Skip to main content
NCBI home page
PLOS One logoLink to PLOS One
. 2021 Jun 16;16(6):e0252987. doi: 10.1371/journal.pone.0252987

Morus alba: Host reaction for Meloidogyne javanica, biological nematicides assessment and study of these relationships with yield and quality of leaves, cocoon and health of the silkworm

Santino Aleandro da Silva 1,2,#, Renata da Rosa 1,#, Rachel Colauto Milanezi-Aguiar 1,#, Cristianne Cordeiro Nascimento 3,#, Andressa Cristina Zamboni Machado 2,*,#
Editor: Adler R Dillman4
PMCID: PMC8208536  PMID: 34133425

Abstract

Root-knot nematodes cause damage to several crops and the importance of each species can vary according with the crop and the agricultural region. In Brazil, Meloidogyne javanica is one of the most important nematode species parasitizing mulberry. To define management strategies, it is important to know if the crop species is damaged by the parasitism of the nematode and the best choices for control, as the use of nematicides. Biological nematicides have been extensively used in Brazil, but no information regarding its efficiency to control M. javanica in mulberry is available. Besides, it is not known if biological nematicides could improve the quality of leaves or if they alter the nutrient composition of leaves, which could interfere in the development of the silkworms that are feed with these leaves or in the quality of the silk produced. With the aim to address these questions, we propose a study that will start in the phenotyping of the main Brazilian mulberry cultivars to Meloidogyne species, passing through the test of efficiency of biological nematicides in the control of M. javanica in mulberry cultivar Miura, evaluation of the amount and quality of leaves produced and, using these leaves to feed silkworms, in the analyzes of the impact of these diet in the health of silkworms, and in the production and quality of the silk.

Introduction

Brazil is the fifth world main producer of silk, in which Paraná State is the most important Brazilian producer, where sericulture occupies about 3,000 hectares, distributed in 1,700 farmers [1, 2], and set up as an activity highly related to familiar agriculture. Sericulture involves the crop of mulberry leaves (Morus alba), the silkworm (Bombix mori) cultivation and the spinning. The quality of silk, as well as the yield of cocoons, is directly related to nutritional factors and to the adequate management of the mulberry leaves offered to the silkworms, which must be free of any agrochemical residues [3–6]. By this way, the volume and the quality of the mulberry leaves are of extreme importance to the success in obtaining high quality cocoons.

An important disease which affects the crop is that caused by root-knot nematodes from the genus Meloidogyne. Several Meloidogyne species have been reported parasitizing mulberry worldwide. In China, M. enterolobii [7], in Japan, M. mali [8], in India, M. incognita [9], in Brazil, M. incognita and M. javanica [10], and, also in Brazil, M. enterolobii was described parasitizing Morus nigra (blueberry) [11]. These reports highlight the importance and distribution of root-knot nematodes in mulberry growing regions worldwide.

Plants parasitized by Meloidogyne spp. can have low photosynthetic rates and in long term experiments, which include the complete vegetative cycle of the crop, it is possible to infer about the losses related to the nematode parasitism. Besides, the parasitism by Meloidogyne spp. can lead plants to hydric stress [12] and to severe alterations in the root system of mulberry [13]. Moreover, the higher M. incognita incidence the higher the presence of other root and leaf diseases and plant depletion [9]. In a study conducted with mulberry plants cropped in microplots infested and non-infested with M. incognita, it was verified reduction in the number of leaves, weight and budding of infested plants in relation to non-infested [14].

Management of nematodes in mulberry represents a challenge either by it is a perennial crop or because of the possible risks of leaf contamination with chemical residues, since leaves will be offered in the silkworm diet and contaminations can interfere in the worm development. Besides, in Brazil there are no chemical nematicides registered by Brazilian Ministry of Agriculture, Livestock and Food Supply for use in mulberry fields. So, the use of biological nematicides is an important option, since they are registered for the biological target and not for crops in Brazil. By this way, two biological control agents that could be used in the management of Meloidogyne spp. in mulberry are Pochonia chlamydosporia, a parasite of eggs and juveniles, and Bacillus firmus, a bacteria which colonizes the rhizosphere forming a biofilm that causes disorientation in the nematode, avoiding the penetration of nematodes into the roots.

Considering available information until now, we verified that M. incognita is the more studied nematode species in mulberry worldwide, but, in Brazil, it was pointed out that M. javanica is the main species found in mulberry fields in Paraná State [10]. Therefore, our study aiming to evaluate the effect of biological nematicides in mulberry plants inoculated with M. javanica in the development of mulberry plants and, later, to evaluate the effects in the growth of silkworms feed by these leaves.

In the first phase of this project, the three main cropped mulberry cultivars in Brazil, Miura, Tailandesa, and Taichi, will be phenotype in relation to their reaction to M. incognita and M. javanica, the main nematode species occurring in Brazil in mulberry [10]. In the sequence, we will evaluate two biological nematicides, P. chlamydosporia (Rizotec®) and B. firmus (Votivo Prime®) in the control of M. javanica in mulberry cultivar Miura. Following, with the cultivar Miura, indicated as susceptible to M. javanica [10], we will test the effect of these nematicides in inoculated and non-inoculated plants with M. javanica in the yield and protein and mineral content of leaves. Leaves from each treatment obtained in this experiment will be offered to silkworms during the corresponding period to the cultivation time normally carried out by sericulture farmers, under controlled conditions, and at the end of the cycle, production of silk will be measured, as well as the gene expression levels of the main genes involved in the silk production. In addition, histological analyzes of the digestive tract and sericigenic glands will be done to verify the cell integrity and worm healthy after treatments.

By this way, in the final of this project, we will have a broad overview of the real impact of M. javanica in the silk production, from the productive base, represented by the mulberry tree, through the silkworms and the silk extracted from the cocoons.

Material and methods

Mulberry seedlings obtention

Seedlings will be produced from cuttings taken from mature plants, with buds developed, collected from the germplasm collection maintained by Instituto de Desenvolvimento Rural do Paraná –IDR–IAPAR/ EMATER, located at the municipality of Londrina, Paraná State, Brazil. 10 cm-length cuttings from the cultivars Miura, Taichi, and Tailandesa with one bud each will be cut and maintained on water during 24 hours to hydration. After, cuttings will be transferred to 945 ml-capacity Styrofoam pots fulfilled with a mixture of soil and sand in the proportion of 75% of sand, 5% of silt, and 20% of clay, previously sterilized under forced air circulation drying chamber at 150 oC for 5 hours. Each seedling will be fertilized at the time of planting with 5 g of Osmocote Plus (15 N; 9 P; 12 K; 1 Mg; 2.3 S; 0.05 Cu; 0.45 Fe; 0.06 Mn; 0.02 Mo) (ICL Specialty Fertilizers).

After planting the cuttings, pots will be maintained under humidity chamber for 30 days, with programed nebulization. After budding and rooting, seedlings will be transferred to a greenhouse to acclimatization for 15 days.

Host reaction of mulberry (Morus alba) cultivars to Meloidogyne spp.

Seedlings of the three mulberry cultivars, after acclimatization, will be tested against M. incognita and M. javanica to confirm previous report about their host reaction to these root-knot nematodes. Experiment will be conducted in completed randomized design, with six replicates per treatment, in which each pot containing one mulberry seedling will be considered the plot, in factorial arrangement 3x2 (three mulberry cultivars x two Meloidogyne species).

Inoculations will be done using pure populations of each nematode species, extracted from tomato roots through the methodology of trituration-sieving described in literature [15]. Nematodes extracted will be quantified under light microscope with the aim of a Peters slide and suspensions will be adjusted to contain 500 eggs per ml. Inoculation will be performed by pipetting 2 ml of each suspension per plant, distributed in two 4 cm holes made near the plant stem, individually, resulting in an initial population density of 1,000 eggs per plant.

Evaluation will be done after 120 days from inoculation (DAI), when roots will be washed free of soil, weighted, and submitted to nematode extraction [15]. Nematodes extracted from each plant will be quantified to obtain the final population (FP) that will be divided by the initial population (IP) to calculate the reproduction factor (RF = FP/IP) of the nematodes [16]. Plants with RF values higher than 1.0 will be classified as susceptible to the nematode and those with RF values lower than 1.0, as resistant. The number of nematodes per gram of roots (nema.g) will be obtained dividing the total number of nematodes present in each plant by the fresh root weight. This variable will be submitted to the homogeneity of variances test of Bartlett and to the normality of data test of Shapiro-Wilk. To attend the assumptions of the model, the transformation of data will be done according to Box-Cox procedure, followed by the two-way variance analysis, when the unfolding of interactions will be performed and means will be grouped by the Scott-Knot test.

Evaluation of the impacts of the biological nematicides in the yield and quality of mulberry leaves cultivar Miura

Acclimatized mulberry seedlings will be transplanted to 5 liters-capacity plastic pots containing the same mixture of soil and sand. Experiment will be conducted in completed randomized design, with fifth replicates per treatment, in which each pot containing one mulberry seedling will be considered the plot. Treatments will be as follows: 1) absolute check (without nematode and without nematicide); 2) inoculated check (with nematode and without nematicide); 3) with nematode and Pochonia clamydosporia (Rizotec®); and 4) with nematode and B. firmus (Votivo Prime®).

Fifth days after the transplant, 5,000 eggs of M. javanica will be inoculated per plant in treatments 2, 3, and 4. Ninety DAI, a second fertilization with 5 g of Osmocote Plus per plant will be performed and, after five days, mulberry plants will be pruned and biological nematicides will be pulverized in soil, in bands around each side of plants. After more 75 days, leaves will be collected to feed silkworms. In addition, leaves will be collected to tissue analysis aiming to verify the nutrient and crude protein contents. After cutting of leaves, plants will be submitted to a destructive analysis to verify the nematode multiplication, according with the described earlier.

Data regarding the multiplication of the nematode (RF and nema.g) will be submitted to the univariate analyzes, as follows: data will be submitted to the homogeneity of variances test of Bartlett and to the normality of residuals test of Shapiro-Wilk. To attend the assumptions of the model, the transformation of data will be done according to Box-Cox procedure, followed by the one-way variance analysis, and means will be compared by the Tukey Honestly Significant Difference test.

Data regarding the nutrient content of leaves (nitrogen, phosphorus, potassium, calcium, magnesium, sulfur, boron, cuprum, iron, manganese, zinc, molybdenum, nickel, aluminum, silicon, cobalt, sodium, selenium, vanadium) will be analyzed by multivariate analyzes, with principal component analysis based in the correlation and means grouping by dendrogram based in cophenetic matrix, using the Euclidian distance and the average method to clade obtention. Bromatological analysis of the leaves will be also performed, using the variables crude protein and dry matter, by one-way variance analysis and means will be compared by the Tukey Honestly Significant Difference test as described above.

Silkworm (Bombix mori) creation and feeding

Third-stage larvae of Bombix mori (240 larvae) from the commercial hybrid ♂Japanese x ♀ Chinese (provided by Fiação de Seda Bratac S. A.), with the same age (9 days), weight and parental origin will be maintained in creation chambers with temperature, humidity and photoperiod controlled (27 oC; ±80% RH; 14 hours light) for this study. Larvae will be aleatory divided in four experimental groups (80 per group) of feeding: 1) feeding with fresh leaves collected in plants without nematode and without nematicide; 2) feeding with fresh leaves collected in plants with nematode and without nematicide; 3) feeding with fresh leaves collected in plants with nematode and Rizotec®; 4) feeding with fresh leaves collected in plants with nematode and Votivo Prime®. Each group will receive the same amount of leaves, according with recommendations from literature [5, 17].

Larvae will be maintained in plastic trays (50 cm x 40 cm x 10 cm) and fed four times at a day (7:30 am, 11:30 am, 3:30 pm, and 7:30 pm) until they complete their larval cycle and reach the cocoon stage. Trays will be covered with tulle tissue to allow aeration. Trays will be cleaned and feces will be removed daily in the early morning, before the first feeding. Values about the food consumption of each group will be calculated daily, through the weight of the leaves offered, leaves not consumed and the weight of the feces. In addition, the average body weight per group and the mortality rate at the beginning and end of each instar will be also measured. Data regarding the variables will be submitted to the univariate analyzes described earlier. All analysis will be performed with R software [18], using the packages MASS [19], ExpDes [20], and vegan [21].

Histological analysis of intestinal and glandular tissues of Bombix mori

Light microscopy

In the fifth day of the last larval stage, five larvae from each group will be randomly selected, anesthetized and dissected in saline solution for insects (1.80 g NaCl; 1.88 g KCl; 0.16 g CaCl2; 0.004 g NaHCO3; 100 ml distilled water) aiming to collect the midgut and sericigenic glands. These tissues will be fixed in Karnovysky fixative for 24 hours and after, maintained in ethylic alcohol 70% until the time of inclusion and processing. The inclusion process will be made in historesin Leica®, followed by these procedures: dehydration in ethylic alcohol 80% for 20 minutes; dehydration in ethylic alcohol 95% for 20 minutes; soaking in a mixture of historesin and ethylic alcohol 95% for 4 hours; soaking in pure historesin for 12 hours; and, finally, soaking and inclusion in pure resin added with catalyzer using appropriate models. After polymerization in incubator at 37 oC for 24 hours, blocs will be adhered with Araldite® on wooden supports.

Histological cuts will be performed in a thickness of 4 μm with a microtome Leica®, placed on a hot plate for better adherence to the slides and submitted to staining with hematoxilin and eosin (HE), according with the following described: distilled water for 10 minutes; staining with Harris´ hematoxilin for 20 minutes; tap water for 10 minutes; staining with eosin for 25 minutes; wash with distilled water; ethylic alcohol 90% for 10 minutes; ethylic alcohol 100% for 10 minutes; xylol I for 10 minutes; xylol II for 10 minutes; and xylol III for 10 minutes. After, slides will be assembled in Entellan® medium and analyzed under a microscope Zeiss Axiophot equipped with a camera and Motic software.

Transmission electron microscopy

Tissues will be fixed in glutaraldehyde 2.5% in phosphate buffer solution 0.1M (pH 7.2) for 8 hours, post-fixed in osmium tetroxide 1% in the same buffer for 2 hours, contrasted in blocks with uranyl acetate 0.5% for 2 hours, dehydrated and included in historesin. Ultrafine cuts (50 nm) will be performed, contrasted in alcoholic solution saturated with uranyl acetate for 20 minutes and lead citrate for 20 minutes. Slides will be analyzed in an electronic microscope FEI TECNAI 12, in which the tissue integrity and morphological patterns of the epithelial tissues will be observed.

Real-time PCR analysis (qRT-PCR)

The mRNA expression patterns of genes related to silk production (sericin and fibroin) in silkworms fed with leaves treated with the different treatments will be evaluated by real-time quantitative PCR (qRT-PCR). Three samples will be used in triplicates for each experimental group of larvae. The tissue samples will be previously collected and immediately freezes in liquid nitrogen and then stored at -80°C. Total RNA from each sample of the medium silk gland (~ 0.5g of tissue) will be isolated using PureLinkTM RNA Mini Kit (Invitrogen) according to the manufacturer’s specifications. The RNA samples will then be stored at -80°C. The quality of the RNA will be evaluate using BioDropTM (Isogen Life Science) and Agilent 2100 Bioanalyzer (Agilent Technologies).

The primer pairs (Table 1) that will be used in qRT-PCR are Sericin-1, H-Fibroin, L-Fibroin, were designed using Mega-X and Gedit softwares and will be synthesized by Thermofisher Scientific (Invitrogen, Londrina, Paraná, Brazil). The internal reference genes, ribosomal protein L3 (RpL3) and alpha-tubulin (α-tubulin) that will be used were described in literature [22].

Table 1. Sequences of primers used in qRT-PCR.

Gene Name Primer Sequences (5’-3’) Product Size (bp)
Sericin 1 CTACCGTACAGTCATCCAC 192
GTCTGTTCACGCCTGAATG
H-Fibroin ACAAGGTGCAGGAAGTGC 144
GCAATTCACACAAGGCAGT
L-Fibroin CCGGAGGTGGAAGAATCTAT 155
GGTTATGTAGGCAGCGATGT
α-tubulin ACATGGCTTGCTGTATGCT 146
GGGTGGCTGGTAGTTGATA
RpL3 CGGTGTTGTTGGATACATTGAG 161
GCTCATCCTGCCATTTCTTACT
Open in a new tab

The primers were designed using genes sequences previously deposited in the NCBI for B. mori and B. mandarina. The sequences were searched using the follows terms: “silk sericin”, “silk heavy fibroin”, “silk light fibroin”. After that, we preferentially selected sequences related to the B. mori, such as Sericin 1 (M26105.1, JX681123.1, Z48802.1, AB112020.1 and NM_001044041.2), H-Fibroin (DQ459410.1, AB017362.1, S74439.1, XM_028178929.1 and AF226688.1), L-Fibroin (NM_001044023.1, X17291.1, AY078388.1 and HQ116534.1).

The cDNA synthesis will be performed in a T100TM Thermal Cycler (BIO-RAD), using 12.4 μl of total RNA (1000 ng/ml), 1 μl of oligo dT (20 pmol/ml) and 2 μl of dNTPs (2.5 mM) for each sample, which will be maintained for 10 min at 65°C. Samples will be cooled quickly by placing microtubes on ice and, then, 4 μl of MLV 5x First Strand Buffer (M-MLV–Invitrogen, Life Technologies) [250mM Tris-HCL (pH 8.3), 375 mM KCl, 15 mM Magnesium Chloride] will be added to each sample for 2 minutes. So, 0.1 μl of RNAout (Invitrogen, Life Technologies) and 0.5 μl of reverse transcriptase enzyme (M-MLV–Invitrogen, Life Technologies) will be added to each sample and the reactions will be maintained at 37°C for 50 minutes, 70°C for 15 minutes and, then, maintained at 10°C. qRT-PCR will be conducted in an Applied Biosystems® Real-Time PCR Systems, using 6.0 μl of Platinum SYBR Green qPCR Supermix-UDG (Invitrogen), 0.5 μl of each pair of oligonucleotides, and 5 μl of cDNA of each sample. The qRT-PCR reactions will be performed under the following conditions: 95°C for 5 minutes and 45 cycles [95°C/ 15 s, 60°C/ 20 s, 72°C/ 20 s]. The melting curve analysis will be used to analyze the specificity of the qRT-PCR product. The qRT-PCR will be conducted with two technical and three biological replicates.

Data will be normalized to the expression values of RpL3 and α-tubulin constitutive genes. Analyses of the relative expression and normalization for constitutive genes will be tested with pairwise fixed reallocation randomization test [23, 24], with a level of significance fixed at p < 0.05.

Data Availability

All relevant data from this study will be made available upon study completion.

Funding Statement

Initials: RdR - grant number: TC 055/2018 - Funder: Governo do Estado do Paraná (Unidade Gestora do Fundo Paraná). Initials: RdR - Funder: Fiação de Seda Bratac S.A. Initials: RdR - grant number: 302770/2017-8- Funder: Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq) Initials: ACZM - grant number: 308814/2018-5 - Funder: Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq).

References

  • 1.Cirio GM. Sericicultura no Estado Do Paraná Safra 2017/2018—Relatório TAKII. ESTADO DO PARANÁ SEAB- Secretaria da Agricultura e do Abastecimento DERAL- Departamento de Economia Rural, 2018a. Available from:http://www.agricultura.pr.gov.br/sites/default/arquivos_restritos/files/documento/2019-09/sericicultura_2019_v1.pdf [Google Scholar]
  • 2.Cirio GM. Evolução e Condição Atual da Sericicultura no Paraná, 2018b, pp. 21–32. IN: Inovações na sericicultura do Paraná: tecnologias, manejo e rentabilidade / Dimas Soares Júnior, Edson Luiz Diogo de Almeida, Oswaldo da Silva Pádua: orgs.–Londrina: ABRASEDA: IAPAR, 2018. 103 p.: il. [Google Scholar]
  • 3.Juliatto ST. Amoreira: híbridos mais produtivos. São Paulo: CATI, 1985. 23p. [Google Scholar]
  • 4.Tinoco STJ, Almeida RAC. Manual de sericicultura. Campinas: CATI, 1992. 67p. [Google Scholar]
  • 5.Takahashi R, Takahashi KM, Takahashi LS. Sericicultura: uma promissora exploração agropecuária, Jaboticabal-SP: Funep. 2009; 2ed. 135 p. [Google Scholar]
  • 6.Munhoz REF, Bignotto TS, Pereira NC, Saez CRN, Bespalhuk R, Fassina VA, et al. Evaluation of the toxic effect of insecticide chlorantraniliprole on the silkworm Bombyx mori (Lepidoptera: Bombycidae). Journal of Animal Sciences. 2013; 3(4): 343–353. [Google Scholar]
  • 7.Zhang P, Shao H, You C, Feng Y, Xie Z. Characterization of root-knot nematodes infecting mulberry in Southern China. JOURNAL OF NEMATOLOGY. 2020; 04(52): 1–8. doi: 10.21307/jofnem-2020-004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Toida Y. Mulberry Damages Caused by a Root-Knot Nematode, Meloidogyne mali Indigenous to Japan. JARQ. 1991; 24: 300–305. [Google Scholar]
  • 9.Naik VN, Sharma an Govindaiah DD. Incidence and Intensity of Root Disease Complex due to Nematode and Soilborne fungal Pathogens in Mulberry (Morus alba L.). International Journal of Industrial Entomology. 2008; 16(2): 49–56. [Google Scholar]
  • 10.Machado ACZ. Ocorrência de nematoides em amoreirais e práticas de controle. 2018, 52–67. IN: Inovações na sericicultura do Paraná: tecnologias, manejo e rentabilidade / Dimas Soares Júnior, Edson Luiz Diogo de Almeida, Oswaldo da Silva Pádua: orgs.–Londrina: ABRASEDA: IAPAR, 2018. 103 p.: il. [Google Scholar]
  • 11.Paes-Takahashi VS, Soares PLM, Carneiro FA; Ferreira RJ, Almeida EJ, Santos JM. Detection of Meloidogyne Enterolobii in mulberry seedlings (Morus nigra L.). Ciência Rural, Santa Maria. 2015; 45(5): 757–759. [Google Scholar]
  • 12.Bird AF. Plant response to root-knot nematode. Annual. Review. Phytopathology. 1974.12:69–85. Available from: www.annualreviews.org [Google Scholar]
  • 13.Hussey RS; Williamson VM. Physiological and Molecular Aspects of Nematode Parasitism. American Society of Agronomy, Crop Science Society of America, Soil Science Society of America, 677 S. Segoe Rd., Madison, WI 53711, USA. Plant and Nematode Interactions. 1998; Agronomy Monograph no. 36. [Google Scholar]
  • 14.Saha SS, Sinhababu SP, Sukul NLC. The effect of nematode infestation on mulberry plants and their effect on feeding silkworms Bombix mori L. Nematologica, E.J. Brill, Leiden. 1983; 29: 463–467. [Google Scholar]
  • 15.Boneti JI, Ferraz S. Modificações no método de Hussey & Barker para extração de ovos de Meloidogyne exigua em raízes de cafeeiro. Fitopatol. Brasil. 1981; 6: 533. [Google Scholar]
  • 16.Oostenbrink M. Major characteristics of the relation between nematodes and plants. Mendelingen Landbouwhogeschool Wageningen. 1966; 66: 1–46. [Google Scholar]
  • 17.Polycarpo GV, Silva AAR, Fruchi VM, Rigobelo EC, Cruz VC, Nicodemo D. Enriquecimento da dieta do bicho-da-seda com extrato hidrossolúvel de soja. Ciência Rural. 2012; 42(9): 1669–1674. [Google Scholar]
  • 18.R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. 2015; URL https://www.R-project.org/ [Google Scholar]
  • 19.Venables WN & Ripley BD. Modern Applied Statistics with S. Fourth Edition. Springer, New York. 2002. ISBN 0-387-95457-0. [Google Scholar]
  • 20.Ferreira EB, Cavalcanti PP, Nogueira DA. ExpDes: Experimental Designs package. 2013; R package version 1.1.2.
  • 21.Jari Oksanen F, Blanchet G, Friendly M, Kindt R, Legendre P, McGlinn D, et al. vegan: Community Ecology Package. 2017; R package version 2.4–3. https://CRAN.R-project.org/package = vegan.
  • 22.Fang SM, Hu BL, Zhou QZ, Yu QY, Zhang Z. Comparative analysis of the silk gland transcriptomes between the domestic and wild silkworms. BMC Genomics. 2015, 16 (1): 60. doi: 10.1186/s12864-015-1287-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research. 2001; 29 (9): 2002–2007. doi: 10.1093/nar/29.9.e45 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Research. 2002; 30 (9): 1–10. doi: 10.1093/nar/30.9.e36 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Adler R Dillman

1 Apr 2021

PONE-D-20-23665

Morus alba: phenotyping for Meloidogyne javanica, biological nematicides assessment and study of these relationships with yield and quality of leaves, cocoon and health of the silkworm.

PLOS ONE

Dear Dr. Machado,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Registered Report Protocols are still a new kind of report for PLOS One and several of the reviewers were unfamiliar with this kind of manuscript. which led to a couple of incomplete reviews. Reviewers 3 and 4 were well-prepared to examine this particular kind of submission and I encourage the authors to pay close attention to their comments. After going over the reviews myself, it seems clear that the Introduction section could provide more background information for readers to understand the importance of the study, and that it could also be more focused, with less relevant information being removed. Reviewers suggested that there were great ideas expressed in the paper, but the proposed experimental design, may be insufficient to address all of the posed questions. Please respond, point-by-point to the reviewers concerns, paying more attention to the comments made by reviewers 3 and 4.

Please submit your revised manuscript by May 15 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Adler R. Dillman, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that you have stated that you will provide repository information for your data at acceptance. Should your manuscript be accepted for publication, we will hold it until you provide the relevant accession numbers or DOIs necessary to access your data. If you wish to make changes to your Data Availability statement, please describe these changes in your cover letter and we will update your Data Availability statement to reflect the information you provide.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Does the manuscript provide a valid rationale for the proposed study, with clearly identified and justified research questions?

The research question outlined is expected to address a valid academic problem or topic and contribute to the base of knowledge in the field.

Reviewer #1: No

Reviewer #2: Partly

Reviewer #3: Yes

Reviewer #4: Partly

**********

2. Is the protocol technically sound and planned in a manner that will lead to a meaningful outcome and allow testing the stated hypotheses?

The manuscript should describe the methods in sufficient detail to prevent undisclosed flexibility in the experimental procedure or analysis pipeline, including sufficient outcome-neutral conditions (e.g. necessary controls, absence of floor or ceiling effects) to test the proposed hypotheses and a statistical power analysis where applicable. As there may be aspects of the methodology and analysis which can only be refined once the work is undertaken, authors should outline potential assumptions and explicitly describe what aspects of the proposed analyses, if any, are exploratory.

Reviewer #1: Yes

Reviewer #2: No

Reviewer #3: Partly

Reviewer #4: Partly

**********

3. Is the methodology feasible and described in sufficient detail to allow the work to be replicable?

Reviewer #1: No

Reviewer #2: No

Reviewer #3: Yes

Reviewer #4: Yes

**********

4. Have the authors described where all data underlying the findings will be made available when the study is complete?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception, at the time of publication. The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: No

Reviewer #3: No

Reviewer #4: No

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

Reviewer #4: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above and, if applicable, provide comments about issues authors must address before this protocol can be accepted for publication. You may also include additional comments for the author, including concerns about research or publication ethics.

You may also provide optional suggestions and comments to authors that they might find helpful in planning their study.

(Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The manuscript deals with multiple objectives: a) evaluation of the damages caused by nematodes to the mulberry, b) evaluation of biocontrol agents against nematodes in mulberry, c) evaluation of mulberry leaves from treated plants for feeding silkworms. Some parts of the research could be interesting. However, I cannot understand why silkworms could be damaged when fed with leaves harvested from plants treated with biocontrol agents to the roots 75 days before. Preliminary evidence (or literature) for this should be provided as a rationale for the research conducted here.

It should be noted that the manuscript lacks Results and Discussion. it must be a mistake during the upload.

The abstract must contain the results and the main findings, while the introduction to the problem must be shortened. The following sentences are in contrast one to another: "... Meloidogyne javanica is one of the most important nematode species parasitizing mulberry. To define management strategies, it is important to know if the crop species is damaged by the parasitism of the nematode ...". I would not speak about "disease" caused by a nematode, but damage. The Introduction section contains several interesting information; however, it should be better focused on the topic of the manuscript, and other information should be removed to avoid confusion in the readers. English must be revised by a mother tongue with background in the field of this research, as it is unacceptable in the present form.

Other minor comments are the following.

L77: these sentences are in contrast: "...from the second day after infection, but only in long term experiments,..."

L97: arenaria

L111: list the chemical nematicides registered for application on mulberry in Brazil and, possibly, elsewhere.

L122: the biological control agents Pseudomonas fluorescens and Trichoderma viridae must be introduced. Why did you use them?

L126: you must introduce Artemisia nilagirica extract. Why did you use it?

L186: report the manufacturer

L209: report the formula

L214: Bartlett's test, Shapiro-Wilk's test, and Box-Cox method precede ANOVA, but not the contrary.

L225: abbreviate the genus name after the first occurrence

L230: describe the method for inoculation. Report the dosage per pot.

L364: 5S rRNA is an unusual housekeeping gene: report citation. What is "another constitutive gene"?

Reviewer #2: I have read and reviewed the manuscript “Morus alba: phenotyping for Meloidogyne javanica, biological nematicides assessment and study of these relationships with yield and quality of leaves, cocoon and health of the silkworm” By da Silva et al. The article explains the necessity of being able to grow mulberry in order to cultivate silkworms for commercial purposes. Part of the problem is the susceptibility to parasitic nematodes which interferes with cultivation. Furthermore, the current nematicides also have a negative impact on cultivation.

Major points. The Results and Discussion sections are missing. Consequently, I am recommending a rejection. Furthermore, the writing was poor. The work needs a professional editing, but after the experiments have been done and the completed manuscript written. I have highlighted a few minor points regarding the writing, but every sentence had poor structure.

Minor points:

Introduction:

Sericulture involves the crop of mulberry leaves (Morus alba) [note: please put the genus and species name before leaves].

the silkworm cultivation and the spinning. [note: please put genus and species of the silkworm]

note: always italicize genus and species.

Mulberry is a perennial species with lifespan estimated in about 20 years, easy to

grow and with high rusticity, being cropped in Brazil since 1930. [note: Mulberry is a perennial species with lifespan estimated in about 20 years. Mulberry is easy to

grow and has high rusticity, being cropped in Brazil since 1930.]

In this country, its cultivation stretches between August to May [4] and each tree produces near of four kilograms of leaves per year [7]. [note: In Brazil, mulberry cultivation occurs between August to May [4]. Each tree produces nearly four kilograms of leaves per year [7].

Several Meloidogyne species had been reported parasitizing mulberry worldwide. [note: Several Meloidogyne species have been reported parasitizing mulberry worldwide].

In another study with mulberry, using different population densities of M. Arenaria race 2 [note: M. arenaria].

encasulation? [note: encapsulation?].

Note: I could continue with the grammatical errors.

Materials:

Seedlings will be produced from cuttings taken from mature plants, with buds developed, collected from the germplasm collection maintained by Instituto de Desenvolvimento Rural do Paraná – IDR – IAPAR/ EMATER, located at the municipality of Londrina, Paraná State, Brazil. [note: Seedlings have been produced from cuttings {the work has already been done}.

Seedlings of the three mulberry cultivars, after acclimatization, will be tested

against [note: Seedlings of the three mulberry cultivars, after acclimatization, have been tested

against]

Note: I could continue with the grammatical errors.

Results: There is no Results section

Discussion: There is no discussion section

Reviewer #3: Review comments PONE-D-20-23665

Lines 157-162, the objectives of research seem to be overlapping. The authors need to clarify it.

In the “Phenotyping of mulberry (Morus alba) to Meloidogyne spp” section, the authors need to provide validations why eggs are harvested at “90 days from inoculation” to calculate reproduction factor (RF)? The authors also need to show how the RF is calculated in this section first.

Line 258, is “Ninety DAI” the correct date here?

The experiments in the two sections “Evaluation of biologicalnematicides in the control of Meloidogyne javanica in mulberry cultivar Miura” and “Evaluation of the impacts of the biological nematicides in the yield and quality of mulberry leaves cultivar Miura” can be combined to save time and efforts.

Lines 364-365, the authors need to specify “or another constitutive gene.”

Reviewer #4: The authors want to address the following questions: 1. If mulberry cultivar is damaged by RKN. 2. What is the efficiency of biological nematicides. 3. Whether biological nematicides would improve the quality of leaves or change the nutrient composition, thus change the silkworm production, finally affect the silk industry? In another words, whether biological nematicides have any impact on silk industry.

They designed corresponding experiment to answer those questions.

The first experiment is to phenotyping mulberry cultivar, which I found the word phenotyping a little confusing. They basically want to look at whether three mulberry cultivars are susceptible/resistant to four RKN species. I have some questions about the method here, mostly the reproduce factor (RF) they are going to use. Based on their method, I would say 99% if not 100% of the RF would be greater than 1, which could potentially increase false positives when doing analysis. Also one of the RKN species they will chose is not introduced in the introduction, if in Brazil mostly M. incognita and M. javanica were found, why chose other two that were not reported yet? If they all found in Brazil, then they should be introduced first. They plan to inoculate 1000 eggs per plant, but for their next experiment, they will do 2000 eggs instead, I would suggest keep the inoculation the same.

The second experiment is to evaluate the effect of three biological nematicides on M. Javanica, the method seems standard, I donot have much comment here.

The final series of experiment is supposed to answer the third question (the biggest). They chose two biological nematicides to continue, analyses the nutrition of the leaves, histological analysis of intestinal and glandular tissue of silkworm, and qPCR on couple of the genes that are involved in silk production. The methods itself seem to be standard, but my concern is whether those experiments will generate data to answer the question. For example, I would assume not only two genes involved in silk production. Is it enough to characterize couple genes through qPCR to answer the expression pattern change?

line77 where did you get this? the second day the nematode probably have not sucked nutrient from the plants yet. I think this sentence needs to be edited more carefully, at least cite the paper if it is true.

Line 78 For yield loss, it is very hard to accurately determine.

Line 85-95 those two paragraphs could be condensed and merged

Line 111-114 Any papers to support?

Line 129-134 those two active components are used mostly for insecticides, any citations on biological nematicides effect?

Line 135-143 if there is more background on RKN infecting mulberry cultivars that would be great

line148 Are those four RKN species all reported in affecting mulberry, there is one species that is not introduced anywhere.

lines 150-151 what kind of interaction?

Line158-160 why evaluate 3 and then study two later, what is the criteria for selecting those two?

Line 171 I not sure histological analyzes by itself can support the conclusion on this aspect

line 203 2ml might be too much water, 1ml is a good volume.

Lines 211 any literature for these standards? Since you harvest after 90 days, I suspect 99% of the value will be greater than 1, and that has nothing to do with resistant cultivar, because you have at least 3 to 4 generations. Even on resistant cultivar, the RKN still reproduce, just not as many as susceptible.

Line243 why one-way

Line 264 not very clear which methods you are referring to.

Lines 268-269 please describe more specifically, which are the variables that you will put into multivariate analyzes. Is this typical for nutrient analysis?

Line290 again, the analysis should be more specific

Lines 328 are you using the same sample as previous experiment? How to collect the sample for qPCR. If you use previous sample, my concern is whether the tissue if fresh enough to ensure that no environmental factors interferer with the RNA expression.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: Yes: Giovanni Bubici

Reviewer #2: No

Reviewer #3: No

Reviewer #4: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Jun 16;16(6):e0252987. doi: 10.1371/journal.pone.0252987.r002

Author response to Decision Letter 0

15 May 2021

Specific responses are as follows:

Reviewer #1: Introduction section was shortened and the sentences indicated as in contrast one to another were excluded in this new short version of this section. In this new version, the topic of the manuscript was focused on the Introduction and all the information that was initially used to better explore the theme was removed; it could be used in the Discussion section in the next manuscript. English was improved throughout the text.

Other minor comments from reviewer #1 are the following:

L77: these sentences are in contrast: "...from the second day after infection, but only in long term experiments,..." This text was excluded.

L97: arenaria. Excluded

L111: list the chemical nematicides registered for application on mulberry in Brazil and, possibly, elsewhere. We included in the text the information that there are no chemical nematicides registered for mulberry in Brazil.

L122: the biological control agents Pseudomonas fluorescens and Trichoderma viridae must be introduced. Why did you use them? Excluded. We will not use these organisms.

L126: you must introduce Artemisia nilagirica extract. Why did you use it? Excluded. We will not use this extract.

L186: report the manufacturer. ok

L209: report the formula. ok

L214: Bartlett's test, Shapiro-Wilk's test, and Box-Cox method precede ANOVA, but not the contrary. Ok, we changed the order in the text.

L225: abbreviate the genus name after the first occurrence. ok

L230: describe the method for inoculation. Report the dosage per pot. Ok, done.

L364: 5S rRNA is an unusual housekeeping gene: report citation. What is "another constitutive gene"? Analysis done recently by our laboratory showed that the genes initially selected to be used in our study did not amplified adequately. By this reason, we selected other genes from literature that were included in the methodology described in the text. The use of 5S rRNA gene as a housekeeping was a mistake that was corrected in the text; instead, genes RLP3 and alpha-tubulin will be used for this purpose. Table with the primers was corrected and text was modified.

However, I cannot understand why silkworms could be damaged when fed with leaves harvested from plants treated with biocontrol agents to the roots 75 days before. Preliminary evidence (or literature) for this should be provided as a rationale for the research conducted here. We hypothesize that it could be possible that no deleterious effect will be observed in silkworms and so, mulberry growers could use both biological nematicides in their farms without restrictions. However, it is only an hypothesis and we should prove it to guarantee the safety of the silkworms.

Reviewer # 2. English was improved throughout the text. Minor points indicated regarding structure and grammar were all modified in the text, except when reviewer 2 suggested us to change encasulation by encapsulation, because the word is correct.

Reviewer # 3.

Lines 157-162, the objectives of research seem to be overlapping. The authors need to clarify it. We modified the proposition o four work and we think that modifications done in the manuscript could address this question.

In the “Phenotyping of mulberry (Morus alba) to Meloidogyne spp” section, the authors need to provide validations why eggs are harvested at “90 days from inoculation” to calculate reproduction factor (RF)? The authors also need to show how the RF is calculated in this section first. We included the explanation about the calculus of RF values in the Material and Methods section and we altered the evaluation to 120 DAI.

Line 258, is “Ninety DAI” the correct date here? We altered to 120 DAI.

The experiments in the two sections “Evaluation of biological nematicides in the control of Meloidogyne javanica in mulberry cultivar Miura” and “Evaluation of the impacts of the biological nematicides in the yield and quality of mulberry leaves cultivar Miura” can be combined to save time and efforts. Experiments were combined and only one of them, which includes the other, was described to avoid misinterpretations.

Lines 364-365, the authors need to specify “or another constitutive gene.” The same answer to reviewer 1 could be used here: “Analysis done recently by our laboratory showed that the genes initially selected to be used in our study did not amplified adequately. By this reason, we selected other genes from literature that were included in the methodology described in the text. The use of 5S rRNA gene as a housekeeping was a mistake that was corrected in the text; instead, genes RLP3 and alpha-tubulin will be used for this purpose. Table with the primers was corrected and text was modified.”

Reviewer # 4.

The first experiment is to phenotyping mulberry cultivar, which I found the word phenotyping a little confusing. They basically want to look at whether three mulberry cultivars are susceptible/resistant to four RKN species. We decided to evaluate only the main root-knot species for mulberry in Brazil, M. incognita and M. javanica in the phenotyping studies. Although this is a correct word to designate the study that will be done in this section, we agreed with the reviewer and changed to “host reaction of mulberry cultivars to Meloidogyne spp.”

I have some questions about the method here, mostly the reproduce factor (RF) they are going to use. Based on their method, I would say 99% if not 100% of the RF would be greater than 1, which could potentially increase false positives when doing analysis.

Also one of the RKN species they will chose is not introduced in the introduction, if in Brazil mostly M. incognita and M. javanica were found, why chose other two that were not reported yet? If they all found in Brazil, then they should be introduced first. Both species are found in Brazil parasitizing coffee (M. paranaensis) and other fruit trees (M. enterolobii) and we included these two nematodes aiming to evaluate the reaction of the mulberry cultivars to these two potential pathogens for this crop. But we agreed with the reviewer that the inclusion of these species could lead to misinterpretations of the text and maybe it will not bring us a significant information for our study, as presented.

They plan to inoculate 1000 eggs per plant, but for their next experiment, they will do 2000 eggs instead, I would suggest keep the inoculation the same. We decided to maintain 1000 eggs per plant in the experiment aiming to evaluate the host reaction of mulberry cultivars to Meloidogyne spp., according to suggested by Silva et al. (2020) for similar studies with coffee plants, also a perennial species. However, in the experiment in which we will evaluate the effect of biological nematicides, we decided to use 5000 eggs per plant. In this case, the higher initial population density could favor the symptoms and damages in the plants and, additionally, nematicides could be submitted to a higher inoculum pressure, commonly found under field conditions.

The final series of experiment is supposed to answer the third question (the biggest). They chose two biological nematicides to continue, analyses the nutrition of the leaves, histological analysis of intestinal and glandular tissue of silkworm, and qPCR on couple of the genes that are involved in silk production. The methods itself seem to be standard, but my concern is whether those experiments will generate data to answer the question. For example, I would assume not only two genes involved in silk production. Is it enough to characterize couple genes through qPCR to answer the expression pattern change? This concern demonstrated by reviewer 4 is plausible, since there are several genes involved in the silk production reported in literature. Genes that we suggested to use in our study are the more used and they were tested and used in other studies from our lab. Therefore, we initially selected these genes, but we can select other genes during the development of the work, if necessary.

line77 where did you get this? the second day the nematode probably have not sucked nutrient from the plants yet. I think this sentence needs to be edited more carefully, at least cite the paper if it is true. This sentence was excluded.

Line 78 For yield loss, it is very hard to accurately determine. Sentence was changed.

Line 85-95 those two paragraphs could be condensed and merged. Ok, done.

Line 111-114 Any papers to support? We excluded this sentence from the manuscript.

Line 129-134 those two active components are used mostly for insecticides, any citations on biological nematicides effect? This sentence was excluded.

Line 135-143 if there is more background on RKN infecting mulberry cultivars that would be great. Unfortunately, information is scarce.

line148 Are those four RKN species all reported in affecting mulberry, there is one species that is not introduced anywhere. We decided to study only M. incognita and M. javanica.

lines 150-151 what kind of interaction? This sentence was excluded.

Line158-160 why evaluate 3 and then study two later, what is the criteria for selecting those two? We decided to work with only two biological nematicides, with different modes of action, one bacteria that protects the roots against the nematode penetration as a main effect and one fungi that has a direct effect capturing juveniles and parasitizing eggs.

Line 171 I not sure histological analyzes by itself can support the conclusion on this aspect. We think that probably no effect will be observed and that the gland patterns observed in the check will also be observed in the treatments. But, considering the volume of samples and cuts that will be done, if any variation could occur, we will be able to verify it.

line 203 2ml might be too much water, 1ml is a good volume. Considering that 2 ml correspond to only 0.23% from the volume of a 900 ml-capacity pot, we consider that this is not too much water. Therefore, except by a personal opinion from reviewer, we cannot find any justificative to reduce the volume of the inoculum. Even because the spatial distribution of the inoculum in the pot is important to guarantee the uniform infestation.

Lines 211 any literature for these standards? Since you harvest after 90 days, I suspect 99% of the value will be greater than 1, and that has nothing to do with resistant cultivar, because you have at least 3 to 4 generations. Even on resistant cultivar, the RKN still reproduce, just not as many as susceptible. Mulberry is a perennial crop and earlier evaluations of the host reaction to nematodes could lead to erroneous results. If we consider an annual plant species, as Phaseolus vulgaris, whose reproductive cycle is around 65 days, it is plausible to consider an evaluation at 30 days after inoculation, as proposed by Oostenbrink (1966), since at 30 DAI, we have 40% of the total cycle of this plant. Mulberry plants take up one year from cutting planting to production, considering that mulberry flowering occur at spring and fructifying at summer. So, we can consider that the reproductive cycle of mulberry is completed around one year and, therefore, the evaluation done 3 to 4 months after the inoculation seems to be more plausible for us. Our group have been working with coffee plants and our experience with this crop shows that resistant cultivars maintain this characteristic also in evaluation done at 150 DAI.

Line243 why one-way. The variables are dependent.

Line 264 not very clear which methods you are referring to. Nematodes will be extracted from roots according to Boneti and Ferraz (1981) methodology, as described for the host reaction experiment, from plants whose shoot parts were used as feed source to silkworms.

Lines 268-269 please describe more specifically, which are the variables that you will put into multivariate analyzes. Is this typical for nutrient analysis? We described in detail in the text all variables that will be analyzed. The multivariate analysis allows us a global view of the effect of treatments based in the set of variables.

Line290 again, the analysis should be more specific. The analysis was better described in the text.

Lines 328 are you using the same sample as previous experiment? How to collect the sample for qPCR. If you use previous sample, my concern is whether the tissue if fresh enough to ensure that no environmental factors interferer with the RNA expression.

A detailed methodology explaining how the tissues will be extracted and stored was added in this section to clarify this question.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file. (22.4KB, docx)

Decision Letter 1

Adler R Dillman

27 May 2021

Morus alba: host reaction for Meloidogyne javanica, biological nematicides assessment and study of these relationships with yield and quality of leaves, cocoon and health of the silkworm.

PONE-D-20-23665R1

Dear Dr. Machado,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Adler R. Dillman, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Thank you for addressing the reviewers concerns in the revision. The revision is significantly improved.

There are a few minor textual suggestions I would make that I think would improve clarity.

For example, "encasulation," which you have used on line 194 to mean "reach the pupal stage," is not a word, to my knowledge. I only find reference to it in other papers as a typo where the word "encapsulation," is meant. However, in the context used on line 194 "encapsulation" does not mean pupation.

Line 27: change "damages" to damage.

Reviewers' comments:

Acceptance letter

Adler R Dillman

31 May 2021

PONE-D-20-23665R1

Morus alba: host reaction for Meloidogyne javanica, biological nematicides assessment and study of these relationships with yield and quality of leaves, cocoon and health of the silkworm.

Dear Dr. Machado:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Adler R. Dillman

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Attachment

    Submitted filename: Response to Reviewers.docx

    Click here for additional data file. (22.4KB, docx)

    Data Availability Statement

    All relevant data from this study will be made available upon study completion.

    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES