Abstract
There is a constant demand for an effective detection method of major allergens, such as soybean (Glycine max) and wheat (Triticum aestivum). In this study, a triplex polymerase chain reaction (PCR) method was developed for rapid detection of soybean and wheat in processed food products. This triplex PCR contains soybean- and wheat-specific primer pairs and universal primer pair for plant species. Each primer pair was applied to 22 different plant species and showed high specificity with no amplification in non-target species. The sensitivity of triplex PCR for soybean and wheat was 10 pg. The detection limit for soybean and wheat in pea mixture was 0.1%. The developed triplex PCR showed high sensitivity and specificity and was applied to 21 different commercial products. The results were in accordance with the label. Thus, this method is expected to be useful in preventing allergy-related issues via accurate labeling of major allergens in food.
Keywords: Soybean, Wheat, Triplex PCR, Allergen, Processed food products
Introduction
Soybean (Glycine max) and wheat (Triticum aestivum) are the most widely used crops worldwide. They are used as ingredients in various processed foods and raw materials. In addition, they are indicated as major allergens by the United States (USFDA, 2004), European Union (EU, 2011), and United Nations (CAC, 2018). These allergens are of major concern worldwide because of their extensive use. Approximately 5% of adults and 8% of children are likely to be affected by allergy (Sicherer and Sampson, 2014). The only way to avoid allergic reaction is by relying on the information written on the label. Therefore, there is a constant demand for an effective detection method of allergens with high specificity and sensitivity. Currently, there is no international agreement on what allergen exposure level is considered safe. The level of precautionary allergen varies in countries.
Regarding allergens, the detection methods targeting either protein or DNA have been developed. For most analysis, polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA) are employed (Abbott et al., 2010; Poms et al., 2004a). In processed food analysis, the stability of DNA offers advantages in sensitivity. However, because DNA is not the allergenic component, it is an indirect method; therefore, DNA assay has its limits (Poms et al., 2004b). Nevertheless, various studies have developed DNA assays to detect various allergens due to its usefulness (Miyazaki et al., 2019; Palle-Reisch et al., 2015). Previous wheat allergen detection method shows high sensitivity of up to 10 ppm (w/w) even in highly processed food and is used to confirm positive ELISA screening tests (Miyazaki et al., 2019).
The sensitivity and specificity of both DNA- and protein-based methods vary according to the target species. Therefore, it is essential to find the most optimal method of detection. Recent studies show that both ELISA and PCR methods are reliable in detecting wheat gluten from processed foods (Scharf et al., 2013; Yamakawa et al., 2007). In soybean detection, PCR method is more effective, showing less false-negative results (Scharf et al., 2013). However, the detection of each allergen separately from diverse food samples is time-consuming. Furthermore, the amount of extracted DNA from each sample might not be sufficient. Thus, detection through multiplex PCR is not only more effective but also faster and economical.
With each condition in consideration, and given the importance of allergen detection, we present a triplex PCR method to detect soybean and wheat species simultaneously in this study. This method was applied to various processed products, including soybean and wheat.
Methods/experimental
Samples
A total of 21 commercial products, including soybean (Glycine max), wheat (Triticum aestivum), rice (Oryza sativa), pumpkin seed (Cucurbita moschata), maize (Zea mays), oat (Avena sativa), hempseed (Cannabis sativa), quinoa (Quechua kinwa), pea (Pisum sativum), mung bean (Vigna radiata), sword bean (Canavalia gladiate), white kidney bean (Phaseolus multiflorus var. albus Bailey), lentil ( Lens culinaris), chickpea (Cicer arietinum), peanut (Arachis hypogoea), barley (Hordeum vulgare), almond (Prunus dulcis), Brazil nut (Bertholletia excelsa), macadamia (Macadamia integrifolia), hazelnut (Corylus heterophylla), walnut (Juglans regia), and buckwheat (Fogopyrum esculentum), were purchased from online and local markets in Korea. All plant samples and processed products were ground and stored at − 20 °C before analysis.
DNA extraction
The genomic DNA was extracted by Fast Genomic DNA Extraction Kit (Pinucle, Yongin, Korea), following the manufacturer’s instructions. The purity and concetration of isolated DNA samples were determined using nanospectrophotometer (Maestrogen, Las Vegas, NV, USA). The ratio between the absorbance rate at 260 nm and 280 nm was used as the indicator of purity.
Primers
The primer pairs used are listed in Table 1. The primer pairs for soybean, wheat, and plant 18S rRNA were selected considering the amplicon size of each target species for triplex PCR. All primers used in this study were synthesized by Bionics (Bionics, Seoul, Korea).
Table 1.
Primers used in this study
| Target species | Target gene | Primer | Sequence (5′–3′) | Amplicon size (bp) | Reference |
|---|---|---|---|---|---|
| Soybean | Gly m Bd 30K | Gly 30K-6F | GCCACGGGAGCCATAGAAGC | 208 | Torp et al. (2006) |
| Gly30K-6R | TGGCTTTGCATCTACCCTCTT | ||||
| Wheat | Triticum aestivum triticin precursor | Wtr01-5′ | CATCACAATCAACTTATGGTGG | 141 | Hirao et al. (2009) |
| Wtr10-3′ | TTTGGGAGTTGAGACGGGTTA | ||||
| Plant | 18 s rRNA | 18S-F | TGTTGGCCTTCGGGATCGGAGTA | 111 | Mano et al. (2009) |
| 18S-R | GCTTTCGCAGTTGTTCGTCTTTCA |
Simplex PCR reaction
The specificity of three primers was confirmed by simplex PCR on each target allergen. Simplex PCR was performed in a 25-μL mixture containing 2.5 μL of 10× buffer, 200 μM dNTPs, 0.5 unit of Ex-Taq polymerase (Bioneer, Daejeon, Korea), 400 nM of each primer, and 50 ng of DNA template. Simplex PCR was performed as follows: predenaturation at 95 °C for 5 min, 40 cycles consisting of denaturation at 95 °C for 0.5 min, annealing at 60 °C for 0.5 min, and extension at 72 °C for 0.5 min, followed by a final extension at 72 °C for 5 min. The PCR products were electrophoresed on 2% agarose gel (Sea-Kem, Rockland, ME, USA) containing ethidium bromide in 0.5× Tris–acetate-EDTA (TAE) buffer for 22 min at 100 V.
Optimization and sensitivity of triplex PCR
For multiplex PCR, optimal primer concentration was selected out of eight combination. The primer concentration (nM) of soybean/wheat/plant was as follows; 1) 800/400/120, 2) 800/400/160, 3) 800/400/200, 4) 800/400/240, 5) 800/200/120, 6) 800/200/160, 7) 800/200/200, and 8) 800/200/240. The sensitivity of the optimized triplex PCR was evaluated by ten-fold serial dilution with distilled water and 50 ng/μL pea DNA. Triplex PCR was performed in a 25-μL mixture containing 2.5 μL of 10× buffer, 200 μM dNTPs, 1 unit of Ex-Taq polymerase (Bioneer, Daejeon, Korea), 800 nM of wheat primer, 200 nM of soybean primer, 120 nM of 18S rRNA gene universal primer, and 50 ng of DNA template. Multiplex PCR was performed as follows: predenaturation at 95 °C for 5 min, 40 cycles consisting of denaturation at 95 °C for 0.5 min, annealing at 58 °C for 0.5 min, and extension at 72 °C for 0.5 min, followed by a final extension at 72 °C for 5 min. The PCR products were electrophoresed on 3% agarose gel (Sea-Kem, Rockland, ME, USA) containing ethidium bromide in 0.5× Tris–acetate-EDTA (TAE) buffer for 45 min at 100 V.
Results and discussion
Specificity of species-specific primers
After DNA extraction, all genomic DNAs of 22 plant samples were verified using a universal primer targeting 18 s rRNA gene (Mano et al., 2009), with an amplification size of 111 bp (Fig. 1A). These verified DNAs were used to evaluate the specificity of species-specific primer for triplex PCR. The predicted amplification size for soybean and wheat was 208 and 141 bp, respectively. For simultaneous detection of soybean, wheat, and plant DNA, the fragment size difference was set to approximately 50 bp. The specificity of species-specific primers was evaluated with most frequently used plant material in commercial products (Fig. 1). Each target-specific primer showed high specificity with no amplification signal in other non-target species and negative control.
Fig. 1.
Specificity of simplex PCR using plant 18S rRNA primer (A), soybean-specific primer (B) and wheat-specific primer (C). Lane M, 100 bp DNA ladder; lane 1, Glycine max (soybean); lane 2, Triticum aestivum (wheat); lane 3, Oryza sativa (rice); lane 4, Cucurbita moschata (pumpkin seed); lane 5, Zea mays (maize); lane 6, Avena sativa (oat); lane 7, Cannabis Sativa (hempseed); lane 8, Quechua kinwa (quinoa); lane 9, Pisum sativum (pea); lane 10, Vigna radiata (mung bean); lane 11, Canavalia gladiata (sword bean); lane 12, Phaseolus multiflorus var. albus Bailey (white kidney bean), lane 13, Lens culinaris (lentil); lane 14, Arachis hypogoea (peanut); lane 15, Arachis hypogoea (peanut), lane 16, Hordeum vulgare (barley); lane 17, Prunus dulcis (almond); lane 18, Bertholletia excelsa (brazilnut); lane 19, Macadamia integrifolia (macadamia); lane 20, Corylus heterophylla (hazelnut); lane 21, Juglans regia (walnut), lane 22, Fogopyrum esculentum (buckwheat); lane N, non-template
Development of triplex PCR
To develop a fast and reliable detection method of soybean and wheat, the optimization of three primer concentration was necessary, because each primer for triplex PCR had differences in amplification efficiency. Thus, out of the eight combinations, the combination with similar fragment thickness of two target species was selected as the optimal concentration of three primers (Fig. 2). Further experiments were performed using 800 nM of wheat primer, 200 nM of soybean primer, 120 nM of 18S rRNA gene universal primer (lane 9 in Fig. 2).
Fig. 2.
8 different combinations of primer concentration for triplex PCR. Lane M, 100 bp DNA ladder; lanes 1–2, 800/400/120 nM (primer concentration of soybean/wheat/plant); lanes 3–4, 800/400/160; lanes 5–6, 800/400/200; lanes 7–8, 800/400/240; lanes 9–10, 800/200/120; lanes 11–12, 800/200/160; lanes 13–14, 800/200/200; lanes 15–16, 800/200/240. Lanes 1, 3, 5, 7, 9, 11, 13 and 15, DNA of soybean and wheat; lanes 2, 4, 6, 8, 10, 12, 14 and16, non-template
The specificity of the optimized triplex PCR was confirmed by amplifying single species (wheat or soybean) separately and both species simultaneously (Fig. 3A). Two PCR fragments were obtained in triplex PCR with only the DNA of the target species (wheat or soybean) (lanes 1 and 2 in Fig. 3A). For triplex PCR with both soybean and wheat genomic DNA, all three PCR bands with amplification sizes of 111, 141, and 208 bp were detected (lane 3 in Fig. 3A). Furthermore, no PCR product was detected for negative control processed with water. The results show the developed triplex PCR specific to soybean and wheat species.
Fig. 3.
Specificity and sensitivtiy of triplex PCR. (A) Specificity of triplex PCR. Lane M, 100 bp DNA ladder; lane 1, wheat; lane 2, soybean; lane 3, soybean and wheat; lane N, non-template. (B) Limit of detection of triplex PCR using soybean and wheat DNAs diluted serially by distilled water. Lane M, 100 bp ladder; lanes 1–6, 50 ng, 5 ng, 500 pg, 50 pg, 10 pg and 5 pg of two target species; lane N: non-template. (C) Limit of detection of triplex PCR using soybean and wheat DNAs diluted serially by pea DNA. Lane M: 100 bp ladder; lane P: postive control (50 ng of DNA from target specie); lanes 1–4: 10%, 1%, 0.1%, and 0.01% soybean and wheat in pea; lane N: non-template
The limit of detection (LOD) of triplex PCR was tested using diluted target DNA with both distilled water and pea DNA. In dilution with distilled water, 50 ng of each genomic DNA of soybean and wheat was mixed and diluted, ranging from 50 ng to 5 pg. The LOD was determined up to the DNA amount when all the three bands were detected. Thus, as shown in Fig. 3B, the LOD of the triplex PCR was 10 pg for soybean and wheat. In addition, dilution with pea DNA was conducted to measure the sensitivity of the developed triplex PCR in mixed product containing the genomic DNA of other species. To estimate the effect of other plant species on LOD, pea was selected in this study, because it is one of the major legumes and is widely used in many commercial products as a source of protein due to its availability and high protein content (Ge et al., 2020). About 50 ng of each genomic DNA of soybean and wheat was mixed and diluted by ten-fold with 50 ng of pea DNA (Fig. 3C). The dilution ranged from 10% to 0.01%. As shown in Fig. 3C, the LOD for this triplex PCR was 0.1% of the target DNA. The detection limit of 0.1% was comparable to previously develop multiplex PCR allergen detection methods specific to soybean (Köppel et al., 2012). Additionally, it showed higher detection limit than the similar triplex PCR with two allergen primer and one internal DNA control primer (Hubalkova and Rencova, 2011). Compared to previously reported methods, our method with a plant 18 s rRNA primer not only detected two allergens simultaneously, but also confirmed the presence of plant DNA in the sample. Thus, these results showed that the triplex PCR developed in this study had sufficient sensitivity for detecting soybean and wheat in foods.
Application of triplex PCR assay to commercial food
The application test of the triplex PCR was conducted on 21 products with either soybean or wheat on the product label (Fig. 4; Table 2). The 21 processed products include three instant foods, two processed beans, one fermented soybean, two fast-fermented bean pastes, two other processed agricultural products, one dumpling, one bread product, one sausage, six pressed ham, and two plant-based meats to verify the application of the triplex PCR to various types of processed food products. The application results were in accordance with the allergen information presented on the label (Table 2). In addition, all processed products were amplified by a universal primer in a single reaction, suggesting that false-negative results were prevented in triplex PCR reaction. Therefore, this method can simultaneously monitor soybean and wheat in processed food products and provide the consumer with accurate information on soybean and wheat.
Fig. 4.
Application of triplex PCR to processed food products. Detailed allergen information on 21 processed food products is shown in Table 2. Lane M, 100 bp ladder; lane P, postive control (50 ng of DNA from target specie); lanes 1–3, instant foods; lanes 4–5, bean processed foods; lane 6, fermented soybean; lanes 7–8, Fast fermented bean pastes; lanes 9–10, other processed agricultural products; lane 11, dumpling; lane 12, bread product; lane 13, sausage; lanes 14–19, pressed ham; lanes 20–21, plant based meats; lane N: non-template
Table 2.
Application of triplex PCR to processed food products
| No. | Commerical food products | Labeling | Triplex PCR results | |||
|---|---|---|---|---|---|---|
| Soybean | Wheat | Soybean | Wheat | Plant | ||
| 1 | Instant food—1 | + | − | + | − | + |
| 2 | Instant food—2 | + | + | + | + | + |
| 3 | Instant food—3 | + | − | + | − | + |
| 4 | Bean processed food—1 | + | − | + | − | + |
| 5 | Bean processed food—2 | + | − | + | − | + |
| 6 | Fermented soybean—1 | + | − | + | − | + |
| 7 | Fast fermented bean paste—1 | − | + | − | + | + |
| 8 | Fast fermented bean paste—2 | − | + | − | + | + |
| 9 | Other processed agricultural product—1 | + | − | + | − | + |
| 10 | Other processed agricultural product—2 | + | − | + | − | + |
| 11 | Dumpling—1 | + | + | + | + | + |
| 12 | Bread product—1 | + | + | + | + | + |
| 13 | Sausage—1 | + | − | + | − | + |
| 14 | Pressed ham—1 | + | − | + | − | + |
| 15 | Pressed ham—2 | + | − | + | − | + |
| 16 | Pressed ham—3 | + | − | + | − | + |
| 17 | Pressed ham—4 | + | − | + | − | + |
| 18 | Pressed ham—5 | + | − | + | − | + |
| 19 | Pressed ham—6 | + | − | + | − | + |
| 20 | Plant based meat—1 | + | − | + | − | + |
| 21 | Plant based meat—2 | + | + | + | + | + |
Acknowledgements
This paper was conducted with the support of Kyung Hee University's (University Innovation 2020) undergraduate research support project in 2020.
Declaration
Conflict of interest
The authors declare that there is no conflict of interest.
Footnotes
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Jiyong Shin, Email: tim213@khu.ac.kr.
Mi-Ju Kim, Email: mijukim79@gmail.com.
Hae-Yeong Kim, Email: hykim@khu.ac.kr.
References
- Abbott M, Hayward S, Ross W, Godefroy SB, Ulberth F, Van Hengel AJ, Roberts J, Akiyama H, Popping B, Yeung JM, Wehling P, Taylor SL, Poms RE, Delahaut P. Validation procedures for quantitative food allergen ELISA methods: Community guidance and best practices. Journal of AOAC International. 2010;93:442–450. doi: 10.1093/jaoac/93.2.442. [DOI] [PubMed] [Google Scholar]
- Codex Alimentarius Commission (CAC). General standard for the labeling of prepackaged foods (2018)
- European Union. Regulation (EU) No 1169/2011 of the European parliament and of the council of 25 October 2011 on the provision of food information to consumers. (2011)
- Ge J, Sun CX, Corke H, Gul K, Gan RY, Fang Y. The health benefits, functional properties, modifications, and applications of pea (Pisum sativum L.) protein: Current status, challenges, and perspectives. Comprehensive Reviews in Food Science and Food Safety. 19: 1835-1876 (2020) [DOI] [PubMed]
- Hirao T, Watanabe S, Temmei Y, Hiramoto M, Kato H. Qualitative polymerase chain reaction methods for detecting major food allergens (peanut, soybean, and wheat) by using internal transcribed spacer region. Journal of AOAC International. 2009;92:1464–1471. doi: 10.1093/jaoac/92.5.1464. [DOI] [PubMed] [Google Scholar]
- Hubalkova Z, Rencova E. One-step multiplex PCR method for the determination of pecan and Brazil nut allergens in food products. Journal of the Science of Food and Agriculture. 2011;91:2407–2411. doi: 10.1002/jsfa.4479. [DOI] [PubMed] [Google Scholar]
- Köppel R, van Velsen-Zimmerli F, Bucher T. Two quantitative hexaplex real-time PCR systems for the detection and quantification of DNA from twelve allergens in food. European Food Research and Technology. 2012;235:843–852. doi: 10.1007/s00217-012-1806-8. [DOI] [Google Scholar]
- Mano J, Shigemitsu N, Futo S, Akiyama H, Teshima R, Hino A, Furui S, Kitta K. Real-time PCR array a universal platform for the detection of genetically modified crops and its application in identifying unapproved genetically modified crops in Japan. Journal of Agricultural and Food Chemistry. 2009;57:26–37. doi: 10.1021/jf802551h. [DOI] [PubMed] [Google Scholar]
- Miyazaki A, Watanabe S, Ogata K, Nagatomi Y, Kokutani R, Minegishi Y, Tamehiro N, Sakai S, Adachi R, Hirao T. Real-time PCR detection methods for food allergens (wheat, buckwheat, and peanuts) using reference plasmids. Journal of Agricultural and Food Chemistry. 2019;67:5680–5686. doi: 10.1021/acs.jafc.9b01234. [DOI] [PubMed] [Google Scholar]
- Palle-Reisch M, Hochegger R, Cichna-Markl M. Development and validation of a triplex real-time PCR assay for the simultaneous detection of three mustard species and three celery varieties in food. Food Chemistry. 2015;184:46–56. doi: 10.1016/j.foodchem.2015.03.049. [DOI] [PubMed] [Google Scholar]
- Poms RE, Anklam E, Kuhn M. Polymerase chain reaction techniques for food allergen detection. Journal of AOAC International. 2004;87:1391–1397. doi: 10.1093/jaoac/87.6.1391. [DOI] [PubMed] [Google Scholar]
- Poms RE, Klein CL, Anklam E. Methods for allergen analysis in food: a review. Food Additives and Contaminants. 2004;21:1–31. doi: 10.1080/02652030310001620423. [DOI] [PubMed] [Google Scholar]
- Scharf A, Kasel U, Wichmann G, Besler M. Performance of ELISA and PCR methods for determination of allergen in food: an evaluation of six years of proficiency testing for Soy (Glycine max L.) and Wheat Gluten (Triticum aestivum L.) Journal of Agricultural and Food Chemistry. 2013;61:10261–10272. doi: 10.1021/jf402619d. [DOI] [PubMed] [Google Scholar]
- Sicherer SH, Sampson HA. Food allergy: Epidemiology, pathogenesis, diagnosis, and treatment. Journal of Allergy and Clinical Immunology. 2014;133:291–307. doi: 10.1016/j.jaci.2013.11.020. [DOI] [PubMed] [Google Scholar]
- Torp AM, Olesen A, Sten E, Stahl Skov P, Bindslev-Jensen U, Poulsen LK, Bindslev-Jensen C, Andersen SB. Specific, semi-quantitative detection of the soybean allergen Gly m Bd 30 K DNA by PCR. Food Control. 2006;17:30–36. doi: 10.1016/j.foodcont.2004.08.005. [DOI] [Google Scholar]
- US Food and Drug Administration. Food Allergen Labeling and Consumer Protection Act of 2004 (FALCPA) (2004)
- Yamakawa H, Akiyama H, Endo Y, Miyatake K, Sakata K, Sakai S, Toyoda M, Urisu A. Specific detection of wheat residues in processed foods by polymerase chain reaction. Bioscience, Biotechnology, and Biochemistry. 2007;71:2561–2564. doi: 10.1271/bbb.70251. [DOI] [PubMed] [Google Scholar]