Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Jun 21.
Published in final edited form as: Reprod Sci. 2021 Jan 4;28(5):1476–1488. doi: 10.1007/s43032-020-00434-w

Uteroplacental Insufficiency with Hypoxia Upregulates Placental PPARγ-KMT5A Axis in the Rat

Emily Barrett 1,#, Amy Loverin 2,#, Haimei Wang 1, Michelle Carlson 3, Tricia D Larsen 4, Mariana M Almeida 5, Jenna Whitman 1, Michelle L Baack 4, Lisa A Joss-Moore 1,*
PMCID: PMC8215892  NIHMSID: NIHMS1713533  PMID: 33398850

Abstract

The placenta represents a critical node in fetal lipid acquisition, yet the mechanisms by which the placenta handles lipids under normal and pathologic conditions are incompletely understood. A key player in placental lipid handling is peroxisome proliferator activated receptor gamma (PPARγ). PPARγ influences global gene expression via its regulation of the epigenetic modifier lysine methyltransferase 5A (KMT5A), which places a methyl group on histone 4 lysine 20 (H4K20me) of target genes. Here we test the hypothesis that KMT5A is present in both the human and rat placenta and is affected by uteroplacental insufficiency (UPI) in the rat in association with increased placental lipid accumulation. We assessed levels and localization of KMT5A, as well as lipid droplet accumulation, in human placental tissue collected from maternal donors after delivery by planned cesarean section. Using a rat model of UPI we also evaluated the effects of UPI on lipid accumulation, PPARγ, KMT5A, and H4K20me in the rat placenta. In this study we show for the first time the presence and activity of KMT5A, in human and in rat placenta. We also demonstrate that in the rat placenta UPI increases hypoxia, KMT5a expression and activity in association with increased lipid accumulation in placenta supporting male fetuses. Placental PPARγ-KMT5A axis may be an important mediator of placental lipid handling.

Keywords: lysine methyltransferase 5A, PPARγ, epigenetics, placental lipid regulation

INTRODUCTION

The placenta represents a critical node in fetal fatty acid acquisition, which is essential for normal growth, development and ongoing health of the developing fetus [1, 2]. While the contribution of maternal fatty acid intake and stores to fetal fatty acid accretion is well appreciated, the role of the placenta in moderating fatty acid transport from mother to fetus is not fully understood. The placenta is a complex interface between maternal and fetal fatty acid metabolism, and is required to ensure adequate and appropriate fatty acids reach the fetus, timed for critical periods of growth and organ development. To this end, the placenta processes maternal circulating lipids to free fatty acids. Lipids are transported into both cytotrophoblasts and syncytiotrophoblasts at the maternal-fetal interface for utilization or storage. Lipids are then processed and/or transported to the fetal circulation by both passive and active fatty acid transport mechanisms [3, 2, 4, 5]. The processing and metabolism of fatty acids by the placenta includes the production of lipid droplets as an intermediate step. In the placenta and other tissues, lipid droplet formation provides a means of protecting tissues from lipotoxicity [6]. Pathologic conditions of pregnancy, particularly those involving placental insufficiency and hypoxia, disturb the balance of fatty acid uptake, storage, and release, manifesting in increased lipid droplet accumulation [7–9]. The increase in placental lipid droplet accumulation has the potential to negatively impact the growing fetus. Sequestration of fatty acids within placental lipid droplets suggests that they may be unavailable to the growing fetus, thus contributing to fetal growth restriction [7, 8]. While candidate pathways are proposed, the mechanisms by which hypoxia and other pathologies of pregnancy cause an increase in placental lipid droplet accumulation are incompletely understood.

A long appreciated candidate for placental lipid handling is peroxisome proliferator activated receptor gamma (PPARγ). PPARγ is a transcription factor necessary for normal placentation and trophoblast function, as well as placental metabolic function and fatty acid uptake [10–12]. In the human and rodent placenta, PPARγ is expressed in the cytotrophoblast and the syncytiotrophoblast [11, 13]. Activation of PPARγ increases fatty acid uptake by trophoblasts [14]. As a transcription factor, PPARγ directly regulates gene transcription by binding to a PPAR response element (PPRE) in the target gene promoter [15]. Several genes involved in fatty acid metabolism contain a PPRE and are verified targets of PPARγ, including SLC27A1, perilipin 2, fatty acid binding protein 4, and lipoprotein lipase [16–18]. While little doubt exists that PPARγ contributes to placental lipid handling via direct regulation of gene targets, data also suggests that PPARγ may have an additional indirect influence on placental gene expression and thus lipid handling [7, 16–18].

In non-placental tissues, PPARγ indirectly regulates downstream gene expression through an intermediate, the lysine methyltransferase 5A (KMT5A, also known as Setd8). PPARγ binds to the PPRE of KMT5A, and promotes KMT5A transcription [19]. The only known role of KMT5A is placement of the epigenetic mark histone 4, lysine 20 methylation (H4K20me) [20]. In the context of metabolic regulation, H4K20me is enriched in the body of active genes. This placement of H4K20me by KMT5A in the body of target genes contributes to RNA polymerase II release [21]. Gene body methylation of H4K20 across target genes within the genome then promotes the coordinated stimulation of transcription of these suites of target genes [22–24, 21]. Suites of KMT5A target genes have been identified in multiple non-placental tissues, and frequently involve upregulation of lipid storage and metabolism genes [25, 21]. One potential target of KMT5A and H4K20me is fatty acid transport protein 2 (FATP2), coded for by the SLC27A2 gene. FATP2 is an integral membrane protein with intrinsic acyl-CoA synthetase activity [26, 27], which is essential for fatty acid uptake and storage within trophoblast cells [13].

In this study we use a well characterized rat model of surgically induced uteroplacental insufficiency (UPI) [23, 28–30] to examine the association between lipid droplet accumulation, PPARγ, and KMT5A in the placenta. Since, to the best of our knowledge, this is the first study looking at KMT5A in the placenta, we also examined human placenta for KMT5A expression, and association with lipid droplet accumulation. We hypothesized that KMT5A is present in both the human and rat placenta, and is affected by UPI in the rat in association with increased placental lipid accumulation.

METHODS

Rat Model of UPI

All animal procedures were approved by the University of Utah Animal Care and Use Committee and are in accordance with the American Physiological Society’s Guiding Principles for the Care and Use of Vertebrate Animals in Research and Training. The rat model of UPI was as previously described by our group [23, 28, 30, 22]. Briefly, on embryonic day 19, pregnant Sprague-Dawley rats were anesthetized with intraperitoneal xylazine (8 mg/Kg) and ketamine (40 mg/Kg). Both uterine horns were exposed and silk 4.0 sutures were used to tie off the uterine artery to each horn. Although the uterine artery is the main source of blood flow, there are still minor arteries supplying the uterus. The rats were monitored until they recovered within one to two hours. Control dams underwent identical anesthetic procedures. Rat dams had ad libitum access to food and water, and were kept on a 12h/12h light/dark cycle. At embryonic day 21, surgical delivery of UPI and control rat pups was performed, and placentas collected. The weight of each rat pup and its corresponding placenta was recorded. Whole placentas were frozen and stored at −80°C. All experiments used 6–9 pups or placenta per group. Only a single female and single male feto-placental unit was used from each litter to avoid pseudoreplication Pups were sexed by visual examination of the distance between the anus and the genital papilla.

A subset of embryonic day 21 placentas from controls was immediately separated at the regressing basal zone by gentle traction with forceps and processed for KMT5A immunohistochemistry. This was done to histologically examine KMT5A localization differences between the remaining fetal labyrinth zone and maternal decidua basalis/metrial gland separately. Each side was placed in OCT and frozen at −20°C for frozen section staining. Another subset was immersed in fresh 4% paraformaldehyde (4°C) for 24h of fixation at 4°C and processed into paraffin blocks. Male and female pups/placenta were treated as separate groups.

Human Placental Samples

Human placental samples were collected after delivery by planned cesarean section from consenting mothers under approval by the Sanford Health Institutional Review Board and in accordance with Protection of Human Subjects federal law 45 CFR 46 and the Health Insurance Portability and Accountability Act (HIPAA). Subjects with known maternal disease, multiple gestation pregnancy, fetal chromosomal abnormalities, preterm delivery before 34 weeks gestation, placental abruption or chorioamnionitis were excluded from the study. After delivery of the infant and placenta, 1–3 cm3 placental snips were taken under aseptic surgical conditions, one adjacent to the umbilical cord intersection on the fetal side and the other approximately across from the first on the maternal side of the placenta. Tissue specimens were transported to Sanford Research within hours of collection, where they were subdivided and stored in Allprotect® Tissue Reagent (QUIAGEN, Germantown, MD) for RNA and protein (stored at −80C) or OCT embedded (stored at −20C) for imaging.

Placental Histology

Human and rat, maternal and fetal sided placental OCT blocks were frozen, sectioned into 10μm slices, and fixed in 4% PFA. Human placenta were cross-sectioned through the chorionic villi (on both maternal and fetal side). Rat placenta (pre-divided at collection) were cross-sectioned through the labyrinth zone and decidua basalis zone. Sections were stained with 1:1000 wheat germ agglutinin (WGA) (Invitrogen, Carlsbad, CA) which binds to glycoproteins in the syncytial microvillous membrane and the apical cytotrophoblast to allow visualization of trophoblast cell membranes. Samples were then permeabilized in 0.2% Triton X-100, washed and blocked with 10% horse serum, 1% BSA, and 0.02% sodium azide in PBS for 1 hour at RT before incubating overnight at 4 °C with 1:100 anti-KMT5A (My Biosource, San Diego, CA. MBS8500566). After washing, secondary antibody 1:1000 Alexa Fluor 488 anti-rabbit (Invitrogen, A11034) was incubated for 45 minutes at RT followed by 1:200 DAPI for 5 minutes. Human placental samples were digitally imaged with the Aperio VERSA 8 automated slide scanner and qualitatively analyzed using the Aperio Image Scope Software (Leica Biosystems Imaging, Buffalo Grove, IL). Rat placental samples were imaged at 40x on a Nikon Ni-E (Nikon, Melville, NY).

Oil-Red-O staining was used as an additional measure of lipid accumulation in placenta. Frozen rat placenta sections were fixed, washed twice with 100% propylene glycol (ACROS Organics, Thermo Fisher Scientific NJ), stained with Oil-Red-O (Amresco, Solon, OH), washed with 85% propylene glycol, and stained with Gill #2 modified hematoxylin (Fisher Chemical, Fair Lawn, NJ). Quantification of lipid was performed as previously described using the colorimetric lipid quantification kit (STA-613, Cell Biolabs, Inc.) and quantified as described previously [31]. Human placentas were fixed in 10% neutral buffered formalin and processed on a Leica 300 ASP tissue processor. The placentas were serially sectioned onto 6 slides, stained with Oil-red-O, 1 with and 1 without a hematoxylin counterstain and mounted with an aqueous mounting medium. Sections were digitally imaged with the Aperio VERSA 8 automated slide scanner to capture 8 regions of interest which were qualitatively analyzed using the Aperio Image Scope Software (Leica Biosystems Imaging, Buffalo Grove, IL). Image J Software (NIH, Bethesda, MA) was used to analyze lipid stained droplet counts and area on 4–7 quality sections per human placental sample (n=4 samples per group) as previously described [32].

mRNA Transcript Levels

Real-time reverse transcriptase (RT) PCR was used to measure mRNA transcript levels of rat Kmt5a, Pparγ, Slc27a2 (codes for FATP2), in whole rat placental homogenate (n=6–8/group), and KMT5A in human placental samples (n=12/group). Real-time RT PCR was performed as previously described [32–34], with the following Assay-on-demand primer/probe sets: rat Pparγ-Rn01492274_m1, Kmt5a-Rn01477383_g1, Slc27a2-Rn00581971_m1, and human KMT5A- Hs00360662_s1, human TBP- Hs00427620_m1 (Applied Biosystems, Thermo Fisher Scientific, Foster City, CA). The comparative CT method was used for analysis with Glyceraldehyde-3-phosphatase dehydrogenase (Gapdh) as an internal control for rat samples, and TBP for human samples. Gapdh primer and probe sequences; Forward: CAAGATGGTGAAGGTCGGTGT; Reverse: CAAGAGAAGGCAGCCCTGGT; Probe: GCGTCCGATACGGCCAAATCCG. Neither Gapdh nor TBP mRNA transcript levels varied across male, female, control or UPI samples.

Protein Abundance

Immunoblot was used to measure protein abundance of KMT5A and PPARγ in rat whole placental homogenate (n=8/group), as well as KMT5A in human placental samples (n=4/group) as previously described [32, 35, 36]. The following primary antibodies were used: rat PPARγ (sc-7196, Santa Cruz Biotechnology, Santa Cruz, CA); rat KMT5A (ab177488, Abcam, Cambridge, United Kingdom), human KMT5A (MBS8500566, MyBioSource, San Deigo, CA). GAPDH (21185, Cell Signaling Tech, Danvers, MA) was used as a loading control and its densitometry did not vary across male, female, control or UPI samples.

Genome-wide H4K20me

Immunoblot with acid-extracted histones was used to measure genome-wide H4K20me. Acid-extracted histones were prepared as previously described [29, 23]. Levels of histone H4 monomethyl Lys20 (ab9051, Abcam, Cambridge, United Kingdom) were quantified relative to total H4 (ab10158, Abcam, Cambridge, United Kingdom).

Chromatin Immunoprecipitation

Chromatin immunoprecipitation (ChIP) (n=5–7/group) was used to determine 1) proportion of Kmt5a promoter DNA associated with PPARγ protein, and 2) proportion of Slc27a2 promoter and Exon 3 DNA associated with H4K20me region, in rat whole placental homogenate. ChIP was performed as previously described [30]. Immunoprecipitation using isolated chromatin was performed using antibodies to PPARγ (sc-271392, Santa Cruz Biotechnology, Santa Cruz, CA) and H4K20me (ab177188, Abcam, Cambridge, United Kingdom). Real time PCR was used with Isolated ChIP DNA, analyzed relative to input DNA, non-ChIP genomic DNA. Results are % Input. The following primer/probe sets were used: 1) PPARγ at Kmt5a promoter: Forward (5’−3’) CCGCACGGTCCAGAACTC; Reverse (5’−3’) CCGCACGGTCCAGAACTC; Probe (5’−3’) CGGGAGGCCGCATT. 2) H4K20me at the Slc27a2 promoter: Forward (5’−3’) CCACAGCTGCAGTGGGC; Reverse (5’−3’) TCAGATGATCCTTTCGTGCTT; Probe (5’−3’) CCAAGAATCGCCAACTTCCC and 3) H4K20me at the Slc27a2 Exon 3 region: Forward (5’−3’) TTCACACAATTCTCCCAGCA; Reverse (5’−3’) TTGCAGAGACAGGAGGGAAG; Probe (5’−3’) CTCCCTCCTGTAATGGCCAA.

Statistics

Data are expressed as mean ± standard deviation. Two-way analysis of variance (ANOVA) was used to determine UPI, sex, and UPI.sex interaction effects. Pair-wise comparisons were performed using unpaired t-test, or Fisher’s Least Square Difference (LSD) post-hoc test as appropriate. P values < 0.05 were considered to be statistically significant. The software package GraphPad Prism (Version 8.4) was used for all analyses.

RESULTS

UPI Rat Fetal/Placenta Phenotype

No UPI.sex interaction effects were observed for term fetal weights, placenta weights, or placental/fetal weight ratio. Significant UPI effects were observed for fetal weight (P < .0001; two-way ANOVA) whereby overall UPI decreased fetal weights by 16%, with significantly decreased weights in both male (P < .0001;LSD) and female pups (P < .0001; LSD) relative to sex-matched controls (Fig. 1a). Placental weights were not affected by UPI (Fig. 1b). Significant UPI effects were observed for placental efficiency (P < .0001; two-way ANOVA), indicated by the placenta/fetal weight ratio, whereby placental efficiency was decreased 15%, with significantly decreased placenta/fetal weight ratio in males (P < .0001; LSD) and females (P < .0001; LSD) relative to sex-matched controls (Fig. 1c). To determine whether our surgical UPI model resulted in placental hypoxia, we measured mRNA levels of Hif1α. No significant UPI.sex interaction effects were observed for Hif1α mRNA. Significant UPI effects were observed (P < .0001; two-way ANOVA) whereby UPI increased placental Hif1α mRNA levels 132%, with significantly increased Hif1α mRNA levels in male (P < .0001; LSD) and female (P < .0001; LSD) placenta relative to sex-matched controls (Fig. 1d).

Fig. 1. Rat UPI and Control Fetal/Placental Characteristics.

Fig. 1

Open in a new tab

(a) Significant UPI effects were observed for fetal weight (P < .0001; two-way ANOVA). UPI decreased male and female term fetal weights relative to sex-matched controls. (b) Placental weights were not affected by UPI. (c) Significant UPI effects were observed for placental efficiency (P < .0001; two-way ANOVA). UPI decreased placental efficiency in males and in females. (d) Significant UPI effects were observed (P < .0001; two-way ANOVA). UPI increased male and female placental Hif1α mRNA levels relative to sex-matched controls. Results are shown for individual data points and lines are mean and standard deviation. *significant difference to sex-matched control group (p < 0.05).

To assess placental lipid accumulation in control and UPI rat placenta we performed a qualitative assessment using Oil-Red-O (ORO) staining. Increased ORO staining in both male and female UPI placenta was observed, with greater apparent staining in male UPI placenta (Fig. 2a). Quantitative analysis of lipid content confirmed a significant UPI.sex interaction in placental lipid accumulation (P = .0194; two-way ANOVA) where by UPI increased placental lipid accumulation 55% in the male placenta (P = .0024; t-test), with no change in female placenta.

Fig 2. Rat UPI and Control Placental Lipid Accumulation.

Fig 2

Open in a new tab

Top panel (a) Oil-Red-O (ORO) stained rat placental sections, representing placental lipid accumulation (red color) (40X magnification). Quantification (b), represented as optical density of extracted ORO. A significant UPI.sex interaction in placental lipid accumulation (P = .0194; two-way ANOVA) was observed, where by UPI increased placental lipid accumulation in the male placenta, while there was no change in female placenta. Results are shown for individual data points and lines are mean and standard deviation. *significant difference to sex-matched control group (p < 0.05).

PPARγ, KMT5A and H4K20me in Rat Placenta

In the rat placenta, KMT5A was detectable in both the fetal labyrinth zone and maternal decidua/metrial gland of the placenta (Fig. 3a). We also assessed the effect of UPI on Kmt5a mRNA and KMT5A protein in rat whole placental homogenate. There was a significant UPI.sex interaction in placental Kmt5a mRNA transcript levels (P = .0390; two-way ANOVA) whereby UPI increased Kmt5a mRNA 41% in the male placenta (P = 0.0032; t-test), with no change in female placenta (Fig. 3b). A significant UPI.sex interaction was also observed for placental KMT5A protein levels (P = .0099; two-way ANOVA) where UPI increased KMT5A protein levels 33% in male, with no change in female placenta (P = .0145; t-test) (Fig. 3b–c).

Fig 3. Rat UPI and Control KMT5A Localization and Expression.

Fig 3

Open in a new tab

(a) KMT5A is detectable in both the maternal decidua/metrial gland and fetal labyrinth zone of the rat placenta. (b) There was a significant UPI.sex interaction in placental Kmt5a mRNA transcript levels (P = .0390; two-way ANOVA) whereby UPI increased Kmt5a mRNA in the male placenta, with no change in female placenta. (b) and (c) A significant UPI.sex interaction was also observed for placental KMT5A protein levels (P = .0099; two-way ANOVA) where UPI increased KMT5A protein levels in male, but not female placenta. Results are shown for individual data points and lines are mean and standard deviation. *significant difference to sex-matched control group (p < 0.05).

Since PPARγ has been identified as a transcription factor for KMT5A, as well as a regulator of placental lipid metabolism, we assessed the effects of UPI on placental Pparγ mRNA and PPARγ protein, as well as occupancy of PPARγ at the Kmt5a protomer in whole rat placenta. No UPI.sex interaction effects were observed for Pparγ mRNA and UPI did not alter Pparγ mRNA levels in either sex (Fig. 4a). While no significant UPI.sex interaction effects were observed for PPARγ protein levels (P = .0755; two-way ANOVA), a significant UPI effect was observed (P = .0332; two-way ANOVA). UPI increased overall placental PPARγ protein levels 10%, with a significant increase in male UPI placenta (P = .0130; LSD) compared to male control placenta (Fig. 4b–c). No significant UPI.sex interaction effect was observed for the proportion of Kmt5a promoter DNA associated with PPARγ protein. However, consistent with PPARγ increasing Kmt5a mRNA, a significant UPI effect was observed for the proportion of Kmt5a promoter DNA associated with PPARγ (P = .0182; two-way ANOVA) whereby UPI increased the overall proportion of Kmt5a promoter DNA associated with PPARγ protein by 99%, with a significant increase male UPI placenta (P = .0348; LSD) compared to male control placenta (Fig. 4d). We also assessed genome-wide levels of H4K20me, the epigenetic mark placed by KMT5A. A significant UPI effect was observed for levels of H4K20me (P < .0001; two-way ANOVA) whereby UPI increased overall H4K20me by 26%, with a significant increase in male UPI (P = .0015; LSD) and female UPI (P = .0048; LSD) relative to sex-matched controls (Fig. 4e).

Fig 4. Rat UPI and Control PPARγ Levels and Occupancy at Kmt5a Promoter.

Fig 4

Open in a new tab

(a) UPI did not alter Pparγ mRNA levels in either sex. (b) and (c) A significant UPI effect was observed for PPARγ protein levels (P = .0332; two-way ANOVA) whereby UPI increased PPARγ protein levels. (d) A significant UPI effect was observed for the proportion of Kmt5a promoter DNA associated with PPARγ (P = .0182; two-way ANOVA) whereby UPI increased the proportion of Kmt5a promoter DNA associated with PPARγ protein. (e) A significant UPI effect was observed for levels of H4K20me (P < .0001; two-way ANOVA) whereby UPI increased H4K20me. Results are shown for individual data points and lines are mean and standard deviation. *significant difference to sex-matched control group (p < 0.05).

To begin to understand the potential effects on downstream gene-specific targets of H4K20me, we examined mRNA levels of Slc27a2 (codes for FATP2), as well as H4K20me at both the promoter and gene body (exon 3) of Slc27a2.A significant UPI.sex interaction was observed for Slc27a2 mRNA levels (P = .0013; two-way ANOVA) whereby UPI increased Slc27a2 mRNA levels 67% in male placenta (P = .0003; t-test), but did not alter Slc27a2 mRNA levels female placenta (Fig. 5a). H4K20me was not different between groups at the Slc27a2 promoter (Fig. 5b). No significant UPI.sex interaction effects were observed for H4K20me at Slc27a2 exon 3 (P = .0885; two-way ANOVA). Overall, UPI increased H4K20me at Slc27a2 exon 3 by 29%, with a significant increase in H4K20me at Slc27a2 exon 3 in male UPI placenta (P = .0049; LSD) compared to male control placenta (Fig. 5c).

Fig 5. Rat UPI and Control Placental Slc27a2 mRNA and H4K20me on Slc27a2 gene.

Fig 5

Open in a new tab

(a) A significant UPI.sex interaction was observed for Slc27a2 mRNA levels (P = .0013; two-way ANOVA) whereby UPI increased Slc27a2 mRNA levels in male placenta. (b) H4K20me was not different between groups at the Slc27a2 promoter. (c) UPI increased H4K20me at Slc27a2 exon 3. Results are shown for individual data points and lines are mean and standard deviation. *significant difference to sex-matched control group (p < 0.05).

KMT5A in Human Placenta

KMT5A was detectable on both the maternal and fetal side of the human placenta (Fig. 6a), with apparent greater nuclear localization on the maternal side (purple in merged images). KMT5A mRNA and KMT5A protein were measurable in human placenta. Levels of KMT5A mRNA in female placenta were 17% higher than that of male placenta on the fetal side (P = .0112; t-test) (Fig. 6b). Similarly, levels of KMT5A protein (Fig. 6c–d) in female placenta were 245% higher than male placenta on the fetal side (P = .0135; t-test). Placental lipid droplet accumulation was also 177% higher in female placenta on the fetal side than male placenta on the fetal side (P = .0342; t-test) (Fig. 6e–f).

Fig 6. Human Placental KMT5A Localization and Expression.

Fig 6

Open in a new tab

(a) KMT5A is detectable in both the maternal decidua and fetal chorionic villi of the human placenta. (b) Levels of KMT5A mRNA in female placenta were higher that of male placenta on the fetal side. (c) and (d) KMT5A protein in female placenta was also higher than male placenta on the fetal side. (e) and (f) Placental lipid droplet accumulation was also higher in female placenta on the fetal side than male placenta on the fetal side. Results are shown for individual data points and lines are mean and standard deviation. *significant difference to sex-matched placental zone (p < 0.05).

DISCUSSION

Pregnancies complicated by placental insufficiency or FGR are associated with placental lipid accumulation and lower fetal fatty acid accretion, presenting a significant detriment to the growth and development of the fetus [8, 5, 37]. While lipid regulators such as PPARγ are thought to be involved, the mechanisms by which PPARγ influences placental lipid accumulation are not completely understood. In this study we show, for the first time, the presence and activity of the epigenetic modulator, KMT5A, in human and rat placenta. As a PPARγ target gene, and a histone methyltransferase known to regulate lipid accumulation, KMT5A is a potentially important mediator of placental lipid accumulation. In this study, we also demonstrate in the rat placenta that KMT5A expression and activity is upregulated in placental hypoxia, in association with increased lipid accumulation in placenta supporting male fetuses. Understanding the drivers of placental lipid accumulation in pregnancies complicated by hypoxia is an important step toward improving outcomes for FGR infants.

The bilateral uterine artery ligation model of UPI used in this study is well characterized. Rat pups are asymmetrically growth restricted at term, and approximately 25% smaller than control pups, with no variation in litter size [28, 38, 39]. Using the rat UPI model, our group has studied the sexually dimorphic outcomes of UPI in offspring adipose tissue, lung, and brain [40, 23, 30, 22, 41, 28]. In general, phenotypic outcomes are more severe in male UPI offspring, than in female UPI offspring early in life. The phenotypic effects occur in conjunction with differences in molecular tissue profiles between male and female offspring. Additionally, these outcomes occur in an environment of reduced fetal long chain fatty acid accretion [23]. This study is the first to examine the placenta from this model. We speculate that observed placental changes reflect adaptations driven by the fetus. The sexually dimorphic placental responses to UPI in our model, are consistent with effects being driven by the fetus.

Increased placental accumulation of lipid is observed in pathological pregnancies [8]. This increased lipid accumulation is potentially problematic to the fetus for two primary reasons. The first is that lipids accumulated in the placenta are no longer available to the growing fetus [7, 8]. This effect may be particularly detrimental to fetal growth late in gestation when 7g/day of fatty acid transport and 90 per cent of the fetal fat mass accretion occurs [42, 5]. The second adverse effect of placental lipid accumulation may be reduced fetal acquisition of long chain polyunsaturated fatty acids (LCPUFA). Evidence suggests that placental accumulation of LCPUFA influences the transfer rates of LCPUFA to the fetus [43, 3]. Indeed, infants who are small for gestational age are deficient in LCPUFA [44], increasing risk of morbidity [1]. Our data demonstrate that placental lipid accumulation occurs in the UPI rat placenta in association with reduced fetal weight at term, and reduced fetal LCPUFA acquisition [23], and is consistent with decreased placental efficiency. Further, we demonstrate that lipid droplet accumulation in placenta from uncomplicated human pregnancies has the greatest lipid accumulation in placenta supporting female fetuses, consistent with the idea that the female placenta may invest in accumulating greater reserves during pregnancy, leaving more FA for efflux to male fetuses [45]. Understanding the sexually-dimorphic effects of placental lipid handling is important in the context of growth and developmental programming where sex is a well-documented biological variable [46, 45].

In our study, we demonstrate the presence of KMT5A in both human and rat placenta. In uncomplicated human placenta KMT5A is present on both maternal and fetal sides of the placenta, with greatest mRNA and protein levels on the fetal side in placenta supporting female fetuses. Interestingly, the higher levels of KMT5A occurred concurrently with greater lipid accumulation. Similarly, in the rat placenta, KMT5A is detectable on both the maternal and fetal sides. Our molecular studies in the rat did not differentiate between placental zones. However, we observed an increased amount of Kmt5a mRNA in control female placenta compared to control male placenta. Sexually dimorphic placental responses to lipid regulation are not surprising given that placenta supporting male and female fetuses display differences in structure, function and adaptation, placental transcriptomes and DNA methylation profiles, and responses to LCPUFA supplementation [47–49]. Our data suggests KMT5A may play a central role.

Evidence of KMT5A involvement in lipid metabolism has recently become available [19, 21, 25]. In adipose tissue, KMT5A is upregulated by PPARγ and activates adipogenesis via the coordinated expression of adipogenic genes [19]. In cancer cell lines KMT5A also regulates the expression of lipid metabolism genes [25], and KMT5A-deficient mice have reduced expression of fatty acid metabolizing genes in the liver [21]. We previously demonstrated altered PPARγ-KMT5A signaling in the lung and brains of growth restricted rat pups from our UPI model in the context of altered LCPUFAs [23, 29]. The involvement of PPARγ in placental development and function has been comprehensively studied for decades [50, 11, 51]. Additionally, the involvement of PPARγ in placental lipid accumulation has also been investigated in human and animal models with normal pregnancies and pregnancies complicated by obesity, gestational diabetes, and pre-eclampsia [11, 9, 35, 52]. While much evidence exists to support a direct role for PPARγ in the accumulation of placental lipid droplets [21], inconsistent reports of PPARγ changes in pathologic pregnancies leaves the relationship between PPARγ and hypoxia induced lipid accumulation unclear [21, 53]. We speculate that KMT5A, in concert with PPARγ, provides additional sex-specific regulation of placental lipid droplet accumulation. Additional studies will be important in determining cause-and-effect relationships in which PPARγ-KMT5A influence placental lipid droplet accumulation.

A downstream mediator of lipid droplet accumulation is FATP2 (coded for by the SLC27A2 gene). Increased FATP2 has been identified in conditions associated with increased lipid droplet accumulation. In elegant experiments conducted in trophoblasts cultured over 72 hours, SLC27A2 expression correlated with uptake of the long-chain fatty acid analogue, BODIPY-C12, and blocking FATP2 function resulted in reduced BODIPY-C12 uptake [13]. In obese women, increased placental lipid accumulation correlates with FATP2 protein on the basal plasma membrane [54]. In the mouse placenta, Slc27a2 gene expression is upregulated by hypoxia [55]. In our study, SLC27a2 mRNA was upregulated in male placenta in association with increased KMT5A. While we have not demonstrated cause-and-effect relationship in this study, our findings of increased H4K20me in the body of the SLC27a2 gene, and not the promoter of the Slc27a2 gene, is consistent with the expected effects of KMT5A gene body placement of H4K20me enhancing expression of target genes [21].

Our study is not without limitations. The descriptive nature of our study requires that further work be done to determine the cause and effect relationship between PPARγ activation, KMT5A, and lipid droplet accumulation in the placenta. Additionally, genome-wide identification of KMT5A targets and H4K20me in the placenta under normal and hypoxic conditions is also needed. Identification of suites of KMT5A target genes activated under normal and pathologic conditions will help elucidate whether placental lipid droplet accumulation is a cause or symptom of impaired placental lipid metabolism or export. Our rat model studies utilized whole placental homogenate, thus we are unable to assess contributions of KMT5A in different placental zones. Subsequent studies will require separated placenta so as to understand regional effects of KMT5A. We also have not examined the origins of the sexually-dimorphic effects observed in our study. While we were powered to examine male and female rat placenta/fetuses separately, we did not examine potential drivers of sexually-dimorphic effects. Understanding the drivers of sexually-dimorphic effects will be necessary moving forward.

In conclusion, we demonstrated for the first time that KMT5A is present in the human and rat placenta, and that in the rat UPI with hypoxia upregulates the PPARγ-KMT5A axis and lipid droplet accumulation in placenta supporting male pups. Ongoing studies are identifying cause-and-effect relationships between the PPARγ-KMT5A axis, lipid accumulation and genome-wide downstream targets.

Acknowledgments:

This study was supported in part through National Institutes of Health (NIH) DK084036 (LJM) and NIH/NIGMS: 2P20GM103620-06, Sanford Research Experience for Undergraduates (SPUR) NSF REU:1756912 (MLB), and the Division of Neonatology, Department of Pediatrics at the University of Utah.

Footnotes

Conflicts of interest/Competing interests: On behalf of all authors, the corresponding author states that there is no conflict of interest.

Ethics approval (include appropriate approvals or waivers): All animal procedures were approved by the University of Utah Animal Care and Use Committee under protocol 18-06003 (Joss-Moore, PI). Placenta was collected under IRB approved protocol STUDY00000571 at Sanford Health in accordance with local and federal Protection of Human Subjects law 45 CFR 46 and the Health Insurance Portability and Accountability Act (HIPAA).

Consent to participate (include appropriate statements): All maternal donors consented to participate and gave HIPPA authorization for data collection and use in research.

REFERENCES

  • 1.Harris WS, Baack ML. Beyond building better brains: bridging the docosahexaenoic acid (DHA) gap of prematurity. J Perinatol. 2015;35(1):1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Hanebutt FL, Demmelmair H, Schiessl B, Larque E, Koletzko B. Long-chain polyunsaturated fatty acid (LC-PUFA) transfer across the placenta. Clin Nutr. 2008;27(5):685–93. [DOI] [PubMed] [Google Scholar]
  • 3.Kolahi KS, Valent AM, Thornburg KL. Cytotrophoblast, Not Syncytiotrophoblast, Dominates Glycolysis and Oxidative Phosphorylation in Human Term Placenta. Scientific reports. 2017;7:42941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Larque E, Pagan A, Prieto MT, Blanco JE, Gil-Sanchez A, Zornoza-Moreno M et al. Placental fatty acid transfer: a key factor in fetal growth. Annals of nutrition & metabolism. 2014;64(3–4):247–53. [DOI] [PubMed] [Google Scholar]
  • 5.Duttaroy AK. Transport of fatty acids across the human placenta: a review. Prog Lipid Res. 2009;48(1):52–61. [DOI] [PubMed] [Google Scholar]
  • 6.Jarc E, Petan T. Lipid Droplets and the Management of Cellular Stress. Yale J Biol Med. 2019;92(3):435–52. eCollection 2019 Sep. [PMC free article] [PubMed] [Google Scholar]
  • 7.Bildirici I, Schaiff WT, Chen B, Morizane M, Oh SY, O’Brien M et al. PLIN2 Is Essential for Trophoblastic Lipid Droplet Accumulation and Cell Survival During Hypoxia. Endocrinology. 2018;159(12):3937–49. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Chassen SS, Ferchaud-Roucher V, Gupta MB, Jansson T, Powell TL. Alterations in placental long chain polyunsaturated fatty acid metabolism in human intrauterine growth restriction. Clinical science (London, England : 1979). 2018;132(5):595–607. [DOI] [PubMed] [Google Scholar]
  • 9.Calabuig-Navarro V, Haghiac M, Minium J, Glazebrook P, Ranasinghe GC, Hoppel C et al. Effect of Maternal Obesity on Placental Lipid Metabolism. Endocrinology. 2017;158(8):2543–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Barak Y, Nelson MC, Ong ES, Jones YZ, Ruiz-Lozano P, Chien KR et al. PPAR gamma is required for placental, cardiac, and adipose tissue development. Molecular cell. 1999;4(4):585–95. [DOI] [PubMed] [Google Scholar]
  • 11.Schaiff WT, Knapp FF Jr., Barak Y, Biron-Shental T, Nelson DM, Sadovsky Y. Ligand-activated peroxisome proliferator activated receptor gamma alters placental morphology and placental fatty acid uptake in mice. Endocrinology. 2007;148(8):3625–34. [DOI] [PubMed] [Google Scholar]
  • 12.Pham J, Arul Nambi Rajan K, Li P, Parast MM. The role of Sirtuin1-PPARgamma axis in placental development and function. Journal of molecular endocrinology. 2018;60(4):R201–R12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Kolahi K, Louey S, Varlamov O, Thornburg K. Real-Time Tracking of BODIPY-C12 Long-Chain Fatty Acid in Human Term Placenta Reveals Unique Lipid Dynamics in Cytotrophoblast Cells. PLoS One. 2016;11(4):e0153522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Schaiff WT, Bildirici I, Cheong M, Chern PL, Nelson DM, Sadovsky Y. Peroxisome proliferator-activated receptor-gamma and retinoid X receptor signaling regulate fatty acid uptake by primary human placental trophoblasts. J Clin Endocrinol Metab. 2005;90(7):4267–75. [DOI] [PubMed] [Google Scholar]
  • 15.Berger J, Moller DE. The mechanisms of action of PPARs. Annu Rev Med. 2002;53:409–35. [DOI] [PubMed] [Google Scholar]
  • 16.Frohnert BI, Hui TY, Bernlohr DA. Identification of a functional peroxisome proliferator-responsive element in the murine fatty acid transport protein gene. J Biol Chem. 1999;274(7):3970–7. [DOI] [PubMed] [Google Scholar]
  • 17.Tachibana K, Kobayashi Y, Tanaka T, Tagami M, Sugiyama A, Katayama T et al. Gene expression profiling of potential peroxisome proliferator-activated receptor (PPAR) target genes in human hepatoblastoma cell lines inducibly expressing different PPAR isoforms. Nucl Recept. 2005;3:3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Tontonoz P, Graves RA, Budavari AI, Erdjument-Bromage H, Lui M, Hu E et al. Adipocyte-specific transcription factor ARF6 is a heterodimeric complex of two nuclear hormone receptors, PPAR gamma and RXR alpha. Nucleic Acids Res. 1994;22(25):5628–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Wakabayashi K, Okamura M, Tsutsumi S, Nishikawa NS, Tanaka T, Sakakibara I et al. The peroxisome proliferator-activated receptor gamma/retinoid X receptor alpha heterodimer targets the histone modification enzyme PR-Set7/Setd8 gene and regulates adipogenesis through a positive feedback loop. Molecular and cellular biology. 2009;29(13):3544–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Milite C, Feoli A, Viviano M, Rescigno D, Cianciulli A, Balzano AL et al. The emerging role of lysine methyltransferase SETD8 in human diseases. Clin Epigenetics. 2016;8:102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Nikolaou KC, Moulos P, Harokopos V, Chalepakis G, Talianidis I. Kmt5a Controls Hepatic Metabolic Pathways by Facilitating RNA Pol II Release from Promoter-Proximal Regions. Cell Rep. 2017;20(4):909–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Ke X, Xing B, Yu B, Yu X, Majnik A, Cohen S et al. IUGR disrupts the PPARgamma-Setd8-H4K20me and Wnt signaling pathways in the juvenile rat hippocampus. International journal of developmental neuroscience : the official journal of the International Society for Developmental Neuroscience. 2014;38c:59–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Joss-Moore LA, Wang Y, Baack ML, Yao J, Norris AW, Yu X et al. IUGR decreases PPARgamma and SETD8 Expression in neonatal rat lung and these effects are ameliorated by maternal DHA supplementation. Early Hum Dev. 2010;86(12):785–91. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Okamura M, Inagaki T, Tanaka T, Sakai J. Role of histone methylation and demethylation in adipogenesis and obesity. Organogenesis. 2010;6(1):24–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Liao T, Wang YJ, Hu JQ, Wang Y, Han LT, Ma B et al. Histone methyltransferase KMT5A gene modulates oncogenesis and lipid metabolism of papillary thyroid cancer in vitro. Oncol Rep. 2018;39(5):2185–92. [DOI] [PubMed] [Google Scholar]
  • 26.Falcon A, Doege H, Fluitt A, Tsang B, Watson N, Kay MA et al. FATP2 is a hepatic fatty acid transporter and peroxisomal very long-chain acyl-CoA synthetase. Am J Physiol Endocrinol Metab. 2010;299(3):E384–93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Krammer J, Digel M, Ehehalt F, Stremmel W, Fullekrug J, Ehehalt R. Overexpression of CD36 and acyl-CoA synthetases FATP2, FATP4 and ACSL1 increases fatty acid uptake in human hepatoma cells. International journal of medical sciences. 2011;8(7):599–614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Joss-Moore LA, Wang Y, Campbell MS, Moore B, Yu X, Callaway CW et al. Uteroplacental insufficiency increases visceral adiposity and visceral adipose PPARgamma2 expression in male rat offspring prior to the onset of obesity. Early Hum Dev. 2010;86(3):179–85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Ke X, Lei Q, James SJ, Kelleher SL, Melnyk S, Jernigan S et al. Uteroplacental insufficiency affects epigenetic determinants of chromatin structure in brains of neonatal and juvenile IUGR rats. Physiol Genomics. 2006;25(1):16–28. [DOI] [PubMed] [Google Scholar]
  • 30.Joss-Moore LA, Wang Y, Ogata EM, Sainz AJ, Yu X, Callaway CW et al. IUGR differentially alters MeCP2 expression and H3K9Me3 of the PPARgamma gene in male and female rat lungs during alveolarization. Birth Defects Res A Clin Mol Teratol. 2011;91(8):672–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Nerurkar PV, Lee YK, Nerurkar VR. Momordica charantia (bitter melon) inhibits primary human adipocyte differentiation by modulating adipogenic genes. BMC Complement Altern Med. 2010;10:34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Weinheimer C, Wang H, Comstock JM, Singh P, Wang Z, Locklear BA et al. Maternal Tobacco Smoke Exposure Causes Sex-Divergent Changes in Placental Lipid Metabolism in the Rat. Reproductive sciences (Thousand Oaks, Calif). 2020;27(2):631–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Bagley HN, Wang Y, Campbell MS, Yu X, Lane RH, Joss-Moore LA. Maternal docosahexaenoic acid increases adiponectin and normalizes IUGR-induced changes in rat adipose deposition. Journal of obesity. 2013;2013:312153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Joss-Moore L, Carroll T, Yang Y, Fitzhugh M, Metcalfe D, Oman J et al. Intrauterine growth restriction transiently delays alveolar formation and disrupts retinoic acid receptor expression in the lung of female rat pups. Pediatr Res. 2013;73(5):612–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Louwagie EJ, Larsen TD, Wachal AL, Baack ML. Placental lipid processing in response to a maternal high-fat diet and diabetes in rats. Pediatr Res. 2018;83(3):712–22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Joss-Moore LA, Hagen-Lillevik SJ, Yost C, Jewell J, Wilkinson RD, Bowen S et al. Alveolar formation is dysregulated by restricted nutrition but not excess sedation in preterm lambs managed by noninvasive support. Pediatr Res. 2016;80(5):719–28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Haggarty P Fatty acid supply to the human fetus. Ann. review of nutrition 2010;30:237–55. [DOI] [PubMed] [Google Scholar]
  • 38.Ogata ES, Bussey ME, LaBarbera A, Finley S. Altered growth, hypoglycemia, hypoalaninemia, and ketonemia in the young rat: postnatal consequences of intrauterine growth retardation. Pediatr Res. 1985;19(1):32–7. [DOI] [PubMed] [Google Scholar]
  • 39.Simmons RA, Templeton LJ, Gertz SJ. Intrauterine growth retardation leads to the development of type 2 diabetes in the rat. Diabetes. 2001;50(10):2279–86. [DOI] [PubMed] [Google Scholar]
  • 40.Numpang B, Ke X, Yu X, Callaway C, McKnight R, Joss-Moore L et al. Fetal growth restriction alters hippocampal 17-beta estradiol and estrogen receptor alpha levels in the newborn male rat. Systems biology in reproductive medicine. 2013;59(4):184–90. [DOI] [PubMed] [Google Scholar]
  • 41.Zinkhan EK, Fu Q, Wang Y, Yu X, Callaway CW, Segar JL et al. Maternal Hyperglycemia Disrupts Histone 3 Lysine 36 Trimethylation of the IGF-1 Gene. J Nutr Metab. 2012;2012:930364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kuipers RS, Luxwolda MF, Offringa PJ, Boersma ER, Dijck-Brouwer DA, Muskiet FA. Fetal intrauterine whole body linoleic, arachidonic and docosahexaenoic acid contents and accretion rates. Prostaglandins Leukot Essent Fatty Acids. 2012;86(1–2):13–20. [DOI] [PubMed] [Google Scholar]
  • 43.Haggarty P, Page K, Abramovich DR, Ashton J, Brown D. Long-chain polyunsaturated fatty acid transport across the perfused human placenta. Placenta. 1997;18(8):635–42. [DOI] [PubMed] [Google Scholar]
  • 44.Agostoni C, Marangoni F, Stival G, Gatelli I, Pinto F, Rise P et al. Whole blood fatty acid composition differs in term versus mildly preterm infants: small versus matched appropriate for gestational age. Pediatr Res. 2008;64(3):298–302. [DOI] [PubMed] [Google Scholar]
  • 45.Myatt L, Thornburg KL. Effects of Prenatal Nutrition and the Role of the Placenta in Health and Disease. Methods Mol Biol. 2018;1735:19–46. [DOI] [PubMed] [Google Scholar]
  • 46.Dearden L, Bouret SG, Ozanne SE. Sex and gender differences in developmental programming of metabolism. Mol Metab. 2018;15:8–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Rosenfeld CS. Sex-Specific Placental Responses in Fetal Development. Endocrinology. 2015;156(10):3422–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Chen PY, Ganguly A, Rubbi L, Orozco LD, Morselli M, Ashraf D et al. Intrauterine calorie restriction affects placental DNA methylation and gene expression. Physiol Genomics. 2013;45(14):565–76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Sedlmeier EM, Brunner S, Much D, Pagel P, Ulbrich SE, Meyer HH et al. Human placental transcriptome shows sexually dimorphic gene expression and responsiveness to maternal dietary n-3 long-chain polyunsaturated fatty acid intervention during pregnancy. BMC genomics. 2014;15:941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Barak Y, Sadovsky Y, Shalom-Barak T. PPAR Signaling in Placental Development and Function. PPAR Res. 2008;2008:142082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Schaiff WT, Barak Y, Sadovsky Y. The pleiotropic function of PPAR gamma in the placenta. Mol Cell Endocrinol. 2006;249(1–2):10–5. [DOI] [PubMed] [Google Scholar]
  • 52.Meher AP, Wadhwani N, Randhir K, Mehendale S, Wagh G, Joshi SR. Placental DHA and mRNA levels of PPARgamma and LXRalpha and their relationship to birth weight. Journal of clinical lipidology. 2016;10(4):767–74. [DOI] [PubMed] [Google Scholar]
  • 53.Chassen S, Jansson T. Complex, coordinated and highly regulated changes in placental signaling and nutrient transport capacity in IUGR. Biochimica et biophysica acta Molecular basis of disease. 2020;1866(2):165373. doi: 10.1016/j.bbadis.2018.12.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Lager S, Ramirez VI, Gaccioli F, Jang B, Jansson T, Powell TL. Protein expression of fatty acid transporter 2 is polarized to the trophoblast basal plasma membrane and increased in placentas from overweight/obese women. Placenta. 2016;40:60–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Mishima T, Miner JH, Morizane M, Stahl A, Sadovsky Y. The expression and function of fatty acid transport protein-2 and −4 in the murine placenta. PLoS One. 2011;6(10):e25865. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES