Skip to main content
NCBI home page
3 Biotech logoLink to 3 Biotech
. 2021 Jun 24;11(7):355. doi: 10.1007/s13205-021-02901-w

Induction of moisture stress tolerance by Bacillus and Paenibacillus in pigeon pea (Cajanus cajan. L)

Nunna Sai Aparna Devi 1,2, Karunanandham Kumutha 1,✉, Rangasamy Anandham 1,2, Ramasamy Krishnamoorthy 1,3
PMCID: PMC8225722  PMID: 34249596

Abstract

Drought stress is the main growth-limiting factor in pigeon pea production. Plant growth-promoting bacteria (PGPB) induce abiotic stress tolerance in several plants. However, the physiological and molecular changes with PGPB priming are not well understood in pigeon pea. The present study explored the potential of Firmibacteria (Bacillus azotoformans MTCC2953, Bacillus aryabhattai KSBN2K7, and Paenibacillus stellifer M3T4B6) to induce stress tolerance in pigeon pea under pot culture condition. Different physiological and biochemical parameters, including osmolytes, stress enzymes, and antioxidants, were evaluated under two stress conditions (50% and 25% field capacity) and an unstressed condition in pigeon pea. Under moisture stress conditions significant differences were observed in physiological and biochemical parameters between firmibacteria inoculated and control plants.The quantitative real-time polymerase chain reaction was performed to study the bacterial inoculation mediated expression of proline and drought-responsive genes in enhancing the drought tolerance in pigeon pea. Results showed that the inoculation of Bacillus aryabhattai upregulated the expression of drought-responsive genes (C. cajan_29830 and C. cajan_33874) and downregulated the expression of the proline gene by inducing the drought stress tolerance in inoculated plants compared with the uninoculated control plants. Therefore, Bacillus aryabhattai may be recommended for inducing drought stress tolerance and increasing the growth of pigeon pea under moisture stress conditions after field evaluation.

Keywords: Plant growth-promoting bacteria, Field stress, Antioxidants, Osmolytes, Drought stress, Pigeon pea

Introduction

The use of plant growth-promoting bacteria (PGPB) as inoculants in agriculture and stress alleviation has been recommended as a suitable and sustainable approach (Jha and Subramanian 2014; Egamberdieva et al. 2017). Plant growth promotion using PGPB can be achieved by direct or indirect mechanisms. The direct mechanism leads to indole acetic acid production, phosphate solubilization, biofilm formation, and the indirect mechanism leads to resistance of plants to abiotic stress (Mayak et al. 2004; Islam and Gregorio 2013).

Firmibacteria are the most prominent microorganisms in the ecosystem exhibiting multifunctional properties, which have a good scope in productive agriculture and are involved in various interactions with plants in abiotic stress conditions (Naylor et al. 2017). Firmibacteria are Gram-positive bacteria, spore formers with low G + C content, and include the following bacilli: Lactobacillus, Clostridium, Lysinibacillus, and Paenibacillus. The higher-level members of firmicutes were employed by plants in drought under field conditions (Santos-Medellín et al. 2017) within the root endosphere and rhizosphere communities as compared to the surrounding soil. During drought stress, phytohormones, like abscic acid, gibberlins, cytokinins, auxins, and exopolysaccharides, phosphate solubilization, bacterial biofilm, and enzymes, like 1-aminocyclopropane 1-carboxylate (ACC) deaminase, reduce ethylene levels in the developing roots and play various roles in plant–microbe interactions (Glick 2012).

Pigeon pea (Cajanus cajan. L) is one of the most important pulses, as it plays a major role in agriculture and vegetarian diets. It is the chief source of protein with balanced amino acids for the human body. Drought is a widespread climatic disaster affecting agricultural production (Daryanto et al. 2015) and is, therefore, a determinant of world food security (Sofi et al. 2018). Hence, drought mitigation in agriculture has been a hotspot to governments and scientists (Wilhite et al. 2014). Water stress affects plants at different levels ranging from cells to the whole plant (Gaxiola et al. 2001), and it is the major limiting factor of crop productivity (Gagne-Bourque et al. 2016). During acclimation to soil drought, plants produce reactive free radicals (Simova-Stoilova et al. 2008) against water deficit (Chaves and Oliveira 2004). PGPB alone or in combination reduces the levels of reactive free radicals by antioxidant enzymes like superoxide dismutase (SOD) and catalase (CAT) that scavenge free radicals resulting in less reactive oxygen species (ROS) formation (Manoj et al. 2016). Bacillus licheniformis FMCH001 was reported to be a biostimulant for maize in enhancing plant water use efficiency by producing more biomass (particularly root) and upregulating the activity of antioxidative enzymes under drought stress conditions (Akhtar et al. 2020). Plant growth-promoting efficiency of Pseudomonas fluorescence P2, Pseudomonas jessenii R62, Bacillus cereus BSB38, and Arthrobacter nitroguajacolicus YB3 were tested on IR-64 (drought-sensitive cultivar) of rice (Oryza sativa. L) at different levels of drought stress resulted in higher proline content; higher activity of SOD, CAT, peroxidase (PO), and ascorbate peroxidase; and lower levels of hydrogen peroxide (H2O2) and malondialdehyde in leaves (Gusain et al. 2015). Plant growth-promoting Pseudomonas and Bacillus increased the production of antioxidants during drought by which H2O2 accumulation was reduced (Gusain et al. 2015) in cowpea and alleviated the water stress condition. Bacillus subtilis B26 decreased proline accumulation during stress condition in inoculated timothy (Phleum pratense L.) than in uninoculated timothy and led to less damage of internal cell tissues (Gagne-Bourque et al. 2016). Apart from Gram-negative bacteria, Firmibacteria (gram positive) participate in plant growth promotion both in biotic and abiotic stresses (Gagne-Bourque et al.2016; Santos-Medellín et al. 2017). Inoculation with Paenibacillus polymyxa conferred drought tolerance in Arabidopsis thaliana through the induction of drought-responsive genes, ERD15 (EARLY RESPONSIVE TO DEHYDRATION 15), and an ABA-responsive gene RAB18 (Timmusk and Wagner 1999). The present study explored the mitigation of water stress and plant growth promotion of Firmibacteria in pigeon pea under in vitro condition and studied the expression of drought-responsive genes due to the inoculation of Firmibacteria under moisture stress.

Material and methods

Bacterial strains

Three firmibacterial strains, Bacillus azotoformans MTCC2953 from Microbial Type Culture Collection, Institute of Microbial Technology, Chandigarh, India and Bacillus aryabhattai KSBN2K7 (MT791368) and Paenibacillus stellifer M3T4B6 (GQ246732) from the Department of Agricultural Microbiology, Agricultural College and Research Institute, Tamil Nadu Agricultural University, Madurai, India, were used. These bacteria were selected on the basis of their ability to grow at − 1.03 MPa of drought stress induced by PEG6000 and their multiple plant growth-promoting traits (Devi et al. 2018).

Plant inoculation

Pot culture experiment was conducted with the inoculation of Firmibacteria under induced moisture stress conditions (50% and 25% field capacity [FC], i.e., 50% moisture stress and 75% moisture stress, respectively) with pigeon pea variety V3 as the test crop. Seeds were obtained from the National Pulses Research Centre, Vamban, Tamil Nadu, India. Medium red, sandy loam textured soil, sand, and farmyard manure in the ratio of 2:1:1 were thoroughly mixed and filled in earthen pots (30 cm diameter) at 8 kg per pot. The physicochemical properties of the soil used for the pot culture experiment were as follows: pH, 6.5; EC, 0.06 dSm–1; N, 154.0 kg ha–1; P, 23.5 kg ha–1; K, 411.4 kg ha–1; and organic C, 6.4 g kg–1. The three strains of bacteria were grown in nutrient broth for 48 h at 28 ± 2 °C, and then the cells were harvested through centrifugation (10,000 rpm), washed twice with 0.1 M phosphate buffer (pH 7.0), and resuspended in phosphate buffer. Pigeon pea seeds were surface sterilized with 0.1% mercuric chloride for 1 min and 70% ethanol for 30 s and washed with sterile water 4–5 times. Then, the seeds were immersed in a bacterial suspension of 107 CFU mL–1 for 4 h per the treatment structure. Similarly, control seeds were imbibed in a phosphate buffer (0.1 M) pH 7.0 for 4 h. Four seeds were directly sown in each pot, and only two plants were maintained for the study under greenhouse conditions. The treatment details were as follows: T1: Bacillus aryabhattai KSBN2K7; T2: Bacillus azotoformans MTCC2953; T3: Paenibacillus stellifer M3T4B6; and T4: uninoculated control; all treatments were replicated five times, and the pots were arranged in a completely randomized block design. The field capacity of experimental soil was 16% and calculated based on a weight basis. Drought stress was created by maintaining 50% (8% field capacity) and 25% (4% field capacity) soil moisture content (Heidari and Golpayegani 2012). Hydration and dehydration techniques were followed to maintain 50% and 25% moisture stress content in the pots after 22 days of crop growth based on field capacity.

Plant growth and biomass of samples were taken by a destructive method at two intervals on 22 days after sowing (i.e., the day of imposing stress) as well as 28 days after sowing (i.e., 6 days after imposing drought stress). Plant growth parameters such as shoot, and root lengths were measured. Root volume was measured using the gravimetric method (Harrington et al. 1994) and expressed in cm3 per plant. Biomass was noted by drying the sample at 55 °C for 72 h and then weighed.

Determination of relative water content and electrolytic leakage

Relative water content (RWC) of leaves was determined by recording fresh weight, saturated weight, and dry weight of leaves (Teulat et al. 2003) and expressed in percentage. Electrolyte leakage was analyzed following the procedure of Mishra et al. (2011).

Leaf tissue/sample extraction

Samples for the determination of osmolytes and accumulation of secondary metabolites of drought stress induced plants inoculated with Firmibacteria were prepared as described in Chanratana et al. (2019). To estimate the levels of antioxidant enzymes, leaf tissue (0.5 g) were ground using a mortar and pestle with liquid nitrogen, and 0.5 g of powdered sample was added to 10 mL of a solution containing 50 mM of potassium phosphate buffer (pH 7) and 1% (w/v) polyvinylpyrrolidone (pH 7.8) and kept at 4 °C for 10 min. Later, the homogenate was filtered using a filter paper followed by centrifugation at 10,000 rpm for 15 min at 4 °C. The supernatant (enzyme extract) was used for the estimation of antioxidant enzymes.

Determination of osmolytes and secondary metabolites

Proline content was estimated according to Bates et al. (1973). The reaction mixture consisted of 2 mL of the leaf extract, 2 mL of acid ninhydrin, and 2 mL of glacial acetic acid. The mixture was kept in boiling water of 100 °C for 1 h and transferred to an ice bath for cooling, and proline was extracted by addition of 4 mL of toluene in which proline appears pinkish to red color, and absorbance was measured using a spectrophotometer (Shimadzu Corporation, Japan) at 520 nm. Proline was used as standard, and the result was expressed as µmol of proline g–1of fresh weight of the leaf sample. Glycine-betaine (GB) estimation was done as described by Greive and Grattan (1983). The leaf extract was diluted 1:1 with 2 N sulfuric acid and cooled in ice water for 1 h. Cold iodine reagent 0.2 mL was added and vortexed. The mixture was stored at 4 °C for 16 h and centrifuged at 10,000 g for 15 min at 0 C. One mL of supernatant was aspirated and kept on ice. The precipitate formed was dissolved in 9 mL of 1,2-dichloro ethane and mixed vigorously. After 2.0–2.5 h, absorbance was measured at 365 nm with a visible spectrophotometer. GB was used as standard and expressed as µg g–1 of leaf tissue. Folin–Ciocalteau method of Singleton and Rossi (1965) was followed to determine total phenols. The reaction mixture was prepared by addition of 0.5 mL of the leaf tissue extract and 2 mL of 20 mM Folin–Ciocalteau reagent, which was kept at room temperature for 2 h. Absorbance was read at 760 nm in a UV-spectrophotometer and expressed as mg g–1 of leaf sample. Estimation of L-phenylalanine ammonia lyase (PAL) was performed according to Dickerson et al. (1984). The reaction was stopped by the addition of 0.5 mL of 2 N HCl, and absorbance was measured at 290 nm, expressed as mol of trans-cinnamic acid min–1 g–1 of leaf tissue. Ferulic acid, a stress defensive compound, was analyzed according to Hura et al. (2007). The presence of ferulic acid was determined with a spectrofluorometer by exciting the sample at 243 nm for 2 min, and absorbance was measured at 434 nm. Ferulic acid was used as standard and expressed as µg g–1 of sample.

Antioxidant enzymes

CAT activity was spectrophotometrically measured as described by Chaparro-Giraldo et al. (2000). The activity was measured by monitoring the degradation of H2O2 by using a UV–visible spectrophotometer at 240 nm. The decrease in H2O2 was followed by the decline in optical density at 240 nm. CAT activity was calculated using the extinction coefficient (ε240nm = 40 mM–1 cm–1) for H2O2 and expressed in mol min–1 g–1 of leaf tissue. Super oxide dismutase (SOD) activity was measured by the method described by Dhindsa et al. (1981). SOD activity was assayed by its ability to inhibit photochemical reduction of nitroblue tetrazolium. Absorbance was read at 560 nm in a UV-spectrophotometer. One unit of enzyme activity was defined as the quantity of enzyme that reduced the absorbance to 50% in comparison with the blank. The enzyme activity was measured as unit SOD min–1 mg–1 protein–1 of leaf sample.

Quantification of gene expression for Firmibacteria mediated drought tolerance

Total RNA from the leaf samples were extracted using an RNeasy plant mini kit (Qiagen, Leusden, The Netherlands) as per the manufacturer’s instructions. The integrity of extracted RNA was assessed through agarose gel electrophoresis (1%). The total RNA was reverse transcribed to complementary DNA (cDNA) using a PrimeScript™ first-strand cDNA synthesis Kit (TAKARA BIO INC. USA) following the manufacturer’s protocol and used as a template for qRT-PCR analysis. A quantitative amplification reaction for pigeon pea proline and drought-responsive genes and reference gene (IF4 initiation factor) was performed in a 96-well plate. Three target genes, such as proline, C. cajan_29830, and C. cajan_33874, and one reference gene, IF4α, were used. The primer for pigeon pea proline gene (F–GCTGCCAGCTTGTTGAATTT; R-TGGTTTGGTGAGTGAGCTTG) was designed using Primer3 software (Primer3 v. 0.4.0) (Untergasser et al. 2012) using the Cajanus cajan proline gene HyPRP obtained from NCBI (KU522131). The primers for drought-responsive gene C. cajan_29830 (F-CTTCCACGTTCAATCTCC; R-GATCTGACCTTACTGGTGAC), drought-responsive gene C. cajan_33874 (F-GAGTTTCGTGAGAAGGAG; R-CTACCCATGACCAAAGAG), and housekeeping gene IF4α (F-GCCGAGATCACACAGTCTCA; R-ACCACGAGCCAAAAGATCAG) were selected from previously published studies (Sinha et al. 2015; Mellacheruvu et al. 2016). Takara SYBR® Premix Ex Taq ™ II (TAKARA BIO INC. USA) was used for the quantification of gene expression in a LightCycler® 480 Instrument II (Roche Molecular Systems, Inc.). The reaction mixture was cDNA, 2 µL; forward primer, 0.8 µL; reverse primer, 0.8 µL; ddH2O, 6.4 µL; and SYBR® Premix Ex Taq ™ II (Tli RNaseH Plus), 10 µL. This reaction mixture was given a short spin for thorough mixing of the cocktail compounds, and the thermal cycler was programmed as follows: Initial denaturation at 95 °C for 15 s; 35 cycles of quantification step at 95 °C for 5 s, 55 °C for 15 s, and 72 °C for 20 s; one cycle of the melting curve at 95 °C for 15 s, 55 °C for 1 min, and 95 °C for 20 s, followed by cooling at 40 °C for 30 s. The housekeeping gene initiation factor was used for the proper normalization of real-time qPCR reaction. Gene expression analysis was performed using relative quantification by the ΔΔCT method (Light Cycler® 480).

Statistical analysis

Data obtained were subjected to analysis of variance (ANOVA), and the significance of differences between the mean value was determined by Tukey’s test at p < 0.05. All data were analyzed using SAS version 9.1.3 service pack 4 (SAS Institute Inc., Cary, North Carolina, USA).

Results

Plant growth and biomass

Plant growth parameters were significantly influenced by bacterial inoculation. At 50% and 25% of FC, Bacillus aryabhattai-treated plants recorded the maximum shoot and root lengths of 47.1 and 46.1 cm plant−1 and 21.7 and 23.4 cm plant–1, respectively, among all the treatments (Table 1; Fig. 1). Firmibacteria inoculation led to an increase in the root volume with Bacillus aryabhattai (0.08 cm3 plant–1) at moisture stress of 25% and Paenibacillus stellifer showed the least root volume (0.03 cm3 plant–1) increase over control. Bacillus aryabhattai registered significantly higher dry weight of plants grown under 50% and 25% FC compared with other treatments as well as with the unstressed condition (Table 1).

Table 1.

Influence of firmibacteria on physiological parameters of pigeon pea in two levels of moisture stress under pot culture condition

Treatment Unstressed* Stressed**
50% FC 25% FC
SL (cm) RL (cm) RV Dry wt SL (cm) RL (cm) RV Dry wt SL (cm) RL (cm) RV Dry wt
T1 41.0 ± 1.9b 17.0 ± 0.8b 0.20 ± 0.01c 0.37 ± 0.02a 47.1 ± 0.5a 21.7 ± 0.55a 0.06 ± 0.0a 0.43 ± 0.03a 46.1 ± 0.6a 23.4 ± 0.61a 0.08 ± 0.004a 0.37 ± 0.03a
T2 42.0 ± 1.9a 18.0 ± 0.8ab 0.40 ± 0.02a 0.35 ± 0.02a 45.3 ± 2.0ab 14.6 ± 0.48b 0.08 ± 0.002b 0.29 ± 0.02b 43.6 ± 0.6b 16.2 ± 0.22b 0.04 ± 0.004b 0.31 ± 0.02a
T3 39.0 ± 1.8c 18.5 ± 0.8a 0.30 ± 0.01b 0.36 ± 0.02a 42.8 ± 1.9b 15.1 ± 0.55b 0.04 ± 0.004c 0.33 ± 0.03b 42.2 ± 0.8b 14.8 ± 0.52c 0.03 ± 0.006c 0.30 ± 0.05a
T4 36.0 ± 1.6d 11.0 ± 0.5c 0.20 ± 0.01c 0.27 ± 0.02b 37.4 ± 1.6d 12.1 ± 0.22c 0.01 ± 0.0d 0.19 ± 0.02c 34.8 ± 0.4c 12.0 ± 0.32d 0.01 ± 0.00d 0.15 ± 0.02b
p > (0.05) 0.29 0.14 0.02 0.02 2.7 1.4 0.006 0.08 2.0 1.3 0.01 0.10
Open in a new tab

T1- Bacillus aryabhattai KSBN2K7, T2- Bacillus azotoformans MTCC2953, T3- Paenibacillus stellifer M3T4B6, T4- Uninoculated control *22 DAS; **28 DAS; SL-Soot length; RL- Root length; RV- Root volume (cm3 plant−1); Dry weight of the plant (g). Plants were maintained in normal water regime up to 22 DAS then exposed to two level of stresses for 6 days and then observation taken on 28DAS. FC-Field capacity. 50% FC means 50% available moisture, i.e., 50% moisture stress. 25% FC means 25% available moisture, i.e., 75% moisture stress. Values are mean (± standard error) (n = 5) and column values followed by different letters are significantly different from each other at 5% Tukey

Fig. 1.

Fig. 1

Open in a new tab

Firmibacterial mediated drought mitigation in pigeon Pea. Plant shoot and root growth under 25% moisture level (A) and root growth difference in treated and control plants under 50% (B) and 25% (C) moisture level. T1—Bacillus aryabhattai KSBN2K7, T2—Bacillus azotoformans MTCC 2953, T3—Paenibacillus stellifer M1T2B8, T4—control

Relative water content and electrolyte leakage

Irrespective of moisture stress levels, Bacillus aryabhattai recorded 26.3% higher relative water content compared with uninoculated control (Table 2). An increase in electrolyte release was observed when the plants were under stress. However, Bacillus aryabhattai inoculated plants exhibited significantly lower leakage of electrolytes, 21.4% and 16.5% against control (39.7% and 47.5%) at 50% and 25% moisture stress, respectively (Table 2), and 17.0% against 23.7% (control) in the unstressed condition.

Table 2.

Influence of firmibacteria on RWC, EC of pigeon pea under two levels of moisture stress under pot culture condition

Treatments Unstressed* Stressed**
50% FC 25%FC
RWC% EC % RWC% EC% RWC% EC%
T1 85.9 ± 9.6 17.0 ± 6.9 82.0 ± 0.03b 21.4 ± 0.49b 84.4 ± 2.71a 16.5 ± 3.6d
T2 87.1 ± 8.5 18.9 ± 1.1 86.5 ± 1.13a 22.1 ± 0.02b 66.6 ± 2.4b 23.3 ± 0.32b
T3 97.5 ± 3.5 14.8 ± 2.4 83.2 ± 0.48b 22.0 ± 0.12b 72.4 ± 2.72ab 19.7 ± 2.35c
T4 73.6 ± 5.4 23.7 ± 2.7 61.6 ± 0.55c 39.7 ± 0.76a 52.9 ± 0.69c 47.5 ± 0.00a
p > (0.05) NS NS 0.12 0.136 0.68 0.88
Open in a new tab

T1- Bacillus aryabhattai KSBN2K7, T2- Bacillus azotoformans MTCC2953, T3- Paenibacillus stellifer M3T4B6, T4- Uninoculated control *22 DAS; **28 DAS; RWC- Relative water content; EC- electrolyte leakage; Plants were maintained in normal water regime up to 22 DAS then exposed to two level of stresses for 6 days & then observation taken on 28DAS. FC-Field capacity. 50% FC means 50% available moisture, i.e., 50% moisture stress. 25% FC means 25% available moisture, i.e., 75% moisture stress. Values are mean (± standard error) (n = 5) and column values followed by different letters are significantly different from each other at 5% Tukey. NS-non-significant

Accumulation of osmolytes, secondary metabolites and antioxidant enzyme activity

Usually, osmolytes are produced in plants in large quantities during any stressful conditions to act as osmoprotectants. Stress osmolytes, proline and GB were greatly influenced by Firmibacteria inoculation during stress. The amount of proline was more or less equal in Firmibacteria inoculated plants and control plants during the unstressed condition. However, upon stress induction, proline accumulation of control plants was higher than that of Firmibacteria inoculated plants. Control plants recorded 0.23 and 0.26 µmol g–1 leaf proline accumulation at 50% and 25% FC, respectively, whereas Bacillus aryabhattai treated plants accumulated a lesser content of proline of 0.15 µmol g–1 leaf at 50% and 25% FC, indicating that treated plants accumulated low amounts of proline than their controls even at two stress conditions. Similarly, Bacillus aryabhattai treated plants accumulated a lesser content of GB of 0.69 µg g–1 leaf against 4.31 µg g–1 leaf of control plants at 50% FC, respectively (Table 3). PAL activity was also significantly decreased in inoculated plants than in control plants under both stressed and unstressed conditions. Bacillus aryabhattai treated plants showed lesser PAL activity (40.8%) compared with uninoculated controls under stressed and unstressed conditions, followed by Bacillus azotoformans and Paenibacillus stellifer treated plants (Table 4). Control plants registered the maximum amount of phenolics as 0.35 and 0.38 mg g–1 of leaf sample during 50% and 25% FC, respectively. The amount was further reduced to 47.2% over control plants in Bacillus aryabhattai treated plants, followed by Bacillus azotoformans and Paenibacillus stellifer treated plants in 50% FC. The same trend was observed at 25% FC (Table 4). In the unstressed condition, the ferulic acid content of Firmibacteria treated plants was similar to that of control plants where there was no significant difference. Even under stressed conditions Firmibacteria inoculation also did not show any predominant effect. However, Bacillus aryabhattai treated plants had a lesser content of ferulic acid at 2.67 and 2.37 µg g–1 of leaf against 2.97 and 2.85 µg g–1 of leaf in control plants at 50% and 25% FC, respectively (Table 4).

Table 3.

Influence of firmibacteria on osmolytes of pigeon pea under two levels of moisture stress under pot culture condition

Treatments Unstressed* Stressed**
50% FC 25%FC
Proline† Glycine‡ betaine Proline† Glycine betaine‡ Proline† Glycine betaine‡
T1 0.103 ± 0.01 1.14 ± 0.00 0.15 ± 0.01b 0.69 ± 0.02d 0.15 ± 0.01b 0.96 ± 0.06b
T2 0.101 ± 0.00 0.97 ± 0.01 0.16 ± 0.01b 0.9 ± 0.030cb 0.13 ± 0.00b 1.18 ± 0.23b
T3 0.10 ± 0.00 0.90 ± 0.00 0.13 ± 0.00b 1.55 ± 0.45b 0.13 ± 0.00b 1.16 ± 0.07b
T4 0.097 ± 0.00 1.05 ± 0.01 0.23 ± 0.01a 4.31 ± 0.06a 0.26 ± 0.01a 1.84 ± 0.22a
p > (0.05) NS NS 0.03 0.69 0.02 0.51
Open in a new tab

T1- Bacillus aryabhattai KSBN2K7, T2- Bacillus azotoformans MTCC2953, T3- Paenibacillus stellifer M3T4B6, T4- Uninoculated control *22 DAS; **28 DAS; Plants were maintained in normal water regime up to 22 DAS & then exposed to two levels on stresses for 6 days then observation taken of 28DAS. FC-Field capacity. 50% FC means 50% available moisture, i.e., 50% moisture stress. 25% FC means 25% available moisture, i.e., 75% moisture stress. Values are mean (± standard error) (n = 5) and column values followed by different letters are significantly different from each other at 5% Tukey. NS non-significant, †µm g−1 fresh leaf tissue; ‡µg g−1 leaf tissue

Table 4.

Influence of firmibacteria on secondary metabolites of pigeon pea under two levels of moisture stress under pot culture condition

Treatments Unstressed* Stressed**
50% FC 25%FC
PAL activity* Total phenolic† Ferulic acid‡ PAL activity Total phenolic† Ferulic acid‡ PAL activity Total phenolic† Ferulic acid‡
T I 63.03 ± 0.4c 0.16 ± 0.00d 3.62 ± 0.03c 71.85 ± 1.75c 0.21 ± 0.01d 2.67 ± 0.04 81.21 ± 10.27c 0.17 ± 0.03c 2.37 ± 0.03
T 2 49.97 ± 0.79d 0.17 ± 0.00c 2.78 ± 0.00b 100.3 ± 2.78b 0.30 ± 0.00b 2.90 ± 0.05 104.8 ± 2.40b 0.25 ± 0.01b 2.70 ± 0.05
T 3 63.93 ± 0.30b 0.22 ± 0.00b 2.60 ± 0.04a 98.86 ± 1.15b 0.26 ± 0.01c 2.70 ± 0.04 106.48 ± 3.26b 0.22 ± 0.02bc 2.60 ± 0.03
T 4 81.76 ± 0.41a 0.25 ± 0.00a 3.73 ± 0.05c 110.37 ± 2.55a 0.35 ± 0.01a 2.97 ± 0.00 148.22 ± 3.20a 0.38 ± 0.01a 2.85 ± 0.02
p > (0.05) 0.10 NS 0.03 6.40 0.02 NS 21.36 0.05 NS
Open in a new tab

T1- Bacillus aryabhattai KSBN2K7, T2- Bacillus azotoformans MTCC2953, T3- Paenibacillus stellifer M3T4B6, T4- Uninoculated control *22 DAS; **28 DAS; Plants were maintained in normal water regime up to 22 DAS & then exposed to two level on stresses for 6 days then observation taken of 28DAS. FC-Field capacity. 50% FC means 50% available moisture, i.e., 50% moisture stress. 25% FC means 25% available moisture, i.e., 75% moisture stress.Values are mean (± standard error) (n = 5) and column values followed by different letters are significantly different from each other at 5% Tukey. NS non-significant *µ mol of trans-cinnamic acid min−1 g protein−1 of leaf tissue, †mg g−1 of leaf tissue; ‡µg g−1 leaf tissue

Activities of CAT and SOD were altered significantly by the inoculation of Firmibacteria under stress conditions. CAT activity in inoculated plants ranged from 0.01 to 0.02 µmol min–1 g–1 of leaf tissue under 50% and 25% FC. Irrespective of stress levels, Firmibacteria inoculation caused 75% reduction in CAT activity in the plants. SOD levels released during unstressed condition did not differ between treated and control plants; however, there was a huge difference of 8.54 SOD min–1 mg protein–1 of leaf sample of Bacillus aryabhattai treated plants compared with control plants (21.67 SOD min–1 mg protein–1 of leaf sample) at 50% FC. Irrespective of stress levels, Bacillus azotoformans treated plants showed the maximum decline in SOD (66.6%) over control plants (Table 5).

Table 5.

Influence of firmibacteria on antioxidants of pigeon pea under two levels of moisture stress under pot culture condition

Treatment Unstressed* Stressed**
50% FC 25% ASM
Catalase activity† SOD‡ Catalase activity† SOD‡ Catalase activity† SOD‡
T 1 0.01 ± 0.0 25.70 ± 2.8 0.01 ± 0.0c 8.54 ± 0.12bc 0.02 ± 0.0b 14.71 ± 0.86b
T 2 0.01 ± 0.0 28.20 ± 4.2 0.02 ± 0.0b 6.71 ± 0.18d 0.01 ± 0.0c 6.74 ± 0.40d
T 3 0.02 ± 0.0 26.18 ± 3.0 0.01 ± 0.0c 11.64 ± 2.34b 0.01 ± 0.0c 11.41 ± 0.53c
T 4 0.03 ± 0.0 26.09 ± 1.6 0.03 ± 0.0a 21.67 ± 0.78a 0.05 ± 0.0a 18.59 ± 1.71a
P > (0.05) NS NS 0.009 3.70 0.005 3.05
Open in a new tab

T1- Bacillus aryabhattai KSBN2K7, T2- Bacillus azotoformans MTCC2953, T3- Paenibacillus stellifer M3T4B6, T4- Uninoculated control *22 DAS; **28 DAS; Plants were maintained in normal water regime up to 22 DAS & then exposed to two level on stresses for 6 days then observation taken of 28DAS. FC-Field capacity. 50% FC means 50% available moisture, i.e., 50% moisture stress. 25% FC means 25% available moisture, i.e., 75% moisture stress. Values are mean (± standard error) (n = 5) and column values followed by different letters are significantly different from each other at 5% Tukey. NS nonsignificant. †mol min−1 g of leaf tissue; ‡Unit SOD min−1 mg protien−1 of leaf sample

Quantification of gene expression

Among the three genes, the proline gene was significantly upregulated as the intensity of drought stress increased in uninoculated control plants (Fig. 2A). Firmibacteria inoculation significantly reduced proline gene expression in pigeon pea at both 50% and 25% moisture stress conditions. The other two drought-responsive genes (C. cajan_29830 and C. cajan_33874) showed different expression levels among the treatments. The expression of C. cajan_29830 gene in control plants grown under 25% moisture stress condition was lower than that in unstressed plants (Fig. 2B). C. cajan_29830 gene showed significantly higher expression in Bacillus aryabhattai treated plants, followed by Bacillus azotoformans treated plants grown under 50% moisture stress level compared with uninoculated control plants. However, gene expression was reduced when the plants were exposed to 25% moisture stress level. Similar to C. cajan_29830 gene expression, C. cajan_33874 gene expression was lower as the level of drought stress increased (Fig. 2C).

Fig. 2.

Fig. 2

Open in a new tab

Relative gene expression level of proline (A), C. cajan_29830 (B) and C. cajan_33874 (C) in leaf tissue of pigeon pea exposed to different levels of drought stress. Data are presented as mean ± SE (standard error) from three replications; letters shows significant differences between treatments according to Tukey (p ≤ 0.05)

Discussion

The effect of Firmibacteria inoculation on the growth of pigeon pea under drought stress at green house conditions was studied. Plant growth and crop productivity are adversely affected by biotic and abiotic stresses through pathogen attack, osmotic stress, and salt and oxidative stresses (Ilangumaran and Smith 2017). A plant biostimulant is any substance or microorganism applied to plants with the aim of enhancing nutrition efficiency, stress tolerance, or crop quality traits (du Jardin 2015). Previously, we reported that the bacterial strains used in the present study could synthesize IAA and ACC deaminase under moisture stress conditions (Devi et al. 2018). IAA can stimulate plant cell proliferation and elongation and induce ACC synthase to produce ACC deaminase (Glick 2012). Significant production of IAA by Firmibacteria employed in this study induced the growth of roots and shoots and root volume of pigeon pea at both levels of drought stress conditions, indicating their efficiency in growth promotion during reduced water level conditions. The amount of ACC, which is an immediate precursor of ethylene, increases during water stress conditions (Ali and Kim 2018); ACC was cleaved by microbial ACC deaminases into α-ketobutyrate and NH4+; thus, serving as a nitrogen source for organisms. Furthermore, reducing ethylene levels during stress periods enabled longer roots and shoots and greater biomass (Sarath et al. 2014). Our results were in agreement with the earlier reports (Miller and Wood 1996; Alami et al. 2000; Selvakumar et al. 2012), which indicated that plant growth-promoting Firmibacteria are efficient in promoting the growth and tolerance of plants in stress condition. An endophytic bacterium, Bacillus subtilis, inoculated in timothy plants significantly showed increased shoot (27%) and root (64%) biomass over control (Gagne-Bourque et al. 2016). Similarly, in the present study, Bacillus aryabhattai-treated plants accumulated higher biomass compared with uninoculated control plants at both the stress levels.

Influence of Firmibacteria on physiological and biochemical parameters of pigeon pea under drought

In most crop species, the typical leaf RWC would be around 60–70% (Tanentzap et al. 2015). In this study, RWC in the leaves of pigeon pea after imposing moisture stress, irrespective of stress levels, was 83.2% in Bacillus aryabhattai inoculated plants. Accumulating evidence of ROS showed that electrolyte leakage is mainly related to K+ efflux from plant cells, which is mediated by plasma membrane cation conductance, which occurs due to any abiotic and biotic stresses (Demidchik et al. 2014). In the present study, electrolyte leakage was observed to be high in the unstressed condition. However, during stress conditions, Bacillus aryabhattai treated plants showed the least release (21.4% and 16.5%) of electrolytes at 50% and 25% FC, indicating the significant role of bacteria in reducing ROS, thereby preventing the K+ loss by plants during stress conditions.

Accumulation of stress osmolytes

Compatible solutes are low molecular weight, highly soluble organic compounds that are usually nontoxic at high cellular concentrations. These solutes protect plants from stress by contributing to cellular osmotic adjustment, ROS detoxification, membrane integrity protection, and enzyme/protein stabilization. These solutes include proline, sucrose, trehalose, and quaternary ammonium compounds, such as GB, alanine betaine, proline betaine, and percolate betaine. Proline accumulation is a symptom of a drought stress injury in plants, and during stress an increase in the endogenous pool of its precursor, glutamate occurs in drought-sensitive plants (Mansour and Ali 2017). High proline accumulation in inoculated plants indicated higher plant tolerance to water stress (Gusain et al. 2015). By contrast, Firmibacteria used in this study could reduce the amount of proline accumulation and relieve the plants from stress. No significant changes in proline content were observed in bacteria inoculated plants and control under unstressed condition, whereas control plants exposed to the stress condition accumulated a higher amount of proline compared with plants exposed to other treatments. Similar to our results, inoculation of Bacillus subtilis B26 had a reverse effect on reducing proline content in shoots and roots of timothy plants under drought stress (Gagne-Bourque et al. 2016). Proline content decreases when proline dehydrogenase and pyroline 5-carboxy dehydrogenase enzymes are activated. These enzymes help in reducing proline accumulation, leading to the downregulation of proline gene expression (Chun et al. 2018). This catabolism occurs when the glutamate pathway (precursor of proline) is hindered. Therefore, we assumed that proline gene expression was downregulated with the higher production of proline dehydrogenase enzyme by our firmibacteria which may have caused the decrease of proline production. GB, a quaternary betaine, is generated by plants to exhibit enhanced tolerance to various kinds of stress during germination and vegetative stages of plant growth. An increase in GB accumulation was induced by PGPR under stress conditions that regulated the stress response of plants by preventing water loss (Nadeem et al. 2010; Sandhya et al. 2010). In contrast there are also studies indicating bacteria-treated maize plants produced less amount GB during drought stress when inoculated with Bacillus amyloliquefaciens (Takahashi and Murata 2008). The decrease in GB levels in Firmibacteria inoculated plants under stress conditions might be attributed to the relieving of the stress levels mediated by Firmibacteria. PAL is involved in the biosynthesis of the polyphenol compounds, such as flavonoids, phenyl propanoids, and lignin, in plants. The activities of PAL, ferulic acid, and total phenolics are induced dramatically in response to various stimuli, such as tissue wounding, abiotic stresses, like drought, heat, light, and low temperatures, and hormones (Hura et al. 2008). By contrast, the present study reported a decrease in the production of PAL, phenolics and ferulic acid production in Firmibacteria treated plants under moisture stress, and this finding could be interpreted comparing with control plants, as Firmibacteria might have relieved the stress in plants (Sandhya et al. 2010) on the assumption that the plants were not allowed to reach that level of stress, leading to higher production of PAL or total phenolics.

Antioxidants

Much of the injury on plants under abiotic stress is due to oxidative damage at the cellular level, which is the result of an imbalance between the formation of ROS and their detoxification. Plant cells possess different antioxidant enzymes, such as CAT, peroxides, SOD, glutathione peroxidase, and ascorbate peroxidase that eliminate these reactive free radicals or suppress their formation (Simova-Stoilova et al. 2008). Inoculation of lettuce (Lactuca stiva L.) with PGPB Pseudomonas mendocina augmented the levels of an antioxidant, CAT, under severe drought conditions, suggesting that PGPB can be used as an inoculant to alleviate the oxidative damage elicited by drought (Kohler 2008). In the present study, Firmibacteria treated plants had lesser production of CAT and SOD compared with control plants, indicating that the plants were relieved from stress by producing lesser amounts of antioxidants. Similar to our results, Sandhya et al. (2010) reported that inoculation of maize with PGPB strains (5 Pseudomonas sp.) under drought stress resulted in decreased activities of antioxidant enzymes, which might be the reason that the plants were not exposed to that level of stress where higher production of antioxidants was not reached compared with control plants. In our results all the stress enzymes, osmolytes and antioxidants decreased upon inoculation of firmibacteria under stressed condition of 50% than 25% FC expect for glycine betaine, ferulic acid and SOD. In 50% FC firmibacteria were able to relieve the plant from the moisture stress which could be evidenced by the lower accumulation of GB, FA and SOD. However under 25% FC plant might have felt much stress even upon inoculation of firmibacteria by accumulating required amount of GB, ferulic acid and SOD and this is yet to be validated by further transcriptome analysis for each parameter.

Quantitative gene expression

Firmibacteria inoculation alone did not exhibit any changes in proline gene expression in unstressed plants compared with control plants. However, proline gene expression increased when plants were subjected to drought stress in both bacterial inoculated and uninoculated plants. These results correlated with the quantitative estimation of proline in different treatments by using a spectrophotometer. Under water stress conditions (50% and 25% FC), higher proline gene expression was observed in control plants than in inoculated plants. Similar results were also observed in Arabidopsis thaliana plants exposed to the water stress condition (Ghosh and Mahopatra 2017). However, proline gene expression was significantly lower in Pseudomonas putida inoculated Arabidopsis thaliana plants than in uninoculated plants after the plants were exposed to 2 days of water stress. Arbuscular mycorrhiza inoculation also considerably decreased proline accumulation in AM symbiotic plant (Chun et al. 2018). In line with this, our study also exhibited a reduction in proline gene expression upon bacterial inoculation. This could be confirmed from the fact that the inoculation of Firmibacteira in pigeon pea enhanced soil hydration or improved plant water uptake through increased root volume or by other unknown mechanisms.

Drought-responsive genes (C. cajan_29830 and C. cajan_33874) were less expressive in a drought susceptible genotype of red gram compared with a drought resistance genotype of red gram (Sinha et al. 2015). In our study, the expression of drought-responsive genes (C. cajan_29830 and C. cajan_33874) reduced as the stress level increased in uninoculated plants. However, the expression of the gene C. cajan_29830 increased in Bacillus azotoformans inoculated plants under the stress condition (50% moisture stress) compared with uninoculated plants. This indicated that bacterial inoculation increased the drought-tolerant nature of the plants. Similarly, the expression of the drought-responsive gene C. cajan_33874 in bacteria inoculated plants increased as the stress level increased. Similar to our results, Sarma and Saikia (2014) also reported that the upregulation of stress-responsive genes dehydration-responsive element-binding protein (DREB2A), catalase (CAT1), and dehydrin (DHN) in PGPB-treated plants under water stress conditions. In contrast to our study, Gontia-Mishra et al. (2016) introduced the wheat plant to drought conditions and found that some stress-related genes (DREB2A and CAT1) were upregulated and after bacterial inoculation (Klebsiella sp. IG 3, Enterobacter ludwigii IG 10, and Flavobacterium sp. IG 15) these genes were downregulated.

Conclusion

Bacillus aryabhattai treatment has a potential role in inducing drought stress tolerance in pigeon pea, followed by Bacillus azotoformans and Paenibacillus stellifer. Our results showed that Bacillus aryabhattai had different regulatory strategies, such as increased root biomass and RWC, decreased levels of osmolytes, proline, GB, and antioxidants, under drought stress in pigeon pea. qRT-PCR results indicated that proline gene expression was downregulated during drought exposure in Bacillus aryabhattai treated plants. Bacillus aryabhattai may be recommended as a bioinoculant for crop growth in drought stress conditions to maintain crop resilience. However, these findings need to be verified in field conditions.

Acknowledgements

This work was supported by the Tamil Nadu Agricultural University (TNAU), India.

Declarations

Conflict of interest

All authors declare that they have no conflict of interest, no animals or humans are used in this study and all authors accepted the final version submitted to the journal.

References

  1. Akhtar SS, Amby DB, Hegelund JN, Fimognari L, Großkinsky DK, Westergaard JC, Müller R, Moelbak L, Liu F, Roitsch T. Bacillus licheniformis FMCH001 increases water use efficiency via growth stimulation in both normal and drought conditions. Front Plant Sci. 2020;11:297. doi: 10.3389/fpls.2020.00297. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Alami Y, Achouak W, Marol C, Heulin T. Rhizosphere soil aggregation and plant growth promotion of sunflowers by an exopolysaccharide-producing Rhizobium sp. Strain isolated from sunflower roots. Appl Environ Microbiol. 2000;66:3393–3398. doi: 10.1128/AEM.66.8.3393-3398.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Ali S, Kim WC. Plant growth promotion under water: decrease of waterlogging-induced ACC and ethylene levels by ACC deaminase-producing bacteria. Front Microbiol. 2018;9:1096. doi: 10.3389/fmicb.2018.01096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bates LS, Waldren RP, Teare ID. Rapid determination of free proline for water-stress studies. Plant Soil. 1973;39:205–207. doi: 10.1007/BF00018060. [DOI] [Google Scholar]
  5. Chanratana M, Joe MM, Roy Choudhury A, Anandham R, Krishnamoorthy R, Kim K, Jeon S, Choi J, Choi J, Sa T. Physiological response of tomato plant to chitosan-immobilized aggregated Methylobacteriumoryzae CBMB20 inoculation under salinity stress. 3 Biotech. 2019;9:397. doi: 10.1007/s13205-019-1923-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Chaparro-Giraldo A, Barata R, Chabregas S, Azevedo RA, Silva-Filho MC. Soybean leghemoglobin targeted to potato chloroplasts influences growth and development of transgenic plants. Plant Cell Rep. 2000;19:961–965. doi: 10.1007/s002990000254. [DOI] [PubMed] [Google Scholar]
  7. Chaves MM, Oliveira MM. Mechanisms underlying plant resilience to water deficits: prospects for water-saving agriculture. J Exp Bot. 2004;55:2365–2384. doi: 10.1093/jxb/erh269. [DOI] [PubMed] [Google Scholar]
  8. Chun SC, Paramasivan M, Chandrasekaran M. Proline accumulation influenced by osmotic stress in arbuscular mycorrhizal symbiotic plants. Front Microbiol. 2018;9:2525. doi: 10.3389/fmicb.2018.02525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Daryanto S, Wang L, Jacinthe PA. Global synthesis of drought effects on food legume production. PLoS ONE. 2015 doi: 10.1371/journal.pone.0127401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Demidchik V, Straltsova D, Medvedev SS, Pozhvanov GA, Sokolik A, Yurin V. Stress-induced electrolyte leakage: the role of K+-permeable channels and involvement in programmed cell death and metabolic adjustment. J Exp Bot. 2014;65:1259–1270. doi: 10.1093/jxb/eru004. [DOI] [PubMed] [Google Scholar]
  11. Devi NSA, Kumutha K, Anandham R, Krishnamoorthy R, Babu R, Gnanachitra M. Plant growth promoting traits of Firmibacteria under drought stress. Res J Agric Sci. 2018;9:1294–1299. [Google Scholar]
  12. Dhindsa RS, Plumb-Dhindsa P, Thorpe TA. Leaf senescence: correlated with increased levels of membrane permeability and lipid peroxidation and decreased levels of superoxide dismutase and catalase. J Exp Bot. 1981;32:93–101. doi: 10.1093/jxb/32.1.93. [DOI] [Google Scholar]
  13. Dickerson DP, Pascholati SF, Hagerman AE, Butler LG, Nicholson RL. Phenylalanine ammonia-lyase and hydroxycinnamate: CoA ligase in maize mesocotyls inoculated with Helminthosporiummaydis or Helminthosporiumcarbonum. Physiol Plant Pathol. 1984;25:111–123. doi: 10.1016/0048-4059(84)90050-X. [DOI] [Google Scholar]
  14. Du Jardin P. Plant biostimulants: definition, concept, main categories and regulation. Sci Hortic. 2015;196:3–14. doi: 10.1016/j.scienta.2015.09.021. [DOI] [Google Scholar]
  15. Egamberdieva D, Davranov K, Wirth S, Hashem A, Abd Allah EF. Impact of soil salinity on the plant-growth–promoting and biological control abilities of root associated bacteria. Saudi J Biol Sci. 2017;24:1601–1608. doi: 10.1016/j.sjbs.2017.07.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gagné-Bourque F, Bertrand A, Claessens A, Aliferis KA, Jabaji S. Alleviation of drought stress and metabolic changes in timothy (Phleumpratense L.) colonized with Bacillus subtilis. Front Plant Sci. 2016;7:584. doi: 10.3389/fpls.2016.00584. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Gaxiola RA, Li J, Undurraga S, Dang LM, Allen GJ, Alper SL, Fink GR. Drought-and salt-tolerant plants result from overexpression of the AVP1 H+-pump. Proc Natl Acad Sci USA. 2001;98:11444–11449. doi: 10.1073/pnas.191389398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Ghosh D, Sen S, Mohapatra S. Modulation of proline metabolic gene expression in Arabidopsis thaliana under water-stressed conditions by a drought-mitigating Pseudomonas putida strain. Ann Microbiol. 2017;67:655–668. doi: 10.1007/s13213-017-1294-y. [DOI] [Google Scholar]
  19. Glick BR. Plant growth-promoting bacteria: mechanisms and applications. Scientifica. 2012 doi: 10.6064/2012/963401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Gontia-Mishra I, Sapre S, Sharma A, Tiwari S. Amelioration of drought tolerance in wheat by the interaction of plant growth-promoting rhizobacteria. Plant Biol. 2016;18:992–1000. doi: 10.1111/plb.12505. [DOI] [PubMed] [Google Scholar]
  21. Greive CM, Grattan SR. Rapid assay for determination of water-soluble quaternary amino compounds. Plant Soil. 1983;70:303–307. doi: 10.1007/BF02374789. [DOI] [Google Scholar]
  22. Gusain YS, Singh US, Sharma AK. Bacterial mediated amelioration of drought stress in drought tolerant and susceptible cultivars of rice (Oryzasativa L.) Afr J Biotechnol. 2015;14:764–773. doi: 10.5897/AJB2015.14405. [DOI] [Google Scholar]
  23. Harrington JT, Mexal JG, Fisher JT. Volume displacement provides a quick and accurate way to quantify new root production. Tree Plant Notes. 1994;45:121–124. [Google Scholar]
  24. Heidari M, Golpayegani A. Effects of water stress and inoculation with plant growth promoting rhizobacteria (PGPR) on antioxidant status and photosynthetic pigments in basil (Ocimumbasilicum L.) J Saudi Soc Agri Sci. 2012;11:57–61. [Google Scholar]
  25. Hura T, Grzesiak S, Hura K, Thiemt E, Tokarz K, Wędzony M. Physiological and biochemical tools useful in drought-tolerance detection in genotypes of winter triticale: accumulation of ferulic acid correlates with drought tolerance. Ann Bot. 2007;100:767–775. doi: 10.1093/aob/mcm162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hura T, Hura K, Grzesiak S. Contents of total phenolics and ferulic acid, and PAL activity during water potential changes in leaves of maize single-cross hybrids of different drought tolerance. J Agron Crop Sci. 2008;194:104–112. doi: 10.1111/j.1439-037X.2008.00297.x. [DOI] [Google Scholar]
  27. Ilangumaran G, Smith DL. Plant growth promoting rhizobacteria in amelioration of salinity stress: a systems biology perspective. Front Plant Sci. 2017;8:1768. doi: 10.3389/fpls.2017.01768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Islam MR, Gregorio GB. Progress of salinity tolerant rice variety development in Bangladesh. SABRAO J Breed Genet. 2013;45:21–30. [Google Scholar]
  29. Jha Y, Subramanian RB. PGPR regulate caspase-like activity, programmed cell death, and antioxidant enzyme activity in paddy under salinity. Physiol Mol Biol Plants. 2014;20:201–207. doi: 10.1007/s12298-014-0224-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kohler J, Hernández JA, Caravaca F, Roldán A. Plant-growth-promoting rhizobacteria and arbuscular mycorrhizal fungi modify alleviation biochemical mechanisms in water-stressed plants. Funct Plant Biol. 2008;35:141–151. doi: 10.1071/FP07218. [DOI] [PubMed] [Google Scholar]
  31. Manoj KP, Kumar V, Kumar M, Shrivastava N, Varma A. Potassium solubilizing microorganisms for sustainable agriculture. Springer; 2016. Rhizosphere microbes: potassium solubilization and crop productivity-present and future aspects; pp. 315–325. [Google Scholar]
  32. Mansour MMF, Ali EF. Evaluation of proline functions in saline conditions. Phytochemistry. 2017;140:52–68. doi: 10.1016/j.phytochem.2017.04.016. [DOI] [PubMed] [Google Scholar]
  33. Mayak S, Tirosh T, Glick BR. Plant growth-promoting bacteria confer resistance in tomato plants to salt stress. Plant Physiol Biochem. 2004;42:565–572. doi: 10.1016/j.plaphy.2004.05.009. [DOI] [PubMed] [Google Scholar]
  34. Mellacheruvu S, Tamirisa S, Vudem DR, Khareedu VR. Pigeonpea hybrid-proline-rich protein (CcHyPRP) Confers biotic and abiotic stress tolerance in transgenic rice. Front Plant Sci. 2016;6:1167. doi: 10.3389/fpls.2015.01167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Miller KJ, Wood JM. Osmoadaptation by rhizosphere bacteria. Annu Rev Microbiol. 1996;50:101–136. doi: 10.1146/annurev.micro.50.1.101. [DOI] [PubMed] [Google Scholar]
  36. Mishra A, Mishra KB, Höermiller II, Heyer AG, Nedbal L. Chlorophyll fluorescence emission as a reporter on cold tolerance in Arabidopsis thaliana accessions. Plant Signal Behav. 2011;6:301–310. doi: 10.4161/psb.6.2.15278. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Nadeem SM, Zahir ZA, Naveed M, Ashraf M. Microbial ACC-deaminase: prospects and applications for inducing salt tolerance in plants. Crit Rev Plant Sci. 2010;29:360–393. doi: 10.1080/07352689.2010.524518. [DOI] [Google Scholar]
  38. Naylor D, DeGraaf S, Purdom E, Coleman-Derr D. Drought and host selection influence bacterial community dynamics in the grass root microbiome. The ISME J. 2017;11:2691. doi: 10.1038/ismej.2017.118. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Sandhya VS, Ali SZ, Grover M, Reddy G, Venkateswarlu B. Effect of plant growth promoting Pseudomonas spp. on compatible solutes, antioxidant status and plant growth of maize under drought stress. Plant Growth Regul. 2010;62:21–30. doi: 10.1007/s10725-010-9479-4. [DOI] [Google Scholar]
  40. Santos-Medellín C, Edwards J, Liechty Z, Nguyen B, Sundaresan V. Drought stress results in a compartment-specific restructuring of the rice root-associated microbiomes. Mbio. 2017;8:e00764–e817. doi: 10.1128/mBio.00764-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Sarath GD, Gutsche AR, Heng-Moss TM, Higley LG, Burd JD. Physiological and biochemical responses of resistant and susceptible wheat to injury by Russian wheat aphid. J Econ Entomol. 2014;100:1692–1703. doi: 10.1603/0022-0493(2007)100[1692:pabror]2.0.co;2. [DOI] [PubMed] [Google Scholar]
  42. Sarma RK, Saikia R. Alleviation of drought stress in mung bean by strain Pseudomonas aeruginosa GGRJ21. Plant Soil. 2014;377:111–126. doi: 10.1007/s11104-013-1981-9. [DOI] [Google Scholar]
  43. Selvakumar G, Panneerselvam P, Ganeshamurthy AN. Bacterial mediated alleviation of abiotic stress in crops In: bacteria in agrobiology: stress management. Springer; 2012. pp. 205–224. [Google Scholar]
  44. Simova-Stoilova L, Demirevska K, Petrova T, Tsenov N, Feller U. Antioxidative protection in wheat varieties under severe recoverable drought at seedling stage. Plant Soil Environ. 2008;54:529–536. doi: 10.17221/427-PSE. [DOI] [Google Scholar]
  45. Singleton VL, Rossi JA. Colorimetry of total phenolics with phosphomolybdic-phosphotungstic acid reagents. Am J Enol Vitic. 1965;16:144–158. [Google Scholar]
  46. Sinha P, Singh VK, Suryanarayana V, Krishnamurthy L, Saxena RK, Varshney RK. Evaluation and validation of housekeeping genes as reference for gene expression studies in pigeonpea (Cajanuscajan) under drought stress conditions. PLoS ONE. 2015;10:e0122847. doi: 10.1371/journal.pone.0122847. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Sofi PA, Baba ZA, Hamid B, Meena RS. Harnessing Soil Rhizobacteria for improving drought resilience in legumes. In: Meena R, Das A, Yadav G, Lal R, editors. Legumes for soil health and sustainable management. Springer; 2018. [Google Scholar]
  48. Takahashi S, Murata N. How do environmental stresses accelerate photoinhibition. Trends Plant Sci. 2008;13:178–182. doi: 10.1016/j.tplants.2008.01.005. [DOI] [PubMed] [Google Scholar]
  49. Tanentzap FM, Stempel A, Ryser P. Reliability of leaf relative water content (RWC) measurements after storage: consequences for in situ measurements. Botany. 2015;93:535–541. doi: 10.1139/cjb-2015-0065. [DOI] [Google Scholar]
  50. Teulat B, Zoumarou-Wallis N, Rotter B, Ben Salem M, Bahri H, This D. QTL for relative water content in field-grown barley and their stability across Mediterranean environments. Theor Appl Genet. 2003;108:181–188. doi: 10.1007/s00122-003-1417-7. [DOI] [PubMed] [Google Scholar]
  51. Timmusk S, Wagner EGH. The plant-growth-promoting rhizobacterium Paenibacilluspolymyxa induces changes in Arabidopsis thaliana gene expression: a possible connection between biotic and abiotic stress responses. Mol Plant Microbe. 1999;12:951–959. doi: 10.1094/MPMI.1999.12.11.951. [DOI] [PubMed] [Google Scholar]
  52. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. Primer3 - new capabilities and interfaces. Nucleic Acids Res Spec Publ. 2012;40:e115. doi: 10.1093/nar/gks596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Wilhite DA, Sivakumar MV, Pulwarty R. Managing drought risk in a changing climate: the role of national drought policy. Weather Clim Extremes. 2014;3:4–13. doi: 10.1016/j.wace.2014.01.002. [DOI] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES