Skip to main content
PMC home page
Archives of Industrial Hygiene and Toxicology logoLink to Archives of Industrial Hygiene and Toxicology
. 2021 Jun 28;72(2):148–156. doi: 10.2478/aiht-2021-72-3422

1,4-dihydropyridine Derivatives Increase mRNA Expression of Psma3, Psmb5, and Psmc6 in Rats

1,4 dihidropiridinski derivati povećavaju ekspresiju gena Psma3, Psmb5 i Psmc6 u glasničkoj RNA štakora

Kristīne Dišlere 1, Evita Rostoka 1,2,3, Egils Bisenieks 3, Gunars Duburs 3, Natalia Paramonova 1, Nikolajs Sjakste 1,2,3,*
PMCID: PMC8265202  PMID: 34187104

Abstract

The ubiquitin-proteasome system modifies different cellular and protein functions. Its dysregulation may lead to disrupted proteostasis associated with multiple pathologies and aging. Pharmacological regulation of proteasome functions is already an important part of the treatment of several diseases. 1,4-dihydropyridine (1,4-DHP) derivatives possess different pharmacological activities, including antiaging and neuroprotective. The aim of this study was to investigate the effects of several 1,4-DHP derivatives on mRNA expression levels of proteasomal genes Psma3, Psmb5, and Psmc6 in several organs of rats. Rats were treated with metcarbatone, etcarbatone, glutapyrone, styrylcarbatone, AV-153-Na, or AV-153-Ca per os for three days. mRNA expression levels were determined with real-time polymerase chain reaction (PCR). For AV-153-Na and AV-153-Ca, we also determined the expression of the Psma6 gene. In the kidney, metcarbatone, etcarbatone, styrylcarbatone, and AV-153-Na increased the expression of all analysed genes. Glutapyrone increased the expression of Psmb5 and Psmc6 but did not affect the expression of Psma3. In the blood, glutapyrone increased Psmb5 expression. In the liver, AV-153-Na increased the expression of Psma6 and Psmc6 but lowered the expression of Psmb5, while AV-153-Ca only increased Psma6 expression. The ability of 1,4-DHP derivatives to increase the expression of proteasome subunit genes might hold a therapeutic potential in conditions associated with impaired proteasomal functions, but further research is needed.

Key words: AV-153-Ca, AV-153-Na, etcarbatone, gene expression, glutapyrone, impaired proteasomal functions, metcarbatone, pharmacological activities, proteasome subunits, styrylcarbatone, ubiquitin-proteasome system

Proteostasis, or cellular protein homeostasis, relies on the regulation of protein synthesis, folding, conformational maintenance, and degradation (1). Deviations from optimal proteostasis can result in serious pathologies and accelerate the aging of an organism. Proteostasis is maintained by several control systems, all of them of equal importance (1). Protein degradation is partly regulated by the ubiquitin-proteasome system (UPS), which ensures rapid and specific turnover of proteins. UPS modifies cellular and protein functions, including cell cycle, cell signalling, DNA repair, chromatin modifications, and protein trafficking (2). These are mediated by ATPase (ubiquitination enzymes encoded by the Psmc genes in rodents) and the 20S core particle. The latter has a cylinder-like structure consisting of 28 proteins arranged in four heptameric rings. The outer ring is formed by alpha subunits encoded by the Psma genes in rodents (PSMA in humans). The inner, beta subunits are encoded by the Psmb genes (PSMB in humans) (2). Proteasome gene expression is triggered by the nuclear respiratory factor 1 (Nrf1). This transcription factor is, in turn, regulated by the mammalian target of rapamycin complex 1 (mTORC1) (3) and a feedback mechanism compensating proteasome dysfunction (4). Nrf1-dependent transcription of proteasomal genes is also increased by pharmacological inhibition of proteasomes (2). Pharmacological inhibition of proteasome function is important for the treatment of several diseases such as cancer (5), whereas stimulators of proteasome activity are being researched (6) as potential remedies against neurodegenerative diseases and as antiaging agents. It was shown that proteasome activity in long-living mammal species is higher than in short-living animals (7). Several natural substances were found to stimulate proteasome activity (8), synthetic molecules are also intensively studied (9).

In our opinion, testing of the impact of 1,4-dihydropyridine (1,4-DHP) derivatives, a vast group of compounds with different pharmacological activities, on the UPS could be a prospective research branch. A big group of these compounds has been synthesised in the Latvian Institute of Organic Synthesis over the last few years. Some of them manifest interesting effects besides antioxidant activity (9), as they can modify cell proliferation (10), bind DNA and proteins, or stimulate DNA repair by activating DNA repair enzymes (11, 12). These novel 1,4‑DHP derivatives have a weak Ca2+ channel blocker activity and are water-soluble unlike “classical” Ca2+ channel blockers, which are hydrophobic. Yet they can modify the expression of several genes and proteins (13, 14), including the proteasome gene Psma6 (15). The present work aimed to expand our previous research by studying the effects of several 1,4‑DHP derivatives on mRNA expression levels of proteasomal genes Psma3, Psmb5, and Psmc6 in several organs of rats to see if they have pharmacological potential as UPS modulators.

Materials and methods

Animals

This study was approved by the Animal Ethics Committee of the Food and Veterinary Service (Riga, Latvia) and was carried out according to the guidelines of the 1986 European Convention for the Protection of Vertebrate Animals Used for Experimental and other Scientific Purposes (16). Male Wistar rats (215.0±5.6 g) were purchased from the Laboratory of Experimental Animals, Riga Stradins University, Riga, Latvia. Animals were kept at 22±0.5 °C with a 12 h light/dark cycle and fed standard laboratory diet.

Chemicals

All drugs used in the study – metcarbatone, etcarbatone, glutapyrone, styrylcarbatone (J-9-125), and AV-153 Na and Ca salts (Figure 1) were synthesised at the Latvian Institute of Organic Synthesis. Other chemicals were purchased from Sigma-Aldrich Chemie (Taufkirchen, Germany).

Figure 1.

Figure 1

Open in a new tab

Formulas of 1,4-dihydropyridine derivatives used in the study

Experimental design

Rats were divided into control and treatment groups. The latter received 0.05 mg/kg or 0.5 mg/kg of metcarbatone, etcarbatone, glutapyrone, styrylcarbatone, AV-153-Na, or AV-153-Ca per os by gavage for three days. The rats were then euthanised and their organ samples (kidneys, blood, and liver) taken and frozen in liquid nitrogen until analysis. There were two sets of rats. Kidneys and blood were taken from the control group (11 animals) and groups treated with metcarbatone, etcarbatone, glutapyrone, and styrylcarbatone (3–4 animals per group). Kidneys and liver were taken from the control group (10 animals) and groups treated with AV-153-Na and AV-153-Ca (3–5 animals per group).

RNA extraction and cDNA synthesis

Total RNA was isolated from the kidneys, blood, and liver with a TRI reagent (Sigma Aldrich, Taufkirchen, Germany). RNA was purified from DNA with a DNA-free kit (Ambion, Austin, TX, USA) and its quantity and purity determined with a NanoPhotometer ® NP 80 spectrophotometer (ImplenGMBH, Munich, Germany).

The quality of RNA was analysed with gel electrophoresis. cDNA was synthesised from the obtained RNA (5 μg from kidneys and liver, and 2 μg from blood) with random hexamer primers (RevertAid™ First Strand cDNA Synthesis Kit, Fermentas, Vilnius, Lithuania).

Real-time reverse-transcription polymerase chain reaction tests

mRNA expression of Psma3, Psmb5 and Psmc6, and a reference gene (RNA-polymerase II) in the kidney, blood, and liver was determined using the SYBR® Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) according to the instructions provided by the manufacturer. For the AV-153-Na and AV-153-Ca treatment groups, we also determined the expression of the Psma6 gene.

Primers were designed using Primer‑BLAST software ( 1 7 ) . Primer sequences were: Psma3 – 5’‑CACCATCCTCTGGTGTCCATT‑3’ (forward) and 5’‑CGCAGATATCCTCAATTACCCAAC‑3’ (reverse) ( fragment size 1 2 8 b p ) ; P s m b 5 – 5’‑AGGTGCCTACATTGCTTCCC‑3’ (forward) and 5’‑GAGATGCGTTCCTTGTTGCG‑3’ (reverse) (fragment size 159 bp); Psmc6 – 5’‑TACATTGGGGAAAGCGCTCG‑3’ (forward) and 5’‑TCAGAAAACCGACGACCACC‑3’ (reverse) (fragment size 116 bp); and Psma6 – 5’‑GTGTGCGCTACGGGGTGTA‑3’ (forward) and 5’‑AGTCACGGTGCTGGAATCCA‑3’ (reverse) (fragment size 247 bp). The choice of the reference RNA‑polymerase II gene was described earlier (18). Primer sequences for this gene were 5’‑GCCAGAGTCTCCCATGTGTT‑3’ (forward) and 5’‑GTCGGTGGGACTCTGTTTGT‑3’ (reverse) (amplified fragment size 135 bp).

Oligonucleotides were supplied by Metabion International AG (Martinsried, Germany). qPCR reactions were performed using a StepOne™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Cycling conditions were as follows: one cycle at 95 ºC for 10 min, 40 cycles at 95 ºC for 15 sec, and one cycle at 60 ºC for 1 min (Applied Biosystems StepOne software, version 2.1). The specificity of amplification products was verified by dissociation curve: one cycle at 95 ºC for 15 sec, one at 60 ºC for 1 min, and one at 95 ºC for 15 sec. The cycle threshold (Ct) values are presented in Tables 1 and 2.

Table 1.

Kidney and blood real-time PCR cycle threshold (Ct) values

Kidneys Blood
RNSpolII Psma3 Psmb5 Psmc6 RNSpolII Psma3 Psmb5 Psmc6
Control 20,6336 21,2849 20,2966 18,5916 19,3183 24,7317 23,9346 23,4343
19,9632 21,0402 20,1468 18,5301 19,1140 24,9544 23,9330 23,6485
20,5162 20,6843 19,9793 18,4140 19,5568 23,5918 23,6477 22,6171
19,7661 20,8542 20,0899 18,4168 19,5473 25,3724 23,5371 23,2719
20,4493 21,1992 20,3281 18,7329 19,2752 24,2432 23,6730 22,2758
20,0575 20,7519 19,8123 18,2283 18,0247 24,1311 23,7417 21,8996
19,8994 20,8551 20,1670 18,5733 19,6721 24,1230 22,6278 22,9333
19,9792 21,2709 20,5719 18,8297 18,5737 23,8446 23,0603 22,4729
20,3273 21,4559 20,4872 18,9060 18,9473 24,8475 24,5772 23,0626
20,7163 21,1733 20,4132 18,8730 19,7215 24,5549 23,4031 23,6338
20,1879 21,1945 20,4594 18,7461 18,7025 24,7850 24,1693
18,7703 24,3940 24,0506
Metcarbatone 0.05 mg/kg 21,1421 21,1700 20,2690 18,7102 19,1992 24,9793 24,9819 23,4209
20,6063 20,9449 20,0149 18,6103 18,2122 25,0053 24,6967 22,8411
20,9352 21,4263 20,5656 18,9078 19,6951 24,3028 23,8090 22,9598
20,5415 20,9494 20,0938 18,4946 18,7135 24,5634 24,1763 22,6806
Metcarbatone 0.5 mg/kg 20,8324 20,9915 20,1140 18,8390 18,9062 25,2567 23,8337 23,6736
21,1187 21,0831 20,1682 18,7917 19,2715 25,2724 24,5450 23,6550
21,0912 21,1248 20,3896 18,8515 18,5728 24,6956 23,9355 22,8742
20,6640 21,1151 20,0875 18,7441 18,6701 25,2925 24,5882 23,2121
Etcarbatone 0.05 mg/kg 20,6521 21,3114 20,2236 18,6247 18,8542 24,8812 24,1604 22,9606
21,2283 21,3560 20,3069 18,6993 19,1319 24,8758 24,7965 22,9433
21,3387 21,4437 20,1647 18,7293 18,1798 24,6700 24,4486 22,5183
Etcarbatone 0.5 mg/kg 20,6957 21,2241 20,1316 18,4727 19,2888 24,9479 24,4943 23,1595
21,4283 21,6113 20,5876 18,8926 19,2577 24,8016 24,0260 23,0911
21,0995 21,5415 20,3180 18,8051 18,9519 24,5479 24,2079 22,4058
20,9716 21,4134 20,4994 18,8108 19,0836 24,6532 24,6596 22,5140
Styrylcarbatone 0.05 mg/kg 21,4476 21,4452 20,5627 18,6984 19,5796 23,9558 23,0535 22,6217
20,9010 21,0415 20,1628 18,3986 19,0160 24,8889 24,1739 23,2842
21,3434 21,2509 20,2865 18,6662 18,1215 23,5157 23,3238 21,4245
21,6191 22,0462 21,5846 18,9777 19,5722 25,4267 24,9225 23,4448
Styrylcarbatone 0.5 mg/kg 21,5660 21,5113 21,2236 18,9375 19,1745 23,8688 23,2048 22,2596
21,2131 21,5601 20,7720 18,7713 19,5076 24,7026 23,6100 23,0168
21,0897 21,4685 20,4881 18,7617 18,9420 24,6156 23,8653 23,2664
21,4455 21,6779 20,9215 18,9282
Glutapyrone 0.05 mg/kg 22,0678 22,8544 21,6248 19,8827 18,9078 23,7505 22,4539 22,0790
21,0281 22,1696 20,8820 19,3440 19,1537 23,5877 22,7654 22,3149
21,1787 21,9149 20,8096 19,0287 20,1436 25,5499 23,8626 23,8251
21,3287 21,5062 20,4549 18,7512 19,6614 24,1258 23,0498 23,1506
Glutapyrone 0.5 mg/kg 21,0105 21,8076 20,5749 18,8806 19,3639 24,6586 23,1130 22,9958
20,6910 21,6908 20,2656 18,6775 19,6876 25,6195 23,7417 24,0393
21,1142 21,4909 20,2270 18,7062 19,4588 24,3839 23,1421 22,8727
21,3715 21,4707 20,0467 18,8292 19,4118 24,7691 23,3703 23,2199
Open in a new tab

Table 2.

Liver real-time PCR cycle threshold (Ct) values

Kidneys Liver
RNSpolII Psma3 Psmb5 Psmc6 Psma6 RNSpolII Psma3 Psmb5 Psmc6 Psma6
Control 20,5970 22,5839 19,2551 19,1623 19,9986 19,8560 23,0557 21,1670 18,6385 19,8489
20,4384 22,5746 19,0794 18,8645 19,5620 19,5794 22,9181 21,1984 18,6208 19,6455
20,4358 22,5837 19,1140 18,8865 19,7310 19,9334 23,3011 21,1796 19,6168 20,4226
20,5461 22,7381 19,0685 19,1585 19,7124 19,7203 23,1264 21,1636 19,4941 20,2836
20,3772 22,3517 19,0689 19,2026 20,2427 19,1888 22,9224 21,0717 19,1761 19,8373
20,3640 22,2591 18,9613 18,9177 19,7695 19,7114 23,1850 21,1812 19,1708 20,0905
20,4210 22,1444 19,0667 18,8171 19,3981 19,8140 23,5071 21,3909 19,3937 20,2497
20,5429 22,3808 19,2618 20,5558 19,7631 23,3798 21,3486 19,0927 20,2443
20,4095 22,3303 18,9823 20,3727 19,6435 23,5475 21,2771 19,3322 20,4155
19,9648 22,0525 18,7116 19,2846
AV-153-Na 0.05 mg/kg 21,1756 22,9314 19,3199 19,5803 20,0066 19,3193 22,6985 21,0440 18,3758 18,9400
22,0513 23,4752 19,6423 19,9317 20,6172 18,8415 22,8245 20,9705 18,3795 19,0355
21,4856 23,2240 19,4647 19,6623 19,8643 19,5196 22,7070 21,0585 18,3857 19,0187
21,6234 23,2381 19,5993 19,5928 19,6469 18,8631 22,7883 20,9608 18,3031 18,9503
AV-153-Na 0.5 mg/kg 21,9367 23,2775 19,4898 19,8077 20,0014 19,6059 22,7776 20,9764 18,4171 19,0567
21,6564 23,2385 19,5634 19,4900 19,8338 19,6035 22,8215 21,0093 18,4078 19,0701
21,2077 23,2004 19,4074 19,5859 19,9741 19,5527 22,8589 20,9877 18,3254 19,1177
AV-153-Ca 0.05 mg/kg 19,7019 22,0370 19,1800 18,7166 19,3175 19,3393 22,9415 20,8086 19,1408 19,8715
19,8564 22,2813 19,3695 18,7706 19,2143 19,6280 23,3113 21,0154 19,1477 20,3142
20,1111 21,8349 19,0583 18,6593 19,3757 19,3697 22,8512 20,9235 18,9642 20,2187
19,6506 23,1935 21,0658 19,3068 20,0824
AV-153-Ca 0.5 mg/kg 20,3086 22,0432 19,5138 18,8374 19,3591 19,4528 22,9892 20,7577 19,0212 19,3202
20,5201 22,7760 18,8733 19,2125 20,2666 19,5880 23,2170 21,2606 19,0527 19,6300
19,5801 21,8729 18,8382 18,7051 19,3437 18,8662 23,0295 21,3512 18,8270 19,3601
20,1326 22,0602 18,9902 18,8147 19,6876 19,5368 23,2560 21,5740 19,0952 19,4394
20,1226 21,8402 18,8235 18,8101 19,4492 19,5666 23,0126 21,1141 18,7163 19,2355
Open in a new tab

Statistics

Reference gene stability was analysed with BestKeeper provided in RefFinder (https://www.heartcure.com). Among studied organs, standard deviation (SD) values ranged from 0.22 to 0.54, and the coefficient of variance (CV) ranged from 1.13 to 2.63. These values are consistent with those reported for stable housekeeping genes (19). Gene expression data were expressed using the 2-ΔΔCt method – mean fold difference with standard error of the mean (SEM) (20). The P values were calculated from delta values using one-way ANOVA followed by Dunnett’s test for multiple comparisons between the groups. In all tests, the P value of <0.05 was considered statistically significant. All analyses were run on the GraphPad Prism 6 version 6.01 software (GraphPad Software, San Diego, CA, USA).

Results

Metcarbatone

In the kidney, metcarbatone at both doses significantly increased the expression of the Psma3, Psmb5, and Psmc6 genes (Table 3). The higher dose produced a more pronounced effect for Psma3 and Psmb5. The increase ranged from 1.43-fold with Psmc6 (0.05 mg/kg: P=0.010; 0.5 mg/kg: P=0.015) to 1.69-fold with Psmb5 (0.5 mg/kg: P=0.001). In the blood, metcarbatone significantly decreased the Psmc6 gene expression by 0.60 (0.5 mg/kg: P=0.032).

Table 3.

The effect of metcarbatone on Psma3, Psmb5 and Psmc6 gene expression in the kidney and blood

Metcarbatone (mg/kg) Kidney fold difference (SEM range) Blood fold difference (SEM range)
Psma3 Control 1.00 (0.93–1.07) 1.00 (0.87–1.14)
0.05 1.44 (1.34–1.54)* 0.76 (0.56–1.04)
0.50 1.61 (1.50–1.74)** 0.53 (0.48–0.58)
Psmb5 Control 1.00 (0.93–1.08) 1.00 (0.84–1.18)
0.05 1.51 (1.40–1.63)** 0.55 (0.39–0.77)
0.50 1.69 (1.60–1.79)** 0.58 (0.51–0.67)
Psmc6 Control 1.00 (0.94–1.07) 1.00 (0.90–1.12)
0.05 1.43 (1.34–1.54)* 0.83 (0.68–1.01)
0.50 1.43 (1.34–1.53)* 0.60 (0.55–0.64)*
Open in a new tab

*P<0.05 and **P<0.01 compared to control

Etcarbatone

The Psma3, Psmb5, and Psmc6 gene expression significantly increased in the kidney (Table 4), from 1.36-fold at the higher dose for Psma3 (P=0.046) to 1.82-fold at the lower dose for Psmb5 (P=0.002). No significant differences were detected in the blood.

Table 4.

The effect of etcarbatone on Psma3, Psmb5 and Psmc6 gene expression in the kidney and blood

Etcarbatone (mg/kg) Kidney fold difference (SEM range) Blood fold difference (SEM range)
Psma3 Control 1.00 (0.93–1.07) 1.00 (0.87–1.14)
0.05 1.46 (1.29–1.65)* 0.61 (0.52–0.70)
0.50 1.36 (1.29–1.43)* 0.85 (0.84–0.87)
Psmb5 Control 1.00 (0.93–1.08) 1.00 (0.84–1.18)
0.05 1.82 (1.56–2.12)** 0.45 (0.37–0.55)
0.50 1.61 (1.52–1.71)** 0.66 (0.59–0.74)
Psmc6 Control 1.00 (0.94–1.07) 1.00 (0.90–1.12)
0.05 1.72 (1.52–1.95)** 0.79 (0.71–0.88)
0.50 1.62 (1.53–1.72)** 1.07 (0.99–1.17)
Open in a new tab

*P<0.05 and **P<0.01 compared to control

Styrylcarbatone

Styrylcarbatone significantly increased the expression of the Psma3, Psmb5 and Psmc6 genes (Table 5). It was the most pronounced for Psmc6 – up to 2.05-fold at the lower dose (P<0.0001). No significant differences were detected in the blood.

Table 5.

The effect of styrylcarbatone on Psma3, Psmb5 and Psmc6 gene expression in the kidney and blood

Styrylcarbatone (mg/kg) Kidney fold difference (SEM range) Blood fold difference (SEM range)
Psma3 Control 1.00 (0.93–1.07) 1.00 (0.87–1.14)
0.05 1.65 (1.53–1.79)** 0.99 (0.78–1.26)
0.50 1.53 (1.43–1.64)** 1.13 (0.93–1.37)
Psmb5 Control 1.00 (0.93–1.08) 1.00 (0.84–1.18)
0.05 1.63 (1.39–1.90)** 0.87 (0.64–1.18)
0.50 1.41 (1.36–1.47)* 1.18 (0.97–1.44)
Psmc6 Control 1.00 (0.94–1.07) 1.00 (0.90–1.12)
0.05 2.05 (1.98–2.13)*** 1.09 (0.90–1.32)
0.50 1.83 (1.75–1.91)*** 1.08 (0.84–1.39)
Open in a new tab

*P<0.05, **P<0.01, and ***P<0.0001 compared to control

Glutapyrone

In the kidney, the higher dose of glutapyrone significantly increased Psmb5 expression 1.73-fold (P=0.003; Table 6) and Psmc6 expression up to 1.59-fold (P=0.004). In the blood, the lower dose of glutapyrone increased Psmb5 expression 2.04-fold (P=0.036).

Table 6.

The effect of glutapyrone on Psma3, Psmb5 and Psmc6 gene expression in the kidney and blood

Glutapyrone (mg/kg) Kidney fold difference (SEM range) Blood fold difference (SEM range)
Psma3 Control 1.00 (0.93–1.07) 1.00 (0.87–1.14)
0.05 1.10 (0.95–1.26) 1.49 (1.27–1.74)
0.50 1.21 (1.05–1.39) 0.99 (0.86–1.14)
Psmb5 Control 1.00 (0.93–1.08) 1.00 (0.84–1.18)
0.05 1.40 (1.26–1.55) 2.04 (1.94–2.14)*
0.50 1.73 (1.49–2.01)** 1.66 (1.56–1.77)
Psmc6 Control 1.00 (0.94–1.07) 1.00 (0.90–1.12)
0.05 1.46 (1.28–1.66)* 1.30 (1.19–1.42)
0.50 1.59 (1.46–1.73)** 0.96 (0.84–1.11)
Open in a new tab

*P<0.05 and **P<0.01 compared to control

AV-153-Na

AV-153-Na significantly increased the expression of Psma3, Psmb5, Psmc6, and Psma6 at both doses (Table 7) in the kidney. The higher dose resulted in the highest (2.17-fold) increase in Psma6 (P=0.0007), while the lower dose increased it 1.91-fold (P=0.0002). Psmc6 gene expression increased 1.61-fold at the higher dose (P=0.017), but the lower dose decreased the Psmb5 gene expression by 0.79 (P=0.029).

Table 7.

The effect of AV-153-Na on Psma3, Psmb5, Psmc6 and Psma6 gene expression in the kidney and liver

AV-153-Na (mg/kg) Kidneys fold difference (SEM range) Liver fold difference (SEM range)
Psma3 Control 1.00 (0.97–1.03) 1.00 (0.95–1.05)
0.05 1.28 (1.21–1.35)* 0.94 (0.82–1.08)
0.50 1.28 (1.12–1.46)* 1.23 (1.19–1.26)
Psmb5 Control 1.00 (0.99–1.02) 1.00 (0.94–1.04)
0.05 1.64 (1.51–1.78)*** 0.79 (0.71–0.87)*
0.50 1.68 (1.47–1.91)*** 1.09 (1.08–1.11)
Psmc6 Control 1.00 (0.97–1.03) 1.00 (0.92–1.09)
0.05 1.39 (1.29–1.51)** 1.19 (1.07–1.33)
0.50 1.47 (1.30–1.66)** 1.61 (1.59–1.62)*
Psma6 Control 1.00 (0.92–1.08) 1.00 (0.94–1.06)
0.05 2.00 (1.78–2.25)*** 1.49 (1.32–1.68)**
0.50 2.17 (1.87–2.52)*** 1.91 (1.86–1.95)***
Open in a new tab

*P<0.05, **P<0.01, and ***P<0.001 compared to control

AV-153-Ca

In the kidney, AV-153-Ca significantly affected only the Psmb5 gene expression, which decreased by 0.62 at the lower dose (P=0.0043; Table 8). In the blood, Psma6 gene expression increased 1.35-fold at the lower dose. Other tested genes were not affected significantly.

Table 8.

The effect of AV-153-Ca on Psma3, Psmb5, Psmc6 and Psma6 gene expression in the kidney and liver

AV-153-Ca (mg/kg) Kidney fold difference (SEM range) Liver fold difference (SEM range)
Psma3 Control 1.00 (0.97–1.03) 1.00 (0.95–1.05)
0.05 0.89 (0.76–1.03) 0.96 (0.94–0.99)
0.50 1.00 (0.92–1.09) 0.89 (0.81–0.97)
Psmb5 Control 1.00 (0.99–1.02) 1.00 (0.94–1.04)
0.05 0.62 (0.55–0.71)** 1.05 (1.03–1.08)
0.50 0.85 (0.75–0.95) 0.82 (0.71–0.95)
Psmc6 Control 1.00 (0.97–1.03) 1.00 (0.92–1.09)
0.05 0.85 (0.77–0.93) 0.89 (0.86–0.93)
0.50 0.90 (0.84–0.96) 0.96 (0.88–1.05)
Psma6 Control 1.00 (0.92–1.08) 1.00 (0.94–1.06)
0.05 1.03 (0.96–1.11) 0.87 (0.82–0.93)
0.50 0.98 (0.89–1.07) 1.35 (1.22–1.48)*
Open in a new tab

*P<0.05 and **P<0.01 compared to control

Discussion

Most of the tested 1,4-DHP derivatives increased gene expression levels in the kidney but were mainly without a significant effect in the blood and liver. The general sensitivity of the kidney cells to 1,4‑DHP could simply be explained by accumulation of the compounds in the kidney before excretion, but there are no data to support it.

Comparing the effects of 1,4‑DHP derivatives on different proteasome subunit genes, we noticed that subunit mRNA expression did not follow a uniform pattern. Other authors have also reported divergent effects of drugs on different proteasome subunit gene expression. For example, cocaine mainly upregulated the PSMB1 and PSMA5 subunits and downregulated the PSMA6 subunit but did not affect the PSMB2 and PSMB5 subunits (21).

In the kidney, metcarbatone, etcarbatone, styrylcarbatone, and AV-153-Na increased the expression of all analysed genes, but glutapyrone and AV-153-Ca showed varying effects. Glutapyrone did not affect the expression of Psma3, which codes for the outer ring subunit of the 20S proteasome, but did increase the expression of Psmc6, which encodes for the subunit of the 19S regulatory complex. At the higher dose glutapyrone also increased the expression of Psmb5, which codes for the inner ring subunit of the 20S proteasome. Interestingly, while AV-153-Na increased Psmb5 expression in the kidney, AV-153-Ca decreased it. Furthermore, AV-153-Ca was the only compound that decreased the expression of any of the tested genes in the kidney.

In the blood, glutapyrone increased only Psmb5 expression. An earlier study (15) reported that glutapyrone increased the mRNA expression of Psma6, another subunit of the outer ring of the 20S proteasome, both in the kidney and blood. Metcarbatone at the higher dose decreased Psmc6 expression in blood.

In the liver, AV-153-Na upregulated the expression of Psma6 and also of Psmc6 at the higher dose but downregulated Psmb5 at the lower dose. The higher dose of AV-153-Ca increased only Psma6 expression.

1,4‑DHP derivatives as prospective drugs have already shown antioxidant activities and a wide range of antiaging, antibacterial, anticancer, and neuroprotective actions (10). Glutapyrone, a representative of the novel group of 1,4‑DHP derivatives with weak Ca2+ channel blocker activity has very low toxicity and multiple pharmacological properties, including concomitant effects on multiple neurotransmitter systems and antioxidant activities (22). Carbatone, another compound of this group, administered orally, showed fast absorption in the gastrointestinal tract and 62 % bioavailability. It quickly spreads across tissues and is excreted mostly through urine and faeces. This group of 1,4-DHP derivatives seems to have a very low cytotoxicity at the tested doses (unpublished data).

It also seems that the protective antioxidant activities of 1,4-DHP derivatives are achieved by targeting the mitochondria. They might be working through direct scavenging of reactive oxygen species and decomposition of hydrogen peroxide. Furthermore, they stimulate cell growth and differentiation (23). An in vitro study in human osteoblast-like cells treated with 1,4-DHP derivatives (23) demonstrated de novo glutathione synthesis, indicating the involvement of the NRF2 signalling pathway in the action of these compounds. It also suggested that the bioactivity of 1,4-DHP derivatives is associated with 4-hydroxynonenal and related second messengers of free radicals, but precise bioactivity mechanisms remain to be elucidated. The increase in proteasomal gene expression by 1,4-DHP derivatives may have similar beneficial mechanisms as those reported for antioxidants, which elevate transcription levels of 26S proteasome subunits responsible for removal of damaged proteins and attenuating the progression of human diseases related to oxidative stress (24).

The downregulation of UPS genes in the liver seems to correspond with age. In old mice, this downregulation was reported to lead to the accumulation of IκBα in the cytoplasm, which prevented the activation of the NF-κB protein, which is important for hepatocyte survival and liver health (25). Older age also seems to be associated with lower mRNA levels of both proteasome beta subunits, which are directly involved in the proteolytic function of the proteasome and antioxidant activity (26), but some healthy centenarians were reported to have proteasome subunit mRNA levels close to young donors. Furthermore, one study showed that a stable transfection of either PSMB1 or PSMB5 enhanced proteasome function and resistance to oxidative stress (27). This is why our findings of increased proteasome subunit gene expression by 1,4‑DHP derivatives seem promising in terms of pharmacotherapy.

Downregulated proteasomal gene expression is also associated with several pathologies. For instance, in patients with schizophrenia, dentate granule neurons showed decreased expression of several proteasome subunit and other genes involved in protein processing by proteasomes and ubiquitin, resulting in a deficient ubiquitin-proteasome function that can lead to reduced neuron responsiveness (28). In patients with Parkinson’s disease, both catalytic and regulatory subunits of the UPS, including the PSMA3 gene analysed in this study, showed decreased gene expression in substantia nigra (29). This might lead to decreased levels of the 26S proteasome complex, insufficient degradation of short-lived proteins such as cyclins, and accumulation of ubiquitinated proteins, which can eventually result in dopaminergic neuronal damage. In this kind of pathologies, the potential of 1,4-DHP derivatives to increase proteasomal gene expression might lead to restored proteasome function and therapeutic effect. However, additional research is needed to determine whether 1,4‑DHP derivatives increase proteasomal protein expression in the same way as they increase gene expression.

To sum up, our research has confirmed the ability of several 1,4-DHP derivatives to increase the expression of proteasome subunit genes. This might be a promising property for the development of drugs for conditions associated with impaired proteasomal functions and low mRNA levels of proteasome subunits.

Acknowledgements

This work was supported from the Grant of the Latvian Council of Science 278/2012 and the National Research Program “Biomedicine 2014”.

Footnotes

Conflicts of interest

The authors declare that they have no conflict of interest.

References

  • 1.Klaips CL, Jayaraj GG, Hartl FU. Pathways of cellular proteostasis in aging and disease. J Cell Biol. 2018;217:51–63. doi: 10.1083/jcb.201709072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Albornoz N, Bustamante H, Soza A, Burgos P. Cellular responses to proteasome inhibition: molecular mechanisms and beyond. Int J Mol Sci. 2019;20(14):3379. doi: 10.3390/ijms20143379. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Motosugi R, Murata S. Dynamic regulation of proteasome expression. Front Mol Biosci. 2019;6:30. doi: 10.3389/fmolb.2019.00030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Marshall RS, Vierstra RD. Dynamic regulation of the 26S proteasome: from synthesis to degradation. Front Mol Biosci. 2019;6:40. doi: 10.3389/fmolb.2019.00040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Sherman DJ, Li J. Proteasome inhibitors: harnessing proteostasis to combat disease. Molecules. 2020;25(3):671. doi: 10.3390/molecules25030671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Coleman RA, Trader DJ. Methods to discover and evaluate proteasome small molecule stimulators. Molecules. 2019;24(12):2341. doi: 10.3390/molecules24122341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Dammann P. Slow aging in mammals - Lessons from African mole-rats and bats. Semin Cell Dev Biol. 2017;70:154–63. doi: 10.1016/j.semcdb.2017.07.006. [DOI] [PubMed] [Google Scholar]
  • 8.Cuanalo-Contreras K, Moreno-Gonzalez I. Natural products as modulators of the proteostasis machinery: implications in neurodegenerative diseases. Int J Mol Sci. 2019;20(19):4666. doi: 10.3390/ijms20194666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zhang Y, Loh C, Chen J, Mainolfi N. Targeted protein degradation mechanisms. Drug Discov Today Technol. 2019;31:53–60. doi: 10.1016/j.ddtec.2019.01.001. [DOI] [PubMed] [Google Scholar]
  • 10.Velena A, Zarkovic N, Gall Troselj K, Bisenieks E, Krauze A, Poikans J, Duburs G. 1,4‑Dihydropyridine derivatives: dihydronicotinamide analogues-model compounds targeting oxidative stress. Oxid Med Cell Longev. 2016;2016:1892412. doi: 10.1155/2016/1892412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Bruvere I, Bisenieks E, Poikans J, Uldrikis J, Plotniece A, Pajuste K, Rucins M, Vigante B, Kalme Z, Gosteva M, Domracheva I, Velena A, Vukovic T, Milkovic L, Duburs G, Zarkovic N. Dihydropyridine derivatives as cell growth modulators in vitro. O x i d Med Cell Longev. 2017;2017:4069839. doi: 10.1155/2017/4069839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Leonova E, Rostoka E, Sauvaigo S, Baumane L, Selga T, Sjakste N. Study of interaction of antimutagenic 1,4-dihydropyridine AV-153-Na with DNA-damaging molecules and its impact on DNA repair activity. PeerJ. 2018;6:e4609. doi: 10.7717/peerj.4609. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Leonova E, Ošiņa K,, Duburs G, Bisenieks E, Germini D, Vassetzky Y, Sjakste N. Metal ions modify DNA-protecting and mutagen-scavenging capacities of the AV-153 1,4-dihydropyridine. Mutat Res. 2019;845:403077. doi: 10.1016/j.mrgentox.2019.06.007. [DOI] [PubMed] [Google Scholar]
  • 14.Ošiņa K, Rostoka E, Isajevs S, Sokolovska J, Sjakste T, Sjakste N. Effects of an antimutagenic 1,4-dihydropyridine AV-153 on expression of nitric oxide synthases and DNA repair-related enzymes and genes in kidneys of rats with a streptozotocin model of diabetes mellitus. Basic Clin Pharmacol Toxicol. 2016;119:458–63. doi: 10.1111/bcpt.12617. [DOI] [PubMed] [Google Scholar]
  • 15.Ošiņa K, Leonova E, Isajevs S, Baumane L, Rostoka E, Sjakste T, Bisenieks E, Duburs G, Vīgante B, Sjakste N. Modifications of expression of genes and proteins involved in DNA repair and nitric oxide metabolism by carbatonides [disodium-2,6-dimethyl-1,4- dihydropyridine-3,5-bis(carbonyloxyacetate) derivatives] in intact and diabetic rats. Arh Hig Rada Toksikol. 2017;68:212–27. doi: 10.1515/aiht-2017-68-2945. [DOI] [PubMed] [Google Scholar]
  • 16.Ošiņa K, Rostoka E, Sokolovska J, Paramonova N, Bisenieks E, Duburs G, Sjakste N, Sjakste T. 1,4-dihydropyridine derivatives without Ca2+-antagonist activity up-regulate Psma6 mRNA expression in kidneys of intact and diabetic rats. Cell Biochem Funct. 2016;34:3–6. doi: 10.1002/cbf.3160. [DOI] [PubMed] [Google Scholar]
  • 17.European Convention for the Protection of Vertebrate Animals Used for Experimental and other Scientific Purposes [displayed 31 May. 2021. https://www.coe.int/en/web/conventions/full-list/-/conventions/treaty/123 Council of Europe. Available at.
  • 18.Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 2012;13:134. doi: 10.1186/1471-2105-13-134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Sokolovska J, Isajevs S, Sugoka O, Sharipova J, Lauberte L, Svirina D, Rostoka E, Sjakste T, Kalvinsh I, Sjakste N. Correction of glycaemia and GLUT1 level by mildronate in rat streptozotocin diabetes mellitus model. Cell Biochem Funct. 2011;29:55–63. doi: 10.1002/cbf.1719. [DOI] [PubMed] [Google Scholar]
  • 20.Pfaffl MW, Tichopad A, Prgomet C, Neuvians TP. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol L e t t. 2 0 0 4 ; 2 6 : 5 0 9 – 1 5 . d o i : 10.1023/b:bile.0000019559.84305.47. [DOI] [PubMed]
  • 21.Taylor SC, Nadeau K, Abbasi M, Lachance C, Nguyen M, Fenrich J. The ultimate qPCR experiment: producing publication quality, reproducible data the first time. Trends Biotechnol. 2 0 1 9 ; 3 7 : 7 6 1 – 7 4 . doi: 1 0 . 1 0 1 6 / j . tibtech.2018.12.002. [DOI] [PubMed]
  • 22.Caputi FF, Carboni L, Mazza D, Candeletti S, Romualdi P. Cocaine and ethanol target 26S proteasome activity and gene expression in neuroblastoma cells. Drug Alcohol Depend. 2016;161:265–75. doi: 10.1016/j.drugalcdep.2016.02.012. [DOI] [PubMed] [Google Scholar]
  • 23.Misane I, Klusa V, Dambrova M, Germane S, Duburs G, Bisenieks E, Rimondini R, Ogren SO. “Atypical” neuromodulatory profile of glutapyrone, a representative of a novel ‘class’ of amino acid-containing dipeptide-mimicking 1,4-dihydropyridine (DHP) compounds: in vitro and in vivo studies. Eur Neuropharmacol. 1998;8:329–47. doi: 10.1016/s0924-977x(97)00097-7. [DOI] [PubMed] [Google Scholar]
  • 24.Milkovic L, Vukovic T, Zarkovic N, Tatzber F, Bisenieks E, Kalme Z, Bruvere I, Ogle Z, Poikans J, Velena A, Duburs G. Antioxidative 1,4-dihydropyridine derivatives modulate oxidative stress and growth of human osteoblast-like cells in vitro. Antioxidants (Basel) 2018;7(9):123. doi: 10.3390/antiox7090123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kwak MK, Wakabayashi N, Greenlaw JL, Yamamoto M, Kensler TW. Antioxidants enhance mammalian proteasome expression through the Keap1-Nrf2 signaling pathway. Mol Cell Biol. 2003;23:8786–94. doi: 10.1128/MCB.23.23.8786-8794.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Huber N, Sakai N, Eismann T, Shin T, Kuboki S, Blanchard J, Schuster R, Edwards MJ, Wong HR, Lentsch AB. Age-related decrease in proteasome expression contributes to defective nuclear factor-kappaB activation during hepatic ischemia/reperfusion. Hepatology. 2009;49:1718–28. doi: 10.1002/hep.22840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Chondrogianni N, Petropoulos I, Franceschi C, Friguet B, Gonos ES. Fibroblast cultures from healthy centenarians have an active proteasome. Exp Gerontol. 2000;35:721–8. doi: 10.1016/s0531-5565(00)00137-6. [DOI] [PubMed] [Google Scholar]
  • 28.Chondrogianni N, Stratford FL, Trougakos IP, Friguet B, Rivett AJ, Gonos ES. Central role of the proteasome in senescence and survival of human fibroblasts: induction of a senescence-like phenotype upon its inhibition and resistance to stress upon its activation. J Biol Chem. 2003;278:28026. doi: 10.1074/jbc.M301048200. –. [DOI] [PubMed] [Google Scholar]
  • 29.Altar CA, Jurata LW, Charles V, Lemire A, Liu P, Bukhman Y, Young TA, Bullard J, Yokoe H, Webster MJ, Knable MB, Brockman JA. Deficient hippocampal neuron expression of proteasome, ubiquitin, and mitochondrial genes in multiple schizophrenia cohorts. Biol Psychiatry. 2005;58:85–96. doi: 10.1016/j.biopsych.2005.03.031. [DOI] [PubMed] [Google Scholar]
  • 30.Grünblatt E, Mandel S, Jacob-Hirsch J, Zeligson S, Amariglo N, Rechavi G, Li J, Ravid R, Roggendorf W, Riederer P, Youdim MBH. Gene expression profiling of parkinsonian substantia nigra pars compacta; alterations in ubiquitin-proteasome, heat shock protein, iron and oxidative stress regulated proteins, cell adhesion/cellular matrix and vesicle trafficking genes. J Neural Transm. 2004;111:1543–73. doi: 10.1007/s00702-004-0212-1. [DOI] [PubMed] [Google Scholar]

Articles from Archives of Industrial Hygiene and Toxicology are provided here courtesy of Sciendo

RESOURCES