Table 3.
List of hybrid duplex RNAs potentially formed with one strand from the human transcriptome and the other from MERS-CoV. The table shows the start position of the sequence in the RNA virus, the DNA sequence encoding the human RNA and the corresponding features in humans. The numbers in the column ‘Human target’ are specified using the format x(y), where x and y are the numbers of known and predicted transcripts, respectively.
| Start pos. in virus | Human sequence forming hybrid duplex RNA |
Length | Human target |
|---|---|---|---|
| 9467 | CAGCAGCAACAACAGCAATT | 20 | 1(27) mRNAs, 0(1) miscRNA of KMT2C |
| 15455 | TGCAGTGGTGGCATCTCCGCT | 21 | 2(0) mRNAs of CDC42 |
| 21230 | TTAATAGTACCCAAGTAATT | 20 | 1 mRNA of ARIH1 |
| 22581 | TCAACACCTTCAGCCTGTTC | 20 | 2(5) mRNAs, 0(10) miscRNAs of ANO9 |
| 23098 | AAGCCAGCCACCACCTTCAA | 20 | 6(12) mRNAs of KCNMA1 |
| 25583 | TTTGAGGATGCAGTGACCAA | 20 | 0(2) mRNAs, 1 ncRNA of THBS3 |