Abstract
At low temperatures, psychrotolerant B. cereus group strains exhibit a higher growth rate than mesophilic strains do. However, the different survival responses of the psychrotolerant strain (BCG34) and the mesophilic strain (BCGT) at low temperatures are unclear. We investigated the morphological and genomic features of BCGT and BCG34 to characterize their growth strategies at low temperatures. At low temperatures, morphological changes were observed only in BCGT. These morphological changes included the elongation of rod-shaped cells, whereas the cell shape in BCG34 was unchanged at the low temperature. A transcriptomic analysis revealed that both species exhibited different growth-related traits during low-temperature growth. The BCGT strain induces fatty acid biosynthesis, sulfur assimilation, and methionine and cysteine biosynthesis as a survival mechanism in cold systems. Increases in energy metabolism and fatty acid biosynthesis in the mesophilic B. cereus group strain might explain its ability to grow at low temperatures. Several pathways involved in carbohydrate mechanisms were downregulated to conserve the energy required for growth. Peptidoglycan biosynthesis was upregulated, implying that a change of gene expression in both RNA-Seq and RT-qPCR contributed to sustaining its growth and rod shape at low temperatures. These results improve our understanding of the growth response of the B. cereus group, including psychrotolerant B. cereus group strains, at low temperatures and provide information for improving bacterial inhibition strategies in the food industry.
Keywords: Bacillus cereus group, morphology, transcriptome, low temperature, peptidoglycan biosynthesis, energy conservation
1. Introduction
The Bacillus cereus group comprises more than 20 species with close genetic similarity and nine species, namely, B. anthracis, B. cereus, B. cytotoxicus, B. mycoides, B. pseudomycoides, B. thuringiensis, B. toyonensis, B. weihenstephanensis, and B. wiedmannii that can cause anthrax or foodborne illness in humans or insects [1,2,3] depending on the presence and expression of virulence genes. Psychrotolerant B. cereus group strains, such as B. weihenstephanensis and B. wiedmannii, can grow at 7 °C or below, whereas other B. cereus group strains cannot grow at less than 10 °C [3,4,5]. The psychrotolerant B. cereus strains can survive during the production, distribution, and storage of various refrigerated foods, such as dairy products [6]. As the psychrotolerant B. cereus group strains possess enterotoxin or emetic toxin genes [3,7], their existence in refrigerated food products should be monitored, and the control of these species is crucial for improving food safety.
Consumer demand for refrigerated foods has increased due to the retention of nutritional and sensorial qualities in foodstuffs. Cold storage might provide an environment that is favorable for bacterial survival and the growth of psychrotolerant B. cereus strains. A temperature lower than the optimal temperature poses many challenges to bacteria. Exposure to low temperature increases the fluidity of the cell membrane by modifying the fatty acid composition, such as the unsaturated fatty acid composition [8]. Bacteria repress protein-folding and stabilize nucleic acid structures by increasing RNA transcription and translation to allow for their survival at low temperatures [9]. The impact of low temperature on the survival and growth of bacteria has been reported. According to Becker et al. [10], Listeria monocytogenes utilizes an adaptive response mechanism under cold stress that involves a modification of the fatty acid composition of its bacterial membrane to maintain the fluidity of the membrane. The adaptation of Escherichia coli to low temperatures is associated with an increasing ratio of unsaturated fatty acids to saturated fatty acids [11]. In Bacillus subtilis, the stress response to low temperatures involves a high content of branched fatty acids and proteins involved in the translation machinery [12]. The growth of B. cereus at low temperatures is also associated with a higher proportion of unsaturated fatty acids in the bacterial membrane than that found at optimal growth temperatures [13]. In general, bacteria regulate cellular factors such as fatty acid desaturases [13], cold-shock proteins [14], and transcriptional regulators [15,16] to survive at low temperatures.
B. cereus group is not traditionally considered a psychrotrophic species, but psychrotolerant B. cereus group strains possess a growth ability at below 10 °C and have successfully colonized at low temperatures without cold adaptation. In a previous study, we isolated a psychrotolerant B. cereus group strain from fresh vegetables distributed by cold supply chains. Some isolates were grown at less than 10 °C and showed greater biofilm formation at low temperatures than at an optimal temperature [17]. The survival response in cold adaptation strategies of B. cereus under cold conditions has been studied, but limited information is available on the growth response of psychrotolerant B. cereus group strains (which are able to colonize without cold adaptation) under cold conditions. In this study, we investigated whether a psychrotolerant B. cereus group strain reveals a similar response to growth at low temperatures as a mesophilic B. cereus group strain. This study compared the relevant transcriptomic changes and morphological changes in each B. cereus group strain using field-emission scanning electron microscopy (FE-SEM) and RNA sequencing at optimal (30 °C) and low temperatures (10 °C) to confirm the morphological and transcriptomic changes associated with the growth of a mesophilic B. cereus strain and a psychrotolerant B. cereus group strain at low temperature. The present study may provide a better understanding of the bacterial growth response employed by B. cereus group strains, including psychrotolerant strains, at low temperatures.
2. Materials and Methods
2.1. Bacterial Strains and Growth Conditions
The experiments conducted in this study were performed with a mesophilic B. cereus strain (B. cereus ATCC 14579, BCGT) and a psychrotolerant B. cereus strain (food isolate, BCG34). The food isolate BCG34 is a psychrotolerant strain isolated from our previous study [17]. The two types of B. cereus group were cultured using tryptic soy broth (TSB, Merck, Darmstadt, Germany) at 30 °C. As the mesophilic B. cereus group (BCGT) did not grow without the adaptation process at the low temperature, pre-cultures were propagated to an OD600 of 0.5 at 30 °C, diluted to an OD600 of 0.1, and subsequently transferred to a lower growth temperature (20 °C) depending on the individual experiments for the adaptation of BCGT to low temperatures. The growth regimen applied allowed the growth of the cultures to an OD600 of at least 6, and the cultures were propagated at a lower temperature (15 °C) for at least three generations before harvesting. Fifteen days after the transfer to 10 °C, when the OD600 exceeded 0.6, the cultures were harvested for growth capability evaluation and RNA extraction. The psychrotolerant strain BCG34 was activated at 30 °C, transferred to 10 °C, and incubated for 8 days (OD600>0.6) without cold adaptation processing. BCGT and BCG34 grown at 30 °C were included as controls for RNA sequencing.
2.2. Bacterial Growth Capability at Low Temperature
The mesophilic (BCGT) B. cereus strain and the psychrotolerant (BCG34) B. cereus strain were first incubated overnight at 30 °C. The overnight cultures of BCGT and BCG34 were activated at 10 °C, diluted to a final concentration of 1 × 103 log CFU/mL, and then incubated in triplicate at 10 °C for 12 days and 7 °C for 30 days to evaluate the growth capability at low temperatures. The bacterial suspension was cultured at various time intervals (0, 5, 10, 15, 20, 25, and 30 days for 7 °C and 0, 2, 4, 6, 8, 10, and 12 days for 10 °C) during growth at low temperatures, from which aliquots were serially diluted in 0.85% sterile saline. Then, 100 µL of each dilution was inoculated on Mannitol egg yolk polymyxin agar (MYP, Merck, Germany) in duplicate, followed by incubation at 30 °C for 24 h before a colony count was performed.
2.3. Field-Emission Scanning Electron Microscopy (FE-SEM)
To obtain vegetative cells (endospore-free suspension), the mesophilic (BCGT) B. cereus group strain and the psychrotolerant (BCG34) B. cereus group strain were first incubated overnight at 30 °C, and 1 mL suspensions were then poured in 99 mL of TSB. The final suspensions were allowed to grow at 30 °C for 4 h, when the cell density reached 7 log CFU/mL [18]. In addition, BCGT and BCG34 also grew at 10 °C for 10 days (for BCGT) and 8 days (for BCG34) to collect the vegetative cells activated at low temperatures. For the preprocessing of the samples for field-emission scanning electron microscopy (FE-SEM), the cells activated at 30 and 10 °C were collected by centrifugation at 2320× g and 4 °C for 10 min, washed twice with 0.85% sterile saline, fixed with 2.0% paraformaldehyde and 2.0% glutaraldehyde in 0.05 M cacodylate buffer (pH 7.2) overnight at 4°C, and washed three times with 0.05 M sodium cacodylate buffer (pH 7.2) at 2320× g for 5 min. The samples were then postfixed with 1% osmium tetroxide in 0.05 M cacodylate buffer (pH 7.2) for 1.5 h at 4 °C and again washed three times with distilled water. Subsequently, the specimens were dehydrated through a graded ethanol series (30, 40, 50, 70, 80, 90, and 100%). The drying process was conducted twice with 100% hexamethyldisilazane (HMDS) for 5 min. Afterward, a platinum film coating made the cell surface observable by an FE-SEM instrument (SUPRA 40 VP, Carl Zeiss Oberkochen, Germany).
2.4. RNA Sequencing
2.4.1. Cell Lysis and RNA Isolation
Briefly, total RNA from the mesophilic (BCGT) B. cereus group strain and the psychrotolerant (BCG34) B. cereus group strain grown at 30 and 10 °C in TSB broth to the mid-exponential phase (OD600 > 0.6) was extracted using an RNA plus mini kit (Qiagen, Germany) according to the manufacturer’s protocol for next-generation sequencing and quantitative real-time PCR (RT-qPCR) assay. Duplicates of RNA samples with an RNA integrity number > 7.0 were used for RNA sequencing by Bioneer Company (Daejeon, Korea). The purity, concentration, and integrity of the RNA samples were determined using NanoDrop (Thermo Scientific, Wilmington, DE, USA), Agilent 2100, and Qubit 2.0 instruments, respectively. The RNA samples were purified and fragmented using the TruSeq RNA Sample Preparation Kit v2-Set A (Illumina, San Diego, CA, USA) for library construction.
2.4.2. Illumina Sequencing
B. cereus transcriptomes were sequenced on the Illumina HiSeq 2500 (Illumina, San Diego, CA, USA) platform, and de novo assembly was performed with the short paired end reads. Prior to transcript assembly, all raw reads were processed to remove low-quality and adapter sequences. After filtering, the trimmed reads were assessed using FastQC (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 16 January 2020)). The preprocessed reads were aligned to the B. cereus group reference genome (GenBank Accessions: NZ_CP034551, NZ_CP064875, NZ_CP021061, NZ_CP032365, and NZ_CP000903) to obtain high-quality clean reads. Finally, the reads from BCGT and BCG34 were mapped to the complete sequenced genomes of NZ_CP034551 and NZ_CP000903, respectively. The clean reads were then assembled into contigs, transcripts, and unigenes using the Trinity platform. The raw data have been submitted to the NCBI Sequence Read Archive with the accession number PRJNA727406.
2.4.3. Differential Gene Expression Analysis
Bowtie was used to align the read reference sequences [19], and the expression levels were estimated by RSEM [20]. The gene expression level was measured as the number of clean reads mapped to the reference sequence and normalized to fragments per kilobase per million (FPKM) fragments. Differential expression analysis was conducted via pairwise comparisons using the Benjamini–Hochberg method with EBSeq software [21]. The false discovery rate (FDR) was used to determine the threshold P-value in multiple tests and analyses. The criteria FDR < 0.01 and absolute value of log2 (FC) ≥ 1 were used as thresholds to define significantly different gene expression levels [22]. Functional classification of the DEGs was conducted through BLAST analysis as described above. GO enrichment analysis and KEGG pathway enrichment analysis were performed using DAVID bioinformatics resources 6.8 (https://david.ncifcrf.gov/ (accessed on 16 January 2020)). For pathway enrichment analysis, all DEGs were aligned to terms in the KEGG pathway database (https://www.genome.jp/kegg/pathway.html (accessed on 16 January 2016)) and searched to identify significantly enriched KEGG terms.
2.5. Gene Expression Analysis Using Reverse Transcription Quantitative PCR (RT-qPCR)
Total RNA was extracted using an RNA plus mini kit (Qiagen, Hilden, Germany) from the mesophilic B. cereus group strain and the psychrotolerant B. cereus group strain. Complementary DNA was synthesized using a High-Capacity RNA-to-cDNATM kit (Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions. Three independent experiments were performed. Six differentially expressed genes (DEGs) with a twofold change and a p-value < 0.05 were selected for RT-qPCR analysis. The qPCR was performed using 20 uL reaction volume with a cDNA template, SYBR premix, and primer pairs by ABI QuantStudio™ 3 real time system (ABI Systems, Foster City, CA, USA). The housekeeping gene rpoB was used as the reference gene to normalize and estimate the up- or downregulation of the selected genes. Gene-specific primer pairs were designed using the NCBI primer BLAST tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast (accessed on 9 April 2021)) and Primer3Plus (https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi (accessed on 9 April 2021)). All primers are listed in Table 1. The relative expression level of each gene was calculated using the 2−∆∆Ct method with a reference gene. The results were expressed as the fold change (log2) between 30 and 10 °C.
Table 1.
Primer sequences for RT-qPCR.
| Gene | Primer | Sequence (5′→3′) |
Tm (°C) |
GC (%) |
Product Size (bp) |
|---|---|---|---|---|---|
| uppP | uppP -F | TCCAGCAGGTGTTATTGGTG | 60.1 | 50.0 | 186 |
| uppP -R | GCTTGTGCTAATCCGACGAT | 60.0 | 50.0 | ||
| murG | murG -F | GGTACAGCCGGACACGTTAT | 59.9 | 50.0 | 155 |
| murG -R | CTCCTAAGCTTTCCCGTTGA | 59.4 | 55.0 | ||
| mraY | mraY -F | AGCTTTAGGTGGAGCCATTG | 59.3 | 60.0 | 210 |
| mraY -R | GTCACAACAACACGCCACTC | 60.2 | 55.0 | ||
| fabG | fabG -F | GCAGCGAAAGTAGGACTTGT | 57.2 | 60.0 | 182 |
| fabG -R | TCACCTGTTCCAGATCTACC | 55.0 | 50.0 | ||
| fabH | fabH -F | GAATTAGGAGCAGACGGAAG | 56.6 | 55.0 | 211 |
| fabH -R | ACCTCTCTCTTGCAGATTCC | 56.0 | 50.0 | ||
| fadE | fadE -F | AAGAAGGAGAGCAAGCTAGG | 55.7 | 50.0 | 152 |
| fadE -R | GCAATACCGTTACGACCTC | 55.7 | 52.6 | ||
| rpoB | rpoB-F | CGGAGCTTGGTTAGAGTATG | 55.2 | 50.0 | 230 |
| rpoB-R | CAGGACGTAGACGCTCATAA | 56.6 | 50.0 |
The thermal cycling protocol was as follows: initial denaturation for 10 min at 95 °C followed by 40 cycles of 15 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C. The fluorescence signal was measured at the end of each extension step at 72 °C. After the amplification, a melting curve analysis with a temperature gradient of 0.1 °C/s from 60 to 95 °C was performed to confirm that only the specific products were amplified. Finally, the samples were cooled to 20 °C for 10 s. The 2−ΔΔCt method was used to evaluate the expression levels of each target gene compared with the housekeeping gene, rpoB. The results were expressed as the fold change (log2) between 30 and 10 °C, and the results of the RNA qPCR were consistent with RNA-Seq data. All the experiments were performed in duplicate, and the data presented were obtained from at least three independent experiments.
2.6. Statistical Analyses
Statistical analyses were performed using Microsoft Excel 2018. The growth ability test for the mesophilic B. cereus group strain and the psychrotolerant B. cereus group strain was carried out in triplicate, and the mean values and standard deviations were calculated.
3. Results
3.1. Growth Capability of Mesophilic B. cereus Group Strain and Psychrotolerant B. cereus Group Strain Activated at Low Temperature
BCGT and BCG34 were selected as the mesophilic B. cereus group strain and the psychrotolerant B. cereus group strain, respectively, and the growth rate of these strains at low temperatures was tested. Although BCGT and BCG34 grew at 10 °C, BCG34 showed a higher growth rate than BCGT did, with a lag time of 0.657 and a specific maximum rate of 1.3 (Figure 1a,b).
Figure 1.
Growth curve of mesophilic B. cereus group strain (BCGT) and psychrotolerant B. cereus group strain (BCG34) at 10 °C (a) and 7 °C (b).
At 7 °C, BCG34 exhibited a reduced ability to grow, whereas BCGT was completely unable to grow. Therefore, the morphological and transcriptomic changes in the mesophilic B. cereus group strain and the psychrotolerant B. cereus group strain at low temperatures were compared to understand the differences in the bacterial survival responses between these two different B. cereus groups.
3.2. Microscopic Observations of Mesophilic B. cereus Group Strain and Psychrotolerant B. cereus Group Strain at Low Temperature
The morphological changes in the mesophilic B. cereus group strain and the psychrotolerant B. cereus group strain after cultivation at optimal and low temperatures were observed by FE-SEM, and these observations provide a better understanding of the growth abilities of these different B. cereus groups at low temperatures. After cultivation at 30 °C, BCGT and BCG34 showed similar features of intact and striated membranes with rough surfaces (Figure 2a,d). BCGT and BCG34 cells grown at 30 °C also exhibited a normal rod morphology with a cell length of 1934~2753 µm, but BCGT and BCG34 cells cultivated at 10 °C showed different morphological features (Figure 2b,c for BCGT and Figure 2e,f for BCG34). Specifically, BCGT cells grown at 10 °C were more elongated than those grown at 30 °C, and the cell lengths detected in the experiment ranged from an average of 2.742 µm (observed for BCG34 cells) to a maximum of 7890 µm (observed for BCGT cells). The formation of elongated cells under cold conditions was observed only in BCGT cells. These results are consistent with those obtained by other researchers. Den Besten et al. [23] observed individual B. cereus cells forming filaments during growth under salt stress conditions. Aerobic cultures of B. cereus ATCC 14579 maintained at 15 °C produced larger cells than those obtained after culture at 37 °C [24].
Figure 2.
FE-SEM studies of mesophilic B. cereus group strain (BCGT) and psychrotolerant B. cereus group strain (BCG34) grown at 30 °C (a,d) and 10 °C (b,c,e,f). BCGT at 30 °C (a), BCGT at 10 °C (b,c), BCG34at 30 °C (d), and BCG34 at 10 °C (e,f).
Cell division occurs in different stages: DNA duplication, lengthening of cells, septum formation, septum finalization, and the separation of cells [25]. Elongation and division require the biosynthesis of peptidoglycan, which is an essential component of the cell wall that protects bacteria from environmental stress. The carefully coordinated biosynthesis of peptidoglycans during cell elongation and division is needed for cell viability [26]. The inhibition of cell wall synthesis by the disruption of homeostasis between elongation and division might lead to bacterial death. At low temperatures, some BCGT cells formed pores, whereas others were markedly shrunken and collapsed, and some cell walls and membranes were partially disrupted (Figure 2b). However, the majority of the BCG34 cells activated at 10 °C maintained their original shape, as revealed by the observation that most of the cell wall and cell membrane remained intact, and this maintenance of the cell wall integrity resulted in little outflow of the cellular contents, such as proteins and nucleic acids. Some researchers have reported that the mechanisms of antimicrobial agents include cell wall degradation, damage to the cytoplasmic membrane or membrane proteins, leakage of intracellular contents, coagulation of the cytoplasm, and/or depletion of the proton motive force [27]. When activated at low temperatures, BCGT cells may be unable to maintain their proton motive force, and an imbalance of these forces induces a morphological change that leads to the degradation of peptidoglycan and ultimately results in the disruption of the turgor pressure of the cell membrane as well as the release of internal and cell-wall-associated enzymes [28]. The difference in morphological changes between the mesophilic B. cereus group strain and the psychrotolerant B. cereus group strain cultivated at 10 °C suggests that cold-activated mesophilic B. cereus group isolates may be more susceptible to other environmental stress conditions than the psychrotolerant B. cereus group isolates activated at 10 °C.
3.3. Differential Expression Analysis of Cold-Response-Related Genes
The results from the analysis of the RNA database of the mesophilic B. cereus group strain and the psychrotolerant B. cereus group strain at low temperatures are shown in Table 2.
Table 2.
Statistics of sequencing data assessment.
| Name | Raw | Clean | Mapped | Uniquely Mapped |
Splice | Gene |
|---|---|---|---|---|---|---|
| BCGT_C * | 28,665,486 | 27,171,092 (94.8%) |
26,397,864 (97.2%) |
24,064,848 (88.6%) |
758 (0.0%) |
5015 |
| BCGT_T | 32,167,584 | 30,479,776 (94.8%) |
29,567,793 (97.0%) |
28,795,121 (94.5%) |
2599 (0.0%) |
5089 |
| BCG34_C ** | 26,733,232 | 25,381,698 (94.9%) |
23,359,519 (92.0%) |
22,653,509 (89.3%) |
4025 (0.0%) |
4901 |
| BCG34_T | 36,039,900 | 34,424,698 (95.5%) |
30,175,814 (87.7%) |
14,568,814 (42.3%) |
4051 (0.0%) |
5047 |
* BCGT _C, mesophilic B. cereus group ATCC 14579 activated at 30 °C; BCGT _T, mesophilic B. cereus ATCC 14579 activated at 10 °C. ** BCG34_C, psychrotolerant B. cereus group isolated from foodstuff activated at 30 °C; BCG34_T, psychrotolerant B. cereus group activated at 10 °C.
A total of 28,171,092 reads at 30 °C (BCGT _C) and 30,479,776 reads at 10 °C (BCGT _T) were identified from the mesophilic B. cereus group strain. A total of 25,381,698 reads at 30 °C (BCG34_C) and 36,039,900 reads at 10 °C (BCG34_T) were identified from the psychrotolerant B. cereus group strain. To investigate the impact of low temperature on the survival of the mesophilic (BCGT) B. cereus group strain, a DEG analysis was performed to compare 30 °C and 10 °C among the biological replicates obtained under each condition. A total of 317 genes were differentially expressed, and among these, 172 and 145 genes showed increased and decreased expression, respectively, in BCGT (Figure 3).
Figure 3.
Differential gene expression of mesophilic B. cereus group strain (BCGT) and psychrotolerant B. cereus group strain (BCG34) grown at 10 °C compared to growth at 30 °C, respectively. Stacked bar graph representing the total number of the up- and downregulated genes identified in BCGT and BCG34, considering a fold change greater than 2.0.
According to the gene ontology (GO) classifications, the transcripts in BCGT that showed differential expression between 30 °C and 10 °C were enriched in the small molecule biosynthetic process, organic acid biosynthetic process, lipid metabolic process, and carboxylic acid biosynthetic process (Figure 4a). However, a total of 202 genes were differentially expressed, and 85 and 117 genes showed increased and decreased expression, respectively, in BCG34 (Figure 3). Most DEGs in BCG34 were classified into the subcategories biosynthetic process, response to low temperature, tRNA-aminoacylation, nitrogen compound metabolism process, cellular protein metabolism process, peptide metabolic process, and translation within the biological process category (Figure 4b). Transcripts involved in the glycolysis pathway, tricarboxylic acid (TCA) cycle, ribosome pathway, antibiotic biosynthesis pathway, and secondary metabolite biosynthesis pathways were downregulated at 10 °C compared with 30 °C, and those involved in peptidoglycan biosynthesis and cell wall biosynthesis were upregulated.
Figure 4.
Functional annotation of the DEGs in the mesophilic B. cereus group strain (a) and the psychrotolerant B. cereus group strain (b) grown at 10 °C compared to growth at 30 °C. GO term analyses of transcriptomes categorized as Biological Process (BP), Cellular Component (CC), and Molecular Function (MF).
3.3.1. Lipid Metabolism
In bacteria, fatty acid metabolism is tightly regulated to allow a rapid response to changes in the environment. Moreover, the fatty acid composition of the cell membrane varies depending on the environmental conditions because it plays a leading role in bacterial adaptation to environmental changes [24]. Under cold stress, increases in the unsaturated fatty acid components in the bacterial membrane constitute an adaptive and survival mechanism to increase the flexibility of cold-adapted bacteria [29]. In the BCGT strain, fabG (Log2FC: 4.61) and fabH2 (Log2FC: 3.09), which are related to fatty acid biosynthesis, were upregulated by over 3.0-fold, and fabZ, which is involved in the first stage of membrane lipid biogenesis, was upregulated by 2.85-fold (Table 3). The genes lcfA, fadE, and fadR, which are related to fatty acid degradation, showed significantly increased expression by 3.08-, 4.63-, and 6.84-fold, respectively.
Table 3.
Differential gene expression related to lipid metabolism of the mesophilic B. cereus group strain (BCGT) and the psychrotolerant B. cereus group strain (BCG34) grown at 10 °C compared to growth at 30 °C.
| Description | Gene ID | Gene | Product | Mesophilic B. cereus Group Strain (BCGT) |
Psychrotolerant B. cereus Group Strain (BCG34) |
||
|---|---|---|---|---|---|---|---|
| Fold Change (Log2) |
p-Value | Fold Change (Log2) |
p-Value | ||||
| Lipid metabolism |
TBIG004756 | menE | 2-succinylbenzoate-CoA ligase | −2.79 | 0.037 | 2.97 | 0.219 |
| TBIG001316 | fabG | 3-oxoacyl-[acyl-carrier-protein] reductase | 4.61 | 0.004 | −0.57 | 0.044 | |
| TBIG001751 | fabH2 | 3-oxoacyl-[acyl-carrier-protein] synthase 3 protein 2 | 3.09 | 0.024 | −0.83 | 0.039 | |
| TBIG001966 | lcfA | Long-chain-fatty-acid-CoA ligase | 3.08 | 0.033 | 0.41 | 0.383 | |
| TBIG005175 | fabZ | 3-hydroxyacyl-[acyl-carrier-protein] dehydratase |
2.85 | 0.040 | - * | - | |
| TBIG004904 | fadE | Probable acyl-CoA dehydrogenase | 4.63 | 0.039 | 3.05 | 0.027 | |
| TBIG002725 | fadR | Fatty acid metabolism regulator protein | 6.84 | 0.016 | 0.75 | 0.272 | |
| Biotin metabolism |
TBIG002459 | accC2 | Biotin carboxylase 2 | 5.15 | 0.025 | −1.29 | 0.245 |
| TBIG002460 | yngHB | Biotin/lipoyl attachment protein | 4.64 | 0.013 | −0.82 | 0.472 | |
* Non-detection by RNA sequencing.
However, the expression levels of fabG and fabH2 were decreased by 0.57- and 0.83-fold, respectively, in the psychrotolerant B. cereus group strain at 10 °C in comparison with their levels at 30 °C. The fadE gene related to fatty acid degradation was upregulated by 3.05-fold. RNA-Seq analysis revealed that the fabG, fabH, and fabZ genes related to fatty acid biosynthesis commonly showed significantly increased expression in BCGT at low temperatures. As these genes are essential for fatty acid biosynthesis, their increased expression in the mesophilic B. cereus group at low temperatures might indicate the availability and utilization of fatty acids for bacterial growth. Furthermore, the observed upregulation of fadR, which is involved in blocking fatty acid oxidation by repressing lcfA, fadR, fadB, fadA, fadE, fadH, and fadG, which are related to fatty acid degradation, indicates that the inhibition of fatty acid degradation is needed to prevent membrane lysis and maintain the cell wall composition at low temperatures. Fatty acid biosynthesis was negatively regulated in the psychrotolerant B. cereus group strain at 10 °C, and the downregulation of genes related to fatty acid metabolism may be associated with repression of catabolic metabolism for providing an energy source. This result suggests a mechanism of energy-saving in the psychrotolerant B. cereus group strain for bacterial growth at low temperatures.
3.3.2. Energy Metabolism
The expression of nine genes involved in sulfur metabolism, namely sat, CYSC1_BACHD, cysH, ssuA, cysA2, cysW, cysA, fbpB, and cysU, in the BCGT strain at 10 °C was higher than that at 30 °C (Table 4).
Table 4.
Differential gene expression related to energy metabolism of mesophilic B. cereus group strain (BCGT) and psychrotolerant B. cereus group strain (BCG34) grown at 10 °C compared to growth at 30 °C.
| Description | Gene ID | Gene | Product | Mesophilic B. cereus Group Strain (BCGT) |
Psychrotolerant B. cereus Group Strain (BCG34) |
||
|---|---|---|---|---|---|---|---|
| Fold Change (Log2) |
p-Value | Fold Change (Log2) |
p-Value | ||||
| Energy Metabolism |
TBIG001419 | sat | Sulfate adenylyltransferase | 5.48 | 0.0001 | −3.51 | 0.127 |
| TBIG001420 | CYSC1_ BACHD |
Probable adenylyl-sulfate kinase | 5.68 | 0.0001 | −3.09 | 0.184 | |
| TBIG001418 | cysH | Phosphoadenosine phosphosulfate reductase |
4.12 | 0.003 | −1.01 | 0.624 | |
| TBIG002870 | ssuA | Putative aliphatic sulfonates-binding protein | 7.71 | 0.009 | - * | - | |
| TBIG001323 | cysA2 | Sulfate/thiosulfate import ATP-binding protein | 3.66 | 0.010 | −1.76 | 0.432 | |
| TBIG001098 | cysW | Sulfate transport system permease protein | 3.76 | 0.018 | - | - | |
| TBIG001323 | cysA | Sulfate/thiosulfate import ATP-binding protein | 3.37 | 0.019 | −1.76 | 0.432 | |
| TBIG001324 | fbpB | Ferric transport system permease protein | 3.33 | 0.019 | −1.27 | 0.558 | |
| TBIG001097 | cysU | Sulfate transport system permease protein | 3.29 | 0.033 | - | - | |
| Cysteine metabolism |
TBIG001873 | abrB | Transition state regulatory protein | −2.85 | 0.047 | −2.26 | 0.331 |
| TBIG003929 | metE | 5-methyltetrahydropteroyltriglutamate-homocysteine methyltransferase | 3.82 | 0.035 | −2.98 | 0.027 | |
| TBIG005298 | OAH sulfhydrylase |
O-acetylhomoserine (thiol)-lyase | 4.43 | 0.037 | 0.98 | 0.388 | |
| TBIG002703 | yosT | SPBc2 prophage-derived putative transcriptional regulator |
4.44 | 0.032 | - | - | |
| Glutathione metabolism | TBIG002097 | bsaA | Glutathione peroxidase homolog | 3.16 | 0.020 | 1.67 | 0.469 |
* Non-detection by RNA sequencing.
These genes play an important role in sulfur assimilation metabolism for the biosynthesis of L-cysteine and methionine. For all microorganisms, sulfur, in addition to carbon and nitrogen, is an essential element for growth, although its elemental amount in living organisms is generally very low [30]. Sulfur is needed primarily as a component of the amino acids cysteine and methionine; plays an essential role in a variety of enzyme cofactors, including biotin, coenzyme A, coenzyme M, thiamine, and lipoic acid; and is critical in many redox processes [31]. Cysteine and sulfate are the preferred sources of sulfur for bacterial species. Moreover, cysteine-derived proteins such as thioredoxin play a central role in protection against oxidative stress. Sulfur for biosynthetic processes is derived from the assimilation of inorganic sulfate by bacteria. Sulfate is taken up by cells from the ambient environment via the ATP-dependent transporter complex CysUWA [32]. CysU and CysW are subunits that form channels in the inner membrane, and CysA is the predicted ATPase subunit driving sulfate translocation [33]. The ssuBACE gene cluster is needed for the utilization of aliphatic sulfonates as sulfur sources [34,35], and the cysH and sat genes encode sulfate transporters [36].
In this study, the BCGT strain activated at low temperatures encoded the set of genes responsible for sulfur metabolism, including the cysC (CYSC1_BACHD), cysH, and sat genes, which are involved in assimilated sulfate reduction. In addition, the BCGT strain possessed a sulfonate transport system that included ssuA and a sulfate transport system that included cysWUA. Furthermore, metE and OAH sulfhydrylase, which are related to cysteine biosynthesis in the BCGT strain, were found at higher levels at 10 °C than at 30 °C. These results showed a trend similar to that reported by Huillet et al. [37], who demonstrated the existence of regulatory connections between sulfur metabolism for cysteine biosynthesis and the oxidative stress response in a mesophilic B. cereus group strain. Our results suggest that increases in genes related to sulfur assimilation metabolism and cysteine biosynthesis might ensure bacterial survival during the growth of mesophilic B. cereus group strains at low temperatures. However, the genes associated with sulfur metabolism were downregulated in the psychrotolerant B. cereus group strain, and the expression of these genes did not show significant differences between the two temperatures.
3.3.3. Amino Acid Metabolism
Arginine is an important nutritional source during bacterial growth and serves as an important energy resource in bacteria by participating in the arginine deiminase (ADI) and arginase pathways. Arginine metabolism via the ADI pathway is widely present in a variety of Gram-positive bacteria, including Bacillus spp., L. monocytogenes, and several lactic acid bacteria, and enables the adaptation to hostile environmental niches and host defenses [38]. The ADI pathway is a multienzyme pathway encoded by arc operon genes, namely arcA, arcB, and arcC, which hydrolyze arginine to ornithine to form ammonia, CO2, and ATP [39]. When B. cereus is exposed to pH 5.5, arcA-arcB-arcC are significantly upregulated in acid-adapted cells compared with non-adapted cells [40]. This result is not consistent with our results. The arcA-arcB-arcC genes of the arginine catabolic operon in the BCGT strain activated at a low temperature were downregulated 6- to 9-fold at 10 °C compared with the levels at 30 °C, and the argH-, argF-, and argJ-encoded enzymes needed for the conversion of glutamate to arginine (arginine biosynthesis) were also downregulated (3- to 7-fold) (Table 5). The downregulation of genes related to arginine catabolism might induce decreases in arginine and citrulline and the accumulation of ornithine. Ornithine is the intermediate compound in arginine biosynthesis and can act as a precursor of proline, which is known to serve as an osmoprotective compound under stress conditions [41,42]. In the BCGT strain activated at a low temperature, the downregulation of the arcA, arcB, argF, and argH genes may be able to increase ornithine accumulation and may be associated with bacterial growth of the mesophilic B. cereus group strain under cold stress.
Table 5.
Differential gene expression related to amino acid metabolism of mesophilic B. cereus group strain (BCGT) and psychrotolerant B. cereus group strain (BCG34) grown at 10 °C compared to growth at 30 °C.
| Description | Gene ID | Gene | Product | Mesophilic B. cereus Group Strain (BCGT) |
Psychrotolerant B. cereus Group Strain (BCG34) |
||
|---|---|---|---|---|---|---|---|
| Fold Change (Log2) |
p-Value | Fold Change Log2) |
p-Value | ||||
| Arginine metabolism |
TBIG000429 | arcC | Carbamate kinase | −7.04 | 0.0002 | - * | - |
| TBIG000427 | arcB | Ornithine carbamoyltransferase | −8.65 | 0.001 | - | - | |
| TBIG003492 | argH | Argininosuccinate lyase | −6.94 | 0.012 | 0.99 | 0.560 | |
| TBIG000426 | arcA | Arginine deiminase | −6.09 | 0.012 | - | - | |
| TBIG004050 | argF | Ornithine carbamoyltransferase | −3.08 | 0.019 | 0.50 | 0.811 | |
| TBIG004053 | argJ | Arginine biosynthesis bifunctional protein | −2.95 | 0.044 | 4.00 | 0.048 | |
| TBIG002004 | bltD | Spermine/spermidine acetyltransferase | −3.51 | 0.035 | 0.77 | 0.734 | |
| TBIG000205 | rocF | Arginase | 3.27 | 0.030 | −1.58 | 0.031 | |
| BCAA metabolism |
TBIG000890 | alsS | Acetolactate synthase | −6.57 | 0.008 | 2.64 | 0.262 |
| TBIG001396 | ilvC1 | Ketol-acid reductoisomerase 1 | −2.83 | 0.032 | −3.31 | 0.177 | |
| TBIG002461 | yngG | Hydroxymethylglutaryl-CoA lyase | 5.24 | 0.0003 | −0.57 | 0.753 | |
| TBIG001913 | LIVB5_ BRUME |
Leu/Ile/Val-binding protein homolog 5 | 3.23 | 0.016 | 5.31 | 0.047 | |
| Histidine metabolism |
TBIG003587 | hutH | Histidine ammonia-lyase | 5.27 | 0.022 | −2.61 | 0.226 |
| TBIG000514 | hutI | Imidazolonepropionase | 5.09 | 0.025 | −2.69 | 0.254 | |
| Tryptophan metabolism | TBIG004527 | Y4613_ BACCR |
UPF0173 metal-dependent hydrolase | 3.25 | 0.040 | ||
| TBIG002724 | kynU | Kynureninase | 0.39 | 0.086 | 3.46 | 0.027 | |
| TBIG002723 | kynB | Kynurenine forma midase | 0.30 | 0.096 | 3.06 | 0.021 | |
* Non-detection by RNA sequencing.
The changes in the expression of genes related to arginine metabolism at the low temperature did not significantly differ between BCG34 and BCGT. However, two genes (kynU and kynB) related to the production of nicotinamide adenine dinucleotide (NAD+) from tryptophan catabolism were increased. NAD+ is utilized as an important cofactor in microbial cellular processes.
3.3.4. Carbohydrate Metabolism
The expression of genes involved in glycolysis, the TCA cycle, butanoate metabolism, and pentose phosphate metabolism was downregulated in the mesophilic B. cereus groupstrain and the psychrotolerant B. cereus group strain at 10 °C compared with that at 30 °C. As shown in Table 6, seven genes (acoC, ldh2, acoL, eno, fba, pdhA, and ldh3) associated with key glycolysis enzymes and three genes (odhA, pdhD, and odhB) involved in the TCA cycle were downregulated in the BCGT strain at 10 °C compared with the levels at 30 °C, which suggests the repression of glycolysis and the TCA cycle at low temperatures. An early event observed during exposure to stress is the downregulation of energy and amino acid metabolism, which might constitute an energy conservation strategy and could represent the transition from bacterial growth to the induction of protective mechanisms [43]. A previous report revealed that stress conditions during bacterial growth decrease cellular respiration and downregulate glycolysis, pyruvate metabolism, and the TCA cycle [44].
Table 6.
Differential gene expression related to carbohydrate metabolism of mesophilic B. cereus strain (BCGT) and psychrotolerant B. cereus strain (BCG34) grown at 10 °C compared to growth at 30 °C.
| Description | Gene ID | Gene | Product | Mesophilic B. cereus Group Strain (BCGT) |
Psychrotolerant B. cereus Group Strain (BCG34) |
||
|---|---|---|---|---|---|---|---|
| Fold Change (Log2) |
p-Value | Fold Change (Log2) |
p-Value | ||||
| Glycolysis/ Gluconeogenesis |
TBIG005105 | licH | Probable 6-phospho-beta-glucosidase | −6.04 | 0.014 | −1.42 | 0.533 |
| TBIG003111 | colA | Colossin-A | −5.54 | 0.017 | −0.96 | 0.655 | |
| TBIG002269 | Hgd | 2-(hydroxymethyl) glutarate dehydrogenase | 4.67 | 0.004 | −0.41 | 0.822 | |
| TBIG002742 | acoC | Dihydrolipoyllysine-residue acetyltransferase component of acetoin cleaving system | −1.02 | 0.044 | −5.99 | 0.026 | |
| TBIG004774 | ldh2 | L-lactate dehydrogenase 2 | −1.74 | 0.036 | −6.63 | 0.012 | |
| TBIG002741 | acoL | Dihydrolipoyl dehydrogenase | −2.29 | 0.073 | −6.51 | 0.017 | |
| TBIG005034 | eno | Enolase | −3.99 | 0.187 | −4.05 | 0.049 | |
| TBIG005229 | fba | Fructose-bisphosphate aldolase | −1.76 | 0.041 | −3.89 | 0.031 | |
| TBIG003899 | pdhA | Pyruvate dehydrogenase E1 component subunit alpha | −0.24 | 0.091 | −3.86 | 0.044 | |
| TBIG004898 | ldh3 | L-lactate dehydrogenase 3 | 0.37 | 0.076 | −7.88 | 0.042 | |
| TBIG005308 | cstA | Carbon starvation protein A | 1.95 | 0.160 | 4.29 | 0.018 | |
| TBIG003044 | adhB | Alcohol dehydrogenase 2 | −1.26 | 0.298 | 4.39 | 0.044 | |
| TBIG002744 | acoA | 2,6-dichlorophenolindophenol oxidoreductase subunit alpha |
−0.70 | 0.058 | −5.82 | 0.033 | |
| TBIG003898 | pdhB | Pyruvate dehydrogenase E1 component subunit beta | −0.70 | 0.755 | −4.67 | 0.047 | |
| TBIG002743 | acoB | 2,6-dichlorophenolindophenol oxidoreductase subunit beta |
−1.79 | 0.052 | −6.29 | 0.027 | |
| TBIG001043 | glpD | Aerobicglycerol−3-phosphate dehydrogenase | −0.83 | 0.516 | −4.39 | 0.069 | |
| TBIG000510 | pflA | Pyruvate formate-lyase-activating enzyme | −5.44 | 0.141 | −8.17 | 0.009 | |
| TBIG002789 | ppaC | Probable manganese-dependent inorganic pyrophosphatase | −0.65 | 0.600 | −4.08 | 0.079 | |
| TBIG001499 | gpsA | Glycerol−3-phosphate dehydrogenase | −2.36 | 0.195 | −3.91 | 0.085 | |
| Citrate cycle (TCA cycle) |
TBIG001253 | odhA | 2-oxoglutarate ehydrogenase E1 component | −0.64 | 0.759 | −4.08 | 0.048 |
| TBIG003896 | pdhD | Dihydrolipoyl dehydrogenase | −0.84 | 0.684 | −4.06 | 0.033 | |
| TBIG001252 | odhB | Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex |
−0.84 | 0.704 | −3.59 | 0.033 | |
| Butanoate metabolism |
TBIG000891 | alsD | Alpha-acetolactate decarboxylase | −6.96 | 0.007 | 1.78 | 0.428 |
| TBIG004083 | buk | Probable butyrate kinase | −1.27 | 0.548 | −3.38 | 0.045 | |
| Inositol phosphate metabolism |
TBIG003692 | PI-PLC | 1-phosphatidylinositol phosphodiesterase |
−3.69 | 0.008 | −4.5 | 0.004 |
| TBIG002621 | Inos | Inositol−3-phosphate synthase | 3.49 | 0.027 | - * | - | |
| Pentose phosphate pathway |
TBIG000359 | pcrB | Heptaprenylglyceryl phosphate synthase | −3.18 | 0.029 | 0.79 | 0.970 |
| TBIG003617 | tkt | Transketolase | −1.77 | 0.292 | −4.96 | 0.031 | |
| TBIG004012 | deoB | Phosphopentomutase | −1.27 | 0.548 | −3.38 | 0.045 | |
| Starch and sucrose metabolism |
TBIG000435 | mapP | Maltose 6′-phosphate phosphatase | −2.82 | 0.033 | 2.05 | 0.368 |
| TBIG003312 | ydzE | Putative permease-like protein | 3.53 | 0.014 | 0.98 | 0.993 | |
| Pyruvate metabolism |
TBIG000509 | pflB | Formate acetyltransferase | −3.97 | 0.039 | −8.65 | 0.251 |
| TBIG002463 | yngE | Uncharacterized carboxylase | 4.49 | 0.042 | −1.84 | 0.381 | |
| Propanoate metabolism |
TBIG002267 | prpB | Methylisocitrate lyase | 4.34 | 0.003 | −2.18 | 0.244 |
| Glyoxylate and dicarboxylate metabolism |
TBIG002265 | mmgD | 2-methylcitrate synthase | 5.32 | 0.024 | −1.07 | 0.524 |
| TBIG003865 | amiF | Formamidase | 3.04 | 0.033 | 2.28 | 0.240 | |
| Amino sugar and nucleotide sugar metabolism |
TBIG003557 | nodB | Chitooligosaccharide deacetylase | 2.72 | 0.038 | 3.49 | 0.200 |
* Non-detection by RNA sequencing.
An analysis of the expression of genes related to the central metabolic pathway (glycolysis) in BCG34 revealed 3.8- to 8.1-fold decreases in fructose-bisphosphate aldolase (fba, log2FC of −3.89), 2,6-dichlorophenolindophenol oxidoreductase subunit alpha and beta (acoA, log2FC of −5.82; acoB, log2FC of −6.29; acoC, log2FC of −5.99), L-lactate dehydrogenase 2 (ldh2, log2FC of −6.63), and pyruvate formate-lyase-activating enzyme (pflA, log2FC of −8.17).
Four genes (phdA, phdB, odhA, and odhB) involved in the TCA cycle were also decreased in BCG34 at 10 °C compared with their levels at 30 °C, whereas the cstA (carbon starvation protein A) and adhB (alcohol dehydrogenase 2) genes were upregulated. Alcohol dehydrogenase (adh) is an NAD(P)-dependent dehydrogenase to which the maintenance of energy metabolism and ATP levels needed for bacterial growth has been ascribed [45]. In E. coli, an increase in carbon-starvation-induced protein (cstA) helps bacteria to survive under carbon- and energy-source-limited conditions during exposure to stress [46].
The metabolic changes experienced by bacteria during growth under low-temperature conditions generally involve the repression of glycolysis and the TCA cycle [47], which is in accordance with our results. During growth at the low temperature, the psychrotolerant strain seemed to prefer to save energy, as indicated by the finding that several genes involved in glycolysis, TCA cycle, pentose phosphate cycle, and butanoate metabolism were downregulated at the low temperature compared to cells activated at the optimal temperature. The downshift of carbohydrate-related metabolic pathways shown in the psychrotolerant B. cereus group strain suggests that catabolic response was inhibited to reserve energy and maintain the growth ability at low temperatures.
3.3.5. Cell Wall/Membrane
Bacillus spp. growing under stress conditions exhibit alterations in their cell wall or membrane [48]. During growth at the low temperature, the epsC gene of the category “cell wall” was downregulated in BCGT relative to its expression at 30 °C, and the murG1 and uppP1 genes involved in peptidoglycan biosynthesis were also repressed (Table 7).
Table 7.
Differential gene expression related to the cell membrane and cell wall of the mesophilic B. cereus group strain (BCGT) and the psychrotolerant B. cereus group strain (BCG34) grown at 10 °C compared to growth at 30 °C.
| Description | Gene ID | Gene | Product | Mesophilic B. cereus Group Strain (BCGT) |
Psychrotolerant B. cereus Group Strain (BCG34) |
||
|---|---|---|---|---|---|---|---|
| Fold Change (Log2) |
p-Value | Fold Change (Log2) |
p-Value | ||||
| Peptidoglycan biosynthesis |
TBIG003837 | murG | UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase | −6.79 | 0.012 | 2.21 | 0.033 |
| TBIG000690 | uppP | Undecaprenyl-diphosphatase | −5.03 | 0.018 | 1.27 | 0.047 | |
| TBIG003840 | mraR | Phospho-N-acetylmuramoyl- pentapeptide-transferase |
−1.81 | 0.047 | 1.76 | 0.030 | |
| TBIG005169 | epsC | UDP-N-acetylglucosamine 4,6-dehydratase | −3.14 | 0.033 | 2.67 | 0.036 | |
| Cell growth factor |
TBIG002125 | spoVS | Stage V sporulation protein S | 2.97 | 0.046 | 3.05 | 0.191 |
| TBIG002015 | cotH | Inner spore coat protein H | 2.63 | 0.042 | 2.79 | 0.241 | |
| TBIG001634 | flgB | Flagellar basal body rod protein | 3.57 | 0.030 | - * | - | |
* Non-detection by RNA sequencing.
The genes involved in peptidoglycan biosynthesis are essential for the elongation and division of many rod-shaped bacteria and are associated with cell wall synthesis [49,50]. Therefore, the observed repression of these genes’ (murG1, uppP1, and epsC) expression was found to be related to peptidoglycan or cell wall biosynthesis.
However, the flgB gene, which encodes the flagellar basal body rod protein, was upregulated in BCGT at 10 °C compared with its expression at 30 °C (Table 7). During exposure to environmental stress, chemotaxis and the ability to swim are important features for bacterial survival. Furthermore, the cell length of B. subtilis generally elongates with increases in flagellar basal bodies [51,52,53]. The temperature-dependent induction of flagellum synthesis has been observed in various bacteria, including pathogenic L. monocytogenes [54], in which Csp proteins regulate flagellum gene expression [55]. In addition, Yersinia enterocolitica [56], which is a cold-tolerant bacterium, overexpresses genes related to flagellar biosynthesis [57]. However, in BCG34, the genes related to peptidoglycan and cell wall biosynthesis were increased at the low temperature compared with the levels found at the optimal temperature; specifically, a 1.2- to 2.7-fold upregulation of three genes, murG1 (2.21 log2FC), uppP1 (1.27 log2FC), and epsC (2.67 log2FC), was observed. These results are in accordance with previous results. Raymond-Bouchard et al. reported that the cold-adapted bacteria Polaromonas sp. upregulates genes such as undecaprenyl diphosphate synthase and UDP-N-acetylmuramyl-tripeptide synthase (murE) for peptidoglycan biosynthesis [58]. Mykytczuk et al. [45] found that Planococcus halocryophilus increases its expression of genes responsible for peptidoglycan synthesis during growth at low temperatures. Since the cell wall/membrane plays an important role in bacterial growth under changed environmental conditions, the upregulation of genes related to peptidoglycan and cell wall biosynthesis in the psychrotolerant B. cereus strain may be used as a growth response to maintain the bacterial cell proliferation and cell rod shape at low temperatures.
4. Conclusions
Storage at low temperature is an effective method for maintaining food quality and inhibiting the growth of foodborne pathogens. However, this strategy might not be appropriate for inhibiting the growth of psychrotolerant B. cereus group strains because these strains are able to survive with a high growth rate under cold conditions. Understanding of the mechanisms associated with bacterial growth at low temperatures is needed to improve the systems used for the management of food safety by inhibiting the frequency of B. cereus group proliferation in foodstuffs distributed via cold supply chains. Our transcriptomic analysis of a mesophilic B. cereus group strain and a psychrotolerant B. cereus group strain grown at low temperatures revealed that these strains utilize different strategies for survival under cold conditions. The mesophilic B. cereus group strain used common bacterial stress mechanisms to grow at the low temperature. For example, this strain exhibited increasing sulfur assimilation, induction of cysteine and glutathione biosynthesis, and the upregulation of fatty acid biosynthesis for bacterial growth under cold conditions. Meanwhile, carbohydrate metabolism in the psychrotolerant B. cereus group strain was repressed to save energy for growth, while the upregulation of the genes responsible for the catabolism of tryptophan and alcohols was modulated for energy production by providing alternate pathways for NAD regeneration and the balance of ATP levels. Furthermore, increased peptidoglycan biosynthesis contributed to protecting the cell shape and maintaining the bacterial growth of the psychrotolerant B. cereus group strain at the low temperature. The present results improve our understanding of the bacterial survival responses of mesophilic B. cereus group strains and psychrotolerant B. cereus group strains to low-temperature environments and should guide the development of strategies for controlling the growth of B. cereus groups, including psychrotolerant strains, at low temperatures.
Author Contributions
Conceptualization, M.K. and K.-M.P.; methodology, K.-M.P. and M.-S.K.; validation, M.-S.K.; formal analysis, K.-M.P.; investigation, K.-M.P. and M.-S.K.; resources, M.-S.K.; data curation, M.-S.K.; writing—original draft preparation, K.-M.P.; writing—review and editing, M.K. and H.-J.K.; supervision, M.K. and H.-J.K.; project administration, M.K.; funding acquisition, M.K. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Korea Food Research Institute, grant number E0210802-01, Korea.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
The NGS data presented in this study are available in the NCBI GenBank under the accession numbers CP034551 and PRJNA727406.
Conflicts of Interest
The authors declare no conflict of interest.
Footnotes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Kim M.J., Han J.K., Park J.S., Lee J.S., Lee S.H., Cho J.I., Kim K.S. Various Enterotoxin and Other Virulence Factor Genes Widespread among Bacillus cereus and Bacillus thuringiensis Strains. J. Microbiol. Biotechnol. 2015;25:872–879. doi: 10.4014/jmb.1502.02003. [DOI] [PubMed] [Google Scholar]
- 2.Moayeri M., Leppla S.H., Vrentas C., Pomerantsev A.P., Liu S. Anthrax Pathogenesis. Annu. Rev. Microbiol. 2015;69:185–208. doi: 10.1146/annurev-micro-091014-104523. [DOI] [PubMed] [Google Scholar]
- 3.Miller R.A., Beno S.M., Kent D.J., Carroll L.M., Martin N.H., Boor K.J. Bacillus wiedmannii sp. nov., a Psychrotolerant and Cytotoxic Bacillus cereus Group Species Isolated from Dairy Foods and Dairy Environments. Int. J. Syst. Evol. Microbiol. 2016;66:4744–4753. doi: 10.1099/ijsem.0.001421. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Ceuppens S., Boon N., Uyttendaele M. Diversity of Bacillus cereus Group Strains is Reflected in Their Broad Range of Pathogenicity and Diverse Ecological Lifestyles. FEMS Microbiol. Ecol. 2013;84:433–450. doi: 10.1111/1574-6941.12110. [DOI] [PubMed] [Google Scholar]
- 5.Ivy R.A., Ranieri M.L., Martin N.H., den Bakker H.C., Xavier B.M., Wiedmann M., Boor K.J. Identification and Characterization of Psychrotolerant Sporeformers Associated with Fluid Milk Production and Processing. Appl. Environ. Microbiol. 2012;78:1853–1864. doi: 10.1128/AEM.06536-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Takahashia N., Satomi N., Akane F., Yousuke I., Kenji K., Ayumi S., Yuka M., Yumiko T., Naoko K., Yoshinori T., et al. Discrimination of Psychrotolerant Bacillus cereus Group Based on MALDITOF MS Analysis of Ribosomal Subunit Proteins. Food Microbiol. 2020;91:103542. doi: 10.1016/j.fm.2020.103542. [DOI] [PubMed] [Google Scholar]
- 7.Guerin A., Rønning H.T., Dargaignaratz C., Clavel T., Broussolle V., Mahillon J., Granum P.E., Nguyen-The C. Cereulide Production by Bacillus weihenstephanensis Strains during Growth at Different pH Values and Temperatures. Food Microbiol. 2017;65:130–135. doi: 10.1016/j.fm.2017.02.006. [DOI] [PubMed] [Google Scholar]
- 8.Haque M.A., Russell N.J. Strains of Bacillus cereus vary in the phenotypic adaptation of Their Membrane Lipid Composition in Response to Low Water Activity, Reduced Temperature and Growth in Rice Starch. Microbiology. 2004;150:1397–1404. doi: 10.1099/mic.0.26767-0. [DOI] [PubMed] [Google Scholar]
- 9.Palonen E., Lindstrom M., Korkeala H. Adaptation of Enteropathogenic Yersinia to Low Growth Temperature. Crit. Rev. Microbiol. 2010;36:54–67. doi: 10.3109/10408410903382581. [DOI] [PubMed] [Google Scholar]
- 10.Becker L.A., Evans S.N., Hutkins R.W., Benson A.K. Role of Sigma(B) in Adaptation of Listeria Monocytogenes to Growth at Low Temperature. J. Bacteriol. 2000;182:7083–7087. doi: 10.1128/JB.182.24.7083-7087.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Cronan J.E., Rock C.O. Biosynthesis of Membrane Lipids. EcoSal Plus. 2008;3:1–44. doi: 10.1128/ecosalplus.3.6.4. [DOI] [PubMed] [Google Scholar]
- 12.Beckering C.L., Steil L., Weber M.H., Volker U., Marahiel M.A. Genome-Wide Transcriptional Analysis of the Cold Shock Response in Bacillus subtilis. J. Bacteriol. 2002;184:6395–6402. doi: 10.1128/JB.184.22.6395-6402.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Brillard J., Jehanno I., Dargaignaratz C., Barbosa I., Ginies C., Carlin F., Fedhila S., Nguyen-the C., Broussolle V., Sanchis V. Identification of Bacillus cereus Genes Specifically Expressed during Growth at Low Temperatures. Appl. Environ. Microbiol. 2010;76:2562–2573. doi: 10.1128/AEM.02348-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Ermolenko D.N., Makhatadze G.I. Bacterial Cold-Shock Proteins. Cell. Mol. Life Sci. 2002;59:1902–1913. doi: 10.1007/PL00012513. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Goodchild A., Saunders N.F.W., Ertan H., Raftery M., Guilhaus M., Curmi P.M.G. A Proteomic Determination of Cold Adaptation in the Antarctic Archaeon, Methanococcoides burtonii. Mol. Microbiol. 2004;53:309–321. doi: 10.1111/j.1365-2958.2004.04130.x. [DOI] [PubMed] [Google Scholar]
- 16.Prakash J.S.S., Sinetova M., Zorina A., Kupriyanova E., Suzuki I., Murata N. DNA Supercoiling Regulates the Stress-Inducible Expression of Genes in the Cyanobacterium Synechocystis. Mol. BioSyst. 2009;5:1904. doi: 10.1039/b903022k. [DOI] [PubMed] [Google Scholar]
- 17.Park K.M., Kim H.J., Jeong M., Koo M. Enterotoxin Genes, Antibiotic Susceptibility, and Biofilm Formation of Low-Temperature-Tolerant Bacillus cereus Isolated from Lettuce in the Cold Chain. Foods. 2020;9:249. doi: 10.3390/foods9030249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Clavel T., Carlin F., Lairon D., Nguyen-The C., Schmitt P. Survival of Bacillus cereus Spores and Vegetative Cells in Acid Media Simulating Human Stomach. J. Appl. Microbiol. 2014;97:214–219. doi: 10.1111/j.1365-2672.2004.02292.x. [DOI] [PubMed] [Google Scholar]
- 19.Langmead B., Trapnell C., Pop M., Salzberg S.L. Ultrafast and Memory-Efficient Alignment of Short DNA Sequences to the Human Genome and the Expression Levels Were Estimated by RSEM. Genome Biol. 2009;10:R25. doi: 10.1186/gb-2009-10-3-r25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Li H., Zhou X.R., Pang B.P., Zhang Z.R., Chang J., Shan Y.M. Effects of Low Temperature Stress on the Super Cooling Capacity and Development of Galeruca daurica (Joannis) larvae (Coleoptera: Chrysomelidae) Chin. J. Appl. Entomol. 2015;52:434–439. [Google Scholar]
- 21.Leng N., Dawson J.A., Thomson J.A., Ruotti V., Rissman A.I., Smits B.M., Haag J.D., Gould M.N., Stewart R.M., Kendziorski C. EBSeq: An Empirical Bayes Hierarchical Model for Inference in RNA-seq Experiments. Bioinformatics. 2013;29:1035–1043. doi: 10.1093/bioinformatics/btt087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Benjamini Y., Yekutieli D. The Control of the False Discovery Rate in Multiple Testing under Dependency. Ann. Stat. 2001;29:1165–1188. doi: 10.1214/aos/1013699998. [DOI] [Google Scholar]
- 23.Den Besten H.M.W., Mols R., Moezelaar M.H., Zwietering T. Phenotypic and Transcriptomic Analyses of Mildly and Severely Salt-Stressed Bacillus cereus ATCC 14579 Cells. Appl. Environ. Microbiol. 2009;75:4111–4119. doi: 10.1128/AEM.02891-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.De Sarrau B., Clavel T., Bornard I., Nguyen-the C. Low Temperatures and Fermentative Metabolism Limit Peptidoglycan Digestion of Bacillus cereus. Impact on Colony Forming Unit Counts. Food Microbiol. 2013;33:213–220. doi: 10.1016/j.fm.2012.09.019. [DOI] [PubMed] [Google Scholar]
- 25.Madigan M., Martinko J., Parker J. Brock Biology of Microorganisms. Prentice Hall; Upper Saddle River, NJ, USA: 2006. [Google Scholar]
- 26.Bisson-Filho A.W., Hsu Y.-P., Squyres G.R., Kuru E., Wu F. Treadmilling by FtsZ Filaments Drives Peptidoglycan Synthesis and Bacterial Cell Division. Science. 2017;355:739–743. doi: 10.1126/science.aak9973. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Bassolé I.H.N., Juliani H.R. Essential Oils in Combination and Their Antimicrobial Properties. Molecules. 2012;17:3989–4006. doi: 10.3390/molecules17043989. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.McGivney E., Han L., Avellan A., VanBriesen J., Gregory K.B. Disruption of Autolysis in Bacillus subtilis using TiO2 Nanoparticles. Sci. Rep. 2017;7:44308. doi: 10.1038/srep44308. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.De Maayer P., Anderson D., Cary C., Cowan D.A. Some Like It Cold: Understanding the Survival Strategies of Psychrophiles. EMBO Rep. 2014;15:508–517. doi: 10.1002/embr.201338170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Ingenbleek Y., Kimura H. Nutritional Essentiality of Sulfur in Health and Disease. Nutr. Rev. 2013;71:413–432. doi: 10.1111/nure.12050. [DOI] [PubMed] [Google Scholar]
- 31.Brown K.A. Sulphur in the environment: A review. Environ. Pollut. Ser. 1982;B3:47–80. doi: 10.1016/0143-148X(82)90042-8. [DOI] [Google Scholar]
- 32.Aguilar-Barajas E., Diaz-Perez C., Ramirez-Diaz M.I., Riveros-Rosas H., Cervantes C. Bacterial Transport of Sulfate, Molybdate, and Related Oxyanions. Biometals. 2011;24:687–707. doi: 10.1007/s10534-011-9421-x. [DOI] [PubMed] [Google Scholar]
- 33.Sirko A., Zatyka M., Sadowy E., Hulanicka D. Sulfate and Thiosulfate Transport in Escherichia coli K-12: Evidence for a Functional Overlapping of Sulfate- and Thiosulfate-Binding Proteins. J. Bacteriol. 1995;177:4134–4136. doi: 10.1128/jb.177.14.4134-4136.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Eichhorn E., van der Ploeg J.R., Leisinger T. Characterization of a Two-Component Alkanesulfonate Monooxygenase from Escherichia coli. J. Biol. Chem. 1999;274:26639–26646. doi: 10.1074/jbc.274.38.26639. [DOI] [PubMed] [Google Scholar]
- 35.Van der Ploeg J.R., Iwanicka-Nowicka R., Bykowski T., Hryniewicz M.M., Leisinger T. The Escherichia coli ssuEADCB Gene Cluster is Required for the Utilization of Sulfur from Aliphatic Sulfonates and Is Regulated by the Transcriptional Activator Cbl. J. Biol. Chem. 1999;274:29358–29365. doi: 10.1074/jbc.274.41.29358. [DOI] [PubMed] [Google Scholar]
- 36.Mansilla M.C., Albanesi D., de Mendoza D. Transcriptional Control of the Sulfur-Regulated cysH Operon, Containing Genes Involved in L-cysteine Biosynthesis in Bacillus subtilis. J. Bacteriol. 2000;182:5885–5892. doi: 10.1128/JB.182.20.5885-5892.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Huillet E., Tempelaars M.H., André-Leroux G., Wanapaisan P., Bridoux L., Makhzami S. PlcRa, a New Quorum-Sensing Regulator from Bacillus cereus, Plays a Role in Oxidative Stress Responses and Cysteine Metabolism in Stationary Phase. PLoS ONE. 2012;7:e51047. doi: 10.1371/journal.pone.0051047. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Maghnouj A., de Sousa Cabral T.F., Stalon V., Vander Wauven C. The arcABDC Gene Cluster, Encoding the Arginine Deiminase Pathway of Bacillus licheniformis, and Its Activation by the Arginine Repressor ArgR. J. Bacteriol. 1998;180:6468–6475. doi: 10.1128/JB.180.24.6468-6475.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Ryan S., Begley M., Gahan C.G., Hill C. Molecular Characterization of the Arginine Deiminase System in Listeria monocytogenes: Regulation and Role in Acid Tolerance. Environ. Microbiol. 2009;11:432–445. doi: 10.1111/j.1462-2920.2008.01782.x. [DOI] [PubMed] [Google Scholar]
- 40.Senouci-Rezkallah K., Schmitt P., Jobin M.P. Amino acids Improve Acid Tolerance and Internal pH Maintenance in Bacillus cereus ATCC14579 Strain. Food Microbiol. 2011;28:364–372. doi: 10.1016/j.fm.2010.09.003. [DOI] [PubMed] [Google Scholar]
- 41.Alcázar R., Marco F., Cuevas J.C., Patron M., Ferrando A., Carrasco P. Involvement of Polyamines in Plant Response to Abiotic Stress. Biotechnol. Lett. 2006;28:1867–1876. doi: 10.1007/s10529-006-9179-3. [DOI] [PubMed] [Google Scholar]
- 42.Culham D.E., Vernikovska Y., Tschowri N., Keates R.A., Wood J.M., Boggs J.M. Periplasmic Loops of Osmosensory Transporter ProP in Escherichia Coli Are Sensitive to Osmolality. Biochemistry. 2008;47:13584–13593. doi: 10.1021/bi801576x. [DOI] [PubMed] [Google Scholar]
- 43.Lobritz M.A., Belenky P., Porter C.B., Gutierrez A., Yang J.H., Schwarz E.G., Dwyer D.J., Khalil A.S., Collins J.J. Antibiotic Efficacy is Linked to Bacterial Cellular Respiration. Proc. Natl. Acad. Sci. USA. 2015;112:8173–8180. doi: 10.1073/pnas.1509743112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Link H., Fuhrer T., Gerosa L., Zamboni N., Sauer U. Real-Time Metabolome Profiling of the Metabolic Switch between Starvation and Growth. Nat. Methods. 2015;12:1091–1097. doi: 10.1038/nmeth.3584. [DOI] [PubMed] [Google Scholar]
- 45.Mykytczuk N.C.S., Foote S.J., Omelon C.R., Southam G., Greer C.W., Whyte L.G. Bacterial Growth at −15 °C; Molecular Insights from the Permafrost Bacterium Planococcus halocryophilus Or1. ISME J. 2013;7:1211–1226. doi: 10.1038/ismej.2013.8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Franchini A.G., Ihssen J., Egli T. Effect of Global Regulators RpoS and Cyclic- AMP/CRP on the Catabolome and Transcriptome of Escherichia coli K12 during Carbon- and Energy-Limited Growth. PLoS ONE. 2015;10:e01337934. doi: 10.1371/journal.pone.0133793. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Piette F., Leprince P., Feller G. Is There a Cold Shock Response in the Antarctic Psychrophile Pseudoalteromonas haloplanktis? Extremophiles. 2012;16:681–683. doi: 10.1007/s00792-012-0456-x. [DOI] [PubMed] [Google Scholar]
- 48.López C.S., Alice A.F., Heras H., Rivas E.A., Sánchez-Rivas C. Role of Anionic Phospholipids in the Adaptation of Bacillus subtilis to High Salinity. Microbiology. 2006;152:605–616. doi: 10.1099/mic.0.28345-0. [DOI] [PubMed] [Google Scholar]
- 49.Dominguez-Escobar J., Chastanet A., Crevenna A.H., Fromion V., Wedlich-Soldner R., Carballido-Lopez R. Processive Movement of Mreb-Associated Cell Wall Biosynthetic Complexes in Bacteria. Science. 2011;333:225–228. doi: 10.1126/science.1203466. [DOI] [PubMed] [Google Scholar]
- 50.Daniel R.A., Errington J. Control of Cell Morphogenesis in Bacteria: Two Distinct Ways to Make a Rod-Shaped Cell. Cell. 2003;113:767–776. doi: 10.1016/S0092-8674(03)00421-5. [DOI] [PubMed] [Google Scholar]
- 51.Wong L.S., Johnson M.S., Sandberg L.B., Taylor B.L. Amino Acid Efflux in Response to Chemotactic and Osmotic Signals in Bacillus subtilis. J. Bacteriol. 1995;177:4342–4349. doi: 10.1128/jb.177.15.4342-4349.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Houry R., Briandet S., Aymerich M. Involvement of Motility and Flagella in Bacillus cereus Biofilm Formation. A. Microbiology. 2010;156:1009–1018. doi: 10.1099/mic.0.034827-0. [DOI] [PubMed] [Google Scholar]
- 53.Guttenplan S.B., Shaw S., Kearns D.B. The Cell Biology of Peritrichous Flagella in Bacillus subtilis. Mol. Microbiol. 2013;87:211–229. doi: 10.1111/mmi.12103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Mattila M., Lindström M., Somervuo P., Markkula A., Korkeala H. Role of flhA and motA in Growth of Listeria monocytogenes at Low Temperatures. Int. J. Food Microbiol. 2011;148:177–183. doi: 10.1016/j.ijfoodmicro.2011.05.022. [DOI] [PubMed] [Google Scholar]
- 55.Eshwar A.K., Guldimann C., Oevermann A., Tasara T. Cold-Shock Domain Family Proteins (Csps) are Involved in Regulation of Virulence, Cellular Aggregation, and Flagella-Based Motility in Listeria monocytogenes. Front. Cell. Infect. Microbiol. 2017;7:453. doi: 10.3389/fcimb.2017.00453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Bresolin G., Neuhaus K., Scherer S., Fuchs T.M. Transcriptional Analysis of Long-Term Adaptation of Yersinia enterocolitica to Low-Temperature Growth. J. Bacteriol. 2006;188:2945–2958. doi: 10.1128/JB.188.8.2945-2958.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Kawamoto J., Kurihara T., Kitagawa M., Kato I., Esaki N. Proteomic Studies of an Antarctic Cold-Adapted Bacterium, Shewanella livingstonensis Ac10, for Global Identification of Cold-Inducible Proteins. Extremophiles. 2007;11:819–826. doi: 10.1007/s00792-007-0098-6. [DOI] [PubMed] [Google Scholar]
- 58.Raymond-Bouchard I., Julien T., Ianina A., Charles W.G., Lyle G.W. Comparative Transcriptomics of Cold Growth and Adaptive Features of a Eury- and Steno-Psychrophile. Front. Microbiol. 2018;9:1565. doi: 10.3389/fmicb.2018.01565. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The NGS data presented in this study are available in the NCBI GenBank under the accession numbers CP034551 and PRJNA727406.




