0.1365, r2 = 0.4637) (Fig. 3B), while Hedge’s g indicated weak effect sizes were demonstrated for all promoters compared to the promoter-less pVEcXLa negative control (Table S5). High background fluorescence from L. agilis La3, combined with low fluorescence intensity of CreiLOV (https://figshare.com/articles/online_resource/Genbank_files_of_Lactobacillus_agilis_La3_genetic_tools/12111015?file=25498142), partially obscured the relationship between promoter strength and protein expression levels that was seen in E. coli. However, these results indicated that the promoters and ribosome binding site (RBS) were correctly predicted and could be correlated with expression levels.

Expression of recombinant C. perfringens toxin rNetB.

With the stable chromosomally integrated native promoters demonstrated to be active, the expression strategy was used to express a relevant vaccine antigen. Recombinant NetB(S254L) [rNetB(S254L)], an inactivated form of the major Clostridium perfringens virulence factor for necrotic enteritis in chickens (48), was expressed to further evaluate the suitability of the selected promoters. Here, rNetB(S254L) will be referred to as rNetB. An L. agilis La3 codon-optimized rnetB sequence was cloned into each of the five pVEcXLa-Promoter-creiLOV plasmids, replacing creiLOV (Table S1). The five plasmids pVEcXLa-Ppsp-rnetB, pVEcXLa-Pgap-rnetB, pVEcXLa-Peno-rnetB, pVEcXLa-Peft-rnetB, and pVEcXLa-Pcwah-rnetB were transformed into L. agilis La3, and then colonies were passaged and screened for chromosomal integration (data not shown). The plasmid-based cassette carrying the Ppsp promoter, pVEcXLa-Ppsp-rnetB, again did not result in chromosomal integration, indicating that the lack of integration may, in some unknown way, be related to the Ppsp promoter. Of the recombinant strains, only L. agilis La3::Peft-rnetB, L. agilis La3::Pcwah-rnetB, and L. agilis La3 (pVEcXLa-Ppsp-rnetB) demonstrated rNetB expression (Fig. 4).

FIG 4.

FIG 4

Western blots of L. agilis La3 chromosomal recombinants expressing rNetB (32 to 34 kDa), harvested at early stationary phase (OD600, 5 to 6). (A) The outcomes of the five different promoter constructs expressing rNetB, performed in biological triplicate, prior to passaging. Lane 1, Precision Plus Protein Dual Xtra (Bio-Rad); lane 2, L. agilis La3 wild type #2 (negative control); lane 3, L. agilis La3 WT (negative control); lanes 4 to 6, L. agilis La3 (pVEcXLa-Ppsp-rnetB); lane 7, L. agilis La3::Pgap-rnetB #2; lanes 8 and 9, L. agilis La3::Peno-rnetB; lanes 10 to 12, L. agilis La3::Peft-rnetB; lanes 13 and 14, L. agilis La3::Pcwah-rnetB; lane 15, 0.69 ng rNetB. (B) rNetB expression from four independent L. agilis La3::Peft-rnetB transformants after passaging for ≥100 generations without selection. Three colonies from each of the four independent transformants were screened. Lane 1, Precision Plus Protein Dual Xtra (Bio-Rad); lane 2, L. agilis La3 wild type; lanes 3 to 6, L. agilis La3::Peft-rnetB transformant #1; lanes 7 to 10, L. agilis La3::Peft-rnetB transformant #2; lanes 11 to 14, L. agilis La3::Peft-rnetB transformant #3; lane 15, 0.69 ng rNetB. (C) rNetB expression from 4 independent L. agilis La3::Pcwah-rnetB transformants after passaging for ≥100 generations without selection. Three colonies from each of the four independent transformants were screened. Lane 1, Precision Plus Protein Dual Xtra (Bio-Rad); lane 2, L. agilis La3 wild type; lanes 3 to 6, L. agilis La3::Pcwah-rnetB transformant #1; lanes 7 to 10, L. agilis La3::Pcwah-rnetB transformant #2; lanes 11 to 14, L. agilis La3::Pcwah-rnetB transformant #3; lane 15, 0.69 ng rNetB.

To determine the stability of rNetB chromosomal expression, a stability assay was performed in biological triplicate that showed 100% DNA stability for L. agilis La3::Peft-rnetB and L. agilis La3::Pcwah-rnetB, while pVEcXLa-Ppsp-rnetB was completely lost from L. agilis La3 due to an initial lack of recombination. The stability of rNetB expression was also evaluated. All independent isolates from both L. agilis La3::Peft-rnetB (Fig. 4) and L. agilis La3::Pcwah-rnetB (Fig. 4) demonstrated rNetB expression in all randomly selected colonies from each strain, indicating consistent expression within each isolate population.

The amount of rNetB produced by the L. agilis La3 chromosomally integrated constructs was determined by comparison to a dilution series of known quantities of purified rNetB (Fig. S4). Both L. agilis La3::Peft-rnetB and L. agilis La3::Pcwah-rnetB, both before and after passaging, were estimated to produce approximately 6 pg/μl.

DISCUSSION

Food safety is a primary concern when evaluating a live vaccine vector candidate for use in food production animals. The analysis of the coding potential of the L. agilis La3 genome was consistent with previous literature, which showed L. agilis can colonize the gut (49, 50), and there is no evidence of L. agilis causing disease (49–51). No known virulence factors were identified in the L. agilis La3 genome.

Previously identified as an isolate that can reliably colonize the gut of chickens (52), the transcriptome analysis provided some indication as to why this is the case. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), elongation factor Tu, and enolase were the first, third, and fifth most abundant transcripts, respectively (Fig. 1). All are implicated in host binding and adhesion (53–55). GAPDH and enolase expressed by Lactobacillus species are positively charged and bind to negatively charged components of the cell wall at pH <5.6, human epithelial cells at pH <5, and fibronectin, plasminogen, and mucin, while releasing at higher pHs. Enolase and phosphoglycerate kinase (PGK) have also been shown to be adhesive to mucus (55). Elongation factor Tu is also a surface protein that has been shown to bind strongly to several human intestinal cell lines and mucin at pH 5 but suffers a significant binding reduction at pH 7 (56). Another potential adhesion CDS in the L. agilis La3 genome is degV, which binds to short-chain fatty acids (57). The pH within the chicken gastrointestinal tract is 3.47 ± 0.139 in the gizzard, 6.43 ± 0.031 in the small intestine, 6.4 ± 0.057 in the large intestine, and 6.62 ± 0.162 in the cecum (58). However, Lactobacillus and, specifically, L. agilis have been shown to lower the pH of their environment by producing lactic acid (43, 45, 59). The high transcript abundance of these adherence genes may play a role in the probiotic impact (44, 45) of L. agilis by competing for epithelial cell binding sites, thereby reducing the chance of pathogenic infection (60). This, combined with the high transcription levels for lactic acid-producing l-lactate dehydrogenase, the 16th most abundant transcript in L. agilis La3 (Fig. 1), which has been confirmed experimentally via a reporter gene (37), means L. agilis La3 can alter its environment to increase acidity, thereby improving its adhesive abilities. The acidic environment produced may also reduce the ability of potential pathogens to gain colonization footholds by eroding their niche, which is more suited to itself and other lactic acid bacteria. One study showed a probiotic mix of L. agilis JCM 1048 (ATCC 43564) and Ligilactobacillus salivarius JCM 1230 inhibited growth of Salmonella spp. and Campylobacter jejuni, both of which make up most poultry-related foodborne illness incidences (61–63). It is hypothesized that the inhibitory activity is due to acid production. When the probiotic mix was given to chickens, a short-term significant increase of Lactobacillus isolates was noted (44–46). The potential probiotic effects are not due to bacteriocins in L. agilis. Therefore, most likely L. agilis La3 modulates its environment to allow adhesion and successful colonization.

The presence of motility factors such as flagellar proteins (an important characteristic of the L. agilis strain) (43) likely allows L. agilis La3 to move through the mucosal layer of the gastrointestinal tract of the chicken. Combined with the bind-and-release mechanism of highly abundant host cell and mucus adhesion proteins, such as GAPDH, enolase, and elongation factor Tu, L. agilis La3 seems to be a highly flexible organism. Along with its ability to modulate the surrounding environment, this could partially explain why L. agilis is a highly specialized gastrointestinal colonizer across many different animals, including chickens (41, 44, 46, 64, 65), humans (49, 50), horses (66), pigeons (67), pigs, lemurs, and tapirs (42, 55, 64, 68). These adherence and motility genes may explain why L. agilis La3 is suitably adapted to persisting within the chicken gastrointestinal tract throughout the life of a chicken, across a diverse range of microbial populations and diets (41).

The transcription profiling of L. agilis La3 was undertaken to identify strong promoters. The goal was to identify constitutively transcribed promoters that were likely to be active in vivo, when L. agilis was colonizing the chicken gut gastrointestinal tract. It was not possible to obtain L. agilis cells from that in vivo environment, so, to increase the likelihood of identifying constitutively expressed genes, two different in vitro growth phases were investigated. The five predicted promoters (Table 1) associated with highly transcribed gene activity across different growth phases were confirmed to be promoters (and RBS) by demonstrating a positive relationship between transcript abundance and protein expression levels of CreiLOV. The relationship between increasing antigen dose and immune response has been previously shown (33, 34, 69, 70), so the success of a live vaccine relies heavily on the expression level of the antigen. These L. agilis La3 promoters all have higher TPM values than the l-lactate dehydrogenase promoter (PldhL) previously used in L. agilis La3 expression constructs (37), which was found to be the 16th most abundant transcript (Fig. 1). The GAPDH promoter (Pgap) produced the highest constitutive transcript level and has been used previously to express high levels of heterologous protein in the algae Dunaliella salina (71). This promoter also produced the highest levels of CreiLOV in both E. coli JM109 and L. agilis La3 (Fig. 3B and C); however, no rNetB expression was identified. It is unclear why this occurred, although expression above a particular amount may be deleterious to L. agilis La3. Curiously, the relationship between promoter strength and protein expression of the predicted L. agilis La3 native promoters showed a stronger, positive relationship in E. coli than in L. agilis La3. It is possible that a more accurate measurement of CreiLOV expression in L. agilis La3 can be determined using antibody-based methods (72). Regardless, a moderately positive relationship (r2 = 0.4637) was found between promoter strength and number of RFUs (Fig. 3B and C), indicating that a stronger promoter resulted in higher CreiLOV expression.

The pTRKH2-LCER and pVEcXLa chromosomal insertion system proved to be highly successful. Chromosomal recombination has been demonstrated many times within Lactobacillus species through site-specific attP-attB recombination (73), and homologous recombination (74) and has been occasionally used in developing live vectors (20, 75). The constructed pVEcXLa allowed stable chromosomal integration and formation of new L. agilis La3 strains, confirmed via antibiotic resistance profile, PCR, and protein expression. Surprisingly, the pVEcXLa-Ppsp plasmid did not allow chromosomal integration despite passaging for >200 generations. The mechanism at work here is unknown but may be a sequence-specific effect of the 151-bp promoter region. Formation of DNA secondary structures was previously shown to impact recombination as well as gene regulation (76–78).

We utilized a validated vaccine antigen to demonstrate the potential of L. agilis La3 and pVEcXLa as a delivery platform. The necrotic enteritis essential virulence factor, NetB, is a 33-kDa protein (79). rNetB(S254L) is a reduced-activity mutated derivative of NetB (48) that has been previously used as an immunogenic vaccine antigen, resulting in partial protection against necrotic enteritis (11, 13, 80–82). Successful demonstration of chromosomal rNetB expression by L. agilis La3, a native chicken colonizer, regulated by a highly active, constitutive, and native promoter demonstrates the potential value of L. agilis La3 as a live delivery vector. Three of the five constructed plasmids resulted in expression of rNetB (pVEcXLa-Ppsp-rnetB, pVEcXLa-Peft-rnetB, and pVEcXLa-Pcwah-rnetB), with the latter two demonstrating 100% stability, both in terms of the chromosomal insert and rNetB expression levels.

The chromosomal insertion site was chosen partially based on its relatively low level of transcription. The working hypothesis was that by utilizing a lowly transcribed region with no identified protein coding sequences, the chances of an insertion in the region disrupting any normal cellular function would be low. Considering the results obtained, it is likely this low transcriptional area has structural barriers to high expression and may explain the low levels of rNetB expression in L. agilis La3::Peft-rnetB and L. agilis La3::Pcwah-rnetB. Variation in protein expression of up to around 300-fold has been demonstrated by inserting an identical expression cassette into multiple different regions of the E. coli chromosome (83). This shows the importance of chromosomal location for therapeutic gene expression. However, given that the CreiLOV expression results indicated a positive relationship between transcript abundance and protein expression levels, it is likely that they are the strongest promoters. The data presented here showed that promoters and ribosomal binding sites taken from highly transcribed genes do not equate to high expression levels when expressed in a different place within the chromosome.

In summary, we have constructed novel expression systems for the highly effective poultry gut colonizer L. agilis La3, allowing stable expression of recombinant protein. Useful extensions of this work to further develop L. agilis La3 as a live vector for poultry should include efforts to express a variety of vaccine antigens from notable pathogens such as C. perfringens or C. jejuni, as well as assessment of alternative chromosomal insertion sites to maximize recombinant protein expression, before testing the developed live vaccine strains in animal vaccination experiments.

MATERIALS AND METHODS

Growth conditions.

L. agilis La3 (41) was grown anaerobically at 37°C in de Man, Rogosa, and Sharpe (MRS) medium (Oxoid), with antibiotics as required (unless otherwise stated, chloramphenicol, 10 μg/ml; erythromycin, 10 μg/ml). All Escherichia coli strains were grown at 37°C in lysogeny broth (LB) medium (1%, wt/vol, tryptone, 1%, wt/vol, NaCl, and 0.5%, wt/vol, yeast extract [Oxoid]) and shaken at 250 rpm. Antibiotics were added as required (chloramphenicol, 30 μg/ml; erythromycin, 10 μg/ml). Growth curves were performed as described in Data Set S1 in the supplemental material.

Plasmid construction.

Plasmids were constructed via restriction enzymes (NEB) and T4 ligase (NEB) and are summarized in Table S1. Where stated, fragments used for cloning were PCR amplified using Platinum Taq (Invitrogen) per the manufacturer’s instructions using primers detailed in Table S2. Constructs were confirmed by Sanger sequencing. Plasmids were isolated from E. coli JM109 using an ISOLATE II plasmid minikit (BIOLINE) kit per the manufacturer’s instructions. Gel electrophoresis and transformation of E. coli were performed as described in Data Set S1.

Transformation of L. agilis La3.

L. agilis La3 transformation was performed using a modified version of a previously published method (37). Briefly, overnight 30-ml cultures of L. agilis La3 were grown and inoculated 1:6 into fresh MRS liquid medium with 2% (wt/vol) glycine and grown at 37°C for 90 min. Cells were then centrifuged at 4,000 × g for 2 min at 4°C and supernatants removed via pipetting. Cells were washed with 40 ml of ice-cold ultrapure water and then resuspended in 40 ml ice-cold 50 mM EDTA and incubated for 5 min on ice. Cells were then washed in 40 ml 0.3 M sucrose and resuspended in 100 μl 0.3 M sucrose containing 3 μg plasmid DNA. This mixture was added to an ice-cold Gene Pulser 0.2-cm electroporation cuvette (Bio-Rad). Cells were electroporated using a Gene Pulser and Pulse Controller (Bio-Rad) at 1.5 kV, 200 Ω, and 25 μF. Cells were immediately diluted 1:20 into 1.3 ml of prewarmed MRS liquid medium in 1.5-ml microtubes and incubated for 3 h at 37°C. Culture (200 μl) was gently spread onto MRS plates containing appropriate antibiotics and incubated anaerobically at 37°C for 24 to 72 h. All solutions were sterilized through a 0.22-μm Millex-GP syringe filter unit (Merck) before use. Plasmid pTRKH2 (Table S1) was used as a positive DNA control for transformations. DNA stability assays and Southern blotting were performed as described in Data Set S1.

Genome sequencing and assembly.

For long-read data, L. agilis La3 was grown overnight in 10 ml MRS and 10 μl subcultured into five 1.5-ml MRS broth samples until mid-log phase (optical density at 600 nm [OD600] of 1.8). DNA was extracted using the MagAttract HMW kit (Qiagen) per the manufacturer’s instructions. DNA was concentrated and cleaned using Agencourt AMPure XP beads (Beckman Coulter) per the manufacturer’s instructions, with one exception: 0.5 μl instead of 1.8 μl beads per 1 μl of DNA was used and eluted into 84 μl ultrapure water. Size selection at 20 kb was performed using BluePippin size selection (Sage Science), and DNA was prepared for sequencing using SMRTbell Template Prep kit 1.0 (Pacific Biosciences) and sequenced on the PacBio RS II at Macrogen (South Korea). For short-read data, chromosomal DNA was isolated from L. agilis La3 using the ISOLATE fecal DNA kit (Bioline) per the manufacturer’s instructions. The Nextera XT DNA Library Prep kit (Illumina) was used per the manufacturer’s instructions to prepare DNA for sequencing, with size selection at around 600 bp. The MiSeq was run using the 2× 300-bp reagent kit, and 588,547,918 raw bases and 2,736,962 raw reads were generated. The L. agilis La3 genome is approximately 2.2 Mb, indicating 267-fold coverage. Sequence data and accession numbers from this study can be found in Table S3. DNA was also sequenced on the Genome Sequencer FLX system (454 Life Sciences/Roche, Branford, CT, USA) using 3-kb paired-end reads.

Sequencing data were analyzed on Biolinux 8 (84). Output PacBio bax.h5 files were concatenated into a .bam file using bax2bam version 0.0.8 (pitchfork release, 6 October 2016) (85) and then converted to fastq format using the bamToFastq command from bedtools version 2.17.0 (pitchfork release, 6 October 2016). All PacBio reads were incorporated for assembly using Canu Assembler version 1.3 with the following options: “stopOnReadQuality=false”, “genomeSize = 2.2m”, and “-pacbio-raw” (86). The beginning and end of the assembled L. agilis La3 molecule were aligned against each other using BLAST (87–89) to determine if the molecule could be circularized. Seqret (EMBOSS version 6.6.0.0) was used to reformat the circularized fasta file to appropriate fasta format. Raw PacBio reads were aligned using blasr version 5.2.b99b47c (pitchfork release, 6 October 2016) (85) and output in .bam format to confirm correct circularization and polish the genome assembly. The aligned .bam file was sorted and ordered using the “sort” command in SAMtools, version 1.3.1 (90). The sorted alignment .bam file was indexed using pbindex version 0.5.0 (pitchfork release, 6 October 2016). Mapped reads were then visualized on Tablet (version 1.14.04.10) (91). Indexing of the L. agilis La3 genome file was done using the “faidx” command from SAMtools, version 1.3.1. The genome file was then polished using the “arrow” command from variantCaller, version 2.0.0 (pitchfork release, 6 October 2016) (92). To improve the accuracy of the genome, the MiSeq data were integrated into the polished genome for short-read error correction. An index of the genome was created using the “index” command from bwa, version 0.7.12 (93). The MiSeq output fastq files were concatenated using the “cat” command from GNU coreutils, version 8.21, and then aligned to the genome using the “mem” option from bwa, version 0.7.12. The resulting sam file was converted to .bam format, sorted, and indexed using the “view”, “sort”, and “index” commands, respectively, from SAMtools, version 1.3.1. The indexed mapped reads were used as the input for Pilon version 1.18 (94) for short-read error correction of the L. agilis La3 genome.

Annotation.

The complete genome sequence was submitted to GenBank for the Prokaryotic Genome Annotation Pipeline (95). The genome was also submitted to RAST for annotation and SEED subsystem information (96–98). BAGEL3 BLASTN was used to identify potential bacteriocins present in the L. agilis La3 genome (99). Prophage regions were identified using PHAST (100).

Comparison to other L. agilis strains.

Sequences of L. agilis strains were downloaded from NCBI GenBank, and genome statistics were compared. BPGA (version 1.3) (101) was used to compare the core and pangenomes at 70% similarity, as typically used in other comparative genomics studies (102).

Codon usage.

A codon usage table was generated using cusp (EMBOSS, version 6.6.0.0) after extracting the coding sequences (CDS) from the annotated L. agilis La3 genome.

RNA isolation from L. agilis La3.

RNA was isolated from the mid-logarithmic-phase (OD600, 3.5) and early-stationary-phase (OD600, 5.7) cultures to identify constitutively expressed genes. All reagents for RNA isolation and purification were made using diethyl pyrocarbonate (DEPC)-treated water to ensure no RNases would be active. L. agilis La3 was grown anaerobically at 42°C in a Whitley A35 anaerobic workstation. One milliliter of culture was taken, and two volumes of RNAlater (Qiagen) were added to sample and then vortexed for 5 s. The tubes were then centrifuged for 10 min at 5,000 × g and the supernatant discarded. A volume of 100 μl lysozyme solution (1% 2-mercaptoethanol, 10 mM Tris-Cl, 1 mM EDTA, 15 mg/ml lysozyme, pH 8.0) was added and vortexed for 10 s and then incubated at room temperature for 1 h. Buffer RLT (Qiagen) was added (700 μl) and vortexed for 10 s, and then the suspension was added to 2-ml screw-cap tubes containing 50 mg 0.1-mm zirconia/silica beads (Daintree Scientific). Samples were homogenized at maximum speed for 5 min in the Precellys 24 lysis and homogenization instrument (Bertin Technologies), and then samples were centrifuged at 14,000 × g for 10 s. Supernatant was kept, and 440 μl 100% ethanol was added. The RNeasy minikit (Qiagen) was used to purify RNA per the manufacturer’s instructions. Quality was determined using a NanoDrop ND1000 (ThermoScientific).

cDNA synthesis and library preparation.

cDNA was prepared using 3.35 nmol random pentadecamer primers (103) and SuperScript II (400 U) (Invitrogen), and NEBNext second-strand synthesis enzyme mix (NEB) was used for second-strand synthesis per the manufacturer’s instructions. Primers and small fragments were removed using the MinElute reaction cleanup kit (Qiagen). The Nextera XT DNA sample preparation kit (Illumina) was used per the manufacturer’s instructions, with the following exceptions. The initial amount of DNA was halved, and during PCR cleanup, 25 μl AMPure XP beads was added to size select fragment sizes of 500 to 700 bp, confirmed by analysis on the 2100 Bioanalyzer (Agilent) using the high-sensitivity DNA quick kit (Agilent) per the manufacturer’s instructions.

RNA sequencing and analysis.

Logarithmic and stationary-phase libraries were sequenced (2× 300 bp) on a MiSeq (Illumina) with v3 sequencing chemistry per the manufacturer’s instructions (104). Two million reads were taken as a subsample from the output fastq files and quality trimmed using FastqMcf, version 1.04.636, from ea-utils (105) with the following options: “-l 50 -q 15 -w 5 -H -X –homopolymer-pct 50 –lowcomplex-pct 70.” The build command from Bowtie2 version 2.2.3 was used to build a reference genome index file and map the trimmed reads to the reference genome. SAMtools, version 0.1.19, was used to convert to .bam, sort, and index files. Artemis (106) was used to visualize the mapped reads against the genome and calculate reads per kilobase of transcript per million mapped reads (RPKM). Numbers of transcripts per million reads (TPM) (107, 108) were calculated using the following formula: TPM = (RPKM of feature/total RPKM) × 106.

Fluorescent quantification of CreiLOV expression.

Freshly transformed E. coli JM109 and L. agilis La3 were grown to mid-logarithmic phase (OD600 0.4 and 3.5, respectively) in biological triplicate. Cell density was normalized in 1× phosphate-buffered saline (PBS) to an OD600 of 0.3 and 0.1, respectively. Whole-cell lysate from 5-ml cultures of E. coli and L. agilis La3 was obtained by resuspending cells in 1 ml 1× PBS and bead-beating in 2-ml screw-cap microtubes with 250 mm3 0.1-mm zirconia/silica beads (BioSpec) at 6.5 m/s for 60 s using a FastPrep-24 classic instrument (MP Biomedicals). Lysed cells were then centrifuged at 2,000 × g for 10 s. Supernatant (200 μl) was transferred to a 96-well black CellStar plate (Greiner), and CreiLOV expression levels were quantified using relative fluorescent units (RFUs) in technical triplicates. Fluorescence intensity was determined using a POLARstar Omega plate reader spectrophotometer and 360- to 10-nm excitation and 490- to 10-nm emission filters. The gain was set on the sample with highest fluorescence and 1× PBS was used as a blank. Wild-type E. coli JM109 and L. agilis La3 were used as negative controls. Data were then analyzed using GraphPad Prism (version 7.02). Numerical RFU values were analyzed using one-way analysis of variance (ANOVA), and Dunnett’s test was done to correct for multiple comparisons. Linear regression analysis was used to correlate number of RFUs to TPM. Hedge’s g was calculated using https://www.polyu.edu.hk/mm/effectsizefaqs/calculator/calculator.html.

Quantification of rNetB expression.

Freshly transformed L. agilis La3 was grown to mid-logarithmic phase (OD600, 3.5) in biological triplicate, and then cell density was normalized in 1× PBS to an OD600 of 0.1. Whole-cell lysate was electrophoresed on 4% to 20% Novex Wedgewell Tris-glycine gels (ThermoFisher Scientific) per the manufacturer’s instructions. Gels were either directly stained with Coomassie blue or used for Western blotting. Protein was transferred onto polyvinylidene difluoride (PVDF) membranes. Membranes were washed with 40 ml blocking solution (50 mM Tris base, 150 mM NaCl [pH 7.5], 0.05% Tween 20, 5%, wt/vol, skim milk powder). To preabsorb nonspecific, non-anti-rNetB antibodies, a primary antibody solution was prepared by adding 50 μl L. agilis La3 wild-type and E. coli JM109 wild-type whole-cell lysates to fresh antibody solution (1/500 dilution of rabbit polyclonal IgG antibody serum [anti-rNetB] in blocking solution). This was incubated at room temperature for 1 h and then centrifuged at 3,500 × g for 10 min and the supernatant kept. The membrane was probed with this solution. The membrane was washed 3 times for 10 min in 40 ml TBST (50 mM Tris base, 150 mM NaCl [pH 7.5], 0.05% Tween 20) and then incubated with the secondary antibody solution (1/8,000 dilution of goat polyclonal antibody serum [anti-rabbit IgG]-AP [ThermoFisher Scientific]) in blocking solution. The membrane was then washed 3 times for 10 min in 40 ml TBS (50 mM Tris base, 150 mM NaCl [pH 7.5]) and the blot developed with 1.5 ml Western blue (Promega). When the desired level of development had been achieved, the blot was washed with deionized water. To determine stability of rNetB expression, L. agilis La3 was passaged for ≥100 generations without selection, and then Western blots were performed as described above. To determine protein concentration, rNetB production was semiquantitatively compared to dilutions of known quantities of purified rNetB via Western blotting.

Promoter identification.

Promoters were identified from the most abundant transcripts via visual comparison to a Lactobacillus promoter consensus sequence (52, 109) by searching upstream of identified genes.

Data availability.

All data utilized in this study are found in the supplemental material. GenBank accession numbers can be found in Table S3. Briefly, the assembly accession numbers are the following: chromosomal DNA of L. agilis La3, CP016766.1; pLa3_1, CP034226; pLa3_2, CP034227; pLa3_3, CP034228; and pLa3_4, CP034229. The DNA sequencing reads can be found with accession numbers SRX4927791 and SRX4927790 for PacBio RS II and 2× 300 MiSeq, respectively. RNA sequencing data can be found with accession numbers SRX4927788 and SRX4927789 for logarithmic and stationary phases, respectively. DNA methylation data and motifs generated from PacBio reads can be found at http://rebase.neb.com/cgi-bin/onumget?25455. Synthetic plasmid and CreiLOV sequences can be found at https://figshare.com/articles/Genbank_files_of_Lactobacillus_agilis_La3_genetic_tools/12111015.

Supplementary Material

Download
Download

ACKNOWLEDGMENTS

We thank the Australian Federal Government for providing Ben Vezina with an Australian Postgraduate Award scholarship and the Poultry Cooperative Research Center for providing a top-up scholarship.

We also thank Honglei Chen for performing the MiSeq DNA sequencing.

Footnotes

Supplemental material is available online only.

REFERENCES

  • 1.U.S. Census Bureau. 2016. Total midyear population for the world: 1950–2050. U.S. Census Bureau, Washington, DC. https://web.archive.org/web/20170521041303/https:/www.census.gov/population/international/data/worldpop/table_population.php. [Google Scholar]
  • 2.United Nations. 2013. World population prospects: the 2012 revision. Department of Economic and Social Affairs PD, United Nations, New York, NY. http://www.un.org/en/development/desa/population/theme/trends/index.shtml. [Google Scholar]
  • 3.Mekonnen MM, Hoekstra AY. 2012. A global assessment of the water footprint of farm animal products. Ecosystems 15:401–415. 10.1007/s10021-011-9517-8. [DOI] [Google Scholar]
  • 4.Giannenas I, Tsalie E, Triantafillou E, Hessenberger S, Teichmann K, Mohnl M, Tontis D. 2014. Assessment of probiotics supplementation via feed or water on the growth performance, intestinal morphology and microflora of chickens after experimental infection with Eimeria acervulina, Eimeria maxima and Eimeria tenella. Avian Pathol 43:209–216. 10.1080/03079457.2014.899430. [DOI] [PubMed] [Google Scholar]
  • 5.Kaufmann AF, Feeley JC. 1968. Culture survey of Salmonella at a broiler-raising plant. Public Health Rep 83:417–422. 10.2307/4593310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Newell DG, Wagenaar JA. 2000. Poultry infections and their control at the farm level, p 497–509. In Nachamkin I, Blaser MJ (ed), Campylobacter, 2nd ed. ASM Press, Washington, DC. [Google Scholar]
  • 7.Timbermont L, Haesebrouck F, Ducatelle R, Immerseel FV. 2011. Necrotic enteritis in broilers: an updated review on the pathogenesis. Avian Pathol 40:341–347. 10.1080/03079457.2011.590967. [DOI] [PubMed] [Google Scholar]
  • 8.Williams RB. 2005. Intercurrent coccidiosis and necrotic enteritis of chickens: rational, integrated disease management by maintenance of gut integrity. Avian Pathol 34:159–180. 10.1080/03079450500112195. [DOI] [PubMed] [Google Scholar]
  • 9.Melo RT, Nalevaiko PC, Mendonça EP, Borges LW, Fonseca BB, Beletti ME, Rossi DA. 2013. Campylobacter jejuni strains isolated from chicken meat harbor several virulence factors and represent a potential risk to humans. Food Control 33:227–231. 10.1016/j.foodcont.2013.02.032. [DOI] [Google Scholar]
  • 10.Mot D, Timbermont L, Haesebrouck F, Ducatelle R, Van Immerseel F. 2014. Progress and problems in vaccination against necrotic enteritis in broiler chickens. Avian Pathol 43:290–300. 10.1080/03079457.2014.939942. [DOI] [PubMed] [Google Scholar]
  • 11.Keyburn AL, Portela RW, Sproat K, Ford ME, Bannam TL, Yan X, Rood JI, Moore RJ. 2013. Vaccination with recombinant NetB toxin partially protects broiler chickens from necrotic enteritis. Vet Res 44:54. 10.1186/1297-9716-44-54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Saleh N, Fathalla SI, Nabil R, Mosaad AA. 2011. Clinicopathological and immunological studies on toxoids vaccine as a successful alternative in controlling clostridial infection in broilers. Anaerobe 17:426–430. 10.1016/j.anaerobe.2011.04.019. [DOI] [PubMed] [Google Scholar]
  • 13.Keyburn AL, Portela RW, Ford ME, Bannam TL, Yan XX, Rood JI, Moore RJ. 2013. Maternal immunization with vaccines containing recombinant NetB toxin partially protects progeny chickens from necrotic enteritis. Vet Res 44:108. 10.1186/1297-9716-44-108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Rice BE, Rollins DM, Mallinson ET, Carr L, Joseph SW. 1997. Campylobacter jejuni in broiler chickens: colonization and humoral immunity following oral vaccination and experimental infection. Vaccine 15:1922–1932. 10.1016/s0264-410x(97)00126-6. [DOI] [PubMed] [Google Scholar]
  • 15.Kulkarni RR, Parreira VR, Jiang Y-F, Prescott JF. 2010. A live oral recombinant Salmonella enterica serovar Typhimurium vaccine expressing Clostridium perfringens antigens confers protection against necrotic enteritis in broiler chickens. Clin Vaccine Immunol 17:205–214. 10.1128/CVI.00406-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Mishra N, Smyth JA. 2017. Oral vaccination of broiler chickens against necrotic enteritis using a non-virulent NetB positive strain of Clostridium perfringens type A. Vaccine 35:6858–6865. 10.1016/j.vaccine.2017.10.030. [DOI] [PubMed] [Google Scholar]
  • 17.LeCureux JS, Dean GA. 2018. Lactobacillus mucosal vaccine vectors: immune responses against bacterial and viral antigens. mSphere 3:e00061-18. 10.1128/mSphere.00061-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Jee P-F, Tiong V, Shu M-H, Khoo J-J, Wong WF, Abdul Rahim R, AbuBakar S, Chang L-Y. 2017. Oral immunization of a non-recombinant Lactococcus lactis surface displaying influenza hemagglutinin 1 (HA1) induces mucosal immunity in mice. PLoS One 12:e0187718. 10.1371/journal.pone.0187718. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Kobierecka PA, Olech B, Książek M, Derlatka K, Adamska I, Majewski PM, Jagusztyn-Krynicka EK, Wyszyńska AK. 2016. Cell wall anchoring of the Campylobacter antigens to Lactococcus lactis. Front Microbiol 7:165. 10.3389/fmicb.2016.00165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Layton SL, Morgan MJ, Cole K, Kwon YM, Donoghue DJ, Hargis BM, Pumford NR. 2011. Evaluation of Salmonella-vectored Campylobacter peptide epitopes for reduction of Campylobacter jejuni in broiler chickens. Clin Vaccine Immunol 18:449–454. 10.1128/CVI.00379-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.de Zoete MR, van Putten JPM, Wagenaar JA. 2007. Vaccination of chickens against Campylobacter. Vaccine 25:5548–5557. 10.1016/j.vaccine.2006.12.002. [DOI] [PubMed] [Google Scholar]
  • 22.Messaoudi S, Madi A, Prévost H, Feuilloley M, Manai M, Dousset X, Connil N. 2012. In vitro evaluation of the probiotic potential of Lactobacillus salivarius SMXD51. Anaerobe 18:584–589. 10.1016/j.anaerobe.2012.10.004. [DOI] [PubMed] [Google Scholar]
  • 23.Shin MS, Han SK, Ji AR, Kim KS, Lee WK. 2008. Isolation and characterization of bacteriocin-producing bacteria from the gastrointestinal tract of broiler chickens for probiotic use. J Appl Microbiol 105:2203–2212. 10.1111/j.1365-2672.2008.03935.x. [DOI] [PubMed] [Google Scholar]
  • 24.Messaoudi S, Kergourlay G, Dalgalarrondo M, Choiset Y, Ferchichi M, Prévost H, Pilet M-F, Chobert J-M, Manai M, Dousset X. 2012. Purification and characterization of a new bacteriocin active against Campylobacter produced by Lactobacillus salivarius SMXD51. Food Microbiol 32:129–134. 10.1016/j.fm.2012.05.002. [DOI] [PubMed] [Google Scholar]
  • 25.Lohans CT, Belkum MJV, Cochrane SA, Huang Z, Sit CS, McMullen LM, Vederas JC. 2014. Biochemical, structural, and genetic characterization of tridecaptin A1, an antagonist of Campylobacter jejuni. Chembiochem 15:243–249. 10.1002/cbic.201300595. [DOI] [PubMed] [Google Scholar]
  • 26.Niederstadt L, Hohn O, Dorner BG, Schade R, Bannert N. 2012. Stimulation of IgY responses in gene gun immunized laying hens by combined administration of vector DNA coding for the target antigen botulinum toxin A1 and for avian cytokine adjuvants. J Immunol Methods 382:58–67. 10.1016/j.jim.2012.05.005. [DOI] [PubMed] [Google Scholar]
  • 27.Nishimichi N, Aosasa M, Kawashima T, Horiuchi H, Furusawa S, Matsuda H. 2005. Biological activity of recombinant chicken interleukin-6 in chicken hybridoma cells. Vet Immunol Immunopathol 106:97–105. 10.1016/j.vetimm.2005.01.006. [DOI] [PubMed] [Google Scholar]
  • 28.Cho SH, Loewen PC, Marquardt RR. 2004. A plasmid DNA encoding chicken interleukin-6 and Escherichia coli K88 fimbrial protein FaeG stimulates the production of anti-K88 fimbrial antibodies in chickens. Poult Sci 83:1973–1978. 10.1093/ps/83.12.1973. [DOI] [PubMed] [Google Scholar]
  • 29.Nariya H, Miyata S, Tamai E, Sekiya H, Maki J, Okabe A. 2011. Identification and characterization of a putative endolysin encoded by episomal phage phiSM101 of Clostridium perfringens. Appl Microbiol Biotechnol 90:1973–1979. 10.1007/s00253-011-3253-z. [DOI] [PubMed] [Google Scholar]
  • 30.Gervasi T, Horn N, Wegmann U, Dugo G, Narbad A, Mayer MJ. 2014. Expression and delivery of an endolysin to combat Clostridium perfringens. Appl Microbiol Biotechnol 98:2495–2505. 10.1007/s00253-013-5128-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Ragione RML, Woodward MJ, Kumar M, Rodenberg J, Fan H, Wales AD, Karaca K. 2013. Efficacy of a live attenuated Escherichia coli O78:K80 vaccine in chickens and turkeys. Avian Dis 57:273–279. 10.1637/10326-081512-Reg.1. [DOI] [PubMed] [Google Scholar]
  • 32.De Cort W, Haesebrouck F, Ducatelle R, Immerseel F. 2015. Administration of a Salmonella Enteritidis hilAssrAfliG strain by coarse spray to newly hatched broilers reduces colonization and shedding of a Salmonella Enteritidis challenge strain. Poult Sci 94:131–135. 10.3382/ps/peu018. [DOI] [PubMed] [Google Scholar]
  • 33.Cardenas L, Clements JD. 1993. Stability, immunogenicity and expression of foreign antigens in bacterial vaccine vectors. Vaccine 11:126–135. 10.1016/0264-410X(93)90007-K. [DOI] [PubMed] [Google Scholar]
  • 34.De Cort W, Geeraerts S, Balan V, Elroy M, Haesebrouck F, Ducatelle R, Van Immerseel F. 2013. A Salmonella enteritidis hilAssrAfliG deletion mutant is a safe live vaccine strain that confers protection against colonization by Salmonella enteritidis in broilers. Vaccine 31:5104–5110. 10.1016/j.vaccine.2013.08.042. [DOI] [PubMed] [Google Scholar]
  • 35.Lin R, Zhang Y, Long B, Li Y, Wu Y, Duan S, Zhu B, Wu X, Fan H. 2017. Oral immunization with recombinant Lactobacillus acidophilus expressing espA-Tir-M confers protection against enterohemorrhagic Escherichia coli O157:H7 challenge in mice. Front Microbiol 8:417. 10.3389/fmicb.2017.00417. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Curtiss IIR, Hassan JO. 1996. Nonrecombinant and recombinant avirulent Salmonella vaccines for poultry. Vet Immunol Immunopathol 54:365–372. 10.1016/s0165-2427(96)05683-8. [DOI] [PubMed] [Google Scholar]
  • 37.Stephenson DP, Moore RJ, Allison GE. 2011. Transformation of, and heterologous protein expression in, Lactobacillus agilis and Lactobacillus vaginalis isolates from the chicken gastrointestinal tract. Appl Environ Microbiol 77:220–228. 10.1128/AEM.02006-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Browning DF, Busby SJW. 2004. The regulation of bacterial transcription initiation. Nat Rev Microbiol 2:57–65. 10.1038/nrmicro787. [DOI] [PubMed] [Google Scholar]
  • 39.Guiziou S, Sauveplane V, Chang HJ, Clerté C, Declerck N, Jules M, Bonnet J. 2016. A part toolbox to tune genetic expression in Bacillus subtilis. Nucleic Acids Res 44:7495–7508. 10.1093/nar/gkw624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O'Toole PW, Pot B, Vandamme P, Walter J, Watanabe K, Wuyts S, Felis GE, Gänzle MG, Lebeer S. 2020. A taxonomic note on the genus Lactobacillus: description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol 70:2782–2858. 10.1099/ijsem.0.004107. [DOI] [PubMed] [Google Scholar]
  • 41.Stephenson DP, Moore RJ, Allison GE. 2010. Lactobacillus strain ecology and persistence within broiler chickens fed different diets: identification of persistent strains. Appl Environ Microbiol 76:6494–6503. 10.1128/AEM.01137-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kajikawa A, Midorikawa E, Masuda K, Kondo K, Irisawa T, Igimi S, Okada S. 2016. Characterization of flagellins isolated from a highly motile strain of Lactobacillus agilis. BMC Microbiol 16:49. 10.1186/s12866-016-0667-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Weiss N, Schillinger U, Laternser M, Kandler O. 1981. Lactobacillus sharpeae sp. nov. and Lactobacillus agilis sp. nov., two new species of homofermentative, meso-diaminopimelic acid-containing lactobacilli isolated from sewage. Zentralbl Bakteriol Mikrobiol Hyg C 2:242–253. 10.1016/S0721-9571(81)80005-1. [DOI] [Google Scholar]
  • 44.Lan PTN, Binh LT, Benno Y. 2003. Impact of two probiotic Lactobacillus strains feeding on fecal lactobacilli and weight gains in chicken. J Gen Appl Microbiol 49:29–36. 10.2323/jgam.49.29. [DOI] [PubMed] [Google Scholar]
  • 45.Meimandipour A, Shuhaimi M, Hair-Bejo M, Azhar K, Kabeir BM, Rasti B, Yazid AM. 2009. In vitro fermentation of broiler cecal content: the role of lactobacilli and pH value on the composition of microbiota and end products fermentation. Lett Appl Microbiol 49:415–420. 10.1111/j.1472-765X.2009.02674.x. [DOI] [PubMed] [Google Scholar]
  • 46.Chen CY, Chen SW, Wang HT. 2016. Effect of supplementation of yeast with bacteriocin and Lactobacillus culture on growth performance, cecal fermentation, microbiota composition, and blood characteristics in broiler chickens. Asian-Australas J Anim Sci 30:211–220. 10.5713/ajas.16.0203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Mukherjee A, Weyant KB, Agrawal U, Walker J, Cann IKO, Schroeder CM. 2015. Engineering and characterization of new LOV-based fluorescent proteins from Chlamydomonas reinhardtii and Vaucheria frigida. ACS Synth Biol 4:371–377. 10.1021/sb500237x. [DOI] [PubMed] [Google Scholar]
  • 48.Yan X-X, Porter CJ, Hardy SP, Steer D, Smith AI, Quinsey NS, Hughes V, Cheung JK, Keyburn AL, Kaldhusdal M, Moore RJ, Bannam TL, Whisstock JC, Rood JI. 2013. Structural and functional analysis of the pore-forming toxin NetB from Clostridium perfringens. mBio 4:e00019-13. 10.1128/mBio.00019-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Molin G, Jeppsson B, Johansson ML, Ahrné S, Nobaek S, Ståhl M, Bengmark S. 1993. Numerical taxonomy of Lactobacillus spp. associated with healthy and diseased mucosa of the human intestines. J Appl Bacteriol 74:314–323. 10.1111/j.1365-2672.1993.tb03031.x. [DOI] [PubMed] [Google Scholar]
  • 50.Drissi F, Labas N, Merhej V, Raoult D. 2015. Draft genome sequence of the Lactobacillus agilis strain Marseille. Genome Announc 3:e00840-15. 10.1128/genomeA.00840-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Johansson M-L, Molin LG, Jeppsson LB, Nobaek S, Ahrne S, Bengmark S. 1993. Administration of different Lactobacillus strains in fermented oatmeal soup: in vivo colonization of human intestinal mucosa and effect on the indigenous flora. Appl Environ Microbiol 59:15–20. 10.1128/AEM.59.1.15-20.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Stephenson DP. 2010. Microbial ecology of Lactobacillus strains in the chicken gastrointestinal tract: identification of persistent strains for use as live vectors. PhD dissertation. Australian National University, Canberra, Australia. https://openresearch-repository.anu.edu.au/handle/1885/150516. [Google Scholar]
  • 53.Antikainen J, Kuparinen V, Kupannen V, Lähteenmäki K, Korhonen TK. 2007. pH-dependent association of enolase and glyceraldehyde-3-phosphate dehydrogenase of Lactobacillus crispatus with the cell wall and lipoteichoic acids. J Bacteriol 189:4539–4543. 10.1128/JB.00378-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Glenting J, Beck HC, Vrang A, Riemann H, Ravn P, Hansen AM, Antonsson M, Ahrné S, Israelsen H, Madsen S. 2013. Anchorless surface associated glycolytic enzymes from Lactobacillus plantarum 299v bind to epithelial cells and extracellular matrix proteins. Microbiol Res 168:245–253. 10.1016/j.micres.2013.01.003. [DOI] [PubMed] [Google Scholar]
  • 55.Kinoshita H, Ohuchi S, Arakawa K, Watanabe M, Kitazawa H, Saito T. 2016. Isolation of lactic acid bacteria bound to the porcine intestinal mucosa and an analysis of their moonlighting adhesins. Biosci Microbiota Food Health 35:185–196. 10.12938/bmfh.16-012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Granato D, Bergonzelli GE, Pridmore RD, Marvin L, Rouvet M, Corthesy-Theulaz IE. 2004. Cell surface-associated elongation factor Tu mediates the attachment of Lactobacillus johnsonii ncc533 (La1) to human intestinal cells and mucins. Infect Immun 72:2160–2169. 10.1128/iai.72.4.2160-2169.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Nan J, Zhou Y, Yang C, Brostromer E, Kristensen O, Su XD. 2009. Structure of a fatty acid-binding protein from Bacillus subtilis determined by sulfur-SAD phasing using in-house chromium radiation. Acta Crystallogr D Biol Crystallogr 65:440–448. 10.1107/S0907444909007756. [DOI] [PubMed] [Google Scholar]
  • 58.Mabelebele M, Alabi OJ, Ng`Ambi JW, Norris D, Ginindza MM. 2013. Comparison of gastrointestinal tracts and pH values of digestive organs of Ross 308 broiler and indigenous venda chickens fed the same diet. Asian J Anim Vet Adv 9:71–76. 10.3923/ajava.2014.71.76. [DOI] [Google Scholar]
  • 59.Palop ML, Smiths JP, Brink B. 1995. Degradation of sinigrin by Lactobacillus agilis strain R16. Int J Food Microbiol 26:219–229. 10.1016/0168-1605(95)00123-2. [DOI] [PubMed] [Google Scholar]
  • 60.Mangell P, Lennernas P, Wang M, Olsson C, Ahrne S, Molin G, Thorlacius H, Jeppsson B. 2006. Adhesive capability of Lactobacillus plantarum 299v is important for preventing bacterial translocation in endotoxemic rats. APMIS 114:611–618. 10.1111/j.1600-0463.2006.apm_369.x. [DOI] [PubMed] [Google Scholar]
  • 61.EFSA. 2010. Analysis of the baseline survey on the prevalence of Campylobacter in broiler batches and of Campylobacter and Salmonella on broiler carcasses in the EU, 2008. EFSA J 8:1503. 10.2903/j.efsa.2010.1503. [DOI] [Google Scholar]
  • 62.EFSA. 2016. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2015. EFSA J 16:5500. 10.2903/j.efsa.2018.5500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Kirk M, Ford L, Glass K, Hall G. 2014. Foodborne illness, Australia, circa 2000 and circa 2010. Emerg Infect Dis 20:1857–1864. 10.3201/eid2011.131315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Mitsuoka T. 2002. Research in intestinal flora and functional foods. J Intest Microbiol 15:57–89. 10.11209/jim1997.15.57. [DOI] [Google Scholar]
  • 65.Bujnakova D, Strakova E, Kmet V. 2014. In vitro evaluation of the safety and probiotic properties of lactobacilli isolated from chicken and calves. Anaerobe 29:118–127. 10.1016/j.anaerobe.2013.10.009. [DOI] [PubMed] [Google Scholar]
  • 66.Morita H, Shiratori C, Murakami M, Takami H, Kato Y, Endo A, Nakajima F, Takagi M, Akita H, Okada S, Masaoka T. 2007. Lactobacillus hayakitensis sp. nov., isolated from intestines of healthy thoroughbreds. Int J Syst Evol Microbiol 57:2836–2839. 10.1099/ijs.0.65135-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Baele M, Devriese LA, Haesebrouck F. 2001. Lactobacillus agilis is an important component of the pigeon crop flora. J Appl Microbiol 91:488–491. 10.1046/j.1365-2672.2001.01407.x. [DOI] [PubMed] [Google Scholar]
  • 68.Murphya P, Bello FD, O'Doherty J, Arendt EK, Sweeney T, Coffey A. 2013. The effects of liquid versus spray-dried Laminaria digitata extract on selected bacterial groups in the piglet gastrointestinal tract (GIT) microbiota. Anaerobe 21:1–8. 10.1016/j.anaerobe.2013.03.002. [DOI] [PubMed] [Google Scholar]
  • 69.Reveneau N, Geoffroy M-C, Locht C, Chagnaud P, Mercenier A. 2002. Comparison of the immune responses induced by local immunizations with recombinant Lactobacillus plantarum producing tetanus toxin fragment C in different cellular locations. Vaccine 20:1769–1777. 10.1016/S0264-410X(02)00027-0. [DOI] [PubMed] [Google Scholar]
  • 70.Grangette C, Muller-Alouf H, Goudercourt D, Geoffroy M-C, Turneer M, Mercenier A. 2001. Mucosal immune responses and protection against tetanus toxin after intranasal immunization with recombinant Lactobacillus plantarum. Infect Immun 69:1547–1553. 10.1128/IAI.69.3.1547-1553.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71.Jia Y, Li S, Allen G, Feng S, Xue L. 2012. A novel glyceraldehyde-3-phosphate dehydrogenase (GAPDH) promoter for expressing transgenes in the halotolerant alga Dunaliella salina. Curr Microbiol 64:506–513. 10.1007/s00284-012-0102-y. [DOI] [PubMed] [Google Scholar]
  • 72.Jiménez B, Ugwu F, Zhao R, Ortí L, Makhnevych T, Pineda-Lucena A, Houry WA. 2012. Structure of minimal tetratricopeptide repeat domain protein Tah1 reveals mechanism of its interaction with Pih1 and Hsp90. J Biol Chem 287:5698–5709. 10.1074/jbc.M111.287458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 73.Auvray F, Coddeville M, Ordonez RC, Ritzenthaler P. 1999. Unusual structure of the attB site of the site-specific recombination system of Lactobacillus delbrueckii bacteriophage mv4. J Bacteriol 181:7385–7389. 10.1128/JB.181.23.7385-7389.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 74.van Zyl WF, Deane SM, Dicks LMT. 2015. Use of the mCherry fluorescent protein to study intestinal colonization by Enterococcus mundtii ST4SA and Lactobacillus plantarum 423 in mice. Appl Environ Microbiol 81:5993–6002. 10.1128/AEM.01247-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.Layton SL, Kapczynski DR, Higgins S, Higgins J, Wolfenden AD, Liljebjelke KA, Bottje WG, Swayne D, Berghman LR, Kwon YM, Hargis BM, Cole K. 2009. Vaccination of chickens with recombinant Salmonella expressing M2e and CD154 epitopes increases protection and decreases viral shedding after low pathogenic avian influenza challenge. Poult Sci 88:2244–2252. 10.3382/ps.2009-00251. [DOI] [PubMed] [Google Scholar]
  • 76.Bochman ML, Paeschke K, Zakian VA. 2012. DNA secondary structures: stability and function of G-quadruplex structures. Nat Rev Genet 13:770–780. 10.1038/nrg3296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 77.Pike JE, Henry RA, Burgers PMJ, Campbell JL, Bambara RA. 2010. An alternative pathway for Okazaki fragment processing: resolution of fold-back flaps by Pif1 helicase. J Biol Chem 285:41712–41712. 10.1074/jbc.M110.146894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78.Rawal P, Kummarasetti VBR, Ravindran J, Kumar N, Halder K, Sharma R, Mukerji M, Das SK, Chowdhury S. 2006. Genome-wide prediction of G4 DNA as regulatory motifs: role in Escherichia coli global regulation. Genome Res 16:644–655. 10.1101/gr.4508806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Keyburn AL, Boyce JD, Vaz P, Bannam TL, Ford ME, Parker D, Di Rubbo A, Rood JI, Moore RJ. 2008. NetB, a new toxin that is associated with avian necrotic enteritis caused by Clostridium perfringens. PLoS Pathog 4:e26. 10.1371/journal.ppat.0040026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Lillehoj HS, Jang SI, Panebra A, Lillehoj EP, Dupuis L, Arous JB, Lee SK, Oh ST. 2017. In ovo vaccination using Eimeria profilin and Clostridium perfringens NetB proteins in Montanide IMS adjuvant increases protective immunity against experimentally-induced necrotic enteritis. Asian-Australas J Anim Sci 30:1478–1485. 10.5713/ajas.17.0053. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Jang SI, Lillehoj HS, Lee S-H, Lee KW, Lillehoj EP, Hong YH, An D-J, Jeong W, Chun J-E, Bertrand F, Dupuis L, Deville S, Arous JB. 2012. Vaccination with Clostridium perfringens recombinant proteins in combination with Montanide ISA 71 VG adjuvant increases protection against experimental necrotic enteritis in commercial broiler chickens. Vaccine 30:5401–5406. 10.1016/j.vaccine.2012.06.007. [DOI] [PubMed] [Google Scholar]
  • 82.Costa SPFD, Mot D, Bokori-Brown M, Savva CG, Basak AK, Immerseel FV, Titball RW. 2013. Protection against avian necrotic enteritis after immunization with NetB genetic or formaldehyde toxoids. Vaccine 31:4003–4008. 10.1016/j.vaccine.2013.05.063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 83.Bryant JA, Sellars LE, Busby SJW, Lee DJ. 2014. Chromosome position effects on gene expression in Escherichia coli K-12. Nucleic Acids Res 42:11383–11392. 10.1093/nar/gku828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Field D, Tiwari B, Booth T, Houten S, Swan D, Bertrand N, Thurston M. 2006. Open software for biologists: from famine to feast. Nat Biotechnol 24:801–803. 10.1038/nbt0706-801. [DOI] [PubMed] [Google Scholar]
  • 85.PacificBioSciences. 2015. Pitchfork. https://github.com/PacificBiosciences/pitchfork. Accessed 10 June 2016.
  • 86.Koren S, Walenz BP, Berlin K, Miller JR, Bergman NH, Phillippy AM. 2017. Canu: scalable and accurate long-read assembly via adaptive k‐mer weighting and repeat separation. Genome Res 27:722–736. 10.1101/gr.215087.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 87.NCBI Resource Coordinators. 2018. Database resources of the National Center for Biotechnology Information. Nucleic Acids Res 46:D8–D13. 10.1093/nar/gkv1290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. J Mol Biol 215:403–410. 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  • 89.Boratyn GM, Camacho C, Cooper PS, Coulouris G, Fong A, Ma N, Madden TL, Matten WT, McGinnis SD, Merezhuk Y, Raytselis Y, Sayers EW, Tao T, Ye J, Zaretskaya I. 2013. BLAST: a more efficient report with usability improvements. Nucleic Acids Res 41:W29–W33. 10.1093/nar/gkt282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R, 1000 Genome Project Data Processing Subgroup. 2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25:2078–2079. 10.1093/bioinformatics/btp352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Milne I, Stephen G, Bayer M, Cock PJA, Pritchard L, Cardle L, Shaw PD, Marshall D. 2013. Using Tablet for visual exploration of second-generation sequencing data. Brief Bioinform 14:193–202. 10.1093/bib/bbs012. [DOI] [PubMed] [Google Scholar]
  • 92.Chin C-S, Alexander DH, Marks P, Klammer AA, Drake J, Heiner C, Clum A, Copeland A, Huddleston J, Eichler EE, Turner SW, Korlach J. 2013. Nonhybrid, finished microbial genome assemblies from long-read SMRT sequencing data. Nat Methods 10:563–571. 10.1038/nmeth.2474. [DOI] [PubMed] [Google Scholar]
  • 93.Li H. 2013. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv 1303.3997 [q-bio.GN]. https://arxiv.org/abs/1303.3997.
  • 94.Walker BJ, Abeel T, Shea T, Priest M, Abouelliel A, Sakthikumar S, Cuomo CA, Zeng Q, Wortman J, Young SK, Earl AM. 2014. Pilon: an integrated tool for comprehensive microbial variant detection and genome assembly improvement. PLoS One 9:e112963. 10.1371/journal.pone.0112963. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95.Tatusova T, DiCuccio M, Badretdin A, Chetvernin V, Nawrocki EP, Zaslavsky L, Lomsadze A, Pruitt KD, Borodovsky M, Ostell J. 2016. NCBI prokaryotic genome annotation pipeline. Nucleic Acids Res 44:6614–6624. 10.1093/nar/gkw569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Brettin T, Davis JJ, Disz T, Edwards RA, Gerdes S, Olsen GJ, Olson R, Overbeek R, Parrello B, Pusch GD, Shukla M, Thomason JA, Stevens R, Vonstein V, Wattam AR, Xia F. 2015. RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci Rep 5:8365. 10.1038/srep08365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 97.Overbeek R, Olson R, Pusch GD, Olsen GJ, Davis JJ, Disz T, Edwards RA, Gerdes S, Parrello B, Shukla M, Vonstein V, Wattam AR, Xia F, Stevens R. 2014. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res 42:D206–D214. 10.1093/nar/gkt1226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA, Formsma K, Gerdes S, Glass EM, Kubal M, Meyer F, Olsen GJ, Olson R, Osterman AL, Overbeek RA, McNeil LK, Paarmann D, Paczian T, Parrello B, Pusch GD, Reich C, Stevens R, Vassieva O, Vonstein V, Wilke A, Zagnitko O. 2008. The RAST Server: Rapid Annotations using Subsystems Technology. BMC Genomics 9:75. 10.1186/1471-2164-9-75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 99.Heel AJv, Jong A, Montalban-Lopez M, Kok J, Kuipers OP. 2013. BAGEL3: automated identification of genes encoding bacteriocins and (non-)bactericidal posttranslationally modified peptides. Nucleic Acids Res 41:W448–W453. 10.1093/nar/gkt391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Zhou Y, Liang Y, Lynch KH, Dennis JJ, Wishart DS. 2011. PHAST: a fast phage search tool. Nucleic Acids Res 39:W347–W352. 10.1093/nar/gkr485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 101.Chaudhari NM, Gupta VK, Dutta C. 2016. BPGA–an ultra-fast pan-genome analysis pipeline. Sci Rep 6:24373. 10.1038/srep24373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 102.Inglin RC, Meile L, Stevens MJA. 2018. Clustering of pan- and core-genome of Lactobacillus provides novel evolutionary insights for differentiation. BMC Genomics 19:284. 10.1186/s12864-018-4601-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 103.Stangegaard M, Dufva IH, Dufva M. 2006. Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA. Biotechniques 40:649–656. 10.2144/000112153. [DOI] [PubMed] [Google Scholar]
  • 104.Illumina. 2014. MiSeq system user guide, p 1–112. Illumina, San Diego, CA. [Google Scholar]
  • 105.Aronesty E. 2011. ea-utils: command-line tools for processing biological sequencing data. https://github.com/ExpressionAnalysis/ea-utils. Accessed 16 October 2016.
  • 106.Rutherford K, Parkhill J, Crook J, Horsnell T, Rice P, Rajandream MA, Barrell B. 2000. Artemis: sequence visualization and annotation. Bioinformatics 16:944–945. 10.1093/bioinformatics/16.10.944. [DOI] [PubMed] [Google Scholar]
  • 107.Wagner GP, Kin K, Lynch VJ. 2012. Measurement of mRNA abundance using RNA-seq data: RPKM measure is inconsistent among samples. Theory Biosci 131:281–285. 10.1007/s12064-012-0162-3. [DOI] [PubMed] [Google Scholar]
  • 108.Li B, Ruotti V, Stewart RM, Thomson JA, Dewey CN. 2010. RNA-Seq gene expression estimation with read mapping uncertainty. Bioinformatics 26:493–500. 10.1093/bioinformatics/btp692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 109.Pouwels PH, Leer RJ. 1994. Genetics of lactobacilli: plasmids and gene expression. Antonie Van Leeuwenhoek 64:85–107. 10.1007/BF00873020. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Download
Download

Data Availability Statement

All data utilized in this study are found in the supplemental material. GenBank accession numbers can be found in Table S3. Briefly, the assembly accession numbers are the following: chromosomal DNA of L. agilis La3, CP016766.1; pLa3_1, CP034226; pLa3_2, CP034227; pLa3_3, CP034228; and pLa3_4, CP034229. The DNA sequencing reads can be found with accession numbers SRX4927791 and SRX4927790 for PacBio RS II and 2× 300 MiSeq, respectively. RNA sequencing data can be found with accession numbers SRX4927788 and SRX4927789 for logarithmic and stationary phases, respectively. DNA methylation data and motifs generated from PacBio reads can be found at http://rebase.neb.com/cgi-bin/onumget?25455. Synthetic plasmid and CreiLOV sequences can be found at https://figshare.com/articles/Genbank_files_of_Lactobacillus_agilis_La3_genetic_tools/12111015.


Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES