Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Caenorhabditis elegans) | JH3477 | Smith et al., 2016 | MEG-3::OLLAS meg-4 deletion | meg-3(ax3051) meg-4(ax3052) |
| Strain, strain background (C. elegans) | JH3479 | Smith et al., 2016 | MEG-3IDR::OLLAS meg-4 deletion | meg-3(ax3056) meg-4(ax3052) |
| Strain, strain background (C. elegans) | JH3517 | This study | MEG-3698::OLLAS MEG-4::3xFLAG | meg-3(ax4500) meg-4(ax2080) |
| Strain, strain background (C. elegans) | JH3630 | This study | MEG-3698::OLLAS meg-4 deletion | meg-3(ax4500) meg-4(ax3052) |
| Strain, strain background (C. elegans) | JH3632 | This study | MEG-3(HMGL deletion)::OLLAS meg-4 deletion | meg-3(ax4501) meg-4(ax3052) |
| Strain, strain background (C. elegans) | JH3861 | This study | MEG-3HMGL-::OLLAS meg-4 deletion | meg-3(ax4502) meg-4(ax3052) |
| Strain, strain background (C. elegans) | JH3420 | This study | MEG-3Cterm::OLLAS MEG-4::3xFLAG | meg-3(ax4503) meg-4(ax2080) |
| Strain, strain background (C. elegans) | JH3553 | This study | MEG-3Cterm::OLLAS meg-4 deletion | meg-3(ax4503) meg-4(ax4504) |
| Strain, strain background (C. elegans) | JH3475 | Smith et al., 2016 | meg-3 deletion meg-4 deletion | meg-3(ax3055) meg-4(ax3052) |
| Antibody | Anti-OLLAS-L2 | Novus Cat# NBP1-06713 | RRID:AB_1625979 | (1:200 IF, 1:1000 Western) |
| Antibody | Anti-PGL-3 KT3 | DSHB Cat# KT3 | RRID:AB_1556927 | (1:10 IF) |
| Antibody | Goat Anti-Mouse IgA 650 | Abcam Cat# ab97014 | RRID:AB_10680780 | (1:200 IF) |
| Antibody | Goat Anti-Rat IgG (H + L) 488 | Thermo Fisher Scientific Cat# A-11006 | RRID:AB_2534074 | (1:200 IF) |
| Antibody | Anti-α-Tubulin | Sigma-Aldrich Cat# T6199 | RRID:AB_477583 | (1:1000 Western) |
| Antibody | Goat Anti-Rat IgG (H + L) HRP | Thermo Fisher Scientific Cat# 31470 | RRID:AB_228356 | (1:2500 Western) |
| Antibody | Goat Anti-Mouse IgG1 HRP | Jackson ImmunoResearch Labs Cat# 115-035-205 | RRID:AB_2338513 | (1:6000 Western) |
| Sequence-based reagent | dcr12: crRNA to cut meg-3 at 2408 bp | Smith et al., 2016 | tgaaagcttgacagcattcc | |
| Sequence-based reagent | rHS03: cRNA cuts meg-3 5 bp upstream of stop codon | Smith et al., 2016 | tcagtacaatcattgatctc | |
| Sequence-based reagent | rHS20: crRNA to cut meg-3 at 2386 bp | This study | gtcaagctttcagaaatgcg | |
| Sequence-based reagent | rHS20: crRNA to cut meg-3 at 2546 bp | This study | atccaatcttggaattgtct | |
| Sequence-based reagent | rHS26: cRNA to cut MEG-3(HMGL deletion) strain | This study | tccaatcttggaattgtgcg | |
| Sequence-based reagent | rHS01: crRNA to cut meg-3 at 23 bp | Smith et al., 2016 | tcctcaaaaccttacccaag | |
| Sequence-based reagent | rHS01: crRNA to cut meg-3 at 1694 bp | Smith et al., 2016 | tcagatcaatcggaacaatg | |
| Sequence-based reagent | dcr11: crRNA to cut meg-4 3'UTR, 133 bp downstream of stop codon | Smith et al., 2016 | tctgcccaggaacttgtaac | |
| Sequence-based reagent | pk06: crRNA to cut meg-4 at 25 bp | Smith et al., 2016 | catgtgatctgccaaactcc | |
| Sequence-based reagent | dc89: homology template to delete meg-4 and insert a synthetic guide sequence | Smith et al., 2016 | gttgcaggtatgagttcttcaaagctttcctcatgtgggaagtttgtccagagcagaggaacgggtagttttctattgttatcaggactgctgc | |
| Sequence-based reagent | dc257: Homology template to make MEG-3698 | This study | caccacctcgcatttctgaaagcttgacagcattccaatccggattcgccaacgagctcggaccacgtctcatgggaaagtgattgtaccaatttatatctattacttgtagactata | |
| Sequence-based reagent | oHS264: Homology template to delete the HMGL | This study | ctcaagatccagcttcaacctcgccaccacctcgcacaattccaagattggatggtccttatgccgatgg | |
| Sequence-based reagent | oHS270, 272: Homology template to insert MEG-3HMGL- mutations in the HMGL deletion strain | This study | ctcaagatccagcttcaacctcgccaccacctcgcatttctgaaagcttgacagcatttttggaggcgcaacaggatgccaacgacgctattgatactaacgccaaagaaaagacacaactcctgaaagtgaatttggctattcacgggatgtcacctgaaagatggctgtacttgaattatttttgcaccgagacaattccaagattggatggtccttatgccgatgg | |
| Sequence-based reagent | dc198: Homology template to make MEG-3IDR | This study | gatttttgcaggtatgagctcctcaaaaccttacccaaatgtggatgtaaagagaacaccttcctcgtcaatc |