Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2021 Jun 23.
Published in final edited form as: Toxicology. 2021 Mar 4;454:152744. doi: 10.1016/j.tox.2021.152744

Effect of exposure to 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and polychlorinated biphenyls (PCBs) on mitochondrial DNA (mtDNA) copy number in rats

Samantha L VanEtten a,1, Matthew R Bonner b, Xuefeng Ren b, Linda S Birnbaum c, Paul J Kostyniak a,d, Jie Wang e, James R Olson a,b,*
PMCID: PMC8220889  NIHMSID: NIHMS1696641  PMID: 33677009

Abstract

Mitochondria are intracellular organelles responsible for biological oxidation and energy production. These organelles are susceptible to damage from oxidative stress and compensate for damage by increasing the number of copies of their own genome, mitochondrial DNA (mtDNA). Cancer and environmental exposure to some pollutants have also been associated with altered mtDNA copy number. Since exposures to polychlorinated biphenyls (PCBs) and 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) have been shown to increase oxidative stress, we hypothesize that mtDNA copy number will be altered with exposure to these compounds. mtDNA copy number was measured in DNA from archived frozen liver and lung specimens from the National Toxicology Program (NTP) study of female Harlan Sprague Dawley rats exposed to TCDD (3, 10, or 100 ng/kg/day), dioxin-like (DL) PCB 126 (10, 100, or 1000 ng/kg/day), non-DL PCB 153 (10, 100, or 1000 μg/kg/day), and PCB 126 + PCB 153 (10 ng/kg/day + 10 μg/kg/day, 100 ng/kg/day + 100 μg/kg/day, or 1000 ng/kg/day + 1000 μg/kg/day, respectively) for 13 and 52 weeks. An increase in mtDNA copy number was observed in the liver and lung of rats exposed to TCDD and the lung of rats exposed to the mixture of PCB 126 and PCB 153. A statistically significant positive dose-dependent trend was also observed in the lung of rats exposed to PCB 126 and a mixture of PCB 153 and PCB 126, although in neither case was the control copy number significantly exceeded at any dose level. These exposures produced a range of pathological responses in these organs in the two-year NTP studies. Conversely, there was a significant decrease or no change in mtDNA copy number in the liver and lung of rats exposed to non-DL PCB 153. This is consistent with a general lack of PCB 153 mediated liver or lung injury in the NTP study, with the exception of liver hypertrophy. Together, the results suggest that an increase in mtDNA copy number may serve as a sensitive, early biomarker of mitochondrial injury and oxidative stress that contributes to the development of the toxicity of dioxin-like compounds.

Keywords: Polychlorinated biphenyls, Mitochondrial DNA copy number, Rat, TCDD, Mitochondria

1. Introduction

PCBs continue to be wide-spread global contaminants regularly detected in humans even though commercial production of the compounds ended in 1977 in the U.S. due to environmental and human health concerns (Centers for Disease Control and Prevention, 2019; NTP, 2006b). These compounds persist in the environment, wildlife, and humans due to their stability and resistance to environmental and biological degradation (NTP, 2006b; Patterson et al., 2009). Although PCBs are no longer produced, these compounds continue to be released into the environment during the use and disposal of products containing PCBs or as unintentionally produced PCBs from organic chemical manufacturing and other processes (NTP, 2006c; Song et al., 2018). PCB exposure in humans and laboratory animals is associated with a variety of adverse health effects including cancer, diabetes, cardiovascular disease, liver injury, chloracne, and thyroid dysfunction, as well as impaired immune and reproductive systems and developmental, neurological, and neurobehavioral effects (ATSDR, 2000, 2011; EPA, 2019; IARC, 2015; Mrema et al., 2013; Ng et al., 2010; Perkins et al., 2016; Ruzzin et al., 2012; Silverstone et al., 2012; WHO, 2003). The International Agency for Research on Cancer (IARC) classified PCBs as a Group 1, known human carcinogen, after completing a comprehensive review of human and animal carcinogenicity data and mechanistic data related to PCBs (Lauby-Secretan et al., 2016).

The mechanisms through which PCBs cause toxicity have not been fully determined; however, dioxin-like (DL) PCBs, such as 3,3’,4,4’,5-pentachlorobiphenyl (PCB 126), have been shown to bind to the aryl hydrocarbon receptor (AhR), altering gene expression which may contribute to carcinogenesis (National Research Council, 2006). Non-dioxin-like PCBs, such as 2,2’,4,4’,5,5’-hexachlorobiphenyl (PCB 153), do not bind to the AhR, but instead activate the human pregnane-X receptor (PXR) and/or constitutive androstane receptor (CAR) and induce cytochrome P450 2B (CYP2B) and alter the expression of other genes (Al-Salman and Plant, 2012; Gahrs et al., 2013; Negishi, 2017). Non-DL PCBs may also activate the ryanodine receptors (RyRs) resulting in increased cellular calcium levels that may contribute to the neurological and endocrine toxicity seen following PCB exposure (Pessah et al., 2006; Simon et al., 2007). Previously, using liver tissue from these NTP studies, a large number of genes were up- and down-regulated in rats exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and DL PCBs, including induction of cytochrome P-450 1A1 (CYP1A1) (Ovando et al., 2010, 2006; Vezina et al., 2004). Other studies have suggested that TCDD and PCB exposure increases oxidative stress and may play a role in producing some adverse health effects associated with these compounds (Gao et al., 2017; Kumar et al., 2014; Liu et al., 2012; Mutlu et al., 2016).

Mitochondria are intracellular organelles that contain their own genome and are responsible for supplying ATP in eukaryotic cells (Lee and Wei, 2000). Aerobic metabolism within mitochondria generates reactive oxygen species (ROS) as by-products of the process. This causes mitochondria to be an immediate target of ROS, in addition to being a main intracellular source (Lee and Wei, 2005). Mitochondrial DNA (mtDNA) is highly susceptible to damage related to oxidative stress, which can cause alterations in mtDNA copy number (Liu et al., 2003). The copy number of mtDNA does vary depending on cell type (Moraes, 2001); however, mitochondria can synthesize more copies of its genome in response to damage or as a feedback mechanism that compensates for dysfunctional mitochondria (Ames et al., 1995; Lee and Wei, 2005). Alterations in mtDNA copy number have been associated with disease (Clay Montier et al., 2009) and have been observed in pre-neoplastic lesions (Ding et al., 2010; Mambo et al., 2005) and tumors in humans (Chang et al., 2009; Lin et al., 2008). Increased risk for colorectal cancer (Huang et al., 2014), renal cell carcinoma (Xing et al., 2008), type 2 diabetes (Choi et al., 2001; Rolo and Palmeira, 2006), and liver disease (Morten et al., 2007) have been associated with low mtDNA copy number. Higher mtDNA copy number has been associated with increased risk of several cancers, including non-Hodgkin’s lymphoma (Hosnijeh et al., 2014; Kim et al., 2015), lung (Bonner et al., 2009; Hosgood et al., 2010), breast (Lemnrau et al., 2015; Thyagarajan et al., 2013), and prostate cancer (Zhou et al., 2014).

Oxidative stress and mitochondrial injury may contribute to pathways leading to the etiology of diseases associated with exposure to PCBs, such as diabetes (Lim et al., 2010; Silverstone et al., 2012), and cancer (IARC, 2015; Ng et al., 2010; Penta et al., 2001; WHO, 2003). A population based study (Kumar et al., 2014) and an in vitro study (Liu et al., 2012) suggested that increased oxidative stress may play a role in producing adverse health effects associated with PCB exposure. In addition, increased formation of oxidative hepatic DNA adducts was observed in rats exposed to TCDD and PCBs (Gao et al., 2017; Mutlu et al., 2016). Since exposure to PCBs and TCDD has been shown to increase oxidative stress, we hypothesize that exposure to these compounds will produce mitochondrial injury and resulting alterations in mtDNA copy number. While several in vitro studies have shown that PCBs and TCDD can impact mitochondrial function (Chen et al., 2010; Aly, 2013; Shen et al., 2011), there are apparently no experimental animal studies that have investigated the relationship between mtDNA copy number and exposure to PCBs or TCDD.

This study was conducted to determine the association between exposures to TCDD and representative PCBs and mtDNA copy number in a unique set of rat liver and lung tissue samples obtained from earlier studies conducted by the National Toxicology Program (NTP) (NTP, 2006a, b, c, d). This research provides data necessary to establish whether mitochondria are targets of TCDD and PCB toxicity and if mtDNA copy number may be a molecular biomarker related to the toxicity of these persistent environmental contaminants.

2. Materials and methods

2.1. Animal exposure and tissue procurement

The National Toxicology Program completed two-year toxicology and carcinogenesis studies that investigated the relative potencies of TCDD, PCB 126, PCB 153, and a binary mixture of PCB 126 and PCB 153 (NTP, 2006a, b, c, d). The studies involved exposing female Harlan Sprague Dawley rats via oral gavage five days per week to TCDD (TEF = 1.0) at 3, 10, or 100 ng/kg/day, and PCB 126 (TEF = 0.1) at 10, 100, or 1000 ng/kg/day, PCB 153 (TEF = 0.0) at 10, 100, or 1000 μg/kg/day, and the binary mixture of PCB 126 and PCB 153 (10 ng/kg/day + 10 μg/kg/day, 100 ng/kg/day + 100 μg/kg/day, or 1000 ng/kg/day + 1000 μg/kg/day, respectively) or corn oil: acetone (99:1; vehicle control). The doses used during the NTP studies were based on World Health Organization TEF recommendations for toxicological equivalence (Van den Berg et al., 2006), while the doses of the binary mixture of PCB 126 and PCB 153 were chosen to reflect the environmentally relevant 1:1, 000 ratio of these congeners (NTP, 2006d). All studies were conducted by Battelle (Columbus, OH), where they followed NIH guidelines for housing and maintained the rats on NTP-2000 diet, as described in the NTP technical reports (NTP, 2006a, b, c, d). Following 13, 30, or 52 weeks of exposure, subgroups of rats were sacrificed. The liver and lung tissues were removed, flash frozen in liquid nitrogen, and stored at −80 °C for future mechanistic studies. Following completion of each incremental sacrifice, liver and lung tissues from these subgroups were shipped on dry ice from Battelle (Columbus, OH) to J. Olson’s lab at the University at Buffalo, where they have been maintained at −80 °C.

2.2. DNA isolation

DNA was previously isolated from all available frozen liver (n = 4–6) and lung (n = 3–7) tissues of rats exposed to the vehicle control, TCDD, PCB 126, PCB 153, or a mixture of PCB 126 and PCB 153 for 13 and 52 weeks. DNA was isolated from the lung tissues of rats exposed to TCDD for 30 weeks since 13-week samples were not available. Frozen tissue specimens were not available following 104 weeks of exposure. The DNA was isolated using Qiagen Blood & Cell Culture DNA Mini Kits (Qiagen Inc., Valencia, CA), following the manufacturer’s protocol. The quality and concentration of the isolated DNA were measured using a NanoDrop 2000c Spectrophotometer (Thermo Fisher Scientific, Waltham, MA). The 260/280 spectral ratios of the samples were between 1.80 and 1.89, with a 260/280 ratio of 1.8–1.9 considered to be pure DNA.

2.3. mtDNA copy number analysis

The qPCR method utilized was adapted from Rooney et al. (2015). The target sequences of the qPCR are from mitochondrial ND1 and nuclear beta-globin genes. The sequences for the primers and probes were determined using the Primer-BLAST™ tool from the National Center for Biotechnology Information (https://www.ncbi.nlm.nih.gov/tools/primer-blast/). The primers and probes were obtained from Integrated DNA Technologies (Coralville, Iowa) with the following sequences: ND1 fwd, CAAAGGCCCCAACATCGTAG; ND1 rev, GGTTGA-TAAGGGGGTGAGGT; ND1 probe, TCGCCCCAACCCTCTCCCTT; beta-globin fwd, GATATAAAGCTGTTGGGACATGC; beta-globin rev, CAGGGAAGGTTGTCCACAGA; beta-globin probe, AGGCATTCAGTTGGACTTCGTGCA. DNA isolated from the NTP rat liver and lung tissues was diluted to a concentration of 5 ng/μL to conduct the analysis. Each PCR reaction was run in triplicate and contained 7 μL of gDNA in a total volume of 20 μL using 1 x PrimeTime® Gene Expression Master Mix (Integrated DNA Technologies) on a CFX Connect Real Time PCR Detection System (Bio-Rad). The final concentrations for the primers and probes were 300 nM and 150 nM, respectively. The thermal cycling parameters were: 1 cycle at 95 °C for 3 min followed by 35 cycles of 95 ◦C for 15 s then 58 °C for 30 s and 72 °C for 1 min. Each plate contained the time-matched vehicle control samples that corresponded to the treated samples being measured. Samples of DNA from each tissue sample were analyzed in triplicate on each plate, which also contained a serial dilution of gBlocks® gene fragments for the mitochondrial ND1 and nuclear beta globin genes from Integrated DNA Technologies (Coralville, Iowa).

The number of mitochondrial gene copies and nuclear gene copies were calculated using the serial dilution of the gBlocks® gene fragments which have known copy numbers. The mitochondrial copy number was then normalized to the nuclear gene copy number using the standard curve method as described in Current Protocols in Molecular Biology (Bookout et al., 2006). An analysis of variance followed by a Tukey’s post-hoc test was completed to determine if there were statistically significant differences between the various exposure groups. A Levene test assessed the homogeneity of variance among the comparison groups and confirmed that the data were normally distributed. The Jonckheere-Terpstra trend test was also used to determine if there were statistically significant trends in the dose-response relationships. Statistical analyses were completed using SPSS version 25 (IBM Corp. Released 2017. IBM SPSS Statistics for Windows, Version 25.0. Armonk, NY: IBM Corp.), with a p < 0.05 being considered statistically significant.

2.4. RNA isolation and hybridization

Processing of liver samples was previously described by Vezina et al. (2004). Briefly, the liver tissues were disrupted by homogenization and total RNA was isolated using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA). An Agilent Bioanalyzer 2100 (Agilent Technologies, Palo Alto, CA) was used to assess the integrity of the RNA. A total of six rats and three pools of RNA were created from each exposure group (n = 2 rats per pool). The Roswell Park Cancer Institute Gene Expression Facility (Buffalo, NY) transformed the high-quality RNA into biotinylated cRNA, which was then hybridized to RGU34A GeneChips (Affymetrix, Santa Clara, CA) and scanned using an Affymetrix 428 scanner.

2.5. Gene microarray data analysis

The microarray analysis was performed by several Bioconductor packages based on the workflow package maEndToEnd (v2.8.0), including the use of data import, preprocessing, differential expression, and enrichment analysis functions (Klaus and Reisenauer, 2020). Raw cell intensity (.CEL) files were imported in the software and before checking for outlier samples in the raw data as part of a quality control check. To see if the data clustered together as expected, principal component analysis (PCA) was performed. All of the samples in our data passed the quality control step. The robust multi-array average (RMA) algorithm was then applied to the samples for background correction and normalization. Genes with lower expression were filtered out if the expression level of the genes was below 4 in more than 3 of all of the GeneChips. The differential expression analysis among groups was completed using the limma package, which fits a linear model to the expression data for each gene. The moderated t-statistics were computed by empirical Bayes moderation method using limma package and significantly differentially expressed genes were selected based on a false discovery rate (FDR) adjusted p-value of < 0.05. The topGO package was used for Gene Ontology (GO) enrichment analysis for the differentially expressed genes in the exposure groups relative to the control group. Gene expression data from n = 3 GeneChips in each exposure group were averaged, and changes in gene expression were calculated as the average log2 fold change versus gene expression in the respective vehicle-treated control group (n = 3 GeneChips). A summary of the gene microarray data is available through the Gene Expression Omnibus at the National Center for Biotechnology Information at http://www.ncbi.nlm.nih.gov/geo as accession number GSE5789. The Rat Genome Database (http://rgd.mcw.edu) was used to determine possible genes related to mitochondria and mitochondrial DNA. Genes were selected if their gene ontology was related to mitochondrial DNA. FDR adjusted p values were used to determine if the difference in expression was statistically significant, with an adjusted p value of < 0.05 being considered significant. Gene regulatory regions spanning 5000 bp above and 1000 bp below the transcriptional start site of genes related to mitochondrial DNA were also analyzed for the core xenobiotic response element (XRE) sequence (5′-GCGTG-3′) to identify genes potentially under AhR regulation.

3. Results

To assess the impact of TCDD and PCB exposure on mitochondrial copy number, each treatment group contains the respective time matched vehicle control group. Fig. 1 shows the effect of TCDD on mtDNA copy number in rat liver and lung tissues. Following 13 weeks of exposure to the middle and high dose of TCDD, there were significant increases in the number of mitochondrial gene copies seen in the liver tissues of the rats. This is consistent with the lung tissue which showed significant increases in mtDNA copy number following 30 weeks of TCDD exposure at the middle and high doses. There was also a significant increase in mtDNA copy number in the lungs of rats exposed to the highest dose of TCDD for 52 weeks. Statistically significant positive dose-dependent trends were observed in the liver of rats exposed to TCDD for 13 weeks and in the lung of rats exposed to TCDD for 30 and 52 weeks.

Fig. 1.

Fig. 1.

Open in a new tab

Effect of TCDD on mtDNA copy number in rat liver (A, n = 4–6) and lung (B, n = 3–6). The number of mitochondrial gene copies was normalized to the number of nuclear gene copies and expressed as the mean ± SD of each group (* = p < 0.05, ** = p < 0.01). Statistically significant positive dose-dependent trends were also observed in the liver of rats exposed for 13 weeks and in the lung of rats exposed for 30 and 52 weeks.

The liver of rats exposed to PCB 126 did not show any significant changes in mtDNA copy number, though several groups did show trends towards an increase following exposure, including the low dose group at 13 weeks (p = 0.10) (Fig. 2). Rats exposed to PCB 126 at the low dose for 13 and 52 weeks showed significant decreases in mtDNA copy number in the lung tissues compared to the control animals. However, after 52 weeks of exposure to PCB 126 there were significant increases in lung mtDNA copy number in the mid and high dose groups compared to the low dose. A statistically significant positive dose-dependent trend was observed in the lung of rats exposed to PCB 126 for 52 weeks, although the control copy number was not significantly exceeded at any dose level. The effect of exposure to PCB 153 is shown in Fig. 3. A significant decrease in liver mtDNA copy number was seen in the high dose at 13 weeks. 52 weeks of exposure to PCB 153 resulted in significantly decreased lung mtDNA copy number at the low and mid doses. The high dose at 52 weeks also showed a decrease in lung mtDNA copy number which approached statistical significance (p = 0.087). Exposure to the binary mixture of PCB 126 and PCB 153 for 52 weeks produced increases in liver mtDNA copy number at the low and mid doses relative to the time matched vehicle control (Fig. 4). The mid dose was statistically significant, with the low dose being close to reaching significance (p = 0.058). In contrast, exposure to the high dose of the binary mixture for 52 weeks significantly decreased the hepatic mtDNA copy number. Although there were no statistically significant changes seen in the lung mtDNA copy number following 13 or 52 weeks of exposure to the PCB 126 and PCB 153 mixture, there was a statistically significant positive dose-dependent trend in the lung mtDNA copy number in rats exposed to the mixture for 52 weeks.

Fig. 2.

Fig. 2.

Open in a new tab

Effect of PCB 126 on mtDNA copy number in rat liver (A, n = 5–7) and lung (B, n = 5–7). The number of mitochondrial gene copies was normalized to the number of nuclear gene copies and expressed as the mean ± SD of each group (* = p < 0.05, ** = p < 0.01). A statistically significant positive dose-dependent trend was also observed in the lung of rats exposed for 52 weeks.

Fig. 3.

Fig. 3.

Open in a new tab

Effect of PCB 153 on mtDNA copy number in rat liver (A, n = 4–6) and lung (B, n = 4–6). The number of mitochondrial gene copies was normalized to the number of nuclear gene copies and expressed as the mean ± SD of each group. (* = p < 0.05, ** = p < 0.01).

Fig. 4.

Fig. 4.

Open in a new tab

Effect of PCB 126 and PCB 153 mixture on mtDNA copy number in rat liver (A, n = 5–6) and lung (B, n = 5–6). The number of mitochondrial gene copies was normalized to the number of nuclear gene copies and expressed as the mean ± SD of each group (* = p < 0.05, ** = p < 0.01). A statistically significant positive dose-dependent trend was also observed in the lung of rats exposed for 52 weeks.

The gene microarray analysis included 27 gene probes that are related to mitochondrial DNA. Following 13 weeks of exposure to PCB 126 and the binary mixture of PCB 126 and PCB 153, 13 of the 27 gene probes, representing 11 genes related to mitochondrial DNA, were statistically significantly altered in the liver of the rats, relative to vehicle controls (Table 1). Exposure to 1000 μg/kg/d of PCB 153 for 13 weeks resulted in no significant changes in hepatic expression of genes related to mitochondrial DNA. Following 13 weeks of exposure to 1000 ng/kg/d of PCB 126, 5 genes had significantly different hepatic expression relative to vehicle controls, with 4 genes showing decreased expression (Tp53, Mapt, Opa1, Polg2) and 1 gene showing increased expression (Lig3). Twelve gene probes, representing 10 genes, had significantly different hepatic expression after 13 weeks of exposure to the binary mixture of PCB 126 (1000 ng/kg/d) and PCB 153 (1000 μg/kg/d). Of those 12 gene probes, 4 had increased expression (Lig3, Parp1, Prkaa1, Dcn) and 8 had decreased expression (Fis1, Dcn, Mapt, Micos13, Ssbp1, Fis1, Opa1, Polg2). The combination of PCB 126 and PCB 153 resulted in an increase in the number of genes related to mitochondrial DNA that were significantly up or down regulated compared to the individual congeners alone. Genes related to mitochondrial DNA were also analyzed for the presence of putative XRE sites (5′-GCGTG-3′) within 5000 bp above and 1000 bp below the transcriptional start site. All 11 of the genes in Table 1 contained one or more putative XRE sites, suggesting that they are regulated by the AhR.

Table 1.

Differentially expressed genes related to mitochondrial DNA in liver following 13 weeks of treatment of rats with PCB 126 (1000 ng/kg/d), PCB 153 (1000 μg/kg/d), or the mixture of PCB 126 (1000 ng/kg/d) and PCB 153 (1000 μg/kg/d). logFC = log2 Fold Change, with red colors representing induction and blue colors represent repression. (BOLD = FDR adjusted p < 0.05).

graphic file with name nihms-1696641-t0005.jpg
Open in a new tab
a

XREs identified in genomic DNA sequences spanning 5000 bp above and 1000 bp below the transcriptional start site. The number in parenthesis indicates the number of XREs present.

4. Discussion

While mitochondrial DNA copy number and mitochondrial density vary between cell and tissue type due to differing functions (Moraes, 2001), other factors can alter mtDNA copy number, including dysfunctional mitochondria, oxidative stress, mitochondrial gene stability, mitochondrial biogenesis resulting in marked changes in gene expression and/or other mitochondrial damage (Ames et al., 1995; Lee and Wei, 2005; Clay Montier et al., 2009). Several epidemiological studies have found that changes in mtDNA copy number are associated with various neoplastic and non-neoplastic diseases (Chang et al., 2009; Clay Montier et al., 2009; Ding et al., 2010; Lin et al., 2008; Mambo et al., 2005). In addition, mtDNA copy number was suggested to be a biomarker of mitochondrial injury and oxidative stress associated with exposures of humans to benzene and polycyclic aromatic hydrocarbons (PAHs) (Carugno et al., 2012; Pavanello et al., 2013; Shen et al., 2008). While increased oxidative stress and mitochondrial injury have been suggested to play a role in producing the adverse health effects of PCBs and TCDD (Kumar et al., 2014; Liu et al., 2012), this is apparently the first study in experimental animals to investigate the relationship between mtDNA copy number and exposure to these compounds.

In general, mitochondrial DNA copy number was increased in the liver and lung of female rats exposed to TCDD and the binary mixture of PCB 126 and PCB 153 (Figs. 1 and 4). In contrast to that, a general decrease or no change in mtDNA copy number was seen following PCB 153 exposure (Fig. 3). Exposure to PCB 126 caused an initial decrease in copy number at the low dose in lung; however, after 52 weeks of treatment the mid and high doses showed significant increases in mtDNA copy number compared to the low dose (Fig. 2). Differences in mtDNA copy number were seen between liver and lung tissues, which is consistent with literature stating that mitochondrial copy number can vary depending on cell type and number of mitochondria (Moraes, 2001).

Mitochondrial DNA is highly susceptible to damage from oxidative stress, which may cause alterations in mtDNA copy number (Lee and Wei, 2005; Liu et al., 2003). Since mtDNA lacks protective histones and has a more limited repair capacity compared to nuclear DNA (Lee and Wei, 2000), mtDNA damage is more extensive and persists longer than nuclear DNA damage (Yakes and Van Houten, 1997). As a response to damage, mitochondria can synthesize more copies of its genome (Lee and Wei, 2005). Earlier studies provide evidence associating PCB exposure with increased oxidative stress. In vitro studies have shown that exposure to PCBs results in increased levels of ROS and oxidative stress (Aly, 2013; Jiang et al., 2017; Liu et al., 2012). In vivo studies conducted using the same NTP rat liver tissue samples as our study also showed that exposure to TCDD, PCB 126, PCB 153, and the mixture of PCB 126 and PCB 153 for 13, 30, and 52 weeks resulted in increased DNA adduct formation and oxidative stress (Gao et al., 2017; Mutlu et al., 2016). Another study involving rats exposed to Aroclor 1254, a PCB mixture, showed that 30 days of exposure resulted in increased oxidative stress (Karthikeyan et al., 2014). A population based human study showed that exposure to persistent organic pollutants (POPs), including PCBs, was associated with markers of increased oxidative stress (Kumar et al., 2014). Alterations in mtDNA copy number have been associated with oxidative stress. A study completed in mice showed that there was a temporal association between mtDNA copy number and oxidative stress from fertilization to birth (Aiken et al., 2008). A human study involving 156 healthy participants showed an increase in leukocyte mtDNA copy number is associated with oxidative stress, specifically an increase of 8-oxo-dG, a biomarker of oxidative DNA damage (Liu et al., 2003). Thus, oxidative stress may contribute to the changes in mtDNA copy number seen in the liver and lung of rats exposed to PCBs and TCDD.

In addition to increased oxidative stress, several studies have shown exposure to TCDD and PCBs can result in altered mitochondrial function and morphology. In vitro studies with various cell types exposed to PCBs resulted in decreased mitochondrial membrane potential (Aly, 2013; Cocco et al., 2015; Jiang et al., 2017; Shen et al., 2011) and decreased ATP production (Aly, 2013; Cocco et al., 2015). in vitro exposure to TCDD in human trophoblast-like JAR cells resulted in increased oxidative damage and mitochondrial dysfunction, including a decrease in mtDNA copy number and ATP content and an increase in mtDNA deletions (Chen et al., 2010). Other in vivo studies have shown that exposure to PCBs can result in changes to the mitochondrial volume fraction of mitochondria (ratio of mitochondrial volume to total intracellular volume). Mitochondrial dysfunction may reduce the content of mitochondria, which is expressed as a decreased mtDNA copy number (Clay Montier et al., 2009). Female rats exposed to PCB 126 for 13 weeks showed a dose-dependent significant increase in the volume fraction of mitochondria in the liver (Connell et al., 1999). In contrast, a dose-dependent significant decrease in the volume fraction of mitochondria was observed in the liver of female and male rats exposed to PCB 153 for 13 weeks (Peng et al., 1997). Exposure of Sprague Dawley rats to PCB 126 alone and PCB 153 alone for 13 weeks has been shown to cause alterations in the ultrastructure of mitochondria in the liver, including dumbbell shapes and cristae oriented parallel to the long axis of the organelle (MacLellan et al., 1994a, b). During mitochondrial division the disk-shaped mitochondria become dumbbell-shaped and the dumbbell-shaped mitochondria then divide into two spherical daughter mitochondria (Kuroiwa et al., 2006). Together these studies indicate that PCBs and TCDD produce mitochondrial injury and produce alterations in mitochondrial volume fraction which are consistent with the observed changes in mtDNA copy number in the current study.

The NTP technical reports on PCBs and TCDD include extensive tissue pathology and cell proliferation data (NTP, 2006a, b, c, d). Increases in mtDNA copy number were observed at doses and/or time points where little to no liver or lung pathology was reported. In general, there was an increase in mtDNA copy number in the liver and/or lung of rats following 13–52 weeks of exposure to TCDD, PCB126 and the mixture of PCB 126 and PCB 153. These exposures produced a range of non-neoplastic responses in the liver, but only following 52 weeks of exposure to the high dose of these compounds, which was associated with no change or a decrease in hepatic mtDNA copy number. The lack of a dose-response relationship at the high dose may be due the extensive hepatotoxicity, possibility limiting the mitochondria’s ability to repair and compensate for the damage. A marked, significant increase in hepatic cell proliferation was also observed following 52 weeks of exposure to the high dose of these compounds (NTP, 2006b, c, d). In addition to hepatotoxicity, the hepatic cell proliferation could result in reduced mitochondrial density, which together leads to the decrease or no change in hepatic mtDNA copy number. While frozen tissue specimens were not available following 104 weeks of exposure, extending the exposure to these dioxin-like compounds for 104 weeks produced neoplastic responses and a range of non-neoplastic responses in the liver and lung (NTP, 2006b, c, d). This suggests that the observed changes in mtDNA copy number at 13, 30, and/or 52 weeks may represent an early, sensitive response that proceeds the development of hepatic and pulmonary lesions. Conversely, there was a significant decrease, or no change, in mtDNA copy number in the liver and lung of rats exposed to non-DL PCB 153. This is consistent with a general lack of PCB 153 mediated liver or lung injury in the NTP study, with the exception of liver hypertrophy (NTP, 2006a), and the decrease in the volume fraction of mitochondria observed in the liver of rats exposed to PCB 153 (Peng et al., 1997).

Although the mechanisms for the action of PCBs on mitochondria is not fully known, gene microarray data showed that several genes related to mitochondrial DNA have significantly altered expression in the liver of rats exposed to these compounds (Table 1). Exposure to PCB 126 and the mixture of PCB 126 and PCB 153 for 13 weeks resulted in significantly increased expression of DNA ligase III (Lig3), while exposure to PCB 153 alone resulted in decreased expression, though not statistically significant. Lig3 is essential for maintaining mtDNA integrity (Gao et al., 2011) and is involved in mtDNA repair (Rossi et al., 2009). The Lig3 zinc finger (ZnF) interacts with Poly (ADP-ribose) polymerase 1 (Parp1) (Leppard et al., 2003), and this interaction is reported to be important for the association of Lig3 with mtDNA (Rossi et al., 2009). Parp1, which was significantly increased after exposure to the mixture of PCB 126 and PCB 153, is involved in the maintenance of mitochondrial DNA integrity (Rossi et al., 2009). Mitochondrial contact site and cristae organizing system subunit 13 (Micos13) is essential for the formation of mitochondrial crista junctions, which are crucial for the structure and function of mitochondria (Anand et al., 2016). Micos13 showed a decrease in expression after 13 weeks of exposure to PCB 126 and the binary mixture of PCB 126 and PCB 153. In contrast, exposure to PCB 153 showed an increase in Micos13 expression, though it was not statistically significant. Rats treated with the binary mixture of PCB 126 and 153 resulted in 10 genes with significantly altered expression compared to five genes with PCB 126 alone and none with the non-DL PCB 153 alone. This observation is consistent with the finding that all 11 genes in Table 1 contain one or more putative XRE site, suggesting that these genes are under AhR regulation.

While this study is the first to observe alterations in the mtDNA copy number in the liver and lungs of rats exposed to TCDD and PCBs, the data did not always reach the level of statistical significance. Although the study utilized all tissue specimens available from the NTP studies, there were still limited sample sizes of the groups tested and samples were not available following 104 weeks of exposure. The NTP studies were conducted in the early 2000s and samples have been maintained at −80 °C; however, there may have been some unintended variability in the collection and banking of liver and lung biospecimens during the large study conducted over several years. In spite of this, the DNA extracted from the liver and lung tissues samples was consistently of good purity. In conclusion, thhe observed changes in mitochondrial copy number with PCB and TCDD exposure are consistent with ultrastructural changes in mitochondrial morphology, oxidative injury, and oxidative DNA damage previously reported in the liver of rats exposed to PCBs and TCDD. Together the results suggest that an increase in mtDNA copy number may serve as a sensitive, early biomarker of mitochondrial injury and oxidative stress that contributes to the development of the toxicity of dioxin-like compounds. Further studies are underway to assess the impact of environmental human exposure to PCBs on mtDNA copy number in leukocytes.

Acknowledgements

Tissues for this study were provided to us by the National Toxicology Program as part of a series of chronic 2-year rat bioassays examining the relative potencies for carcinogenicity of individual and mixtures of dioxin-like compounds. These studies were supported in part by the Intramural Research Program of National Cancer Institute/National Institutes of Health (Project ZIA BC 011476) and NIEHS grant ES09440 (JRO).

Footnotes

Disclaimer

This article was prepared while Samantha VanEtten was a graduate student at the University at Buffalo. Although the author is an FDA/CTP employee, this work was not done as part of her official duties. This publication reflects the views of the author and should not be construed to reflect the FDA/CTP’s views or politics.

Declaration of Competing Interest

The authors declare no conflict of interest.

References

  1. Aiken CE, Cindrova-Davies T, Johnson MH, 2008. Variations in mouse mitochondrial DNA copy number from fertilization to birth are associated with oxidative stress. Reprod. Biomed. Online 17, 806–813. [DOI] [PubMed] [Google Scholar]
  2. Al-Salman F, Plant N, 2012. Non-coplanar polychlorinated biphenyls (PCBs) are direct agonists for the human pregnane-X receptor and constitutive androstane receptor, and activate target gene expression in a tissue-specific manner. Toxicol. Appl. Pharmacol 263, 7–13. [DOI] [PubMed] [Google Scholar]
  3. Aly HA, 2013. Aroclor 1254 induced oxidative stress and mitochondria mediated apoptosis in adult rat sperm in vitro. Environ. Toxicol. Pharmacol 36, 274–283. [DOI] [PubMed] [Google Scholar]
  4. Ames BN, Shigenaga MK, Hagen TM, 1995. Mitochondrial decay in aging. Biochim. Biophys. Acta 1271, 165–170. [DOI] [PubMed] [Google Scholar]
  5. Anand R, Strecker V, Urbach J, Wittig I, Reichert AS, 2016. Mic13 is essential for formation of crista junctions in mammalian cells. PLoS One 11, e0160258. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. ATSDR, 2000. Toxicological Profile for Polychlorinated Biphenyls (PCBs). P.H.S. U.S. Department of Health and Human Services, Atlanta, GA. [Google Scholar]
  7. ATSDR, 2011. Addendum to the Toxicological Profile for Polychlorinated Biphenyls (PCBs). P.H.S. U.S. Department of Health and Human Services, Atlanta, GA. [Google Scholar]
  8. Bonner MR, Shen M, Liu CS, Divita M, He X, Lan Q, 2009. Mitochondrial DNA content and lung cancer risk in Xuan Wei. China. Lung Cancer 63, 331–334. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Bookout AL, Cummins CL, Mangelsdorf DJ, Pesola JM, Kramer MF, 2006. High-throughput Real-time Quantitative Reverse Transcription PCR. Curr Protoc Mol Biol Chapter 15, Unit 15 18. [DOI] [PubMed] [Google Scholar]
  10. Carugno M, Pesatori AC, Dioni L, Hoxha M, Bollati V, Albetti B, Byun HM, Bonzini M, Fustinoni S, Cocco P, Satta G, Zucca M, Merlo DF, Cipolla M, Bertazzi PA, Baccarelli A, 2012. Increased mitochondrial DNA copy number in occupations associated with low-dose benzene exposure. Environ. Health Perspect 120, 210–215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Centers for Disease Control and Prevention, 2019. Fourth Report on Human Exposure to Environmental Chemicals, Updated Tables. U.S. Department of Health and Human Services Centers for Disease Control and Prevention, Atlanta, GA. [Google Scholar]
  12. Chang SC, Lin PC, Yang SH, Wang HS, Liang WY, Lin JK, 2009. Mitochondrial D-loop mutation is a common event in colorectal cancers with p53 mutations. Int. J. Colorectal Dis 24, 623–628. [DOI] [PubMed] [Google Scholar]
  13. Chen SC, Liao TL, Wei YH, Tzeng CR, Kao SH, 2010. Endocrine disruptor, dioxin (TCDD)-induced mitochondrial dysfunction and apoptosis in human trophoblast-like JAR cells. Mol. Hum. Reprod 16, 361–372. [DOI] [PubMed] [Google Scholar]
  14. Choi YS, Kim S, Pak YK, 2001. Mitochondrial transcription factor A (mtTFA) and diabetes. Diabetes Res. Clin. Pract 54 (Suppl 2), S3–9. [DOI] [PubMed] [Google Scholar]
  15. Clay Montier LL, Deng JJ, Bai Y, 2009. Number matters: control of mammalian mitochondrial DNA copy number. J. Genet. Genomics 36, 125–131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Cocco S, Secondo A, Del Viscovo A, Procaccini C, Formisano L, Franco C, Esposito A, Scorziello A, Matarese G, Di Renzo G, Canzoniero LM, 2015. Polychlorinated biphenyls induce mitochondrial dysfunction in SH-SY5Y neuroblastoma cells. PLoS One 10, e0129481. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Connell BJ, Singh A, Chu I, 1999. PCB congener 126-induced ultrastructural alterations in the rat liver: a stereological study. Toxicology 136, 107–115. [DOI] [PubMed] [Google Scholar]
  18. Ding Z, Ji J, Chen G, Fang H, Yan S, Shen L, Wei J, Yang K, Lu J, Bai Y, 2010. Analysis of mitochondrial DNA mutations in D-loop region in thyroid lesions. Biochim. Biophys. Acta 1800, 271–274. [DOI] [PubMed] [Google Scholar]
  19. EPA, 2019. Learn About Polychlorinated Biphenyls (PCBs). [Google Scholar]
  20. Gahrs M, Roos R, Andersson PL, Schrenk D, 2013. Role of the nuclear xenobiotic receptors CAR and PXR in induction of cytochromes P450 by non-dioxinlike polychlorinated biphenyls in cultured rat hepatocytes. Toxicol. Appl. Pharmacol 272, 77–85. [DOI] [PubMed] [Google Scholar]
  21. Gao Y, Katyal S, Lee Y, Zhao J, Rehg JE, Russell HR, McKinnon PJ, 2011. DNA ligase III is critical for mtDNA integrity but not Xrcc1-mediated nuclear DNA repair. Nature 471, 240–244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Gao L, Mutlu E, Collins LB, Walker NJ, Hartwell HJ, Olson JR, Sun W, Gold A, Ball LM, Swenberg JA, 2017. DNA product formation in female sprague-dawley rats following polyhalogenated aromatic hydrocarbon (PHAH) exposure. Chem. Res. Toxicol 30, 794–803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Hosgood HD 3rd, Liu CS, Rothman N, Weinstein SJ, Bonner MR, Shen M, Lim U, Virtamo J, Cheng WL, Albanes D, Lan Q, 2010. Mitochondrial DNA copy number and lung cancer risk in a prospective cohort study. Carcinogenesis 31, 847–849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hosnijeh FS, Lan Q, Rothman N, San Liu C, Cheng WL, Nieters A, Guldberg P, Tjonneland A, Campa D, Martino A, Boeing H, Trichopoulou A, Lagiou P, Trichopoulos D, Krogh V, Tumino R, Panico S, Masala G, Weiderpass E, Huerta Castano JM, Ardanaz E, Sala N, Dorronsoro M, Quiros JR, Sanchez MJ, Melin B, Johansson AS, Malm J, Borgquist S, Peeters PH, Bueno-de-Mesquita HB, Wareham N, Khaw KT, Travis RC, Brennan P, Siddiq A, Riboli E, Vineis P, Vermeulen R, 2014. Mitochondrial DNA copy number and future risk of B-cell lymphoma in a nested case-control study in the prospective EPIC cohort. Blood 124, 530–535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Huang B, Gao YT, Shu XO, Wen W, Yang G, Li G, Courtney R, Ji BT, Li HL, Purdue MP, Zheng W, Cai Q, 2014. Association of leukocyte mitochondrial DNA copy number with colorectal cancer risk: results from the Shanghai Women’s Health Study. Cancer Epidemiol. Biomarkers Prev 23, 2357–2365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. IARC, 2015. IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Humans. Polychlorinated Biphenyls and Polybrominated Biphenyls. IARC Monogr Eval Carcinog Risk Chem Hum, p. 107. [PubMed] [Google Scholar]
  27. Jiang LG, Cheng LY, Kong SH, Yang Y, Shen YJ, Chen C, Deng XH, Liu SZ, Chao L, 2017. Toxic effects of polychlorinated biphenyls (Aroclor 1254) on human sperm motility. Asian J. Androl 19, 561–566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Karthikeyan S, Muthusamy Sridhar M, Ramajayam G, Lavanya R, Arunakaran J, Srinivasan N, 2014. Polychlorinated biphenyl (PCBs)-induced oxidative stress plays a role on vertebral antioxidant system: ameliorative role of vitamin C and E in male Wistar rats. Biomed. Prev. Nutr 4, 411–416. [Google Scholar]
  29. Kim C, Bassig BA, Seow WJ, Hu W, Purdue MP, Huang WY, Liu CS, Cheng WL, Mannisto S, Vermeulen R, Weinstein SJ, Lim U, Hosgood HD, Bonner MR, Caporaso NE, Albanes D, Lan Q, Rothman N, 2015. Mitochondrial DNA copy number and chronic lymphocytic leukemia/small lymphocytic lymphoma risk in two prospective studies. Cancer Epidemiol. Biomarkers Prev 24, 148–153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Klaus B, Reisenauer S, 2020. maEndToEnd: An End to End Workflow for Differential Gene Expression Using Affymetrix Microarrays. R Package Version 2.8.0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Kumar J, Monica Lind P, Salihovic S, van Bavel B, Lind L, Ingelsson E, 2014. Influence of persistent organic pollutants on oxidative stress in population-based samples. Chemosphere 114, 303–309. [DOI] [PubMed] [Google Scholar]
  32. Kuroiwa T, Nishida K, Yoshida Y, Fujiwara T, Mori T, Kuroiwa H, Misumi O, 2006. Structure, function and evolution of the mitochondrial division apparatus. Biochim. Biophys. Acta 1763, 510–521. [DOI] [PubMed] [Google Scholar]
  33. Lauby-Secretan B, Loomis D, Baan R, El Ghissassi F, Bouvard V, Benbrahim-Tallaa L, Guha N, Grosse Y, Straif K, 2016. Use of mechanistic data in the IARC evaluations of the carcinogenicity of polychlorinated biphenyls and related compounds. Environ. Sci. Pollut. Res. Int 23, 2220–2229. [DOI] [PubMed] [Google Scholar]
  34. Lee HC, Wei YH, 2000. Mitochondrial role in life and death of the cell. J. Biomed. Sci 7, 2–15. [DOI] [PubMed] [Google Scholar]
  35. Lee HC, Wei YH, 2005. Mitochondrial biogenesis and mitochondrial DNA maintenance of mammalian cells under oxidative stress. Int. J. Biochem. Cell Biol 37, 822–834. [DOI] [PubMed] [Google Scholar]
  36. Lemnrau A, Brook MN, Fletcher O, Coulson P, Tomczyk K, Jones M, Ashworth A, Swerdlow A, Orr N, Garcia-Closas M, 2015. Mitochondrial DNA copy number in peripheral blood cells and risk of developing breast Cancer. Cancer Res. 75, 2844–2850. [DOI] [PubMed] [Google Scholar]
  37. Leppard JB, Dong Z, Mackey ZB, Tomkinson AE, 2003. Physical and functional interaction between DNA ligase IIIalpha and poly(ADP-Ribose) polymerase 1 in DNA single-strand break repair. Mol. Cell. Biol 23, 5919–5927. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Lim S, Cho YM, Park KS, Lee HK, 2010. Persistent organic pollutants, mitochondrial dysfunction, and metabolic syndrome. Ann. N. Y. Acad. Sci 1201, 166–176. [DOI] [PubMed] [Google Scholar]
  39. Lin CS, Wang LS, Tsai CM, Wei YH, 2008. Low copy number and low oxidative damage of mitochondrial DNA are associated with tumor progression in lung cancer tissues after neoadjuvant chemotherapy. Interact. Cardiovasc. Thorac. Surg 7, 954–958. [DOI] [PubMed] [Google Scholar]
  40. Liu CS, Tsai CS, Kuo CL, Chen HW, Lii CK, Ma YS, Wei YH, 2003. Oxidative stress-related alteration of the copy number of mitochondrial DNA in human leukocytes. Free Radic. Res 37, 1307–1317. [DOI] [PubMed] [Google Scholar]
  41. Liu J, Song E, Liu L, Ma X, Tian X, Dong H, Song Y, 2012. Polychlorinated biphenyl quinone metabolites lead to oxidative stress in HepG2 cells and the protective role of dihydrolipoic acid. Toxicol. In Vitro 26, 841–848. [DOI] [PubMed] [Google Scholar]
  42. MacLellan K, Singh A, Chu I, Poon R, Villeneuve DC, 1994a. Subchronic toxicity of pentachlorobiphenyl congeners n. 126 or 118 in the rat liver. An electron microscope study. J. Submicrosc. Cytol. Pathol 26, 279–291. [PubMed] [Google Scholar]
  43. MacLellan K, Singh A, Chu I, Villeneuve DC, 1994b. Toxicity of 2,2’,4,4’,5,5’-hexachlorobiphenyl in the rat liver: an electron microscope study. Histol. Histopathol 9, 461–468. [PubMed] [Google Scholar]
  44. Mambo E, Chatterjee A, Xing M, Tallini G, Haugen BR, Yeung SC, Sukumar S, Sidransky D, 2005. Tumor-specific changes in mtDNA content in human cancer. Int. J. Cancer 116, 920–924. [DOI] [PubMed] [Google Scholar]
  45. Moraes CT, 2001. What regulates mitochondrial DNA copy number in animal cells? Trends Genet. 17, 199–205. [DOI] [PubMed] [Google Scholar]
  46. Morten KJ, Ashley N, Wijburg F, Hadzic N, Parr J, Jayawant S, Adams S, Bindoff L, Bakker HD, Mieli-Vergani G, Zeviani M, Poulton J, 2007. Liver mtDNA content increases during development: a comparison of methods and the importance of age- and tissue-specific controls for the diagnosis of mtDNA depletion. Mitochondrion 7, 386–395. [DOI] [PubMed] [Google Scholar]
  47. Mrema EJ, Rubino FM, Brambilla G, Moretto A, Tsatsakis AM, Colosio C, 2013. Persistent organochlorinated pesticides and mechanisms of their toxicity. Toxicology 307, 74–88. [DOI] [PubMed] [Google Scholar]
  48. Mutlu E, Gao L, Collins LB, Walker NJ, Hartwell HJ, Olson JR, Sun W, Gold A, Ball LM, Swenberg JA, 2016. Polychlorinated biphenyls induce oxidative DNA adducts in female sprague-dawley rats. Chem. Res. Toxicol 29, 1335–1344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. National Research Council, 2006. Health Risks From Dioxin and Related Compounds: Evaluation of the EPA Reassement. National Academies Press, p. 269. [Google Scholar]
  50. Negishi M, 2017. Phenobarbital meets phosphorylation of nuclear receptors. Drug Metab. Dispos 45, 532–539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Ng CH, Janoo-Gilani R, Sipahimalani P, Gallagher RP, Gascoyne RD, Connors JM, Weber JP, Lai AS, Leach S, Le ND, Brooks-Wilson AR, Spinelli JJ, 2010. Interaction between organochlorines and the AHR gene, and risk of non-Hodgkin lymphoma. Cancer Causes Control 21, 11–22. [DOI] [PubMed] [Google Scholar]
  52. NTP, 2006a. NTP Technical Report on the Toxicology and Carcinogenesis Studies of 2,2’,4,4’,5,5’-hexachlorobiphenyl (PCB 153) (CAS No. 35065–27-1) in Female Harlan Sprague-dawley Rats (Gavage Studies). Natl Toxicol Program Tech Rep Ser, pp. 4–168. [PubMed] [Google Scholar]
  53. NTP, 2006b. NTP Technical Report on the Toxicology and Carcinogenesis Studies of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) (CAS No. 1746–01-6) in Female Harlan Sprague-dawley Rats (Gavage Studies). Natl Toxicol Program Tech Rep Ser, pp. 4–232. [PubMed] [Google Scholar]
  54. NTP, 2006c. NTP Technical Report on the Toxicology and Carcinogenesis Studies of 3,3’,4,4’,5-pentachlorobiphenyl (PCB 126) (CAS No. 57465–28-8) in Female Harlan Sprague-dawley Rats (Gavage Studies). Natl Toxicol Program Tech Rep Ser, pp. 4–246. [PubMed] [Google Scholar]
  55. NTP, 2006d. NTP Technical Report on the Toxicology and Carcinogenesis Studies of a Binary Mixture of 3,3’,4,4’,5-pentachlorobiphenyl (PCB 126) (Cas No. 57465–28-8) and 2,2’,4,4’,5,5’-hexachlorobiphenyl (PCB 153) (CAS No. 35065–27-1) in Female Harlan Sprague-dawley Rats (gavage Studies). Natl Toxicol Program Tech Rep Ser, pp. 1–258. [PubMed] [Google Scholar]
  56. Ovando BJ, Vezina CM, McGarrigle BP, Olson JR, 2006. Hepatic gene downregulation following acute and subchronic exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Toxicol. Sci 94, 428–438. [DOI] [PubMed] [Google Scholar]
  57. Ovando BJ, Ellison CA, Vezina CM, Olson JR, 2010. Toxicogenomic analysis of exposure to TCDD, PCB126 and PCB153: identification of genomic biomarkers of exposure to AhR ligands. BMC Genomics 11, 583. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Patterson DG Jr., Wong LY, Turner WE, Caudill SP, Dipietro ES, McClure PC, Cash TP, Osterloh JD, Pirkle JL, Sampson EJ, Needham LL, 2009. Levels in the U.S. population of those persistent organic pollutants (2003–2004) included in the Stockholm Convention or in other long range transboundary air pollution agreements. Environ. Sci. Technol 43, 1211–1218. [DOI] [PubMed] [Google Scholar]
  59. Pavanello S, Dioni L, Hoxha M, Fedeli U, Mielzynska-Svach D, Baccarelli AA, 2013. Mitochondrial DNA copy number and exposure to polycyclic aromatic hydrocarbons. Cancer Epidemiol. Biomarkers Prev 22, 1722–1729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Peng J, Singh A, Ireland WP, Chu I, 1997. Polychlorinated biphenyl congener 153-induced ultrastructural alterations in rat liver: a quantitative study. Toxicology 120, 171–183. [DOI] [PubMed] [Google Scholar]
  61. Penta JS, Johnson FM, Wachsman JT, Copeland WC, 2001. Mitochondrial DNA in human malignancy. Mutat. Res 488, 119–133. [DOI] [PubMed] [Google Scholar]
  62. Perkins JT, Petriello MC, Newsome BJ, Hennig B, 2016. Polychlorinated biphenyls and links to cardiovascular disease. Environ. Sci. Pollut. Res. Int 23, 2160–2172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Pessah IN, Hansen LG, Albertson TE, Garner CE, Ta TA, Do Z, Kim KH, Wong PW, 2006. Structure-activity relationship for noncoplanar polychlorinated biphenyl congeners toward the ryanodine receptor-Ca2+ channel complex type 1 (RyR1). Chem. Res. Toxicol 19, 92–101. [DOI] [PubMed] [Google Scholar]
  64. Rolo AP, Palmeira CM, 2006. Diabetes and mitochondrial function: role of hyperglycemia and oxidative stress. Toxicol. Appl. Pharmacol 212, 167–178. [DOI] [PubMed] [Google Scholar]
  65. Rooney JP, Ryde IT, Sanders LH, Howlett EH, Colton MD, Germ KE, Mayer GD, Greenamyre JT, Meyer JN, 2015. PCR based determination of mitochondrial DNA copy number in multiple species. Methods Mol. Biol 1241, 23–38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Rossi MN, Carbone M, Mostocotto C, Mancone C, Tripodi M, Maione R, Amati P, 2009. Mitochondrial localization of PARP-1 requires interaction with mitofilin and is involved in the maintenance of mitochondrial DNA integrity. J. Biol. Chem 284, 31616–31624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Ruzzin J, Lee DH, Carpenter DO, Jacobs DR Jr., 2012. Reconsidering metabolic diseases: the impacts of persistent organic pollutants. Atherosclerosis 224, 1–3. [DOI] [PubMed] [Google Scholar]
  68. Shen M, Zhang L, Bonner MR, Liu C-S, Li G, Vermeulen R, Dosemeci M, Yin S, Lan Q, 2008. Association between mitochondrial DNA copy number, blood cell counts, and OccupationalBenzene exposure. Environ. Mol. Mutagen 49, 453–457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Shen K, Shen C, Yu J, Yu C, Chen L, Shi D, Chen Y, 2011. PCB congeners induced mitochondrial dysfunction in Vero cells. J. Hazard. Mater 185, 24–28. [DOI] [PubMed] [Google Scholar]
  70. Silverstone AE, Rosenbaum PF, Weinstock RS, Bartell SM, Foushee HR, Shelton C, Pavuk M, 2012. Polychlorinated biphenyl (PCB) exposure and diabetes: results from the Anniston Community Health Survey. Environ. Health Perspect 120, 727–732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Simon T, Britt JK, James RC, 2007. Development of a neurotoxic equivalence scheme of relative potency for assessing the risk of PCB mixtures. Regul. Toxicol. Pharmacol 48, 148–170. [DOI] [PubMed] [Google Scholar]
  72. Song S, Xue J, Lu Y, Zhang H, Wang C, Cao X, Li Q, 2018. Are unintentionally produced polychlorinated biphenyls the main source of polychlorinated biphenyl occurrence in soils? Environ Pollut 243, 492–500. [DOI] [PubMed] [Google Scholar]
  73. Thyagarajan B, Wang R, Nelson H, Barcelo H, Koh WP, Yuan JM, 2013. Mitochondrial DNA copy number is associated with breast cancer risk. PLoS One 8, e65968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  74. Van den Berg M, Birnbaum LS, Denison M, De Vito M, Farland W, Feeley M, Fiedler H, Hakansson H, Hanberg A, Haws L, Rose M, Safe S, Schrenk D, Tohyama C, Tritscher A, Tuomisto J, Tysklind M, Walker N, Peterson RE, 2006. The 2005 World Health Organization reevaluation of human and Mammalian toxic equivalency factors for dioxins and dioxin-like compounds. Toxicol. Sci 93, 223–241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Vezina CM, Walker NJ, Olson JR, 2004. Subchronic exposure to TCDD, PeCDF, PCB126, and PCB153: effect on hepatic gene expression. Environ. Health Perspect 112, 1636–1644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. WHO, 2003. Polychlorinated biphenyls: human health aspects. Concise Int. Chem. Assessment Document 55, 1–57. [Google Scholar]
  77. Xing J, Chen M, Wood CG, Lin J, Spitz MR, Ma J, Amos CI, Shields PG, Benowitz NL, Gu J, de Andrade M, Swan GE, Wu X, 2008. Mitochondrial DNA content: its genetic heritability and association with renal cell carcinoma. J. Natl. Cancer Inst 100, 1104–1112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Yakes FM, Van Houten B, 1997. Mitochondrial DNA damage is more extensive and persists longer than nuclear DNA damage in human cells following oxidative stress. Proc. Natl. Acad. Sci. U. S. A 94, 514–519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  79. Zhou W, Zhu M, Gui M, Huang L, Long Z, Wang L, Chen H, Yin Y, Jiang X, Dai Y, Tang Y, He L, Zhong K, 2014. Peripheral blood mitochondrial DNA copy number is associated with prostate cancer risk and tumor burden. PLoS One 9, e109470. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES