Abstract
Circular RNA (circRNA) is a type of noncoding RNA that can interact with miRNAs to regulate gene expression. However, little is known concerning circRNA, which is crucial in the pathogenesis of lung cancer. To date, limited studies have explored the role of circ_0044516 in lung cancer progression. Recently, we observed that circ_0044516 expression levels were obviously elevated in lung cancer tissues and cells. A549 and SPCA1 cells were transfected with circ_0044516 siRNA. We observed that knockdown of circ_0044516 dramatically repressed cell proliferation, increased cell apoptosis, and repressed the cell cycle. Moreover, A549 and SPCA1 cell migration and invasion abilities were greatly repressed by circ_0044516 siRNA. Due to accumulating evidence demonstrating the vital role of cancer stem cells, their mechanism of involvement has drawn increasing attention in tumor progression and metastasis research. We also found that cancer stem cell properties were restrained by silencing circ_0044516 in A549 and SPC-A1 cells. Moreover, in vivo xenograft experiments showed that circ_0044516 downregulation reduced tumor growth. Mechanistically, in lung cancer and using bioinformatics, we demonstrated that circ_0044516 sponges miR-136 targeting MAT2A. Furthermore, rescue assays were carried out to identify that circ_0044516 modulates cell proliferation, invasion, and stemness by regulating miR-136 and MAT2A in lung cancer. In summary, our study revealed that the circ_0044516/miR-136/MAT2A axis is involved in lung cancer progression. Our findings may provide novel targets for diagnosis and therapeutic intervention in lung cancer patients.
1. Introduction
Lung cancer is a prevalent malignancy and is becoming an important factor in tumor-related deaths worldwide [1]. Nonsmall cell lung cancer (NSCLC) and small-cell lung cancer (SCLC) are two common subtypes of lung cancer [2]. Significant progress has been achieved in lung cancer therapy. However, the five-year overall survival rate is low [3]. In addition, the outcome of lung cancer patients with metastasis or recurrence is very poor [4]. Therefore, understanding the pathogenesis of lung cancer progression will be of great significance in the management of the disease.
Back-splicing with no 5′-3′ polarity or a polyadenylated tail also contributes to the generation of circular RNAs (circRNAs) [5–7]. circRNAs are significant posttranscriptional regulators of gene control. CircRNAs can function via the competing endogenous RNA (ceRNA) network by competitively sponging microRNAs to modulate mRNAs [8]. Recently, circRNAs have been shown to contribute to tumor development and are typically present in various cancers [9–11]. For example, circ_100395 can regulate miR-1228 and TCF21 signaling to repress lung cancer development [12]. CircNOL10 suppresses lung cancer by inducing transcriptional modulation of the human polypeptide family mediated by SCLM1 [13]. In addition, circ_100146 can serve as a tumor inducer by regulating miR-361-3p [14]. CircFGFR1 promotes lung cancer progression by sponging miR-381-3p [15]. Hence, investigating the effects of circRNAs in cancer may be beneficial for lung cancer. To date, circ_0044516 has not been investigated in lung cancer progression.
Increasingly, circRNAs are involved in lung cancer, and in our research, we explored the effects of circ_0044516. Furthermore, we reported that circ_0044516 contributes to lung cancer by modulating miR-136 and MAT2A, which indicated that the circ_0044516/miR-136/MAT2A axis could be a crucial therapeutic target in lung cancer.
2. Materials and Methods
2.1. Lung Cancer Tissue
Lung cancer tissue samples and normal tissues were collected from lung cancer patients at The First Affiliated Hospital of Soochow University from 2012 to 2018. Adjacent normal tissues were >5 cm from tumor tissues. All patients were diagnosed with primary lung cancer and received no preoperative radiotherapy, chemotherapy, targeted therapy, or immunotherapy. General clinical information and detailed pathological records were collected. All participants involved in this study provided informed consent before the study. This study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Soochow University.
2.2. Cell Lines
Human lung bronchial epithelial BEAS-2B cells and five lung cancer cell lines (A549, SPCA1, H1299, H460, and H23) were obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Cells were maintained in RPMI-1640 medium with 10% FBS and 1% penicillin/streptomycin (complete medium, Gibco, Aukland, New Zealand) with 5% CO2 and 95% air at 37°C.
2.3. Cell Transfection
siRNAs of circ_0044516(siRNA-01-TTCCAGGGTCCCGCCGGTCAA; siRNA-02- GGATTCCAGGGTCCCGCCGGT), miR-136 mimics, circ_0044516, MAT2A overexpression plasmid, and negative controls (NCs) were purchased from GenePharma (Shanghai, China). Transfections (50 nM miRNA mimics, inhibitors, and siRNAs) were carried out using the Lipofectamine 3000 reagent (Carlsbad, Invitrogen, CA, USA) based on the protocols provided by the manufacturer.
2.4. CCK-8 Assays
Lung cancer cells were grown in 96-well plates and after transfection for 48 h, and CCK-8 solution (Beyotime, Shanghai, China) was added to the cells to measure cell proliferation. A microplate reader was used to test the optical absorbance values at 450 nm to assess cell proliferation.
2.5. Cell Apoptosis
Cells (2 × 105) were collected in 1.5 mL EP tubes. The supernatant was discarded after centrifugation at 2,000 × g at 4°C. 500 μL binding buffer was used to resuspend the cells. Annexin V-FITC (5 μL) was added and incubated at 4°C for 30 min in the dark. Next, 5 μL propidium iodide (PI) was gently mixed and incubated at room temperature for 5 min. The cell apoptosis rate was detected using an Annexin-V-FITC detection kit (K201-100, BioVision, USA).
2.6. Cell Cycle
In brief, cells were fixed with 70% alcohol overnight at -20°C. Afterwards, staining buffer was added to resuspend the cells. Then, PI staining solution was added to the resuspended cells for 1 min at 37°C with no light. Subsequently, a flow cytometer was used to analyze the samples.
2.7. Spheroid Formation
Cells under different treatments were seeded on ultralow attachment 24-well plates (Corning, Union City, CA, USA) at 1,000 cells/mL in 500 μL volume and maintained in serum-free RPMI-1640 medium with 20 ng/mL EGF, B27, and 4 mg/mL insulin. Cells were cultured for 14 days and the medium was refreshed every 3 days followed by detection of the number and size of mammospheres.
2.8. Wound Healing Assays
Wound healing assays were performed to evaluate the migratory capacity of the cells. The wound healing capacity of lung cancer cells was tested. Cells were cultured in 6-well plates at up to ~100% confluence. Then, a 10 μL pipette was employed to scratch a wound across the middle part of the well. Images of the wound were captured after 48 h.
2.9. Transwell Invasion Assays
Transwell chambers with Matrigel matrix were used to determine the invasive capacity of lung cancer cells. Briefly, cells (1 × 105/ml) were collected and resuspended in serum-free culture medium. Next, the upper chamber was loaded with 200 μL of the cell suspension. The lower chamber was filled with 500 μL of culture medium. After 24 h, the invading cells were stained with 0.5% crystal violet.
2.10. Bioinformatics Analysis
Potential target miRNAs of circ_0044516 were predicted using the bioinformatics database tool CircNet and then further predicted by Shanghai Kangcheng Biotech, China. Potential target genes of miR-136 were predicted using TargetScanHuman (http://www.targetscan.org).
2.11. Western Blotting
The different groups of cells were lysed in lysis buffer (Beyotime, Shanghai, China) supplemented with protease inhibitors (Beyotime, Shanghai, China) and centrifuged. Protein concentrations were determined using a BCA kit (Pierce, Rockford, USA). After the separation by 10% SDS-PAGE, the proteins were transferred onto nitrocellulose membranes (Millipore, Billerica, USA). Nonfat milk (5%) was used to block the membranes. The membrane was then incubated with primary antibodies overnight. The primary antibodies included anti-MAT2A (1 : 5000, ab186129, Abcam) and anti-GAPDH (1 : 5000, ab3674, Abcam) antibodies. The next day, secondary antibodies were used. Protein bands were visualized using an enhanced ECL kit (Millipore).
2.12. qPCR
Total RNA was extracted using TRIzol reagent (Invitrogen). A NanoDrop 2000c (Thermo Scientific, Waltham, USA) instrument was used to assess RNA quality. A Bestar RT-qPCR Kit (DBI Bioscience, China) was used to generate cDNA. Bestar qPCR MasterMix was used to perform RT-qPCR on an ABI 7300 system. The primer sequences are shown in Table 1. The relative levels of gene expression were represented as ΔCt = Ct gene–Ct reference, and the -fold change in gene expression was calculated using the 2−ΔΔCt method.
Table 1.
Genes | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
GAPDH | ACGGATTTGGTCGTATTGGG | TGATTTTGGAGG GATCTCGC |
miR-136 | ACUCCAUUUGUUUUGAUGAUGGA | UCCAUCAUCAAAACAAAUGGAGU |
Circ_0044516 | CGAGAGCATGACCGATGGAT | GCACCTTTAGGTCCAGGGAAT |
U6 | GCTTCGGCAGCACATATACTAAAAT | CGCTTCACGAATTTGCGTGTCAT |
MAT2A | TAGCCTTGGAGCAACAGTCA | CCATTACGGCGTAGTTCTGC |
CD133 | CAATCTCCCTGTTGGTGATTTG | ATCACCAGGTAAGAACCCGGA |
Sox2 | GACAGTTACGCGCACATGAA | TAGGTCTG CGAGCTGGTCAT |
Nanog | GTGATTTGTGGGCCTGA AGA | ACACAGCTGGGTGGAAGAGA |
Oct4 | GGTATTCAGCCAAACGA CCA | CACACTCGGACCACATCCTT |
2.13. Dual Luciferase Reporter Gene Assays
Cells were seeded into 6-well plates and transfected as follows: pMIR-Reporter luciferase reporter plasmid containing wild-type (Luc-circ_0044516/MAT2A-WT) or mutated circ_0044516 3′UTR (Luc-circ_0044516/MAT2A-MUT) via Lipofectamine 3000 (Invitrogen), and transfected with miR-136 mimics. Luc-c/MAT2A-MUT with a mutated miR-136 binding site was constructed using the Site-directed Gene Mutagenesis Kit (Vazyme Biotech). After 72 h, luciferase activity was measured using a dual-luciferase reporter gene assay (Promega, Madison, WI, USA).
2.14. RNA Pull-Down Assays
To pull down circ_0044516, Biotin-labeled wild-type miR-136 or NC was used to pull down circ_0044516. Approximately 1 × 107 lung cancer cells were lysed and incubated with a biotin-labeled miR-136 probe. The Pierce RNA 3′End Desthiobiotinylation Kit was used to label RNAs using biotin. Biotin-labeled wild-type miR-136 or NC was treated with cell lysates using magnetic beads. Streptavidin-coated magnetic beads were washed with lysis buffer, and Trizol (Takara) was used to purify the RNA complexes. The abundance of circ_0044516 was detected using RT-qPCR.
2.15. In Vivo Tumor Growth Assays
Xenograft assays were performed to analyze the role of circ_0044516 in vivo. Animal procedures were performed according to the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. Animal assays were approved by the Animal Care and Use Committee of the First Affiliated Hospital of Soochow University. 5-week-old female BALB/c nude mice were used for xenograft experiments and maintained under specific pathogen-free conditions. 5 × 106 A549 cells transfected with circ_0044516 siRNA or NC were injected into 5-week-old female BALB/c nude mice. Tumor volumes were calculated using the formula (length × width2/2) and recorded weekly. After 28 days, the mice were sacrificed and tumor weights were determined. Tumor tissues were collected for further studies.
2.16. Statistical Analysis
SPSS v.19.0 software was used to carry out statistical analysis. All results are expressed as means ± SD. For comparison of two groups, two-tailed Student's t-test was performed. Multiple groups were compared using one- or two-way ANOVA. Statistical significance was set at P < 0.05.
3. Results
3.1. Elevated circ_0044516 Expression in Lung Cancer
First, to identify circ_0044516 expression in lung cancer, a total of 20 paired clinical lung cancer tissues and adjacent normal tissues were examined for circ_0044516 expression using RT-qPCR. We observed that circ_0044516 was upregulated in lung cancer tissues (Figure 1(a)). Next, we showed that circ_0044516 was elevated in lung cancer cells in comparison to Beas-2B cells, as shown in Figure 1(b). These results indicated that cir_0044516 expression was increased in lung cancer.
3.2. Effects of circ_0044516 siRNA on Lung Cancer Cell Proliferation, Apoptosis, and Cell-Cycle
Circ_0044516 expression was highest in A549 and SPCA1 cells among the five lung cancer cell lines in our study. These two types of cells were transfected with two circ_0044516 siRNAs. In addition, circ_0044516 siRNA-02 exhibited a superior knockdown function; therefore, it was used for subsequent experiments (Figure 2(a)). Through CCK8 assays, loss of circ_0044516 repressed A549 and SPCA1 cell viability (Figures 2(b) and 2(c)). We then evaluated the effect of circ_0044516c on cell apoptosis and the cell cycle. Hochest analysis suggested that circ_0044516 downregulation resulted in increased cell apoptosis, as shown in Figures 2(d)–2(f). In addition, cell cycle distribution was blocked in the G0/G1 phase due to the lack of circ_0044516 (Figures 2(g)–2(i)). These data demonstrated that knockdown of circ_0044516 repressed lung cancer cell proliferation, enhanced cell apoptosis, and blocked cell cycle progression.
3.3. Effects of circ_0044516 siRNA on Lung Cancer Cell Migration and Invasion
A positive association between circ_0044516 expression and metastasis was observed. To confirm this, we performed wound healing and transwell invasion assays using A549 and SPCA1 cells. Circ_0044516 siRNA suppressed cell migration and invasion, as demonstrated in Figures 3(a)–3(d). These results indicated that silencing circ_0044516 might depress lung cancer cell migration and invasion.
3.4. Effects of circ_0044516 siRNA on Lung Cancer Stem Cell Properties
To study the function of circ_0044516 on lung cancer stem cell properties, spheroid formation assays were carried out and circ_0044516 siRNA decreased sphere numbers in A549 and SPCA1 cells (Figures 4(a) and 4(b)). Moreover, flow cytometric assays indicated that the CD133 positive cell ratio was significantly elevated by increased levels of circ_0044516 in A549 and SPCA1 cells (Figures 4(c) and 4(d)). In addition, Sox, Nanog, Oct4, and CD133 mRNA expression were reduced by circ_0044516 siRNA in vitro (Figures 4(e) and 4(f)). These findings implied that the loss of circ_0044516 restrained lung cancer stem cell properties.
3.5. Circ_0044516 Sponged miR-136
The miRNA targets of circ_0044516 were analyzed using https://circinteractome.nia.nih.gov/. miR-136 was predicted to be a target of circ_0044516. miR-136 levels were downregulated in lung cancer cells (Figure 5(a)). RNA pull-down assays using biotin-miR-136 were carried out using A549 or SPCA1 cell lysates. We found that circ_0044516 was enriched by biotin-miR-136 (Figure 5(b)). Next, WT-circ_0044516 and MUT-circ_0044516 were constructed (Figure 5(c)). The findings indicated that transfection with miR-136 mimics repressed the activity of WT-circ_0044516 in vitro (Figure 5(d)). In addition, miR-136 was negatively modulated by circ_0044516 in lung cancer cells (Figure 5(e)). Together, these data suggested that circ_0044516 could directly act as a sponge for miR-136.
3.6. MAT2A Is a Direct Target of miR-136
We then searched for potential targets of miR-136 using http://starbase.sysu.edu.cn/. We identified MAT2A as a possible target of miR-136. MAT2A mRNA levels were enhanced in lung cancer (Figure 6(a)). We found that MAT2A was enriched by biotin-miR-136 (Figure 6(b)). WT-MAT2A and MUT-MAT2A were constructed (Figure 6(c)). Transfection with miR-136 mimics inhibited the activity of WT-MAT2A (Figure 6(d)). Additionally, circ_0044516 promoted MAT2A expression by sponging miR-136, as shown in Figure 6(e). Collectively, these assays demonstrated that MAT2A served as a direct target of miR-136.
3.7. Circ_0044516 Regulates Lung Cancer Cell Proliferation, Invasion, and Cancer Stem Cell Characteristics through Modulating miR-136 and MAT2A
To determine whether circ_0044516 functions by modulating miR-136 and MAT2A, rescue assays were performed by transfection with miR-136 mimics or MAT2A OE plasmid inA549 and SPCA1 cells. Transfection efficiency was confirmed by analyzing MAT2A levels (Figures 7(a) and 7(b)). As shown, circ_0044516 overexpression increased proliferation, invasion, and cancer stem cell properties of A549 and SPCA1 cells (Figures 7(c)–7(f)). However, miR-136 mimics suppressed these processes, while MAT2A overexpression promoted the same. Moreover, circ_0044516 functions by modulating miR-136 and MAT2A. Subsequently, to evaluate whether circ_0044516 affected tumor growth in vivo, a human lung cancer xenograft model was established. We injected circ_0044516 siRNA or control-transfected A549 cells into nude mice. The results indicated that circ_0044516 siRNA suppressed lung cancer tumor volume in a time-dependent manner (Figure 7(g)). As shown, circ_0044516 downregulation reduced tumor weight (Figure 7(h)). Circ_0044516 and MAT2A levels were reduced in circ_0044516 siRNA-transfected tumor tissues, whereas miR-136 was increased (Figures 7(i) and 7(j)). In summary, these results demonstrated that circ_0044516 could function as a sponge for miR-136 to promote lung cancer progression by inducing MAT2A expression.
4. Discussion
circRNAs are important master regulators involved in multiple processes [16]. In recent years, the role of circRNAs in cancer progression has attracted considerable attention. Because of their cell- and tissue-specific unique molecular structures, circRNAs might have various regulatory functions in many biological processes and may represent superior diagnostic markers and therapeutic targets for cancer than linear transcripts [17]. Aberrant expression levels of circRNAs often lead to malignant behavior [18, 19]. However, the expression and role of most circRNAs in lung cancer development are unclear. Therefore, it is important to focus on the relationship between circRNAs and cancer. In the current study, a new role of circ_0044516 in lung cancer was demonstrated, and we reported its tumor-associated roles.
Dysregulated circRNAs are closely correlated with tumorigenesis in many cancers [20–22]. Previously, circ_0044516 was shown to promote prostate cancer development and progression [23]. Circ_0044516 promotes gastric cancer progression by modulating miR-149-5p and HuR [24]. Here, we demonstrated that circ_0044516 expression is upregulated in lung cancer. Thus, circ_0044516 could be a significant biomarker for lung cancer.
circRNAs can participate in various processes in multiple diseases [25–27]. For example, dysregulated circ_100876 induces esophageal squamous cell carcinoma progression [28]. In bladder cancer, circCDYL suppresses c-MYC to reduce cell proliferation and migration [29]. Circ-ITCH inhibits lung cancer proliferation by repressing Wnt/β-catenin [30]. Currently, we have shown that loss of circ_0044516 represses cell proliferation, blocks cell-cycle progression, and suppresses cell migration and invasion. In addition, cancer stem cells are considered to be responsible for tumor relapse. They may play significant roles in lung tumorigenesis [31]. In our study, we also demonstrated that silencing circ_0044516 obviously restrained the stemness of A549 and SPCA1 cells. Overexpression of circ_0044516 induces cancer stem cell properties.
Based on the ceRNA hypothesis, circRNA acts as a ceRNA to modulate miRNA target gene expression. To focus on the role of circ_0044516 in lung cancer, potential target miRNAs were predicted and miR-136 was identified. Circ_0014130 can reduce lung cancer cell apoptosis by sponging miR-136-5p and enhancing BCL2 [32]. miR-136-5p is downregulated in patients with LUSC [33]. Additionally, NORAD promotes lung cancer cell proliferation by sponging miR-136-5p [34]. The association between circ_0044516 and miR-136 was demonstrated through luciferase reporter gene assays and RNA pull-down experiments. miR-136 expression is greatly reduced in lung cancer and acts as a tumor suppressor. Other miRNAs related to circ_0044516 require further investigation.
MAT2A was predicted and confirmed as a target of miR-136 in lung cancer. Bioinformatic analysis using TargetScan revealed that the biosynthesis of S-adenosylmethionine is a unique metabolic property of CSCs. Inhibition of MAT2A contributes to the repression of drug-resistant CSCs [35]. Overexpression of MAT2A has been shown in gastric cancer, and silencing of the MAT2A gene induces apoptosis and blocks cell cycle progression [36]. Nevertheless, the effects of MAT2A on lung cancer progression remains poorly understood. We observed that MAT2A was negatively modulated by miR-136 and positively regulated by circ_0044516. MAT2A reversed the effects of miR-136 on lung cancer cell growth, invasion, and cancer stem cell characteristics. In future studies, we would like to overexpress MAT2A alone to investigate whether it can induce a lung tumor model. These results further confirmed our hypothesis that circ_0044516 serves as a ceRNA for miR-136 to enhance MAT2A expression during lung cancer progression. However, the detailed mechanisms involved in the regulatory process of lung cancer require further elucidation.
Taken together, we identified a novel circRNA, circ_0044516, which plays an oncogenic role in lung cancer. We reported that circ_0044516 might sponge miR-136 to regulate MAT2A expression, leading to lung cancer progression. These data indicate a potential mechanism of action in lung cancer. However, the detailed mechanisms involved require further study.
Acknowledgments
This work was supported by the National Natural Science Foundation of China [grant numbers 81702254 and 81502275].
Contributor Information
Wei Wang, Email: wwei2003@126.com.
Hong-Yun Cheng, Email: chy778@163.com.
Data Availability
The data used to support the findings of this study are included within the article.
Conflicts of Interest
The authors declare no financial or commercial conflict of interest.
Authors' Contributions
WC, CX, WW, and HC designed and revised the study; WC, WJ, QG, YC, QD, and YH performed the research; QG, WC, YC, QD, and YH collected the data and did the analysis; CX, WC, WW, and HC prepared the manuscript draft. All authors approved the final manuscript. Yue-Wei Chen, Qiu-Rong Du, and Yu-Juan He contributed equally to this work.
References
- 1.Chen W., Zheng R., Baade P. D., et al. Cancer statistics in China, 2015. CA: A Cancer Journal for Clinicians. 2016;66(2):115–132. doi: 10.3322/caac.21338. [DOI] [PubMed] [Google Scholar]
- 2.Hirsch F. R., Scagliotti G. V., Mulshine J. L., et al. Lung cancer: current therapies and new targeted treatments. The Lancet. 2017;389(10066):299–311. doi: 10.1016/S0140-6736(16)30958-8. [DOI] [PubMed] [Google Scholar]
- 3.Azar F. E., Azami-Aghdash S., Pournaghi-Azar F., et al. Cost-effectiveness of lung cancer screening and treatment methods: a systematic review of systematic reviews. BMC Health Services Research. 2017;17(1):p. 413. doi: 10.1186/s12913-017-2374-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Gupta G. P., Massague J. Cancer metastasis: building a framework. Cell. 2006;127(4):679–695. doi: 10.1016/j.cell.2006.11.001. [DOI] [PubMed] [Google Scholar]
- 5.Jeck W. R., Sorrentino J. A., Wang K., et al. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA. 2013;19(2):141–157. doi: 10.1261/rna.035667.112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Rong D., Sun H., Li Z., et al. An emerging function of circRNA-miRNAs-mRNA axis in human diseases. Oncotarget. 2017;8(42):73271–73281. doi: 10.18632/oncotarget.19154. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Chen L. L., Yang L. Regulation of circRNA biogenesis. RNA Biology. 2015;12(4):381–388. doi: 10.1080/15476286.2015.1020271. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Zhang S., Zhu D., Li H., Li H., Feng C., Zhang W. Characterization of circRNA-associated-ceRNA networks in a senescence-accelerated mouse prone 8 brain. Molecular Therapy. 2017;25(9):2053–2061. doi: 10.1016/j.ymthe.2017.06.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Meng S., Zhou H., Feng Z., et al. CircRNA: functions and properties of a novel potential biomarker for cancer. Molecular Cancer. 2017;16(1):p. 94. doi: 10.1186/s12943-017-0663-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Yin Y., Long J., He Q., et al. Emerging roles of circRNA in formation and progression of cancer. Journal of Cancer. 2019;10(21):5015–5021. doi: 10.7150/jca.30828. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kristensen L. S., Hansen T. B., Veno M. T., Kjems J. Circular RNAs in cancer: opportunities and challenges in the field. Oncogene. 2018;37(5):555–565. doi: 10.1038/onc.2017.361. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Chen D., Ma W., Ke Z., Xie F. CircRNA hsa_circ_100395 regulates miR-1228/TCF21 pathway to inhibit lung cancer progression. Cell Cycle. 2018;17(16):2080–2090. doi: 10.1080/15384101.2018.1515553. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Nan A., Chen L., Zhang N., et al. Circular RNA circNOL10 inhibits lung cancer development by promoting SCLM1-mediated transcriptional regulation of the humanin polypeptide family. Advanced Science. 2019;6(2):p. 1800654. doi: 10.1002/advs.201800654. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Chen L., Nan A., Zhang N., et al. Circular RNA 100146 functions as an oncogene through direct binding to miR-361-3p and miR-615-5p in non-small cell lung cancer. Molecular Cancer. 2019;18(1):p. 13. doi: 10.1186/s12943-019-0943-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Zhang P. F., Pei X., Li K. S., et al. Circular RNA circFGFR1 promotes progression and anti-PD-1 resistance by sponging miR-381-3p in non-small cell lung cancer cells. Molecular Cancer. 2019;18(1):p. 179. doi: 10.1186/s12943-019-1111-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Hsiao K. Y., Sun H. S., Tsai S. J. Circular RNA - new member of noncoding RNA with novel functions. Experimental Biology and Medicine. 2017;242(11):1136–1141. doi: 10.1177/1535370217708978. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Dong Y., He D., Peng Z., et al. Circular RNAs in cancer: an emerging key player. Journal of Hematology & Oncology. 2017;10(1):p. 2. doi: 10.1186/s13045-016-0370-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Zhang H. D., Jiang L. H., Sun D. W., Hou J. C., Ji Z. L. CircRNA: a novel type of biomarker for cancer. Breast Cancer. 2018;25(1):1–7. doi: 10.1007/s12282-017-0793-9. [DOI] [PubMed] [Google Scholar]
- 19.Di X., Jin X., Li R., Zhao M., Wang K. CircRNAs and lung cancer: biomarkers and master regulators. Life Sciences. 2019;220:177–185. doi: 10.1016/j.lfs.2019.01.055. [DOI] [PubMed] [Google Scholar]
- 20.Qu S., Yang X., Li X., et al. Circular RNA: a new star of noncoding RNAs. Cancer Letters. 2015;365(2):141–148. doi: 10.1016/j.canlet.2015.06.003. [DOI] [PubMed] [Google Scholar]
- 21.Ng W. L., Mohd Mohidin T. B., Shukla K. Functional role of circular RNAs in cancer development and progression. RNA Biology. 2018;15(8):995–1005. doi: 10.1080/15476286.2018.1486659. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Salzman J. Circular RNA expression: its potential regulation and function. Trends in Genetics. 2016;32(5):309–316. doi: 10.1016/j.tig.2016.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Li T., Sun X., Chen L. Exosome circ_0044516 promotes prostate cancer cell proliferation and metastasis as a potential biomarker. Journal of Cellular Biochemistry. 2020;121(3):2118–2126. doi: 10.1002/jcb.28239. [DOI] [PubMed] [Google Scholar]
- 24.Yang Y., Cai B., Shi X., Duan C., Tong T., Yu C. circ_0044516 functions in the progression of gastric cancer by modulating MicroRNA-149-5p/HuR axis. Molecular and Cellular Biochemistry. 2021 doi: 10.1007/s11010-020-04026-9. [DOI] [PubMed] [Google Scholar]
- 25.Hsiao K. Y., Lin Y. C., Gupta S. K., et al. Noncoding effects of circular RNA CCDC66 promote colon cancer growth and metastasis. Cancer Research. 2017;77(9):2339–2350. doi: 10.1158/0008-5472.CAN-16-1883. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Li C., Zhang L., Meng G., et al. Circular RNAs: pivotal molecular regulators and novel diagnostic and prognostic biomarkers in non-small cell lung cancer. Journal of Cancer Research and Clinical Oncology. 2019;145(12):2875–2889. doi: 10.1007/s00432-019-03045-4. [DOI] [PubMed] [Google Scholar]
- 27.Han J., Wang J. Z., Yang X., et al. METTL3 promote tumor proliferation of bladder cancer by accelerating pri-miR221/222 maturation in m6A-dependent manner. Molecular Cancer. 2019;18(1):p. 110. doi: 10.1186/s12943-019-1036-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Cao S., Chen G., Yan L., Li L., Huang X. Contribution of dysregulated circRNA_100876 to proliferation and metastasis of esophageal squamous cell carcinoma. Oncotargets and Therapy. 2018;11:7385–7394. doi: 10.2147/OTT.S177524. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Sun J., Zhang H., Tao D., et al. CircCDYL inhibits the expression of C-MYC to suppress cell growth and migration in bladder cancer. Artificial Cells, Nanomedicine, and Biotechnology. 2019;47(1):1349–1356. doi: 10.1080/21691401.2019.1596941. [DOI] [PubMed] [Google Scholar]
- 30.Wan L., Zhang L., Fan K., Cheng Z. X., Sun Q. C., Wang J. J. Circular RNA-ITCH suppresses lung cancer proliferation via inhibiting the Wnt/β-catenin pathway. BioMed Research International. 2016;2016:11. doi: 10.1155/2016/1579490.1579490 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Wang J., Li Z. H., White J., Zhang L. B. Lung cancer stem cells and implications for future therapeutics. Cell Biochemistry and Biophysics. 2014;69(3):389–398. doi: 10.1007/s12013-014-9844-4. [DOI] [PubMed] [Google Scholar]
- 32.Geng Y., Bao Y., Deng L., Su D., Zheng H., Zhang W. Circular RNA hsa_circ_0014130 inhibits apoptosis in non-small cell lung cancer by sponging miR-136-5p and upregulating BCL2. Molecular Cancer Research. 2020;18(5):748–756. doi: 10.1158/1541-7786.MCR-19-0998. [DOI] [PubMed] [Google Scholar]
- 33.Xie Z. C., Li T. T., Gan B. L., et al. Investigation of miR-136-5p key target genes and pathways in lung squamous cell cancer based on TCGA database and bioinformatics analysis. Pathology, Research and Practice. 2018;214(5):644–654. doi: 10.1016/j.prp.2018.03.028. [DOI] [PubMed] [Google Scholar]
- 34.Gao W., Weng T., Wang L., et al. Long non‑coding RNA NORAD promotes cell proliferation and glycolysis in non‑small cell lung cancer by acting as a sponge for miR‑136‑5p. Molecular Medicine Reports. 2019;19(6):5397–5405. doi: 10.3892/mmr.2019.10210. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Strekalova E., Malin D., Weisenhorn E. M. M., et al. S-adenosylmethionine biosynthesis is a targetable metabolic vulnerability of cancer stem cells. Breast Cancer Research and Treatment. 2019;175(1):39–50. doi: 10.1007/s10549-019-05146-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Zhang T., Zheng Z., Liu Y., et al. Overexpression of methionine adenosyltransferase II alpha (MAT2A) in gastric cancer and induction of cell cycle arrest and apoptosis in SGC-7901 cells by shRNA-mediated silencing of MAT2A gene. Acta Histochemica. 2013;115(1):48–55. doi: 10.1016/j.acthis.2012.03.006. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data used to support the findings of this study are included within the article.