Prevalence of K-ras Codon 12 Mutations in Indian Patients with Head and Neck Cancer

Abstract

In human tumors, somatic mutation frequently occur in K-ras gene at codon 12, which makes the K-ras protein hyper active leading to uncontrolled signaling for cell division: one of the important hall mark of cancer. In order to correlate mutations in K-ras to cause, response to treatment, disease progression and recurrence of Head and Neck Squamous Cell Carcinoma (HNSCC) the following study was undertaken. By using PCR–RFLP method prevalence of codon 12 in K-ras gene was studied in 56 HNSCC patients. High frequency of K-ras mutation was detected in codon 12 (60.71%). The result of this study helps us in understanding the role of K-ras somatic mutations in HNSCC patients and in designing novel treatment protocols for HNSCC patients.

Electronic supplementary material

The online version of this article (10.1007/s12291-020-00882-w) contains supplementary material, which is available to authorized users.

Introduction

Head and neck cancer (HNSCC) is the sixth most frequent cancer worldwide [1]. The overall survival rate for patients with head and neck cancer is the lowest among the major cancer types (5 year) and has not improved during the last decade. The development in head and neck cancer oncology with reference to molecular genetic research to identify alterations or modifications in the genome will lead to correlate tumour behaviour in the patients and their response to treatment to particular protein involved in cancer. Like any other cancer, the molecular changes observed in HNSCC are mainly because of mutations leading to oncogene activation and tumour suppressor gene inactivation, resulting in deregulation of cell cycle and uncontrolled proliferation [2]. Oncogenes family are widely mutated in several cancers this include RAS family of oncogenes [3].

The Ras family of oncogenes include Kirsten- ras (K-ras), Harvey ras (H-ras) and Neuroblastoma –ras (N-ras). All of these three genes encode closely related proteins (p21 ras), which are localized in the plasma membrane and act as ‘molecular switches’ that links the extracellular signals to intracellular signals especially related to activation of cell division [4]. The activation state of RAS proteins depends on whether they are bound to Guanosine triphosphate (GTP) or Guanosine diphosphate (GDP). If bound to GTP, they are active and are able to activate downstream signalling molecules, but if GDP is bound, they are inactive and fail to interact with the effectors and thus signal transduction pathway are not activated [5]. In normal cells, the activation of RAS proteins is controlled by the ratio of bound GTP to GDP. Thus, Ras mutations such as G12D, G12A, and G12C render the Ras proteins in active for regulation, where activation induced hydrolysis of GTP to GDP is prevented, thereby keeping the protein in the ‘on’ stage; resulting in sustained delivery of signals to the cell for continuous proliferation as in the case of cancer.

Of the three human ras isoforms, K-ras gene mutation have been reported in 15–30% of human tumours, among the various mutations reported G12D and G13D mutations are the most common mutation reported in human tumours [6]. Both G12D and G13D encode abnormal p21 proteins which favours an active GTP bound state leading to a pathologic activation of cell division. Moreover, tumor cells with K-ras mutations are resistance to chemotherapy and radiation therapy in lung and colorectal cancers [7]. Because of this major role played by the mutant proteins in cancer, various strategies have been developed to target mutant K-ras for the treatment of many cancers in human.

Identification of mutations in cancer patients is useful by several means (a) it suggests the type of treatment protocol to be followed to that particular patient (b) gives us an insight into molecular basis of disease cause and progression (c) pre-clinical counselling can be given to patient’s relatives processing similar kind of mutations and (d) novel drug targets can be identified. Our lab have been working on identification of mutants in patients with HNSCC and correlating their mutation to disease progression and response to treatment [8, 9].

In HNSCC, the family of Ras genes has a particular interest because a mechanism for mutation of K-ras by tobacco carcinogens has been reported [10]. Furthermore, K-ras mutations have been observed in tobacco related cancers such as pancreatic and lung carcinomas [11]. A limited number of K-ras mutation studies have been carried out in head and neck cancer worldwide. Mutations status of Ras codon 12 have not been reported in head and neck cancer patients of Indian origin. Hence, in this study we report distribution of K-ras codon 12 mutation in head and neck cancer patients of Indian population.

Materials and Methods

Patients and Specimens

Tumor samples were surgically excised from 56 patients suffering from head and neck cancer at Apollo hospital Chennai, India. After resection, the tumors were snap frozen and then transported to Vellore Institute of Technology, Vellore.

DNA Extraction

DNA extraction from tumor samples were carried out by High Salt Method. The tumor tissue was placed in a microfuge tube containing 1 ml of TNES (10 mM Tris, 6 M NaCl, 100 mM EDTA, 0.6% SDS) buffer with 60 µl of proteinase-k (20 mg/ml) and incubated overnight at 45 °C. After the incubation period, 277 µl of 6 M NaCl was added, mixed and centrifuged. The supernatant was transferred to a fresh microfuge tube, and the genomic DNA was precipitated with equal volume of 100% ethanol. The DNA was pelleted by centrifugation. The pellet was washed with 70% ethanol and air dried. The recovered DNA was suspended in 20–100 µl of sterile distilled water.

PCR Amplification

The 157 bp region of genomic DNA coding for K-ras gene covering codon 12 was PCR amplified using specific primers (50 µl of reaction mixture containing 5 µl of 10 × buffer, 2 µl of each primers (10 pM), 4 µl of dNTPs (2.5 mM), 0.4 µl of Taq Polymerase (5units/ul), 100 ng of template DNA and 35.6 µl of H₂O). In Eppendorf thermal cycler the following cycles was used. An initial one time incubation of 5 min at 94 °C followed by 35 cycles consisting of 40 s at 94 °C, 45 s at 60 °C, 50 s at 72 °C; followed by one time incubation of 10 min at 72 °C. Sequences of the primers used are given below:

F-5′ACTGAATATAAACTTGTGGTAGTTGGACCT 3′

R-5′ TCAAAGAATGGTCCTGGACC-3′ [12].

RFLP for Detecting Codon 12 Mutation

The underlined nucleotides in both the primers were changed from the actual K-ras gene sequence; in order to introduce BstNI restriction enzyme site both in the 5′ and 3′ end of the PCR product (in wild type gene). In case of mutation in codon 12, the BstNI site will be abolished in the PCR product. Thus digestion of 157 bp PCR product having wild type codon 12 sequence will produce 111 + 29 + 17 bp products when digested with BstNI restriction enzyme. Under the same condition PCR product with codon 12 mutation will produce 140 + 17 bp products. On gel either 111 bp product (for WT) or 140 bp product (for homozygous mutants) or both the products are observed (in case of heterozygous condition). Rest of the digested products run out of the gel due to its small size.

Statistical Analysis

Differences in the categorical variables including age, gender, anatomical location of the tumour, stage, histopathology, grade, tobacco usage and treatment type between patients with and without K-ras mutations were evaluated for significance with chi-square tests using SPSS software.

Results

Detection of Mutation in Codon 12

One of the commonly mutated site in K-Ras gene is codon 12. This codon encodes for Glycine in wild type genome, in cancer patients it has been observed that this codon is widely mutated. Presence of this mutation was assessed in genomic DNA of 56 HNSCC patients using PCR–RFLP method. As explained in materials and methods, 157 bp product when digested with BstNI enzyme would produce 111 bp product for homozygous WT genome, 140 bp product for homozygous mutation and both products for heterozygous genome as shown in Fig. 1. Out of the 56 HNSCC patient’s genomic DNA included in the study, homozygous mutation of the codon 12 was present in 11% (6/56) of the patients where band size of 140 bp is observed, heterozygous mutation was present in 50% (28/56) of patients where two bands of 140 and 111 bp is observed and 39% (22/56) of the patients were wild types where 111 bp band is observed as shown in Online resource 1. The correlation between k-ras mutations and the clinico-pathological factors of all the patients are shown in (Table 1).

Fig. 1.

Mutational analysis of K-ras gene at codon 12 by PCR–RFLP. Normal K-ras allele: 111 bp, Mutant K-ras allele: 140 bp. Heterozygous mutant case: 140 bp and 111 bp. M = molecular weight marker. Lane 1, 2 and 4 = heterozygous mutant, Lane 3 = Wild type, Lane 5 = homozygous mutant

Table 1.

Correlation between K-ras mutations and clinico-pathological factors of all head and neck cancer patients used in this study

K ras mutation
	Total (n = 56)	WT (n = 22)	HTM (n = 28)	HM (n = 6)	p value*
Age					0.043
< 45 years	26	10 (45.5%)	27 (96%)	5 (83%)
> 45 years	30	12 (54.5%)	1 (4%)	1 (17%)
Gender					0.124
Male	50	20 (91%)	21 (75%)	4 (67%)
Female	6	2 (9%)	7 (25%)	2 (33%)
Diagnosis					0.121
Oral cavity	47	19 (86.4%)	20 (71.4%)	5 (83%)
Oropharynx	2	1 (4.6%)	1 (3.6%)	1 (17%)
Hypopharynx	1	2 (9%)	4 (14%)	0
Larynx	2	0	0	0
Others	4	0	3 (11%)	0
Stage					0.856
Stage I	8	0	4 (14%)	2(33%)
Stage II	0	20 (91%)	0	0
Stage III	14	2 (9%)	10 (36%)	3 (50%)
Stage IV a	21	0	5 (18%)	0
Stage IV b	10	0	8 (28%)	1 (17%)
Stage IV c	3	0	1 (4%)	0
Histopathology report					0.233
Squamous cell Carcinoma	55	19 (86%)	27 (96%)	6 (100%)
Adeno carcinoma	1	3 (14%)	1 (4%)	0
Others	0	0	0	0
Grade					0.027
Grade I	8	2 (9%)	3 (11%)	5 (83%)
Grade II	46	20 (91%)	25 (89%)	0
Grade III	2	0	0	1 (17%)
Tobacco usage					0.494
Yes	42	18 (82%)	21 (75%)	6 (100%)
No	14	4 (18%)	7 (25%)	0
Treatment type					0.201
Radical Surgery	2	20 (91%)	2 (7%)	0
Surgery + post OP RT	52	2 (9%)	26 (93%)	4 (67%)
Radical RT	2	0	0	2 (33%)

WT wild type, HTM heterozygous mutant, OP operation, RT radiation technology

*Significant of p value is < 0.05

Discussion

It has been observed that irrespective of the type of cancer, patients with mutation in K-ras gene at codon 12 makes the cancer more severe and difficult to treat [13]. Hence this study was under taken. Our results indicate that simple PCR–RFLP was able to clearly identify the mutations present in 56 tumor samples of head and neck cancer patients.

In a study on sinonasal cancer in France, 1% mutation was observed at codon 12 of K-ras [14]. Rizos et al. found that no mutation was found in cytological specimens of Laryngeal tumors in Greek population [15]. Furthermore, in the study conducted by Weber et al. in head and neck cancer samples of Germans, out of 89 samples only 1 mutation was detected [16]. Scully et al. performed a study evaluating head and neck squamous cell cancer specimens in Japan population and the K-ras mutation was detected in 2 out of 26 samples [17]. Bissada et al., analyzed prevalence of K-ras G12 mutations in HNSCC patients in Canadian population and observed 3.5% of the patients carried the mutation. Based on this study, they also suggest that this mutation could influence the failure of treatment protocols in these patients [6]. In American population, 16.9% of HNSCC patients had K-ras G12 mutation and found that their response to treatment faded down the time, compared to the other patients included in the study [18]. The same has been observed in Eastern population also, where 18% of the patients possessed K-ras mutation and the overall survival of the patients was not good [19]. In contrast to all these reports, in our study with Indian population, 28 out of 56 (50%) heterozygous mutants, 6 out of 56 (10.71%) homozygous mutations and 22 wild types (39.28%) were detected, suggesting a high incidence of K-ras mutations in Indian HNSCC population.

K-ras proto-oncogene receive and pass signals from a variety of transmembrane receptors to intracellular effectors that control cellular proliferation, migration etc. K-ras codon 12 mutation results in uncontrolled activation of cellular proliferation leading to cancer. Unlike the mutations in tumor suppressor proteins, presence of a single copy activation mutation is sufficient to exert its pathological role in the cell. Thus in this study taken together; both heterozygous and homozygous mutations in the patients, a total of 60.71% patients possess K-ras G12 activation mutation. It is pertinent to note that in a different study involving identification of B-Raf V600 activation mutation using the same set of patient samples used in this study, 98% of patients carry this activation mutation [9]. This observation gives us an important clue that, in HNSCC, uncontrolled cellular proliferation is mediated by Ras – Raf – Mek- Erk pathway and treatment strategies targeting this pathway may be of use in treating the patients. Most of the activating mutations present in the cancer cells are somatic mutations and therefore drugs targeted against these mutants will lead to development of anti-cancer drugs that will inhibit only the mutant protein present in the cancer cells and not the wild type protein present in the non- cancerous cells.

Conclusion

In this study for the first time we report prevalence of K-ras mutation at codon 12 in HNSCC patients of Indian origin. This study revealed that more than 60% of patients possess this mutation. This study and previous study reveals that most of the HNSCC patients have ERK signaling pathway activated continuously leading to uncontrolled cell division. This study also suggest that ERK signaling pathway should be targeted for successful control of proliferation of HNSCCs.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Author Contributions

Conceptualization: [AG]; Methodology: [AG], Formal analysis and investigation: [AG], Writing—original draft preparation: [AG]; Writing—review and editing: [AM], Funding acquisition: [AM], Resources: [AM]; Supervision: [AM].

Funding

This study was funded by Vellore Institute of Technology seed Grant (12927/2018).

Compliance with Ethical Standards

Conflict of interest

The authors declare that they have no conflict of interest.

Ethical Approval

All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional committee (Vellore institute of Technology Human Ethical Committee, IEC/IRB No: IECH/2013/Dec18-006) and with the 1964 Helsinki declaration and its later amendments comparable ethical standards.

Informed Consent

Informed consent was obtained from all individual participants included in the study.