Frequencies of Beta Thalassemia Mutations Show Different Pattern in Bannu Region than Other Parts of Pashtun Population in Khyber Pakhtunkhwa Province Pakistan

Abstract

Purpose: β-Thalassemia arises as result of mutations in HBB gene, influencing the globin production which results in hypochromic and microcytic anaemia. The present study was aimed to investigate the occurrence of six common β-thal mutations, its inheritance pattern, frequency, and consanguinity in parents of Bannu region Khyber Pakhtunkhwa (KP) province, Pakistan. Conducting such studies may impart important information about thalassemia prevention like prenatal diagnosis (PND), carrier screening and genetic counselling which may be helpful in controlling the suspected births. Methods: During the study, 250 blood samples were retrieved from different families comprising of one transfusion dependent child and sporadic patients from different areas of Bannu region. The collected blood samples were investigated to see if there is any common mutations which may trigger β-Thalassemia employing amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) approach. Results: Amongst the studied mutation in District Bannu, frame shift codons (FSC) 8/9 (+ G) (HBB: c.27_28insG) was observed to be the most common mutation followed by Codons 41/42 (− TTCT), IVS-I-5(G > C) and FSC 5 (− CT) having frequencies of 42, 26, 19 and 13 respectively. The results obtained by the present study were found different from previous studies demonstrated from other Pashtun regions of KP, showing heterogeneity in frequencies of known mutations. Conclusion: These observations may help in implementing parental meetings about disease recurrence in future, large scale mutation screening, and prenatal diagnosis in the whole Pashtun ethnicity including District Bannu.

Introduction

β-thalassemia (β-thal), a blood related autosomal recessive genetic disorder is categorized by mutation in β-globulin gene clusters positioned at the short arm (p) of chromosome no-11 band 11p15.4-11p15.5. It may arise from several anomalies notably point mutations, addition of stop codons in mRNA which encodes the β-thal genes [1]. It may exist either in homozygous or heterozygous form. The typical structures linked with heterozygous β-thal carriers comprise hypochromia, microcytosis, increased HbA₂ and variable ratio of α/β-globin chain synthesis [2]. Studies have reported more than 400 mutations which may disturb the expression of β-globin gene and leads to β-thal. Of the reported mutations, 35 have been detected in Pakistan [3]. Although the reported mutations have not been disseminated equally across the World but rather shown specificity to given geographical area as every region has some common mutations and rare ones in variable number. β-thal being an autosomal single gene ailments was observed in more than 60 countries having carrier population up to 150 million. The carrier rate of β-thal in Pakistan ranges from 5.0 to 7.0%. Every year more than 9000 young ones with homozygous β-thal inheritance are born.

The present study aimed to investigate the occurrence of common β-thal mutations in the District Bannu, KP Province, Pakistan, its inheritance pattern, and relation to consanguinity. Khyber Pakhtunkhwa is located on the western side of Pakistan adjacent to Afghanistan, while District Bannu is located in southern part of KP. This study could be exciting for the Public health department conferring important information like genetic counselling, carrier screening & prenatal diagnosis which can help in controlling the abnormal growth.

Materials and Methods

Blood sampling was carried out in District Bannu of KP Province Pakistan. Molecular Lab, Department of Biotechnology, University of Science & Technology Bannu, KP Province, Pakistan was used for the practical research work. Various parameters comprising age, clinical symptoms, gender, & family history of the genetic disorder etc. were recoded with the help of direct interviews with elders of the affected family [4]. The consent was sought from all participants in writing. In this study, we collected 250 blood samples from different families with at least one transfusion-dependent β-thal major (β-TM) child and sporadic cases [5]. The present study was allowed by the Ethical board Thalassemia research centre Bannu Khyber Pakhtunkhwa.

Those patients who were invited in the present study were found to be transfusion-dependent and diagnosed as β-TM patients through different diagnostic tests [6]. It was also noticed that most of the families under study were inbred and patients with β-Thal born due to close family marriages. Similarly, the socioeconomic status of non-consanguineous families reported satisfactory than consanguineous [7]. Phenol–Chloroform method was used for the isolation of genomic DNA from the blood samples [8].

The ARMS-PCR approach was chosen for amplification of identified sequences from the collected DNA samples. The six common primers (i.e. FSC 5, codon 15, FSC 8/9, IVS-1–5, IVS-1–1, codons 41/42), control A & B & common primer C utilized for assessing the point mutations in the studied β-thal genes (Table 1) [9]. A 9 µL PCR product from each reaction was mixed with 5 µL bromophenol blue and run on 2.0% agarose gel (Sigma Aldrich) at 100 V for 45mins (Fig. 1). Those samples which may be amplified with mutant primers will be considered as homozygous (affected), & those amplify with normal primers as negative for a particular mutation. Those samples giving amplification with normal and mutant primers shall be termed as heterozygous (carriers) for given mutation. Gel doc system connected with digital camera (Bio-Rad USA) was used for taking gel pictures.

Table 1.

Allele specific primers used during the study

Primers	Sequences (5′ > 3′)	Product size (bp)
Control A	CAATGTATCATGCCTCTTTGCACC	861
Control B	GACTCAAGGCTGAGAGATGCAGGA	861
Common C	TCACTTAGACCTCACCCTGTGGAGCCAC	–
Codons 41/42 (Mt)	GAGTGGACAGATCCCCAAAGGCCTTGTTAG	439
Codons 41/42 (N)	GAGTGGACAGATCCCCAAAGGACTCAAAGA	–
IVS-1–5 (Mt)	CTCCTTAAACCTGTCTTGTAACCTTGTTAG	285
IVS-1–5 (N)	CTCCTTAAACCTGTCTTGTAACCTGATACGAAA	–
IVS-1–1 (Mt)	TTAAACCTGTCTTGTAACCTTGATACGAAA	280
IVS-1–1 (N)	GATGAAGTTGGTGACGCCCRGGGTAGG	–
FSC 8/9 (Mt)	CCTTGCCCCACAGGGCAGTAACGGCACACC	215
FSC 8/9 (N)	CCTTGCCCCACAGGGCAGTAACGGCACACT	–
Codon 15 (Mt)	CACCAACTTCATCCACG5TCACCTTGGCCT	500
Codon 15 (N)	CACCAACTTCATCCACGTTCACCTTGGCCC	–
FSC 5 (− CT) (Mt)	ACAGGGCAGTAACGGCAGACTTCTACTCG	170
FSC 5 (− CT) (N)	ACAGGGCAGTAACGGCAGACT-TCT-CAT CAG	–

IVS: Intervening Sequence; FSC: Frameshift Codon; Mt: Mutant; N: Normal

Fig. 1.

Gel electrophoresis showing amplified PCR product for FSC-5, IVS-I-5, Codons 41/42 and FSC 8/9 mutations (from top to bottom) respectively

Results

DNA obtained from 250 samples was checked by ARMS-PCR to see whether any of six β-thal mutations exist in these samples (Fig. 1). Our study reports that four β-thal mutations (Table-2) of the six studied mutation were the most abundant in the population. Among the studied samples, 91 were recorded as homozygous and 135 as heterozygous (Table-3). Similarly, 11 samples with homozygous normal alleles were also observed. Among aforementioned six common mutations, no mutation was observed in 13 samples (Table-2).

The present study could not report codon 15 (G > A) (HBB: c.47G > A) & IVS-I-1 (G > T) mutations from any of the studied samples (Tables 2, 3). Overall 317 mutant alleles were noted for the detected four mutations. Among the analysed mutations, the HBB: c.27_28insG mutant was noticed the most common (42.5%) mutation in Bannu region followed by mutation BB:c.126_129delCTTT (26%), HBB: c.92 + 5G > C (19%), and HBB: c.17_18delCT (12.5%) (Table 3).

Table.2.

Homozygous, heterozygous β-thal mutations, uncharacterized mutation and normal alleles reported in the studied individuals from Bannu region, KP province Pakistan by the present study

	HbVar nomenclature	Mutations	No. of homozygous individuals	Number of heterozygous individuals	Uncharacterized patients	Number of homozygous normal individuals
1	HBB: c.27_28insG	FSC 8/9 (+ G)	39	57	–
2	HBB: c.126_129delCTTT	Codons 41/42 (− TTCT)	24	34
3	HBB: c.92 + 5G > C	IVS-I-5(G > C)	17	26	–
4	HBB: c.17_18delCT	FSC 5 (− CT)	11	18	–
5		Uncharacterized patients	–	–	13
		homozygous normal individuals				11
Total No			91	135	13	11

Table 3.

The frequency of mutant alleles in studied population

S. no	Hb var nomenclature	Mutations	Homozygous	Heterozygous	Total no. of mutant alleles (n)	Freq. (%)
1	HBB: c.27_28insG	FSC 8/9 (+ G)	39	57	135	42.5
2	HBB: c.126_129delCTTT	Codons 41/42 (− TTCT)	24	34	82	26
3	HBB: c.92 + 5G > C	IVS-I-5(G > C)	17	26	60	19
4	HBB: c.17_18delCT	FSC 5 (− CT)	11	18	40	12.5
Total no (%)			91	135	317	100

Discussion

β-thal has been shown to be global health problem affecting huge population. The inheritance of β-thal in Pakistan ranged from 5.0 to 7.0% where more than 9000 children are born each year carrying homozygous β-thal form [6]. As large population is unaware of the importance of screening during pregnancy, therefore new born carrying β-thal may be overlooked which is serious challenge.

It was noted that 4–7 mutations are nearly common in a given area or group which constitute about 90.0% of its occurrence [10]. The high frequency of β-thal homozygous here in this country may be attributed to closed marriages, enhanced annual birth rate, exposure to mutagens and increased entry of immigrants from Afghanistan [11, 12]. It was observed that number of homozygous thalassemia cases rose due to elevated annual birth rate in Pakistan.

Previous studies have reported up to 40 β-thal mutations from the Indian subcontinent. Among the reported mutatios, five (i.e. IVS-I-5, FSC 8/9, IVS-I-1, codons 41/42, FSC 5) were reported as the most common mutations [13, 14]. Serious concerns were raised over the use of the current treatment approaches to completely eradicate the disorder due to expensive treatment and limited expertise required. The reasons for the accelerated frequency of β-thal in developing countries may comprise of lack of appropriate screening facilities in hospitals (i.e. premarital screening, hematological diagnosis, prenatal screening) and public awareness etc. For the prenatal diagnosis in β-thal parents, ARMS-PCR genome sequencing and/or linkage analyses study have successfully been used. In case of presence of β-thal mutation in baby during pregnancy, the parents may be taken in confidence and their opinion been sought about the future of baby. The screening and diagnostic techniques employed for the detection of β-thal mutations are expensive and demand expertise, but can provide reliable information in PND. Our result of getting HBB: c.27_28insG as the most frequent mutation in the studied area is in strong concordance to previous reports [15].

Our result of getting HBB: c.27_28insG as the most common mutation is in contrast to other reports [16] who reported HBB: c.92 + 5G > C as the most frequent mutation. We report the HBB: c.126_129delCTTT as the 2nd most common mutation in the study area, which does not support the previous results [15]. The findings of the present study seem novel and contrary to previous studies where HBB: c.126_129delCTTT has been reported with zero or lesser frequency than IVS1-5 [15, 16]. Differences in frequencies of known mutations in overall Pakhtuns population can be attributed to unequal sample size, various numbers of small tribal groups, sampling sites and migration of huge number of Afghan population to KP when Afghanistan was invaded by Russia.

Conclusion

This study concludes that several mutations investigated with varying allele frequencies might have caused β-thal in the study sites. The HBB: c.27_28insG was demonstrated to be the most common mutation by the current study, followed by HBB: c.126_129delCTTT, HBB: c.92þ5G > C and HBB: c.17_18delCT in District Bannu. It can be concluded that data can be expanded for the entire KP Province and even Pakistan if we could increase number of study sites, number of known mutation, sample size etc. Such studies may further improve public awareness, prenatal diagnosis screening and developing new diagnostic kits which may be quite useful for detection and molecular characterization of β-thal across the country.

Funding

None.

Data Availability

NA

Code Availability

NA

Compliance with Ethical Standards

Conflicts of interest

The authors declared no conflicts of interest here.