Skip to main content
eLife logoLink to eLife
. 2021 Jul 15;10:e67718. doi: 10.7554/eLife.67718

Functional interdependence of the actin nucleator Cobl and Cobl-like in dendritic arbor development

Maryam Izadi 1, Eric Seemann 1, Dirk Schlobinski 1, Lukas Schwintzer 1, Britta Qualmann 1,†,, Michael M Kessels 1,†,
Editors: Alphee Michelot2, Catherine Dulac3
PMCID: PMC8282341  PMID: 34264190

Abstract

Local actin filament formation is indispensable for development of the dendritic arbor of neurons. We show that, surprisingly, the action of single actin filament-promoting factors was insufficient for powering dendritogenesis. Instead, this required the actin nucleator Cobl and its only evolutionary distant ancestor Cobl-like acting interdependently. This coordination between Cobl-like and Cobl was achieved by physical linkage by syndapins. Syndapin I formed nanodomains at convex plasma membrane areas at the base of protrusive structures and interacted with three motifs in Cobl-like, one of which was Ca2+/calmodulin-regulated. Consistently, syndapin I, Cobl-like’s newly identified N terminal calmodulin-binding site and the single Ca2+/calmodulin-responsive syndapin-binding motif all were critical for Cobl-like’s functions. In dendritic arbor development, local Ca2+/CaM-controlled actin dynamics thus relies on regulated and physically coordinated interactions of different F-actin formation-promoting factors and only together they have the power to bring about the sophisticated neuronal morphologies required for neuronal network formation in mammals.

Research organism: Mouse, Rat

Introduction

The actin cytoskeleton is crucial for a huge variety of key processes in cell biology. Yet, only few factors were found that can promote the de novo formation of actin filaments (Chesarone and Goode, 2009; Qualmann and Kessels, 2009). Thus, the initial idea that each of the discovered actin nucleators may be responsible for the formation of specific, perhaps tissue- or cell-type-specific F-actin structures obviously had to be dismissed as too simple. Theoretically, the required functional diversity in actin filament formation despite a limited set of powerful effectors could be achieved by combinatory mechanisms specific for a given cell biological process. However, experimental evidence for such combinatory actions of actin nucleators is still very sparse. On top of that, which mechanisms may orchestrate these powerful effectors to bring about a certain cellular processes also remains a fundamental question in cell biology.

Neurons need to extend elaborate cellular protrusions – the single signal-sending axon and multiple signal-receiving, highly branched dendrites – to form neuronal networks. These very demanding and specialized cellular morphogenesis processes are driven by the actin cytoskeleton (Kessels et al., 2011). The formation of the dendritic arbor involves local Ca2+ and calmodulin (CaM) signals coinciding with transient F-actin formation by the evolutionary young actin nucleator Cobl (Cordon-bleu) (Ahuja et al., 2007) at dendritic branch induction sites (Hou et al., 2015). Ca2+/CaM regulates both Cobl’s loading with monomeric actin and its different modes of plasma membrane association (Hou et al., 2015). Cobl is furthermore regulated via arginine methylation by PRMT2 (Hou et al., 2018). All of these aspects were required for Cobl’s crucial role in dendritic arbor formation (Ahuja et al., 2007; Haag et al., 2012; Hou et al., 2015, Hou et al., 2018).

Interestingly, also Cobl’s evolutionary distant ancestor Cobl-like (COBLL1; Coblr1) was recently discovered to be important for Ca2+/CaM-controlled neuromorphogenesis (Izadi et al., 2018). While Cobl uses three Wiskott-Aldrich syndrome protein Homology 2 (WH2) domains to nucleate actin (Ahuja et al., 2007), Cobl-like employs a unique combinatory mechanism of G-actin binding by its single, C terminal WH2 domain and Ca2+/CaM-promoted association with the actin-binding protein Abp1 (Kessels et al., 2000) to promote F-actin formation (Izadi et al., 2018). Cobl-like was also found to interact with cyclin-dependent kinase 1 and to shape prostate cancer cells by not yet fully clear mechanisms (Takayama et al., 2018).

Here, we show that Cobl and Cobl-like work at the same nascent dendritic branch sites in a strictly interdependent manner choreographed by physically bridging by the membrane-binding F-BAR protein syndapin I (Qualmann et al., 1999; Itoh et al., 2005; Dharmalingam et al., 2009; Schwintzer et al., 2011), which we identified to interact with Cobl-like and to specifically occur in nanoclusters at the convex membrane surfaces at the base of nascent membrane protrusions of developing neurons. The finding that one of the three syndapin binding sites of Cobl-like was regulated by Ca2+/CaM unveiled a further important mechanism of local control and coordination of actin dynamics in neuromorphogenesis.

Our work thereby provides insights into how two actin filament formation-promoting components – each critical for dendritic arbor formation – power actin-mediated dendritic branch initiation in a strictly coordinated manner and how this process can be directly linked to local membrane shaping to give rise to the complex morphologies required for proper neuronal network formation.

Results

Cobl-like and the actin nucleator Cobl largely phenocopy each other in their critical role in dendritic arborization and seem to work at the same dendritic branching sites

The actin nucleator Cobl and its evolutionary ancestor protein Cobl-like are molecularly quite distinct (Figure 1—figure supplement 1), however, both critical for dendritic arbor formation (Ahuja et al., 2007; Izadi et al., 2018). Side-by-side loss-of-function analysis of both factors in developing primary hippocampal neurons using IMARIS software-based evaluations for detailed analyses of the elaborate morphology of such cells (Izadi et al., 2018) revealed surprisingly similar phenotypes (Figure 1—figure supplement 2A–D). Dendritic branch and terminal point numbers as well as total dendritic length all were severely affected by lack of Cobl-like (Figure 1—figure supplement 2E–G). Corresponding Cobl loss-of-function showed that, while dendritic growth processes seemed largely unaffected by Cobl deficiency, also Cobl deficiency led to a significant reduction of terminal points and in particular to severe loss of dendritic branch points. With −35%, these defects were about as strong as those caused by Cobl-like RNAi (Figure 1—figure supplement 2E–G). Cobl RNAi mostly affected dendritic arborization in proximal areas, as demonstrated by evaluations of morphological intersections with concentric circles of increasing size (Sholl analysis; Sholl, 1953). Cobl-like RNAi led to reduced Sholl intersections throughout the dendritic arbor (Figure 1—figure supplement 2H).

The phenotypical comparison of Cobl and Cobl-like unveiled that both cytoskeletal effectors have somewhat similar functions in dendritic arborization. Colocalization studies showed that Flag-mCherry-Cobl and GFP-Cobl-like did not show any obvious spatial segregation (neither in proximal nor in peripheral dendritic arbor of developing neurons) but largely colocalized. Dendritic accumulations of Cobl usually showed corresponding albeit less pronounced accumulations of Cobl-like (Figure 1A,B; arrows). This suggested that Cobl and Cobl-like are not responsible for distinct branching sites but work at the same sites.

Figure 1. Cobl-like and the actin nucleator Cobl work at the same dendritic branching sites and show functional interdependence in dendritic arbor formation.

(A,B) Maximum intensity projections (MIPs) of GFP-Cobl-like and Flag-mCherry-Cobl in dendrites of developing hippocampal neurons (DIV6) in standard colors (A) and as heat map representation (B), respectively. Arrows, examples of putative, nascent dendritic branch induction sites with accumulations of both Cobl and Cobl-like. Bar, 5 µm. (C–F) MIPs of neurons showing the suppression of the Cobl-like gain-of-function phenotype (cotransfection at DIV4; fixation 34 hr thereafter) (D; GFP-Cobl-like+Scr. RNAi) by mCherryF-reported RNAi plasmids directed against Cobl (E; GFP-Cobl-like+Cobl RNAi) in comparison to control neurons (C; GFP+Scr. RNAi) and Cobl RNAi neurons (F; GFP+Cobl RNAi). (G–I) Quantitative determinations of indicated dendritic arborization parameters unveiling a full suppression of all Cobl-like functions in dendritic arbor formation by a lack of Cobl. (J–P) Related images (J–M) and quantitative data (N–P) of experiments revealing a functional dependence of Cobl on Cobl-like. Asterisks, transfected neurons. Bars, 10 µm. Data, mean ± SEM. One-way ANOVA+Tukey. Also see Figure 1—source data 1 and 2.

Figure 1—source data 1. Raw data and numerical data graphically presented in Figure 1G–I.
Figure 1—source data 2. Raw data and numerical data graphically presented in Figure 1N–P.

Figure 1.

Figure 1—figure supplement 1. Comparison of domain structures and alignment of Cobl-like with the actin nucleator Cobl.

Figure 1—figure supplement 1.

(A) Scheme of Cobl-like with its domains in comparison to the actin nucleator Cobl with its domains. Abbreviations: PRD, proline-rich domain (PRD next to the Cobl Homology domain is an Abp1- and PRMT2-binding site and therefore colored in light green reminiscent of the RD, that is, the Abp1-binding repeat domain in Cobl-like); WH2, WH2 domain. (B) Amino acid sequence alignment of murine Cobl-like (gi:74201419) and Cobl (gi:162135965) using Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo/). Marked are the Cobl Homology domains of both proteins (boxed in light blue) and the ‘KRAP’ motifs (boxed in red) of both proteins. Furthermore, the single C terminal WH2 domain of Cobl-like and the three WH2 domains of Cobl are marked by orange letters. The CaM-binding region of Cobl in the Cobl Homology domain and in the C terminal CaM-binding regions in Cobl and Cobl-like are boxed in yellow, the Abp1- and PRMT2-binding PRD of Cobl is boxed in light green. The Abp1-binding repeat domain of Cobl-like is boxed in green and the proline-rich region located N terminal of the Abp1-binding area is boxed in purple. Note that although Cobl-like is considered as evolutionary ancestor of Cobl, the sequence conservation between both proteins in general is very low (*, identity; ‘:’, high similarity; ‘.’, moderate similarity). Even in the most-conserved part, the so-called Cobl Homology domain, the similarity is limited to the central core of this proposed domain and to the ‘KRAP’ motifs.
Figure 1—figure supplement 2. Cobl-like and the actin nucleator Cobl work at the same dendritic branching sites and largely phenocopy each other in their critical role in dendritic arborization.

Figure 1—figure supplement 2.

(A–D) Maximum intensity projections (MIPs) of anti-MAP2 immunostained developing primary hippocampal neurons transfected as indicated at DIV4 and fixed 46 hr after transfection (A,C,D) and 2D representative of the 3D reconstruction of the morphology of the example neuron in A using IMARIS software (B). For detailed software parameters, see the Materials and methods section. Shown is the filament representing dendritic tracts (white lines) with branch points (magenta dots placed on the filament) and terminal points (turquoise dots placed on the filament) marked. Asterisks, transfected neurons. Bars, 20 µm. (E–H) Quantitative comparative Cobl-like and Cobl loss-of-function analyses of indicated dendritic parameters. Data, mean ± SEM. One-way ANOVA+Tukey (E–G) and two-way ANOVA+Bonferroni (H).
Figure 1—figure supplement 2—source data 1. Raw data and numerical data graphically presented in Figure 1—figure supplement 2 A-D.
Figure 1—figure supplement 2—source data 2. Raw data and numerical data graphically presented in Figure 1—figure supplement 2E-G.

Cobl-like functions in dendritic arborization strictly depend on Cobl and likewise Cobl functions depend on Cobl-like

Observations of two powerful molecular components for actin filament formation at the same place may either reflect functional redundancy and/or parallel action to drive cellular processes effectively in response to (putatively different) signaling cues or may even reflect interlinked functions. Functional redundancy and/or parallel action seemed unlikely, because both individual loss-of-function DIV4-to-DIV6 phenotypes were so severe that about a third of the entire arborization normally reached at DIV6 was lacking (Cobl, −33%; Cobl-like, −39%) (Figure 1—figure supplement 2E). Thus, we focused on the remaining hypotheses.

Interestingly, Cobl-like-driven dendritic arborization was completely impaired by the lack of Cobl (Figure 1C–I). Dendritic branch point numbers, terminal point numbers, and the total dendritic arbor length of neurons cotransfected with GFP-Cobl-like and Cobl RNAi all were significantly below the values of neurons cotransfected with Cobl-like and scrambled RNAi. The suppression of the Cobl-like gain-of-function effects by Cobl RNAi was so strong that under the chosen condition (only 34 hr expression; GFP coexpression), all three parameters were indistinguishable from control levels. As under the chosen conditions neurons subjected to only Cobl RNAi (+GFP expression) for comparison showed a dendritic arbor development with all three parameters evaluated at about control levels, these experiments permitted the clear conclusion that the effects of Cobl RNAi in Cobl-like-overexpressing neurons did not reflect putative independent and thus merely additive effects on dendritic arborization but clearly represented a full suppression of Cobl-like’s functions in dendritic branching in the absence of Cobl (Figure 1G–I).

To our surprise, likewise, Cobl-promoted dendritic arbor formation turned out to be massively affected by absence of Cobl-like (Figure 1J–M). The dendritic parameters of developing neurons expressing Cobl and Cobl-like RNAi did not show any Cobl gain-of-function phenotype but were statistically not significantly different from those of control or Cobl-like RNAi (Figure 1N–P). The fact that the suppressive effects of Cobl-like RNAi on Cobl gain-of-function clearly exceeded the effects of Cobl-like RNAi alone (GFP+Cobl-like RNAi) allowed us to firmly conclude that Cobl functions in dendritic arbor formation depended on Cobl-like. This conclusion was further underscored by the fact that GFP-Cobl+Cobl-like RNAi and GFP+Cobl-like RNAi were statistically not different from each other in any of the three parameters. The lack of any Cobl effects upon coexpression of Cobl-like RNAi thus represented a full and direct suppression of all Cobl functions in the absence of Cobl-like.

Taken together, Cobl and Cobl-like both are cellular factors promoting actin filament formation and significantly differ in their properties, yet, in dendritic branch formation, they do not work independently but surprisingly strongly depend on each other.

Cobl-like associates with syndapins

The surprising functional interdependence of Cobl and Cobl-like in dendritic arbor formation raised the question how this may be organized mechanistically with two proteins that seem to employ quite different molecular mechanisms (Ahuja et al., 2007; Izadi et al., 2018).

Using a variety of different methods, we failed to observe any obvious interactions of Cobl and Cobl-like (also see below). Thus, the crosstalk of Cobl-like and Cobl had to be less direct and more sophisticated.

Cobl was demonstrated to use complexly choreographed membrane-binding mechanisms involving its direct binding partner syndapin I (Schwintzer et al., 2011; Hou et al., 2015). Syndapins can self-associate (Kessels and Qualmann, 2006) and could therefore theoretically link Cobl and Cobl-like physically. As a prerequisite, syndapin I would have to associate with Cobl-like. Indeed, GFP-Cobl-like specifically coprecipitated with immobilized syndapin I SH3 domain. The interaction was mediated by N terminal proline-rich regions of Cobl-like (Figure 2A; Figure 2—figure supplement 1A) and was conserved among syndapin I, syndapin II, and syndapin III (Figure 2B; Figure 2—figure supplement 1B).

Figure 2. Cobl-like associates with syndapins.

(A) Coprecipitation analyses of GFP-tagged Cobl-like and deletion mutants thereof with immobilized syndapin I SH3 domain (GST-SdpISH3). (B) Related coprecipitation studies with the SH3 domains of syndapin I, syndapin II (SdpIISH3), and syndapin III (SdpIIISH3), respectively. (C) Reconstitution of the association of TrxHis-Cobl-like1-411 with purified GST-syndapin I and GST-syndapin I SH3 domain but not with GST. (D) Scheme of Cobl-like with its domains (PRD, proline-rich domain; RD, Abp1-binding repeat domain; WH2, WH2 domain) and deletion mutants used (red, not binding syndapins; green, binding). Red in the Cobl Homology domain, ‘KRAP’ motifs (not drawn to scale). (E) Coprecipitation assays with Cobl-like deletion mutants mapping Cobl-like’s syndapin binding sites. (F) Coimmunoprecipitations unveiling a specific association of GFP-Cobl-like1-741 with Flag-syndapin I. (G–I) Reconstitution and visualization of Cobl-like/syndapin I complexes in COS-7 cells using mitochondrially targeted syndapin I (G,H) as well as a mutant lacking the SH3 domain (Mito-mCherry-SdpI∆SH3) (I) with GFP-Cobl-like (G) and GFP-Cobl-like1-741 (H,I). Boxed areas are shown at higher magnification as insets. Line scans of fluorescence intensities of both channels are along the respective line indicated in the merged insets in G–I. Bars, 10 µm. (J) Coprecipitation of endogenous syndapin I from mouse brain lysates by TrxHis-Cobl-like1-411. (K) Endogenous coimmunoprecipitation of Cobl-like and syndapin I from mouse brain lysates.

Figure 2.

Figure 2—figure supplement 1. Cobl-like associates with syndapins.

Figure 2—figure supplement 1.

(A,B) Anti-GFP immunoblotting analyses of supernatants of coprecipitation analyses of GFP-tagged Cobl-like and deletion mutants thereof with immobilized syndapin I SH3 domain (GST-SdpISH3) and GST (control) (A) and of related coprecipitation studies with the SH3 domains of syndapin I, syndapin II (SdpIISH3), and syndapin III (SdpIIISH3), respectively (B). For eluate analyses, see Figure 2A,B. (C) More complete immunoblotting analyses of the reconstitution of the association of TrxHis-Cobl-like1-411 with purified GST-syndapin I and GST-syndapin I SH3 domain but not with GST shown in Figure 2C containing a characterization of the input and both the anti-TrxHis and anti-GST immunoblotting analyses of the eluates. (D) Immunoblot analyses of a reconstitution of the association of TrxHis-Cobl-like1-411 with recombinant, purified GST-syndapin I and GST-syndapin I SH3 domain but not with a mutated syndapin I SH3 domain (P434L; SdpISH3mut). (E) Anti-GFP immunoblotting of the cell lysates and of the GST controls of the syndapin I coprecipitation assays with Cobl-like deletion mutants shown in Figure 2E. (F,G) Immunoblotting analyses of specific coimmunoprecipitations of GFP-Cobl-like1-741 but not GFP with Flag-tagged syndapin II-s (short splice variant, SdpII-s) and syndapin III (SdpIII). (H,I) Maximum intensity projections (MIPs) showing control experiments accompanying the protein complex reconstitutions between GFP-Cobl-like and GFP-Cobl-like1-741 and mitochondrially targeted syndapin I (Mito-mCherry-SdpI) shown in Figure 2G–I. (H) GFP is not recruited to Mito-mCherry-SdpI-enriched sites. (I) GFP-Cobl-like is not recruited to mitochondria when a Mito-mCherry-SdpI lacking the SH3 domain (Mito-mCherry-SdpI∆SH3) is coexpressed. Boxed areas are shown at higher magnification as insets. Line scans of fluorescence intensities of both channels are along the respective line indicated in the merged insets of H and I. Bars, 10 µm.

In vitro reconstitutions with purified components proved that syndapin I/Cobl-like interactions were direct (Figure 2C; Figure 2—figure supplement 1C) and were furthermore based on classical SH3 domain/PxxP motif interactions, as proven by using a P434L-mutated SH3 domain (Figure 2—figure supplement 1D).

Cobl-like deletion mutants (Figure 2D,E) showed that specifically three regions in Cobl-like’s Cobl Homology domain (Cobl-like1-111, Cobl-like261-380, and Cobl-like376-540) contained syndapin I interfaces (Figure 2E, Figure 2—figure supplement 1E). Each of them has a single ‘KRAP’ motif (Figure 1—figure supplement 1).

Specific coimmunoprecipitation of GFP-Cobl-like1-741 with Flag-tagged syndapin I demonstrated that the identified interaction can also occur in vivo (Figure 2F). GFP-Cobl-like1-741 also specifically coimmunoprecipitated with Flag-syndapin II-s and Flag-syndapin III (Figure 2—figure supplement 1F,G), that is, with syndapin family members showing a wider expression than syndapin I (Kessels and Qualmann, 2004).

It was furthermore possible to directly visualize Cobl-like/syndapin I complex formation in intact cells by demonstrating specific recruitments of GFP-Cobl-like and GFP-Cobl-like1-741 to mitochondria decorated with Mito-mCherry-syndapin I (Figure 2G,H; Figure 2—figure supplement 1H). This firmly excluded postsolubilization artifacts, which theoretically could compromise biochemical studies. Deletion of the syndapin I SH3 domain (Mito-mCherry-SdpI∆SH3) disrupted complex formations with both GFP-Cobl-like1-741 (Figure 2I) and GFP-Cobl-like full-length (Figure 2—figure supplement 1I).

Cobl-like/syndapin interactions also are of relevance in the brain, as immobilized, recombinant TrxHis-tagged Cobl-like1-411 specifically precipitated endogenous syndapin I from mouse brain lysates (Figure 2J). Furthermore, endogenous Cobl-like/syndapin I complexes in vivo were demonstrated by coimmunoprecipitation analyses from mouse brain lysates (Figure 2K).

Syndapin I is crucial for Cobl-like’s ability to promote dendritic arbor extension and branching

We next addressed whether the identified Cobl-like interaction partner syndapin I would indeed be critical for Cobl-like’s functions. GFP-Cobl-like massively promoted dendritic arborization already after very short times (Izadi et al., 2018). Strikingly, all Cobl-like gain-of-function phenotypes in developing primary hippocampal neurons were completely suppressed upon syndapin I RNAi (Figure 3A–C). Cobl-like-overexpressing neurons cotransfected with syndapin I RNAi showed dendritic branch points, dendritic terminal points, and an overall length of the dendritic arbor that were statistically significantly different from Cobl-like-overexpressing neurons and indistinguishable from those of control cells. The syndapin I RNAi-mediated suppression of Cobl-like functions occurred in all dendritic arbor parts affected by Cobl-like gain-of-function (Figure 3D–G).

Figure 3. Cobl-like functions in dendritic arbor formation rely on syndapin I.

Figure 3.

(A–C) Maximum intensity projections (MIPs) of DIV5.5 neurons transfected as indicated. Asterisks, transfected neurons. Bars, 20 µm. (D–G) Quantitative determinations of key dendritic arborization aspects promoted by Cobl-like for their dependence on syndapin I (cotransfection at DIV4; fixation 34 hr thereafter). Data, mean ± SEM. One-way ANOVA+Tukey (D–F) and two-way ANOVA+Bonferroni (G). Also see Figure 3—source data 1 and 2.

Figure 3—source data 1. Raw data and numerical data graphically presented in Figure 3D–F.
Figure 3—source data 2. Raw data and numerical data graphically presented in Figure 3G.

Cobl-like’s functions in dendritic arbor formation thus are fully dependent on the availability of its direct interaction partner syndapin I.

Syndapins physically interconnect Cobl-like with Cobl

In order to unravel molecular mechanisms underlying the strict functional interdependence of Cobl and Cobl-like in dendritic arborization, we asked whether syndapin I may indeed be able to directly bridge the two actin cytoskeletal effectors. To exclude putative indirect interactions via actin, we used immobilized GST-Cobl-like1-411, which comprises the syndapin binding sites (Figure 2). Cobl-like1-411 indeed formed specific protein complexes with GFP-Cobl1-713 when syndapin I was present (Figure 4A). No GFP-Cobl1-713 was precipitated when syndapin I was omitted. Thus, direct interactions between Cobl-like and Cobl did not occur but complex formation required syndapin I acting as a bridge (Figure 4A). Likewise, also syndapin III mediated complex formation of Cobl-like with Cobl (Figure 4B).

Figure 4. Cobl-like is physically linked to Cobl via syndapin I acting as a bridging component.

(A,B) Coprecipitation analyses unveiling specific and syndapin-dependent formation of complexes composed of immobilized GST-Cobl-like, syndapin I (A) and syndapin III (B), respectively, as well as GFP-Cobl1-713. White lines indicate omitted blot lanes. (C–E) Reconstitution and visualization of Cobl-like/syndapin I/Cobl protein complexes in COS-7 cells. Mito-GFP-Cobl1-713 (C,D) but not Mito-GFP (E) recruited mCherry-Cobl-like1-741 in the presence of Xpress-syndapin I (C) but not in its absence (D). Boxes in C–E areas presented as magnified insets (C,D, fourfold; E, threefold). Arrows, examples of colocalization of all three channels. Boxed areas are shown at higher magnification as insets. (F–H) Line scans of fluorescence intensities of all three channels are along the respective line indicated in the insets of C–E. Bars, 10 µm.

Figure 4.

Figure 4—figure supplement 1. Recruitment of syndapin I to mitochondrial surfaces in intact cells by Mito-GFP-Cobl1-713.

Figure 4—figure supplement 1.

Reconstitution and visualization of Cobl/syndapin I protein complexes inside of intact COS-7 cells. Mitochondrially targeted Cobl1-713 (green in merge) recruits Xpress-tagged syndapin I (red in merge; anti-Xpress immunolabeling) to mitochondria (blue in merge; visualized by MitoTracker). Boxes mark the area presented as magnified inset (fourfold enlargement). Colocalization of all three channels appears in whitish colors (white, beige, turquoise, rosé) in the merge. The line scan of fluorescence intensities of all three channels is along the line indicated in the merged inset. Bar, 10 µm.

Complexes of all three components are also formed at membranes and in intact cells. Mito-GFP-Cobl1-713 was successfully targeted to the cytosolic membrane of mitochondria and did not only successfully recruit syndapin I to mitochondrial membranes (Figure 4—figure supplement 1) but was also able to recruit Cobl-like1-741 (Figure 4C–H).

The visualized complex formations (Figure 4C,F) were specific and mediated by syndapin I acting as bridging component between Cobl and Cobl-like, as omitting syndapin I did not lead to any Cobl-like1-741 mitochondrial presence and also Mito-GFP did not lead to any syndapin/Cobl-like colocalization at mitochondria (Figure 4D,E,G,H).

Syndapin I and Cobl-like colocalize at sites of dendritic branch induction

In line with the BAR domain hypothesis (Peter et al., 2004; Qualmann et al., 2011; Daumke et al., 2014; Kessels and Qualmann, 2015; Carman and Dominguez, 2018), syndapin I may sense/induce certain membrane topologies and thereby provide spatial cues for Cobl and Cobl-like functions. Thus, three syndapin I-related aspects needed to be experimentally addressed: (i) Where and when do Cobl-like and syndapin I occur together in developing neurons? (ii) Would a given syndapin I localization indeed reflect specifically membrane-associated syndapin I? (iii) Would putative accumulations of membrane-associated syndapin I then really correspond to convex membrane topologies?

Dual time-lapse imaging of GFP-Cobl-like and syndapin I-mRubyRFP in developing primary hippocampal neurons showed that syndapin I accumulated in defined spots along dendrites coinciding with subsequent branch induction events. Such accumulations occurred as early as 1 min prior to detectable dendritic branch protrusion, were spatially restricted to very small areas (diameters, ~250–1200 nm), and were spatially and temporally colocalized with Cobl-like at branch initiation sites (Figure 5A,B).

Figure 5. Cobl-like and syndapin I coincide at nascent dendritic branch sites.

Figure 5.

(A) Maximum intensity projections (MIPs) of individual frames of a 3D time-lapse recording of a dendrite segment of a DIV7 rat hippocampal neuron coexpressing GFP-Cobl-like and syndapin I (SdpI)-mRubyRFP. Arrows, GFP-Cobl-like and syndapin I enrichments prior to protrusion initiation from these dendritic sites; *, tips of growing dendritic protrusions; (*), abandoned protrusions. (B) Heat map representations. Bars, 2.5 µm. (C) Quantitation of maximal intensities of fluorescent syndapin I, Cobl-like, Cobl and CaM fusion proteins as well as of mCherry as control at dendritic branch induction sites prior to protrusion formation (time frame: the six 10 s frames prior to protrusion start) in relation to a control ROI at the same dendrite at a position neighboring the branch induction site (shown as % above this control ROI). Data, mean ± SEM. Bar/dot plot overlay of individual data points averaged. (D) Temporal analyses of the maximal fluorescence intensities of syndapin I, Cobl-like, Cobl, and CaM occurring at dendritic branch induction sites prior to protrusion formation. Data, mean (black dot) ± SD (light blue) and ± SEM (dark blue). One-way-ANOVA (C). Also see Figure 5—source data 1.

Figure 5—source data 1. Raw data and numerical data graphically presented in Figure 5C,D.

Afterward, the accumulations of both proteins at the base of newly formed protrusions faded. This suggested a highly mobile subpool of syndapin I and Cobl-like in the dendritic arbor.

Sites with repetitive dendritic protrusion attempts showed accumulations of both syndapin I and Cobl-like prior to the first as well as prior to the second protrusion initiation (Figure 5A,B).

Determinations of maximal fluorescence intensities prior to dendritic branch induction showed that Cobl-like and syndapin I but also syndapin’s binding partner Cobl as well as the calcium sensor protein CaM showed accumulations that were about 75–100% above neighbored control regions in the same dendrite. In contrast, control fluorescent protein (mCherry) significantly differed and did not show such accumulations (Figure 5C). Maximal accumulations of all four proteins hereby occurred in a time window of in average −40 to −25 s prior to protrusion induction (Figure 5D). Interestingly, despite the observed high variances of especially Cobl-like and syndapin I, these two players in dendritic branch induction seemed to be accumulating slightly earlier than Cobl.

Taken together our observations show that Cobl-like, syndapin I, Cobl, and CaM all accumulate a branch initiation sites prior to dendritic branch induction and show some temporal overlap at these particular sites.

Membrane-bound syndapin I occurs preferentially at protrusive membrane topologies in developing neurons and forms nanoclusters at such sites

3D time-lapse studies do not resolve whether the observed syndapin I accumulations at nascent branch sites represent membrane-associated syndapin I or a cytosolic subpool, for example, associated with putative cytoskeletal components at such sites. Immunogold labeling of freeze-fractured plasma membranes is a technique that per se exclusively focuses on membrane-integrated proteins, provides membrane topology information, and can be applied to neuronal networks (e.g. see Tanaka et al., 2005; Holderith et al., 2012; Schneider et al., 2014; Nakamura et al., 2015). We have recently shown that plasma membranes of still developing neurons can in principle be freeze-fractured and immunolabeled, too (Wolf et al., 2019).

Whereas neither Cobl nor Cobl-like seemed to be preservable by the procedure, immunogold labeling of syndapin I, which can insert hydrophobic wedges into one membrane leaflet (Wang et al., 2009), was successfully obtained (Figure 6A–B). In principle, anti-syndapin I immunogold labeling was seen at both cylindrical and protrusive membrane topologies. However, even at the conditions of saturated labeling applied, cylindrical membrane surfaces merely showed sparse anti-syndapin I immunogold labeling and were mostly decorated with single gold particles or by pairs of labels. In contrast, at protrusive sites, the labeling density was about three times as high as at cylindrical surfaces (Figure 6A,A',B).

Figure 6. Syndapin I nanoclusters are enriched at sites of dendritic protrusion.

Figure 6.

(A,A’,A’’) Transmission electron microscopy (TEM) images of anti-syndapin I immunogold-labeled freeze-fracture replica of developing neurons (DIV7). Red lines highlight membrane topologies protruding from regular cylindrical topology. Arrowheads, abundant and clustered anti-syndapin I immunogold labeling (10 nm) at protrusive sites. Arrows, sparse and rarely clustered anti-syndapin immunogold labeling at regular, cylindrical membrane structures. Bars, 200 nm. (B) Quantitative evaluations of anti-syndapin I labeling densities at protrusive and cylindrical membrane topologies. (C) Quantitative analysis of the relative abundance of differently clustered syndapin I labels (ROIs, 35 nm radius). In total, 335 (protrusive) and 130 (cylindrical) labels were evaluated. (D) Quantitative analysis of the density of anti-syndapin I nanoclusters (≥3 anti-syndapin I immunogold labels/ROI) at regular cylindrical membrane surfaces and at those with protrusive topology. Data (B,D), mean ± SEM. One-way ANOVA (B); two-tailed Student’s t-test (D). Also see Figure 6—source data 1.

Figure 6—source data 1. Raw data and numerical data graphically presented in Figure 6B–D.

Protrusive sites also showed a statistically highly significant enrichment of syndapin I nanoclusters (≥3 anti-syndapin I labels in circular ROIs of 35 nm radius) (Figure 6B–D). Interestingly, syndapin I was usually not localized to the tip of the protrusion but preferentially occurred at membrane topology transition zones at the protrusion base (Figure 6A’’).

The accumulation of syndapin I clusters at such sites was in line with a promotion of membrane curvature induction and/or with a stabilization of the complex membrane topologies found at such sites by syndapin I.

Cobl-like’s N terminus is a target for the Ca2+ sensor CaM and Ca2+ signals increase Cobl-like’s associations with syndapin I

The formation of neuronal networks involves local Ca2+ and CaM signals, which coincide with transient F-actin formation at sites of dendritic branch induction (Hou et al., 2015). Cobl-like was identified as Ca2+/CaM target. Yet, this CaM association occurred in the C terminal part of Cobl-like and regulated Cobl-like’s association with the F-actin-binding protein Abp1 (Izadi et al., 2018). Interestingly, also GFP-Cobl-like1-411 showed Ca2+-dependent CaM binding, whereas middle parts, such as Cobl-like376-540 and Cobl-like537-740, did not (Figure 7A,B).

Figure 7. Ca2+/CaM associates with the N terminus of Cobl-like and positively regulates Cobl-like’s syndapin I association.

Figure 7.

(A) Scheme of Cobl-like and deletion mutants used for CaM-binding studies (B) (red, no Ca2+-dependent binding; green, Ca2+-dependent binding). (B) Coprecipitations with immobilized CaM in presence (500 µM) and absence of Ca2+ and different Cobl-like deletion mutants. Green arrowheads, increased CaM interactions in the presence of Ca2+. White lines, lanes omitted from blots. (C) Coprecipitation analyses with immobilized CaM and purified TrxHis-Cobl-like1-411 and GST-syndapin I (GST-SdpI) showing direct and simultaneous interactions of Cobl-like1-411 with both CaM and syndapin I. (D,E) Quantitative coimmunoprecipitation analyses demonstrating that Ca2+/CaM signaling leads to increased syndapin I coimmunoprecipitation with Cobl-like1-741. Blue arrowhead, position of the only faintly detected GFP-Cobl-like1-741 in the lysates (D). Green arrowhead, increase of coimmunoprecipitated syndapin I (D). (E) Anti-syndapin I signal per immunoprecipitated Cobl-like (expressed as change from conditions without Ca2+). Data, bar/dot plot overlays with mean ± SEM. Unpaired Student’s t-test. Also see Figure 7—source data 1.

Figure 7—source data 1. Raw data and numerical data graphically presented in Figure 7E.

Surprisingly, further analyses demonstrated that the central parts of the Cobl Homology domain of Cobl-like, that is, Cobl-like111-262 and Cobl-like182-272, both also did not show any Ca2+-dependent CaM binding (Figure 7A,B), although the central Cobl Homology domain corresponds to the CaM-binding area in Cobl (Hou et al., 2015) and represents an area of at least moderately higher sequence conservation between Cobl and Cobl-like (33% identity; Figure 1—figure supplement 1). Instead, it was the most N terminal part of Cobl-like represented by Cobl-like1-111 and Cobl-like1-58 that was targeted by CaM (Figure 7A,B).

Coprecipitation experiments with purified recombinant proteins confirmed that Ca2+/CaM and syndapin I can bind Cobl-like1-411 simultaneously (Figure 7C). We hypothesized that the discovered Ca2+/CaM binding to the Cobl-like N terminus may play a role in regulating the syndapin binding of the neighbored Cobl Homology domain. Quantitative syndapin I coimmunoprecipitation experiments with Cobl-like1-741 demonstrated an improved complex formation of Cobl-like with syndapin I when Ca2+ was added. With an increase of ~70%, syndapin I binding to Cobl-like1-741 turned out to be massively promoted by Ca2+ (Figure 7D,E).

Thus, the identified N terminal complex formation with syndapin I is Ca2+/CaM-regulated.

Cobl-like’s N terminal CaM-binding site regulating syndapin I association levels is crucial for dendritic arbor formation

The N terminal region of Cobl-like (Figure 1—figure supplement 1) indeed contains putative CaM-binding motifs. Coprecipitation analyses clearly showed that, in contrast to GFP-Cobl-like1-741, a corresponding deletion mutant (GFP-Cobl-like1-741∆CaM NT; GFP-Cobl-like1-741∆11-45) did not show any Ca2+-dependent CaM binding (Figure 8A).

Figure 8. The N terminal CaM-binding site of Cobl-like is indispensable for all critical functions of Cobl-like in dendritic arbor formation.

Figure 8.

(A) Coprecipitation analyses of Cobl-like1-741, Cobl-like1-741∆CaM NT (∆11–45), and GFP with immobilized CaM in Ca2+ presence and absence. Arrowhead, increased CaM interaction of Cobl-like1-741 upon Ca2+ (disrupted in Cobl-like1-741∆CaM NT). (B,C) Functional analyses in primary hippocampal neurons (transfection at DIV4; fixation 37 hr thereafter) unveiling that an RNAi-insensitive (*) Cobl-like mutant lacking the N terminal CaM-binding site (GFP-Cobl-like*∆CaM NT) failed to rescue the Cobl-like loss-of-function phenotypes. Red asterisks, transfected neurons (transfection, DIV4; analyses, DIV5.5). Bars, 10 µm. (D–G) Quantitative evaluations of indicated dendritic parameters. Data, mean ± SEM. One-way ANOVA+Tukey (D–F); two-way ANOVA+Bonferroni (G). Also see Figure 8—source data 1 and 2.

Figure 8—source data 1. Raw data and numerical data graphically presented in Figure 8D–F.
Figure 8—source data 2. Raw data and numerical data graphically presented in Figure 8G.

Strikingly, a RNAi-resistant (*) Cobl-like mutant solely lacking the N terminal CaM-binding site (GFP-Cobl-like*∆CaM NT) failed to rescue the Cobl-like loss-of-function phenotypes in dendritic arborization (Figure 8B,C). Quantitative analyses unveiled that reexpression of GFP-Cobl-like*∆CaM NT instead of resupplying the neurons with RNAi-insensitive wild-type (WT) Cobl-like*, which rescued all Cobl-like deficiency phenotypes, was unable to rescue the RNAi-mediated defects in dendritic branch point numbers, terminal point numbers, and total dendritic length. These defects were as severe as those caused by Cobl-like RNAi without rescue attempt (Figure 8D–F).

Also Sholl analyses confirmed that GFP-Cobl-like*∆CaM NT showed a significant lack of rescue performance in all proximal and central parts of the dendritic arbor (see all Sholl intersections up to 30 µm) when compared to Cobl-like RNAi/GFP-Cobl-like* (Figure 8G).

The identified N terminal CaM-binding site of Cobl-like regulating the syndapin I interactions thus was absolutely indispensable for Cobl-like’s functions in dendritic arbor formation.

Ca2+/CaM signaling exclusively promotes the syndapin I association with the first of the three ‘KRAP’ motifs

The critical N terminal CaM-binding site was adjacent to the most N terminal of the three syndapin binding areas. As a prerequisite for further analyses uncovering the regulatory mechanism, we next confirmed that the interactions with syndapins were indeed solely mediated by the ‘KRAP’ motif-containing regions. Both Cobl-like1-741∆KRAP and Cobl-like∆KRAP indeed were not able to interact with the syndapin I SH3 domain, as shown by coprecipitation studies and by reconstitutions of complex formations with syndapin I in vivo (Figure 9A; Figure 9—figure supplement 1).

Figure 9. Ca2+/CaM signaling exclusively promotes the syndapin I association with the first of the three ‘KRAP’ motifs and this single Ca2+/CaM-regulated motif is crucial for Cobl-like’s functions.

(A) Coprecipitations with immobilized syndapin I SH3 domain (SdpISH3) and Cobl-like and ∆KRAP mutants thereof. (B,C) Quantitative coimmunoprecipitation analyses with GFP-Cobl-like1-457 (B) in comparison to a corresponding mutant solely lacking the first ‘KRAP’ motif (GFP-Cobl-like1-457∆KRAP1) in the presence and absence of Ca2+, respectively (C). Arrowhead, increase of coimmunoprecipitated Flag-syndapin I with GFP-Cobl-like1-457 upon Ca2+. (D) Quantitation of anti-syndapin I coimmunoprecipitation upon Ca2+ presence normalized to immunoprecipitated GFP-Cobl-like1-457 and GFP-Cobl-like1-457∆KRAP1, respectively (as deviation from conditions without Ca2+). (E,F) Side-by-side comparison of syndapin I coimmunoprecipitations with GFP-Cobl-like1-457 and GFP-Cobl-like1-457∆KRAP1 (E) and quantitative analysis thereof (F). White line, lanes omitted from blot. (G,H) Images of Apotome sections showing the cortical localization of GFP-Cobl-like expressed in Cobl-like-deficient background (Cobl-like RNAi/GFP-Cobl-like*) in primary hippocampal neurons transfected at DIV4 and imaged 37 hr later (G) compared to the subcellular distribution of GFP-Cobl-like*∆KRAP1 in the same background (H). Lines indicate positions of line scans shown. Bars, 10 µm. (I) Quantitative assessment of cortical GFP intensities (marked with arrowheads in the line scans) normalized to the GFP intensity of an internal ROI in the same cell. (J–K) Functional analyses of the importance of Cobl-like’s CaM-regulated syndapin I binding site (KRAP1) by loss-of-function rescue experiments evaluating the indicated dendritic arbor parameters of developing neurons (transfection, DIV4; analysis, DIV5.5). Note that neither a Cobl-like mutant lacking the entire N terminal part (GFP-Cobl-like*∆1-412) nor GFP-Cobl-like*∆KRAP1 was able to rescue Cobl-like’s loss-of-function phenotypes. Data, bar/dot plot overlays with mean ± SEM (D,I) and mean ± absolute error (F) as well as bar plots with mean ± SEM (J–L). Unpaired Student’s t-test (D,F,I); one-way ANOVA+Tukey (J–L). Also see Figure 9—source data 14.

Figure 9—source data 1. Raw data and numerical data graphically presented in Figure 9D.
Figure 9—source data 2. Raw data and numerical data graphically presented in Figure 9F.
Figure 9—source data 3. Raw data and numerical data graphically presented in Figure 9I.
Figure 9—source data 4. Raw data and numerical data graphically presented in Figure 9J–L.

Figure 9.

Figure 9—figure supplement 1. The three ‘KRAP’ motifs are critical for Cobl-like’s association with syndapin I.

Figure 9—figure supplement 1.

(A) Anti-GFP immunoblotting of control experiments of the coprecipitation analyses shown in Figure 10A demonstrating that neither Cobl-like nor any of the Cobl-like mutants associated with GST. (B–D) Maximum intensity projections (MIPs) of COS-7 cells transfected with Mito-mCherry-syndapin I and GFP-Cobl-like∆KRAP (B), Mito-mCherry-syndapin I and GFP-Cobl-like1-741 (C), and a GFP-Cobl-like mutant lacking the regions with the three ‘KRAP’ motifs (GFP-Cobl-like1-741∆KRAP) (D), respectively. Note the successful recruitment of GFP-Cobl-like1-741 to syndapin I-decorated mitochondria (C; colocalization of all three channels shown appears white in merge; examples are marked by arrowheads), whereas GFP-Cobl-like∆KRAP and GFP-Cobl-like1-741∆KRAP were not recruited to mitochondria (colocalization of only Mito-mCherry-syndapin I [red in merge] and MitoTracker [blue in merge] appears purple in merge; B,D). Boxed areas are shown at higher magnification as insets. Line scans of fluorescence intensities of all three channels are shown along the respective line indicated in the merged insets of B–D. Bars, 10 µm.

Strikingly, quantitative coimmunoprecipitation analyses unveiled a full abolishment of the about 50% increase of syndapin I interaction with the Cobl Homology domain of Cobl-like (Cobl-like1-457) upon Ca2+ addition when the first ‘KRAP’ motif (KRAP1) was deleted (Cobl-like1-457∆KRAP1; Cobl-like1-457∆59-69) (Figure 9B–D). This insensitivity of Cobl-like1-457∆KRAP1 to Ca2+/CaM signaling revealed that it was exclusively the first ‘KRAP’ motif (aa59-69) that was regulated by Ca2+/CaM signaling.

Side-by-side analyses of GFP-Cobl-like1-457 and Cobl-like1-457∆KRAP1 under Ca2+-free control conditions revealed that without Ca2+ Cobl-like1-457 and the corresponding ∆KRAP1 mutant thereof coimmunoprecipitated the same amount of syndapin I (Figure 9E,F). Thus, without Ca2+ and under the stringency of in vivo conditions, as reflected by coimmunoprecipitations, ‘KRAP’ motif 1 seemed not to contribute to syndapin I complex formation but awaited activation by Ca2+/CaM signaling.

The single Ca2+/CaM-regulated syndapin I binding site of Cobl-like is crucial for Cobl-like’s function in dendritic arbor formation

A lack of proper syndapin I interaction by deletion of ‘KRAP’ motif 1 resulted in a reduced localization of Cobl-like to the cortex of developing neurons when endogenous Cobl-like was replaced by GFP-Cobl-like*∆KRAP1 (Figure 9G–I).

In line with the importance of the identified N terminal CaM-binding site, also deletion of only the first, that is, the Ca2+/CaM-regulated, syndapin I binding interface was as detrimental for Cobl-like’s critical functions in dendritic arborization as lacking the entire N terminal part of Cobl-like all together (GFP-Cobl-like*∆1-412). Both GFP-Cobl-like*∆1-412 and GFP-Cobl-like*∆KRAP1 completely failed to rescue the Cobl-like loss-of-function phenotypes in dendritic arborization (Figure 9J–L).

Instead, cotransfections with Cobl-like RNAi in both cases merely led to dendritic morphologies identical to those of neurons deficient for Cobl-like. The dendritic branch points, terminal points, and total dendritic length all remained significantly reduced in comparison to control neurons (scrambled RNAi/GFP) and did not differ from those of Cobl-like RNAi neurons (Figure 9J–L).

This complete failure to rescue any of the Cobl-like loss-of-function phenotypes in dendritic arborization demonstrated that the Ca2+/CaM-regulated ‘KRAP’ motif 1 of Cobl-like is absolutely critical for Cobl-like’s functions in dendritic arbor formation.

Together, our analyses unveiled that the actin nucleator Cobl and its distant relative Cobl-like – each of them critical for dendritic arbor formation – in fact need to cooperate with each other in a syndapin-coordinated and Ca2+/CaM-regulated manner to bring about the complex morphology of hippocampal neurons (Figure 10).

Figure 10. Model depicting how Cobl and Cobl-like functions in dendritic branch initiation are joined, coordinated, and controlled.

Figure 10.

Cobl and Cobl-like functions are not only both critical for dendritic branch formation but both factors promoting the formation of actin filaments were found to act in an interdependent manner. The underlying mechanisms of coordination and control are depicted and include physical linkage of Cobl and Cobl-like by syndapin I forming dimers and multimeric clusters at the convexly bent membrane areas at the base of nascent branch sites. The newly identified interaction of syndapin I with Cobl-like is mediated by three independent KRAP motifs (red), the most N terminal of which (marked by white asterisk) is regulated by a newly discovered CaM association to Cobl-like’s N terminus. All mechanistic aspects unveiled in this study are depicted in detail and the corresponding functional evaluations conducted are listed in brief. The WH2 domains of Cobl and Cobl-like are shown to indicate the C terminal domains of both proteins and their cytoskeletal functions.

Discussion

Development of proper dendritic arbors of neuronal cells is key for the complex brains of vertebrates, as neuronal morphologies have direct consequences for brain organization patterns, cell-cell connectivity, and information processing within neuronal networks. Here, we show that this fundamental process is powered by the coordinated, strictly interdependent action of two components, which both promote the formation of actin filaments at the cell cortex, the actin nucleator Cobl (Ahuja et al., 2007) and its only distant relative Cobl-like (Izadi et al., 2018).

Cobl-like is already present in bilateria and considered as an evolutionary ancestor of the actin nucleator Cobl. Yet, we did not observe any redundant or additive functions in dendritic arborization of developing neurons. Instead, Cobl and Cobl-like both enriched at the same nascent dendritic branching sites and their functions were cooperative and each crucial for dendritic branch induction. Our findings that Cobl-like interacts with the F-BAR domain protein syndapin I providing links to Cobl and that the syndapin I-binding N terminal part of Cobl-like is regulated by Ca2+/CaM signaling in a positive manner unveil the mechanisms of the striking functional interdependence of Cobl and Cobl-like (Figure 10).

The identified syndapin/Cobl-like interactions were mediated by three ‘KRAP’ motif-containing regions in Cobl-like and the SH3 domain of syndapin I. Cobl-like’s ‘KRAP’ motifs are highly conserved among each other and among different species (consensus, Kr+APxpP). They furthermore show similarity to those of Cobl (consensus, KrRAPpPP) (Schwintzer et al., 2011), as well as to other mapped syndapin I binding sites, such as RRQAPPPP in dynamin I (Anggono and Robinson, 2007), RKKAPPPPKR in ProSAP1/Shank2 (Schneider et al., 2014), and KKPPPAKPVIP in the glycine receptor beta subunit (del Pino et al., 2014).

Coprecipitation of endogenous syndapin I with Cobl-like from brain extracts, coimmunoprecipitations of endogenous Cobl-like and syndapin I from mouse brain lysates, as well as visual proof of complex formation in intact cells underscore the in vivo relevance of the Cobl-like/syndapin I interactions we identified.

Syndapin I/Cobl-like interactions clearly were of functional importance, as syndapin I deficiency completely suppressed Cobl-like-mediated dendritic arbor formation. In line, syndapin I accumulated together with Cobl-like at nascent dendritic branch sites and membrane-bound syndapin I clusters were found at convex membrane curvatures at the base of protrusions in developing neurons. With their topology changes in different directions, these membrane areas fit the structure of the membrane-binding F-BAR domain of syndapin I, which seems unique among the BAR protein superfamily (Qualmann et al., 2011) and shows overall curvature but also a strongly kinked tilde shape (Wang et al., 2009).

We furthermore demonstrated biochemically and in intact cells that Cobl-like and Cobl can physically be interconnected by syndapin I acting as a bridge. Physical interconnection of Cobl and Cobl-like by syndapin I provides a plausible molecular mechanism for the striking functional interdependence of Cobl and Cobl-like and is in line with syndapin I/Cobl interactions (Schwintzer et al., 2011) as well as with syndapin I’s F-BAR domain-mediated self-association ability (Kessels and Qualmann, 2006; Shimada et al., 2007; Wang et al., 2009Figure 10). This would leave the SH3 domain of each syndapin I free for recruiting effector proteins, for spatially organizing them at specific, curved membrane areas at nascent dendritic branch sites and for thereby coordinating their functions in dendritic branch induction. Consistently, all three components of complexes composed of Cobl-like, syndapin I, and Cobl showed spatial coordination at branch induction sites. These data were in line with previous reports of accumulations of Cobl-like and of Cobl at dendritic branch induction sites (Izadi et al., 2018; Hou et al., 2015). Our quantitative determinations of the time points of maximal accumulation prior to dendritic branch induction also demonstrated that, besides being spatially coordinated, both cytoskeletal components and syndapin I interlinking them also are temporally coordinated during dendritic arborization and accumulate together −40 to −25 s prior to dendritic branch induction.

Importantly, we found that the interlinkage of Cobl-like and Cobl was not static. The Cobl-like/syndapin I interaction was regulated by Ca2+ signals. This is well in line with the involvement of transient, local Ca2+ signals in dendritic arborization of developing neurons (Rajan and Cline, 1998; Fink et al., 2003; Gaudillière et al., 2004), with the spatial and temporal coordination of CaM with all of these players at nascent dendritic branch points and with membrane targeting and cytoskeletal functions of Cobl also being controlled by Ca2+/CaM (Hou et al., 2015). The additional Ca2+/CaM regulation of the Cobl-like/syndapin I interface would now provide another key regulatory mechanism right at the interlinking bridge between Cobl and Cobl-like.

The regulatory mechanism is based on an N terminal stretch of amino acids of Cobl-like proteins in front of the so-called Cobl Homology domain, which is absent in Cobl proteins. With ‘KRAP1’, Ca2+ signaling allowed for the modulation of specifically one out of three syndapin I binding sites of Cobl-like (Figure 10). This particular, Ca2+/CaM-regulated syndapin I binding interface played an important role in the recruitment of Cobl-like to the cell cortex of developing neurons. The decline of the cortical Cobl-like localization we observed upon ‘KRAP’ motif 1 deletion suggested that, at least in the cell body, Ca2+ levels are usually high enough to ensure that first ‘KRAP motif’ binds to some syndapin I and that the ‘KRAP’ motif 1 is important for interactions with the plasma membrane-binding and shaping protein syndapin I in developing neurons (Figure 9G–I). Importantly, Cobl-like mutants, which either solely lacked the N terminal CaM-binding site or the single Ca2+/CaM-regulated syndapin binding ‘KRAP1’, both completely failed to rescue Cobl-like loss-of-function phenotypes in dendritic branching. Thus, explicitly the N terminal CaM association regulating the ‘KRAP1’/syndapin I interaction and consistently also the ‘KRAP1’ were absolutely critical for Cobl-like’s functions in dendritogenesis.

Our data clearly show that dendritic arborization of developing neurons requires the Ca2+/CaM- and syndapin I-coordinated, joined action of Cobl and Cobl-like. In other cells and/or cellular processes, Cobl and Cobl-like also seem to have their independent, individual functions, such as the critical role of Cobl in F-actin formation right beneath the sensory apparatus of outer hair cells in the inner ear, the loss of which correlated with defects in pericentriolar material organization, in postnatal planar cell polarity refinement and in hearing (Haag et al., 2018). Further studies of Cobl knock-out (KO) mice unveiled an importance of Cobl for a specialized set of filaments interconnecting structural elements in the F-actin-rich terminal web of microvilli-decorated epithelial cells in the small intestine. However, there were no indications of an additional Cobl-like involvement (Beer et al., 2020). Also in proteomic analyses of myoblasts, which upon IGFN1 deficiency show altered G-to-F-actin ratios, only Cobl was identified but not Cobl-like (Cracknell et al., 2020).

Likewise, apart from dendritic branching of neurons studied here, there are no hints on any Cobl roles in functions that the Cobl-like (Cobll-1) gene has been linked to, such as diabetes and obesity (Mancina et al., 2013; Sharma et al., 2017). Cobl-like was also suggested as biomarker for different cancer types (Gordon et al., 2003; Gordon et al., 2009; Wang et al., 2013; Han et al., 2017; Plešingerová et al., 2018; Takayama et al., 2018), to be suppressed by Epstein-Barr virus infection (Gillman et al., 2018) and to be involved in B-cell development (Plešingerová et al., 2018) but there are no hints on Cobl roles in any of these processes.

The extension of very fine and elaborately branched cellular structures over hundreds of micrometers, as in dendritogenesis of neurons, certainly represents an extreme and rather special case of cellular morphogenesis. It is therefore well conceivable that a joined action of both Cobl and Cobl-like is required to promote actin filament formation at locally restricted sites to drive further branching. It currently seems plausible that Cobl and Cobl-like’s different actin filament formation mechanisms – spatial rearrangement of three actin monomers by the three WH2 domains of Cobl generating actin nuclei (Ahuja et al., 2007) versus use of the single WH2 domain of Cobl-like and the actin-binding cofactor Abp1 in a structurally not fully understood trans-mechanism (Izadi et al., 2018) – and their different modes of regulation by Ca2+ (Hou et al., 2015; Izadi et al., 2018) represent the distinct functions of Cobl and Cobl-like that have to be combined to power dendritic arborization. The recently identified Cobl regulation by PRMT2-mediated arginine methylation (Hou et al., 2018) may potentially also provide a unique aspect that needs to be integrated into the joined, interdependent function of Cobl and Cobl-like in dendritic branch induction.

Although to our knowledge, besides the here reported functions of Cobl and Cobl-like and some not yet fully explored crosstalk of the actin nucleator Cobl with the Arp2/3 complex (Schwintzer et al., 2011), no information on functional cooperations of any actin nucleators is available for any actin cytoskeletal process in the function or development of hippocampal neurons, some initial studies on other actin nucleators also hint toward more interactive roles than initially thought. The actin nucleator Spire associates with and works with the actin nucleator formin 2 in Drosophila oocytes (Quinlan et al., 2007; Pfender et al., 2011; Montaville et al., 2014). Also in actin filament formation linked to DNA damage, Spire and formin 2 seem to be involved together (Belin et al., 2015). The formin mDia1 was reported to synergize with the APC protein (Okada et al., 2010; Breitsprecher et al., 2012). mDia1 was furthermore very recently found to indirectly interact with the Arp2/3 complex functionally cooperating in cortical F-actin stiffening of mitotic HeLa cells (Cao et al., 2020). Furthermore, the actin nucleator JMY was found to interact with the Arp2/3 complex in in vitro reconstitutions (Zuchero et al., 2009; Firat-Karalar et al., 2011). However, as JMY RNAi did not cause any statistically significant decline in cell migration (Zuchero et al., 2009; Firat-Karalar et al., 2011) – a process firmly established to involve the Arp2/3 complex – the functional importance of a putative cooperation of JMY with the Arp2/3 complex in the formation of actin filaments remains unclear.

While these initial observations and the in part apparently conflicting data show that we are only at the very beginning of identifying and understanding any cooperative functions of actin nucleators, the here studied cell biological process of dendritic branching highlights that clearly there are actin filament-driven cellular processes, which require the coordinated action of not only one but at least two effectors promoting the formation of F-actin. Our mechanistic and functional studies clearly demonstrate that with Cobl and Cobl-like shaping neurons into their complex morphologies involves regulated and physically coordinated interactions of different actin filament formation-promoting factors at the base of nascent dendritic protrusion sites.

Materials and methods

DNA constructs

Plasmids encoding for GFP-Cobl-like and parts thereof were described previously (Izadi et al., 2018) and generated by PCR using the EST clone UniProtID Q3UMF0 as template, respectively. GFP-Cobl-like111-262 and Cobl-like1-111 were generated by subcloning with the help of internal restriction sites. Additional Cobl-like deletion mutants were generated by combining the following forward primers, aa1 fw: 5’-AATTAGATCTATGGACCGCAGCGTCCCCGATCC-3’; aa261 fw: 5’-AAAGATCTGATATCAGCAGAGAG-3’; aa537 fw: 5’-AAAGATCTAAGGATCCTGATTCAGC-3’; aa740 fw: 5’-GCCTCAAGAGAATTCAGG-3’; aa376 fw: 5’-TTGAATTCTTAAACCATGATCGCTTC-3’; aa182 fw: 5’- TTAGATCTCCTACACCTATAATC-3’ with the following reverse primers, aa457 rv: 5’- AACTCGAGCCCGGGACCAAGGGAGC-3’; aa741 rv: 5’-TCCTGAATTCTCTTGAGG-3’; aa540 rv: 5’-TTCTCGAGTTAATCAGGATCCTTCTC-3’; aa411 rv: 5’-GCAAGCTTGGTTTTCGAAGGTGG-3’; aa272 rv: 5’-AAGAATTCTCAGTTGTGTGATATTTG-3’; aa380 rv: 5’-TTGAATTCGAAGCGATCATGGTG-3’ using either the introduced or an internal restriction site (1-538; BamH1). Cobl-like1-741 fused to mCherry was generated by subcloning from GFP-Cobl-like1-741 into Cherry-pCMV.

Cobl-like mutants lacking the N terminal CaM-binding site Cobl-like∆CaM NT (∆aa11-45) were generated by fusing a PCR product (primers, aa1-10+46–51 fw: 5’-AAAGATCTATGGACCGCAGCGTCCCGGATCCCGTACCCAAGAATCACAAATTCCTG-3’ and aa741 rv) with Cobl-like740-1273 using the internal EcoRI site (corresponding to aa740/741) to obtain the respective mutated full-length protein.

Cobl-like mutants lacking only the first ‘KRAP’ motif (∆aa59-69; ∆KRAP1) were generated by fusing a DNA fragment obtained by PCR using an RNAi-resistant Cobl-like construct (Izadi et al., 2018) as template and primers aa1 fw and aa58 rv (5’-TTAAGCTTGCTCTGACAAATATG-3’) with a second PCR product (primer aa70 fw and aa457 rv) using a HindIII site. The resulting Cobl-like1-457∆KRAP1 was either used as such or fused with a Cobl-like458-1273 fragment generated by Sma I digestion of Cobl-like RNAi/GFP-Cobl-like* to generate the respective full-length Cobl-like mutant Cobl-like*∆KRAP1 in pRNAT H1.1.

Cobl-like mutants lacking all three ‘KRAP’ motifs were generated by PCR using primers aa70 fw and aa333 5’-TTAAGCTTTGCATCCGAGGGC-3’ rv and fusing the resulting PCR product with a second PCR product obtained by using primers aa413 fw 5’-TTAAGCTTCTGGCTCAGACTGATG-3’ and aa457 rv as well as with a PCR product resulting from the above described aa1 fw and aa58 rv primers to give rise to aa59-69+334–412 deletion construct (Cobl-like1-457∆KRAP). Using an internal SmaI restriction site, Cobl-like1-457∆KRAP was then fused to the more C terminal parts of Cobl-like to give rise to either Cobl-like1-741∆KRAP or Cobl-like∆KRAP mutants.

A Cobl-like deletion mutant lacking the N terminal Cobl Homology domain Cobl-like∆1-412 was generated by fusing a PCR product (primers, aa413 fw and aa741 rv) with Cobl-like740-1273 to obtain Cobl-like∆1-412.

Plasmids encoding for GST fusion proteins of Cobl-like1-411 were generated by subcloning into pGEX-4T-2 (GE Healthcare). A plasmid encoding for TrxHis-Cobl-like1-411 was generated by PCR and subcloning into pET-32 (Novagen) (primers, aa1 fw; aa411 rv Sal I: 5’-GGGTCGACGGTTTTCGAAGGTGG-3’) using EcoRI and SalI sites.

The RNAi construct directed against mouse and rat Cobl-like coexpressing GFP (Cobl-like RNAi#1) and scrambled RNAi control were described before (Izadi et al., 2018; Pinyol et al., 2007). Additionally, Cobl-like RNAi and scrambled RNAi were inserted into a pRNAT vector coexpressing farnesylated mCherry (mCherryF) (pRNAT-mCherryF; Schneider et al., 2014). Plasmids for rescue attempts were built by replacing the GFP reporter by either RNAi-insensitive, GFP-Cobl-like (Cobl-like RNAi/Cobl-like* and scrambled RNAi/Cobl-like*; Izadi et al., 2018), or by mutant GFP-Cobl-like sequences generated based on Cobl-like*.

Plasmids encoding for GST-tagged syndapin I full-length and SH3 domain (aa376-441), respectively, as well as for a P434L-mutated SH3 (SdpISH3mut) were described previously (Qualmann et al., 1999; Qualmann and Kelly, 2000). An alternative syndapin I SH3 domain (aa378-441) was as described (Braun et al., 2005).

Plasmids encoding for Xpress-tagged syndapin I full-length, GFP-syndapin I, Flag-syndapin I and mitochondrially targeted syndapin I (Mito-mCherry-SdpI), syndapin I ∆SH3 (Mito-mCherry-SdpI∆SH3), and mCherry (Mito-mCherry) were described by Qualmann et al., 1999, Kessels and Qualmann, 2006 Qualmann and Kelly, 2000, Kessels and Qualmann, 2002, Braun et al., 2005 and Dharmalingam et al., 2009, respectively. Syndapin I-mRubyRFP was generated by subcloning syndapin I into a derivative of pEGFP-N1 containing mRubyRFP instead of GFP.

The mCherryF-coexpressing SdpI RNAi (bp297-317; for validations, see Dharmalingam et al., 2009) vector and the corresponding control pRNAT vector were described previously (Schneider et al., 2014).

GST-SdpIISH3 (SdpII-l, aa383-488) and GST-SdpIIISH3 (aa366-425) were described before (Qualmann and Kelly, 2000; Seemann et al., 2017). Flag-syndapin II-s was as described (Dharmalingam et al., 2009). Flag-syndapin III was described before (Braun et al., 2005).

GFP-Cobl, Flag-mCherry-Cobl, and GFP-Cobl1-713 were described previously (Hou et al., 2015). Mito-GFP-Cobl1-713 was generated by subcloning the respective Cobl-encoding sequence into the mitochondrial targeting vector.

RNAi constructs against rat and mouse Cobl coexpressing farnesylated mCherry were generated by subcloning into pRNAT-mCherryF (Schneider et al., 2014). The control expressing scrambled RNAi and mCherryF were as described (Schneider et al., 2014).

A plasmid encoding for GFP-CaM was generated by subcloning from TrxHis-CaM described previously (Hou et al., 2015).

Correct cloning by PCR was verified by sequencing in all cases.

Antibodies, reagents, and proteins

Rabbit anti-Cobl-like antibodies were raised against a combination of two GST-Cobl-like fusion proteins (GST-Cobl-like537-741 and GST-Cobl-like740-1015) as described previously (Izadi et al., 2018). The antibodies were affinity-purified according to procedures described previously (Qualmann et al., 1999; Kessels et al., 2000). Anti-syndapin I and anti-syndapin III antibodies were described previously (Qualmann et al., 1999; Koch et al., 2011). Anti-GST and anti-TrxHis antibodies from guinea pig and rabbit were described before, too (Qualmann and Kelly, 2000; Braun et al., 2005; Schwintzer et al., 2011).

Polyclonal rabbit anti-GFP was from Abcam (RRID:AB_303395). Monoclonal mouse anti-GFP antibodies (JL-8) were from Clontech(RRID:AB_10013427). Monoclonal mouse anti-Flag (M2) (RRID:AB_259529) and anti-MAP2 (HM-2) (RRID:AB_477193) antibodies as well as polyclonal rabbit anti-Flag antibodies were from Sigma-Aldrich (RRID:AB_439687). Anti-Xpress antibodies were from Invitrogen (RRID:AB_2556552).

Secondary antibodies used included, Alexa Fluor488- and 568-labeled goat anti-guinea pig antibodies (RRID:AB_142018 and RRID:AB_141954), Alexa Fluor488- and 568-labeled donkey anti-mouse antibodies (RRID:AB_141607 and RRID:AB_2534013), Alexa Fluor647- and 680-labeled goat anti-mouse antibodies (RRID:AB_141725 and RRID:AB_1965956), Alexa Fluor488-labeled donkey anti-rabbit (RRID:AB_141708), Alexa Fluor568-, 647-, and 680-labeled goat anti-rabbit antibodies (RRID:AB_143011; RRID:AB_141775; RRID:AB_2535758) (Molecular Probes) as well as DyLight800-conjugated goat anti-rabbit (RRID:AB_2556775) and anti-mouse antibodies (RRID:AB_2556774) (Thermo Fisher Scientific). Donkey anti-guinea pig antibodies coupled to IRDye680 and IRDye800, respectively, were from LI-COR Bioscience (RRID:AB_10956079 and RRID:AB_1850024). Donkey anti-rabbit and goat anti-guinea pig as well as anti-mouse-peroxidase antibodies were from Jackson ImmunoResearch and Dianova, respectively (RRID:AB_2617176; RRID:AB_10015282; RRID:AB_2337405); 10 nm gold-conjugated goat anti-guinea pig antibodies for electron microscopical examinations of freeze-fractured samples were from BBI Solutions (RRID:AB_2892072). MitoTracker Deep Red 633 was from Molecular Probes.

Sepharose 4B-coupled CaM was from GE Healthcare. GST- and TrxHis-tagged fusion proteins were purified from Escherichia coli lysates using glutathione-agarose or -sepharose (Sigma-Aldrich; GenScript) and Talon metal affinity resin (Clontech), respectively, as described previously (Schwintzer et al., 2011; Qualmann and Kelly, 2000). After purification, fusion proteins were dialyzed against PBS, characterized by SDS-PAGE, and snap-frozen and stored at −80°C.

Tag-free syndapin I and III were generated by expressing both proteins in the pGEX-6P vector (GE Healthcare) and cutting of the GST tag from purified proteins using PreScission protease (GE Healthcare) in 150 mM NaCl, 2 mM DTT, and 20 mM HEPES pH 7.4 buffer overnight at 4°C (during dialysis after elution). Cleaved off GST and non-cleaved GST fusion proteins were removed with glutathione-sepharose.

In vitro reconstitutions of direct protein-protein interactions

Direct protein/protein interactions were demonstrated by coprecipitation assays with combinations of recombinant TrxHis- and GST-tagged fusion proteins purified from E. coli and/or immobilized CaM, respectively, in 10 mM HEPES pH 7.4, 300 mM NaCl, 0.1 mM MgCl2, 1% (v/v) Triton X-100 supplemented with EDTA-free protease inhibitor cocktail as well as in some cases with 500 µM Ca2+ added.

Eluted proteins were analyzed by SDS-PAGE, transferred to PVDF membranes by either semi-dry or tank blotting and then subjected to immunodetection with anti-TrxHis and anti-GST antibodies. Primary antibodies were detected with fluorescent secondary antibodies using a Licor Odyssey System.

Culture and transfection, and immunostaining of cells

Culturing of HEK293 (RRID:CVCL_0045) and COS-7 cells (RRID:CVCL_0224) and their transfection using TurboFect (Thermo Fisher Scientific) as well as their immunolabeling was essentially done as described (Kessels et al., 2001; Haag et al., 2012). The cell lines are regularly tested for mycoplasma and were mycoplasma-negative.

In reconstitutions and visualizations of protein complex formations at the surfaces of mitochondria in intact cells, mitochondria of COS-7 cells were stained with 0.2 µM MitoTracker Deep Red 633 in medium at 37°C for 30 min and cells were subsequently fixed with 4% (w/v) paraformaldehyde (PFA) for 7 min.

Preparation of HEK293 cell lysates

HEK293 cells were washed with PBS 24–48 hr after transfection, harvested and subjected to sonification for 10 s and/or lyzed by incubation in lysis buffer (10 mM HEPES pH 7.4, 0.1 mM MgCl2, 1 mM EGTA, 1% (v/v) Triton X-100) containing 150 mM NaCl and EDTA-free protease inhibitor Complete (Roche) for 20–30 min at 4°C (Kessels and Qualmann, 2006). Cell lysates were obtained as supernatants from centrifugations at 20,000×g (20 min at 4°C).

Coprecipitation of proteins from HEK293 cell lysates

Coprecipitation experiments with extracts from HEK293 cells expressing different GFP fusion proteins were essentially performed as described before (Qualmann et al., 1999; Schwintzer et al., 2011). In brief, HEK293 cell lysates were incubated with purified, recombinant GST fusion proteins immobilized on glutathione-sepharose beads for 3 hr at 4°C. The reactions were then washed several times with lysis buffer containing 150 mM NaCl and EDTA-free protease inhibitor Complete. Bound protein complexes were subsequently eluted with 20 mM reduced glutathione, 120 mM NaCl, 50 mM Tris/HCl pH 8.0 (30 min RT) or obtained by boiling the beads in 4×SDS sample buffer.

For coprecipitations with CaM, HEK293 cell lysates were prepared in an EGTA-free lysis buffer containing 150 mM NaCl, EDTA-free protease inhibitor cocktail, and 200 µM calpain I inhibitor. Cell lysates were supplemented with either 1 mM EGTA or 500 µM Ca2+ to obtain conditions without and with Ca2+, respectively. After incubation with 25 µl CaM-sepharose 4B for 3 hr at 4°C and washing, bound proteins were isolated by boiling in 4×SDS sample buffer. Lysates, supernatants, and eluates were analyzed by immunoblotting.

Triple coprecipitations, that is, the examinations of GST-Cobl-like1-411/syndapin/GFP-Cobl1-713 complexes with either syndapin I or syndapin III as bridging component, were essentially performed as described above (lysis buffer containing 150 mM NaCl) except that the extracts from HEK293 cells expressing GFP-Cobl1-713 were not only incubated with immobilized GST-Cobl-like1-411 but also with tag-free syndapin I or syndapin III for 3 hr. Bound proteins were eluted with 20 mM reduced glutathione, 120 mM NaCl, 50 mM Tris/HCl pH 8.0. Eluates and supernatants were separated by SDS-PAGE and analyzed by anti-syndapin I/III, anti-GST, and anti-GFP immunoblotting.

Coprecipitation of endogenous syndapin I from mouse brain lysates

For coprecipitation of endogenous syndapin I, brain lysates were prepared from mice sacrificed by cervical dislocation. Extracts were prepared using an Ultra Turrax homogenizer (Ika Ultra Turrax T5Fu; 20,000 rpm, 10 s) in lysis buffer containing EDTA-free protease inhibitor Complete and supplemented with 100 mM NaCl and 200 µM calpain inhibitor I. After clearing the lysates from cell debris by centrifugation at 1000×g for 20 min, the supernatants were used to precipitate endogenous syndapin I by TrxHis-Cobl-like1-411 fusion proteins immobilized on Talon metal affinity resin. Bound proteins were eluted by boiling in sample buffer, separated by SDS-PAGE, and analyzed by anti-syndapin I immunoblotting.

Heterologous and quantitative coimmunoprecipitation analyses

Heterologous coimmunoprecipitations addressing Cobl-like/syndapin I, syndapin II, and syndapin III interactions were done with lysates of HEK293 cells transfected with GFP-Cobl-like fusion proteins and GFP, respectively, in combination with Flag-tagged syndapins. The cell lysates were incubated with anti-Flag antibodies or non-immune IgGs in lysis buffer containing 100 mM NaCl and EDTA-free protease inhibitor Complete for 3 hr at 4°C. Antibody-associated protein complexes were isolated by 2 hr incubation with protein A agarose (Santa Cruz Biotechnology) at 4°C. The immunoprecipitates were washed with lysis buffer containing 100 mM NaCl, eluted from the matrix by boiling in a mix of 2 M (final) urea and SDS sample buffer and analyzed by immunoblotting.

Comparisons of GFP-Cobl-like1-457 and Cobl-like1-457∆KRAP1 for their ability to associate with Flag-syndapin I were also done by anti-GFP immunoprecipitations from lysates of transfected HEK293 cells generated according to the procedure described above.

For quantitative evaluations of the regulation of Cobl-like/syndapin I complexes, anti-GFP immunoprecipitations of GFP-Cobl-like fusion proteins were done in the presence (2 µM CaCl2 added) and in the absence of Ca2+ (1 mM EGTA added), respectively.

The amounts of coimmunoprecipitated Flag-syndapin I were quantified based on the detection of fluorescent antibody signals using a Licor Odyssey System providing a linear, quantitative read-out over several orders of magnitude. Anti-syndapin I coimmunoprecipitation signals were normalized to the amounts of anti-GFP signal representing the immunoprecipitated material. This ensured that similar amounts of GFP-Cobl-like proteins were examined for their extent of Flag-syndapin I coimmunoprecipitation. Both fluorescence signals were detected on the same blot using the two different fluorescence channels of the Licor Odyssey System. Data were expressed as percent difference from Ca2+-free conditions.

Endogenous coimmunoprecipitations from mouse brain extracts

Mice were sacrificed and the brain was cut into small pieces and homogenized in 10 mM HEPES pH 7.5, 30 mM NaCl, 0.1 mM MgCl2, and 1 mM EGTA with protease inhibitors. Afterward, Triton X-100 was added (0.2% v/v final) and the homogenates were extracted for 1 hr at 4–6°C. The samples were then centrifuged at 100,000×g for 30 min at 4°C and the resulting supernatants (mouse brain lysates) were incubated with affinity-purified rabbit anti-Cobl-like antibodies and non-immune rabbit IgGs, respectively, bound to protein A agarose (preincubation at 4°C and washing with above buffer and 0.2% (v/v) Triton X-100 [CoIP buffer]). After 4 hr of incubation at 6°C, the proteins bound to the protein A agarose were washed with ice-cold CoIP buffer, eluted with SDS sample buffer (100°C, 5 min), and analyzed by immunoblotting using anti-Cobl-like and anti-syndapin I antibodies.

Microscopy

Images were recorded as z-stacks using a Zeiss AxioObserver.Z1 microscope (Zeiss) equipped with an ApoTome, Plan-Apochromat 100×/1.4, 63×/1.4, 40×/1.3, and 20×/0.5 objectives and an AxioCam MRm CCD camera (Zeiss).

Digital images were recorded by ZEN2012 (PRID:SCR_013672). Image processing was done by Adobe Photoshop (RRID:SCR_014199).

Spinning disk live microscopy of developing neurons

Primary rat hippocampal neurons were transiently transfected using Lipofectamine 2000 at DIV6. For imaging, the culture medium was replaced by 20 mM HEPES pH 7.4, 140 mM NaCl, 0.8 mM MgCl2, 1.8 mM CaCl2, 5 mM KCl, 5 mM D-glucose (live imaging buffer) adjusted to isoosmolarity using a freezing point osmometer (Osmomat 3000; Gonotec).

Live imaging was conducted at 37°C 16–24 hr after transfection employing an open coverslip holder, which was placed into a temperature- and CO2-controlled incubator built around a spinning disk microscope based on a motorized Axio Observer (Zeiss). The microscope was equipped with a spinning disk unit CSU-X1A 5000, 488 nm/100 mW OPSL laser, and 561 nm/40 mW diode lasers as well as with a QuantEM 512SC EMCCD camera (Zeiss).

Images were taken as stacks of 7–17 images at Z-intervals of 0.31 µm depending on cellular morphology using a C-Apochromat objective (63×/1.20 W Korr M27; Zeiss). The time intervals were set to 10 s. Exposure times of 50–200 ms and 3–12% laser power were used.

Image processing was done using ZEN2012 and Adobe Photoshop software.

For quantitative determination of the degree of accumulation of Cobl-like, syndapin I, Cobl, and CaM fused to fluorescent proteins as well as for mCherry as control, the maximal fluorescence intensity was determined at an identified dendritic branch induction site in a time window prior to dendritic branch initiation (3D imaging frame rate, 10 s; six frames prior to protrusion start defined as t=0) and normalized to a neighboring ROI at the same dendrite.

For spatiotemporal analyses, the time points of the frames with the highest accumulation of Cobl-like, syndapin I, Cobl and CaM were averaged. In the rare case that two maxima of equal intensity occurred prior to branch initiation, both time values were considered in the averaging. As above, 3D imaging stacks were recorded every 10 s and six frames prior to protrusion start (defined as t=0) were evaluated.

Culturing, transfection, and immunostaining of primary rat hippocampal neurons

Primary rat hippocampal neuronal cultures were prepared, maintained, and transfected as described previously (Qualmann et al., 2004; Pinyol et al., 2007; Schwintzer et al., 2011). In brief, neurons prepared from hippocampi of E18 rats were seeded at densities of about 60,000/well (24-well plate) and 200,000/well (12-well plate), respectively. Cells were cultured in Neurobasal medium containing 2 mM L-glutamine, 1× B27, and 1 µM/ml penicillin/streptomycin. The neurons were maintained at 37°C with 90% humidity and 5% CO2.

Transfections were done in antibiotic-free medium using 2 µl Lipofectamine 2000 and 1 µg DNA per well in 24-well plates. After 4 hr, the transfection medium was replaced by conditioned medium and neurons were cultured further. All analyses were done with several independent neuronal preparations.

Fixation was done in 4% (w/v) PFA in PBS pH 7.4 at RT for 5 min. Permeabilization and blocking were done with 10% (v/v) horse serum, 5% (w/v) BSA in PBS with 0.2% (v/v) Triton X-100 (blocking solution). Antibody incubations were done in the same buffer without Triton X-100 according to Kessels et al., 2001 and Pinyol et al., 2007. In brief, neurons were incubated with primary antibodies for 1 hr at RT and washed three times with blocking solution. Afterward, they were incubated with secondary antibodies (1 hr, RT). Finally, the coverslips were washed with blocking solution, PBS and water and mounted onto coverslips using Moviol.

Quantitative analyses of dendrites of primary hippocampal neurons

Comparative Cobl and Cobl-like loss-of-function analyses were done 46 hr subsequent to transfection at DIV4 to allow for clear development of loss-of-function phenotypes. For Cobl-like loss-of-function analyses and corresponding rescue experiments, 37 hr post-transfection (transfection at DIV4) was sufficient for loss-of-function phenotypes to clearly develop.

For suppressions of Cobl-like overexpression phenotypes, DIV4 hippocampal neurons were transfected with RNAi against Cobl, RNAi against syndapin I and control vectors, respectively, and fixed and immunostained about 34 hr later (DIV5.5). Suppression of Cobl overexpression phenotypes by Cobl-like RNAi was analyzed similarly. Due to the shorter time frame and/or due to the lower expression caused by cotransfection of two plasmids, the suppression effects exceed the effects of the RNAi effects alone evaluated in comparison. This experimental design helps to exclude putative merely additive, unrelated effects of the two manipulations working in opposite directions and simplifies the evaluation of whether a given knock-down can indeed suppress the function of GFP-Cobl and Cobl-like, respectively.

Two to six independent coverslips per condition per assay and neurons of at least two independent neuronal preparations were analyzed based on the anti-MAP2 immunostaining of transfected neurons.

Transfected neurons were sampled systematically on each coverslip. Morphometric measurements were based on anti-MAP2 immunolabeling of transfected neurons to identify dendrites.

Using IMARIS 7.6 software (RRID:SCR_007370), the number of dendritic branching points, dendritic terminal points, and dendritic filament length was determined and Sholl analyses (Sholl, 1953) were conducted according to procedures established previously (Izadi et al., 2018). For each neuron, a ‘filament’ (morphological trace) was drawn by IMARIS 7.6 software using the following settings: largest diameter, cell body diameter; thinnest diameter, 0.2 µm; start seed point, 1.5× of cell body diameter; disconnected points, 2 µm; minimum segment size, 10 µm. Immunopositive areas that were erroneously spliced by IMARIS or protrusions belonging to different cells as well as filament branch points that the software erroneously placed inside of the cell body were manually removed from the filament. Parameters determined were saved as Excel files and subjected to statistical significance calculations using GraphPad Prism5 and Prism6 software (RRID:SCR_002798).

Quantitative, visual assessments of subcellular distributions

Quantitative determinations of the subcellular distribution of Cobl-like and the ∆KRAP1 mutant thereof were done using line scans across Apotome sections of the cell bodies of developing hippocampal neurons similar to methods described before (Schwintzer et al., 2011). The neurons were transfected at DIV4, immunostained for MAP2, and imaged 37 hr later. Cobl-like and the ∆KRAP1 mutant thereof were analyzed in a Cobl-like-deficient background by expressing Cobl-like RNAi vectors that coexpressed RNAi-resistant WT GFP-Cobl-like* and GFP-Cobl-like*∆KRAP1, respectively. As described before (Schwintzer et al., 2011), the fluorescence intensities reached in cortical areas were extracted from the line scans and expressed in relation to the average intensity of an ROI covering a large part of the cytoplasmic area of the neuron.

Freeze-fracturing and immunogold labeling

Hippocampal neurons were grown for 7 days on poly-D-lysine-coated sapphire disks (diameter 4 mm; Rudolf Brügger, Swiss Micro Technology) in 24-well plates, washed with PBS and subjected to ultrarapid freezing (4000 K/s) as well as to freeze-fracturing as described for mature neurons (Schneider et al., 2014).

Freeze-fracturing of developing neurons led to low yields of rather fragile replica of inner and outer membrane leaflets, which, however, were preserved during subsequent washing, blocking, and incubation (Wolf et al., 2019). Replica were incubated with guinea pig anti-syndapin I antibodies (1:50; overnight, 4°C) and 10 nm gold-conjugated secondary antibodies as described for mature neurons (Schneider et al., 2014).

Controls addressing the specificity of anti-syndapin I labeling of freeze-fracture replica included evaluations of labeling at the E-face (almost no labeling) and quantitative analyses of syndapin I labeling densities at control surfaces not representing cellular membranes (low, unspecific immunogold labels at a density of only 0.4/µm2). Further controls including secondary antibody controls and labeling of syndapin I KO material were described previously (Schneider et al., 2014).

Replica were collected and analyzed using transmission electron microscopy and systematic grid explorations as described (Schneider et al., 2014; Seemann et al., 2017). Images were recorded digitally and processed by using Adobe Photoshop software. All analyses were done with two independent neuronal preparations.

Membrane areas with parallel membrane orientations (cylindrical) were distinguished from protrusive topologies, as established previously (Wolf et al., 2019). Anti-syndapin I immunogold labeling densities were determined using the complete area of the respective membrane topology on each image (measured using ImageJ [RRID:SCR_003070]).

Anti-syndapin I cluster analyses were conducted using circular ROIs of 70 nm diameter. Density of clusters at cylindrical and protrusive membranes were calculated considering ≥3 anti-syndapin I labels per ROI as one cluster. Additionally, anti-syndapin I labeling being single, paired, and clustered in three to eight labels, respectively, was analyzed as percent of total anti-syndapin labeling.

Statistical analyses and sample size estimation

No explicit power analyses were used to compute and predefine required sample sizes. Instead, all neuronal analyses were conducted by systematic sampling of transfected cells across coverslips to avoid any bias. Morphometric analyses were then conducted using IMARIS software.

All data were obtained from two to five independent neuronal preparations seeded onto several independent coverslips for each condition for transfection and immunostaining. For each condition, n numbers of individual neurons ranging from about 30 to 40 were aimed for to fully cover the biological variances of the cells. Higher n numbers yielded from the systematic sampling were accepted, too (e.g. see the control in Figure 1G–I [n=45] and in Figure 1N–P [65]). Lower n numbers were only accepted for the established Cobl overexpression phenotype (n=24) and the Cobl-like-mediated suppression of it (also n=24), as results were clear and sacrificing further rats for further primary neuron preparations could thus be avoided (Figure 1N–P).

Outliers or strongly scattering data reflect biological variance and were thus not excluded from the analyses.

All n numbers are reported directly in the figures of the manuscript and all are numbers of independent biological samples (i.e. neurons) or biochemical assays, as additional replicates to minimize measurement errors were not required because the technical errors were small in relation to the biological/biochemical variances. In live imaging analyses (Figure 5C), the n numbers given are dendritic branch induction events (18-21 from 4 to 12 neurons). In the EM experiments (Figure 6B,D), the n numbers are dendritic segments, i.e. EM images (34 and 41, respectively).

All quantitative biochemical data (Figure 7E, Figure 9D, and Figure 9F) as well as the determinations of accumulations of proteins at dendritic branch sites (Figure 5C) and the quantitative analyses of subcellular distributions (Figure 9I) are provided as bar and dot plot overlays to report the individual raw data and the deviations of individual data points around the mean.

Quantitative data represent mean ± SEM throughout the manuscript. Exceptions are Figure 5D, in which the mean is reported with both ± SD and ± SEM, Figure 9F, in which data represents mean±absolute error (n=2; no difference), and Figure 6C (the percent of total labeling shown in Figure 6C per definition has no error).

Normal data distribution and statistical significance were tested using GraphPad Prism 5 and Prism 6 software (SCR_002798). The statistical tests employed are reported in the respective figure legends.

Dendritic arbor parameters (number of dendritic branch points, number of terminal points, and total dendritic length) were analyzed for statistical significance employing one-way ANOVA and Tukey post-test throughout.

All Sholl analyses were tested by two-way ANOVA and Bonferroni post-test.

Quantitative evaluation of syndapin I coimmunoprecipitations with Cobl-like1-741, Cobl-like1-457, and Cobl-like1-457ΔKRAP1 were analyzed by unpaired Student’s t-test.

Anti-syndapin I immunogold labeling densities at different surfaces of freeze-fractured replica of membranes of developing neurons were analyzed by one-way ANOVA and the densities of anti-syndapin I clusters were analyzed by two-tailed Student’s t-test.

Statistical significances were marked by *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001 throughout. In addition, the numbers of p-values are reported directly in the figures. Note that for p < 0.0001 (****), no values were provided by the software Prism 6, as the p-values are too small.

Ethics statement

As exclusively cells and tissue samples isolated from postmortem WT animals were used in this study, neither a permission of animal experiments nor a breeding permission for genetically modified animals (Zuchtrahmenantrag) was required.

Mice and rats used to obtain biological material were bred by the animal facility of the Jena University Hospital in strict compliance with the European Union guidelines for animal experiments and approved by the Thüringer Landesamt für Verbraucherschutz.

All biological samples from mice and rat were obtained from animals that were sacrificed by cervical dislocation by trained personal. The training status of personal involved was approved by the Thüringer Landesamt für Verbraucherschutz in the context of the breeding permission ZRA (UKJ-17–021). Embryos were removed from uteri and additionally decapitated.

Acknowledgements

We thank A Kreusch, B Schade, and K Gluth for excellent technical support. This work was supported by DFG grants KE685/4-2 to MMK as well as QU116/6-2 and QU116/9-1 to BQ.

Appendix 1

Appendix 1—key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Gene
(Mus musculus)
Cobl-like
(Cobll1)
Izadi et al., 2018 AK144943.1,
GI: 74201418
Gene
(Mus musculus)
Cordon-Bleu
(Cobl)
Ahuja et al., 2007 NM_172496.3,
GI: 162135965
The common abbreviation of Cordon-Bleu is Cobl
Gene
(Rattus norvegicus)
Syndapin I
(Pacsin1)
Braun et al., 2005 AF104402.1,
GI: 4324451
Syndapin is used as gene name in most model organisms, such as rat, worms, flies
Gene
(Rattus norvegicus)
Calmodulin
(Calm1)
SenGupta et al., 1987 M19312.1,
GI: 203255
The common abbreviation of calmodulin is CaM
Strain, background
(Escherichia coli)
E. coli commercial strain BL21-CodonPlus(DE3)-RIPL Agilent Cat#230280
Strain, background
(Escherichia coli)
E. coli commercial strain XL10-Gold Agilent Cat#200314
Cell line (African green monkey) COS-7 Cell Lines Services GmbH RRID:CVCL_0224
Cell line (human) HEK293 Cell Lines Services GmbH RRID:CVCL_0045
Biological sample
(Rattus norvegicus)
Primary hippocampal neurons (Wistar rat; Crl:WI; mixed sex) Charles River RRID:RGD_68115 Primary neurons isolated from E18 rat embryos (sex undetermined)
Biological sample
(Mus musculus)
Isolated brains (Mouse strain C57BL/6J, female) Jackson Labs RRID:IMSR_JAX:000664 Brain material processed for protein biochemical examinations
Antibody Anti-Cobl-like
(Rabbit polyclonal)
Izadi et al., 2018 N/A WB (1:1000)
Antibody Anti-syndapin I
(Guinea pig polyclonal)
Braun et al., 2005 N/A WB (1:500)
EM (1:50)
Antibody Anti-syndapin III
(Guinea pig polyclonal)
Koch et al., 2011 N/A WB (1:500)
Antibody Anti-TrxHis
(Rabbit polyclonal)
This paper N/A WB (1:1000)
Antibody Anti-GST
(Rabbit polyclonal)
Qualmann and Kelly, 2000 N/A WB (1:1000)
Antibody Anti-TrxHis
(Guinea pig polyclonal)
Schwintzer et al., 2011 N/A WB (1:2000)
Antibody Anti-GST
(Guinea pig polyclonal)
Braun et al., 2005 N/A WB (1:1000)
Antibody Anti-GFP (ab290)
(Rabbit polyclonal)
Abcam Cat#ab290
RRID:AB_303395
WB (1:2000)
Antibody Anti-GFP (JL-8)
(Mouse monoclonal)
Clontech Cat#632380 RRID:AB_10013427 WB (1:4000)
Antibody Anti-Flag antibody (M2)
(Mouse monoclonal)
Sigma-Aldrich Cat#F3165
RRID:AB_259529
WB (1:500)
Antibody Anti-MAP2 (HM-2)
(Mouse monoclonal)
Sigma-Aldrich Cat#M4403
RRID:AB_477193
IF (1:500)
Antibody Anti-Flag antibody
(Rabbit polyclonal)
Sigma-Aldrich Cat#F7425
RRID:AB_439687
WB (1:1000)
Antibody Anti-Xpress antibody
(Mouse monoclonal)
Invitrogen Cat#R910-25;
RRID:AB_2556552
IF (1:500)
Antibody Alexa Fluor488-labeled goat anti-guinea pig
(Goat polyclonal)
Molecular Probes Cat#A-11073 RRID:AB_142018 IF (1:1000)
Antibody Alexa Fluor568-labeled goat anti-guinea pig
(Goat polyclonal)
Molecular Probes Cat#A-11075 RRID:AB_141954 IF (1:1000)
Antibody Alexa Fluor488-labeled donkey anti-mouse
(Donkey polyclonal)
Molecular Probes Cat#A-21202 RRID:AB_141607 IF (1:1000)
Antibody Alexa Fluor568-labeled donkey anti-mouse
(Donkey polyclonal)
Molecular Probes Cat#A10037 RRID:AB_2534013 IF (1:1000)
Antibody Alexa Fluor647-labeled goat anti-mouse
(Goat polyclonal)
Molecular Probes Cat#A-21236 RRID:AB_141725 IF (1:1000)
Antibody Alexa Fluor488-labeled donkey anti-rabbit
(Donkey polyclonal)
Molecular Probes Cat#A-21206 RRID:AB_141708 IF (1:1000)
Antibody Alexa Fluor568-labeled goat anti-rabbit
(Goat polyclonal)
Molecular Probes Cat#A-11036 RRID:AB_143011 IF (1:1000)
Antibody Alexa Fluor647-labeled goat anti-rabbit
(Goat polyclonal)
Molecular Probes Cat#A-21245 RRID:AB_141775 IF (1:1000)
Antibody Alexa Fluor680-labeled goat-anti-rabbit
(Goat polyclonal)
Molecular Probes Cat#A-21109 RRID:AB_2535758 WB (1:10000)
Antibody Alexa Fluor680-labeled goat-anti-mouse
(Goat polyclonal)
Molecular Probes Cat#35519 RRID:AB_1965956 WB (1:10000)
Antibody DyLight800-conjugated goat anti-rabbit
(Goat polyclonal)
Thermo Fisher Scientific Cat#SA5-35571 RRID:AB_2556775 WB (1:10000)
Antibody DyLight800-conjugated goat anti-mouse
(Goat polyclonal)
Thermo Fisher Scientific Cat#SA5-35521 RRID:AB_2556774 WB (1:10000)
Antibody IRDye680-conjugated donkey anti-guinea pig
(Donkey polyclonal)
LI-COR Bioscience Cat#926–68077 RRID:AB_10956079 WB (1:10000)
Antibody IRDye800-conjugated donkey anti-guinea pig
(Donkey polyclonal)
LI-COR Bioscience Cat#926–32411 RRID:AB_1850024 WB (1:10000)
Antibody Peroxidase-AffiniPure donkey anti-rabbit antibody
(Donkey polyclonal)
Jackson ImmunoResearch Labs Cat#711-035-152
RRID:AB_10015282
WB (1:5000)
Antibody Peroxidase-AffiniPure goat anti-guinea pig antibody
(Goat polyclonal)
Jackson ImmunoResearch Labs Cat#106-036-003
RRID:AB_2337405
WB (1:5000)
Antibody Peroxidase-goat F(ab')2 anti-mouse
(Goat polyclonal)
Dianova Cat#115-036-003
RRID:AB_2617176
WB (1:5000)
Antibody Goat anti-guinea pig IgG 10 nm gold
(Goat polyclonal)
BBI Solutions Cat#EM.GAG10
RRID:AB_2892072
EM (1:50)
Recombinant DNA reagent Flag-mCherry Cobl (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like (Plasmid) Izadi et al., 2018 N/A
Recombinant DNA reagent Scr. RNAi in pRNAT-H1.1 (Plasmid) Pinyol et al., 2007 N/A
Recombinant DNA reagent Scr. RNAi in pRNAT-mCherryF (Plasmid) Schneider et al., 2014 N/A
Recombinant DNA reagent Cobl-RNAi in pRNAT-mCherryF (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent Cobl-like RNAi (#1) in pRNAT-H1.1 (Plasmid) Izadi et al., 2018 N/A
Recombinant DNA reagent Cobl-like RNAi (#1) in pRNAT-mCherryF (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl (Plasmid) Hou et al., 2015 N/A
Recombinant DNA reagent GFP-Cobl1-713 (Plasmid) Hou et al., 2015 N/A
Recombinant DNA reagent Mito-GFP-Cobl1-713 (Plasmid) This paper N/A
Recombinant DNA reagent GFP-Cobl-like1-741 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like740-1273 (Plasmid) Izadi et al., 2018 N/A
Recombinant DNA reagent GFP-Cobl-like1-538 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like1-411 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like1-380 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like376-540 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like261-380 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like111-262 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like1-111 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like537-740 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like182-272 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like1-58 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent Cobl-like RNAi/GFP-Cobl-like* in pRNAT H1.1 (Plasmid) Izadi et al., 2018 N/A
Recombinant DNA reagent Cobl-like RNAi/GFP-Cobl-like*∆CaM NT in pRNAT H1.1 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent mCherry-Cobl-like1-711 This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like1-741∆CaM NT (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like∆KRAP (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like1-741∆KRAP (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like1-457∆KRAP1 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-Cobl-like1-457 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent Cobl-like RNAi/GFP-Cobl-like*∆KRAP1 in pRNAT H1.1 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent Cobl-like RNAi/GFP-Cobl-like*∆1-412 in pRNAT H1.1 (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent Flag-syndapin I (SdpI) (Plasmid) Qualmann and Kelly, 2000 N/A
Recombinant DNA reagent Flag-syndapin II-s (SdpII) (Plasmid) Dharmalingam et al., 2009 N/A
Recombinant DNA reagent Flag-syndapin III (SdpIII) (Plasmid) Braun et al., 2005 N/A
Recombinant DNA reagent Xpress-syndapin I (SdpI) (Plasmid) Qualmann et al., 1999 N/A
Recombinant DNA reagent Syndapin I–mRubyRFP (Plasmid) This paper N/A See Materials and methods
Recombinant DNA reagent GFP-syndapin I (Plasmid) Kessels and Qualmann, 2006 N/A
Recombinant DNA reagent Mito-mCherry-SdpI (Plasmid) Kessels and Qualmann, 2002 N/A
Recombinant DNA reagent Mito-mCherry-SdpI∆SH3 (Plasmid) Braun et al., 2005 N/A
Recombinant DNA reagent Mito-mCherry (Plasmid) Dharmalingam et al., 2009 N/A
Recombinant DNA reagent SdpI-RNAi in pRNAT-mCherryF (Plasmid) Dharmalingam et al., 2009
Schneider et al., 2014
N/A
Recombinant DNA reagent GFP-CaM (Plasmid) This paper N/A See Materials and methods
Sequence-based reagent Cobl-like aa1 fw This paper PCR primer 5’-AATTAGATCTATGGACCGCAGCGTCCCCGATCC-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa261 fw This paper PCR primer 5’-AAAGATCTGATATCAGCAGAGAG-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa537 fw This paper PCR primer 5’-AAAGATCTAAGGATCCTGATTCAGC-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa740 fw This paper PCR primer 5’-GCCTCAAGAGAATTCAGG-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa376 fw This paper PCR primer fw: 5’-TTGAATTCTTAAACCATGATCGCTTC-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa182 fw This paper PCR primer 5’- TTAGATCTCCTACACCTATAATC-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa457 rv This paper PCR primer 5’- AACTCGAGCCCGGGACCAAGGGAGC-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa741 rv This paper PCR primer 5’-TCCTGAATTCTCTTGAGG-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa540 rv This paper PCR primer 5’-TTCTCGAGTTAATCAGGATCCTTCTC-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa411 rv This paper PCR primer 5’-GCAAGCTTGGTTTTCGAAGGTGG-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa272 rv This paper PCR primer 5’-AAGAATTCTCAGTTGTGTGATATTTG-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa380 rv This paper PCR primer 5’-TTGAATTCGAAGCGATCATGGTG-3’
(see Materials and methods)
Sequence-based reagent Cobl-like∆CaM NT aa1-10+46–51 fw This paper PCR primer 5’-AAAGATCTATGGACCGCAGCGT
CCCGGATCCCGTACCCAAGAATCAC
AAATTCCTG-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa413 fw This paper PCR primer 5’-TTAAGCTTCTGGCTCAGAC
TGATG-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa58 rv This paper PCR primer 5’-TTAAGCTTGCTCTGACAAATATG-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa70 fw This paper PCR primer 5’-TTAAGCTTGCCGAGACGAAGGGC-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa333 rv This paper PCR primer 5’-TTAAGCTTTGCATCCGAGGGC-3’
(see Materials and methods)
Sequence-based reagent Cobl-like aa411 rv Sal I This paper PCR primer 5’-GGGTCGACGGTTTTCGAAGGTGG-3’
(see Materials and methods)
Recombinant protein TrxHis Hou et al., 2015 N/A
Recombinant protein TrxHis-Cobl-like1-411 This paper N/A
Recombinant protein GST-Cobl-like1-411 This paper N/A
Recombinant protein GST-SdpISH3 Qualmann et al., 1999 N/A
Recombinant protein GST-SdpIISH3 Qualmann and Kelly, 2000 N/A
Recombinant protein GST-SdpIIISH3 Seemann et al., 2017 N/A
Recombinant protein GST-SdpI Qualmann et al., 1999 N/A
Recombinant protein GST-SdpISH3mut Qualmann and Kelly, 2000 N/A
Commercial assay or kit NucleoSpin Plasmid Macherey-Nagel Cat#740588.50
Commercial assay or kit NucleoBond Xtra Midi Macherey-Nagel Cat#740410.50
Commercial assay or kit Lipofectamine 2000 transfection reagent Invitrogen Cat#11668019
Commercial assay or kit Turbofect transfection reagents Thermo Fisher Scientific Cat#R0532
Commercial assay or kit Calmodulin Sepharose 4B GE Healthcare Cat#GE17-0529-01
Commercial assay or kit PreScission protease GE Healthcare Cat#27-0843-01
Chemical compound, drug MitoTracker Deep Red Alexa Fluor633 Molecular Probes Cat#M22426
Software, algorithm ZEN2012 Zeiss RRID:SCR_013672
Software, algorithm Prism5, Prism6 GraphPad Prism RRID:SCR_002798
Software, algorithm ImageJ Other RRID:SCR_003070 Open source software
Software, algorithm IMARIS 7.6 Bitplane RRID:SCR_007370
Software, algorithm Adobe Photoshop Adobe RRID:SCR_014199

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Britta Qualmann, Email: Britta.Qualmann@med.uni-jena.de.

Michael M Kessels, Email: Michael.Kessels@med.uni-jena.de.

Alphee Michelot, Institut de Biologie du Développement, France.

Catherine Dulac, Harvard University, United States.

Funding Information

This paper was supported by the following grants:

  • Deutsche Forschungsgemeinschaft KE685/4-2 to Michael M Kessels.

  • Deutsche Forschungsgemeinschaft QU116/6-2 to Britta Qualmann.

  • Deutsche Forschungsgemeinschaft QU116/9-1 to Britta Qualmann.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft.

Data curation, Investigation, Visualization.

Investigation.

Investigation.

Conceptualization, Supervision, Funding acquisition, Writing - Original draft; Writing - review and editing.

Conceptualization, Data curation, Supervision, Funding acquisition, Visualization, Writing - original draft, Writing - review and editing.

Ethics

Animal experimentation: As exclusively cells and tissue samples isolated from postmortem WT animals were used in this study, neither a permission of animal experiments nor a breeding permission for genetically modified animals (Zuchtrahmenantrag) was required. Mice and rats used to obtain biological material were bred by the animal facility of the Jena University Hospital in strict compliance with the European Union guidelines for animal experiments and approved by the Thüringer Landesamt für Verbraucherschutz.

Additional files

Transparent reporting form

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files. Source data files have been provided and cover all quantitative data shown in the figures and their supplements.

References

  1. Ahuja R, Pinyol R, Reichenbach N, Custer L, Klingensmith J, Kessels MM, Qualmann B. Cordon-bleu is an actin nucleation factor and controls neuronal morphology. Cell. 2007;131:337–350. doi: 10.1016/j.cell.2007.08.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Anggono V, Robinson PJ. Syndapin I and endophilin I bind overlapping proline-rich regions of dynamin I: role in synaptic vesicle endocytosis. Journal of Neurochemistry. 2007;102:931–943. doi: 10.1111/j.1471-4159.2007.04574.x. [DOI] [PubMed] [Google Scholar]
  3. Beer AJ, González Delgado J, Steiniger F, Qualmann B, Kessels MM. The actin nucleator Cobl organises the terminal web of enterocytes. Scientific Reports. 2020;10:11156. doi: 10.1038/s41598-020-66111-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Belin BJ, Lee T, Mullins RD. DNA damage induces nuclear actin filament assembly by Formin-2 and Spire-1/2 that promotes efficient DNA repair. eLife. 2015;4:e07735. doi: 10.7554/eLife.07735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Braun A, Pinyol R, Dahlhaus R, Koch D, Fonarev P, Grant BD, Kessels MM, Qualmann B. EHD proteins associate with syndapin I and II and such interactions play a crucial role in endosomal recycling. Molecular Biology of the Cell. 2005;16:3642–3658. doi: 10.1091/mbc.e05-01-0076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Breitsprecher D, Jaiswal R, Bombardier JP, Gould CJ, Gelles J, Goode BL. Rocket launcher mechanism of collaborative actin assembly defined by single-molecule imaging. Science. 2012;336:1164–1168. doi: 10.1126/science.1218062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cao L, Yonis A, Vaghela M, Barriga EH, Chugh P, Smith MB, Maufront J, Lavoie G, Méant A, Ferber E, Bovellan M, Alberts A, Bertin A, Mayor R, Paluch EK, Roux PP, Jégou A, Romet-Lemonne G, Charras G. SPIN90 associates with mDia1 and the Arp2/3 complex to regulate cortical actin organization. Nature Cell Biology. 2020;22:803–814. doi: 10.1038/s41556-020-0531-y. [DOI] [PubMed] [Google Scholar]
  8. Carman PJ, Dominguez R. BAR domain proteins—a linkage between cellular membranes, signaling pathways, and the actin cytoskeleton. Biophysical Reviews. 2018;10:1587–1604. doi: 10.1007/s12551-018-0467-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chesarone MA, Goode BL. Actin nucleation and elongation factors: mechanisms and interplay. Current Opinion in Cell Biology. 2009;21:28–37. doi: 10.1016/j.ceb.2008.12.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cracknell T, Mannsverk S, Nichols A, Dowle A, Blanco G. Proteomic resolution of IGFN1 complexes reveals a functional interaction with the actin nucleating protein COBL. Experimental Cell Research. 2020;395:112179. doi: 10.1016/j.yexcr.2020.112179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Daumke O, Roux A, Haucke V. BAR domain scaffolds in dynamin-mediated membrane fission. Cell. 2014;156:882–892. doi: 10.1016/j.cell.2014.02.017. [DOI] [PubMed] [Google Scholar]
  12. del Pino I, Koch D, Schemm R, Qualmann B, Betz H, Paarmann I. Proteomic analysis of glycine receptor β subunit (GlyRβ)-interacting proteins: evidence for syndapin I regulating synaptic glycine receptors. The Journal of Biological Chemistry. 2014;289:11396–11409. doi: 10.1074/jbc.M113.504860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Dharmalingam E, Haeckel A, Pinyol R, Schwintzer L, Koch D, Kessels MM, Qualmann B. F-BAR proteins of the syndapin family shape the plasma membrane and are crucial for neuromorphogenesis. Journal of Neuroscience. 2009;29:13315–13327. doi: 10.1523/JNEUROSCI.3973-09.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Fink CC, Bayer KU, Myers JW, Ferrell JE, Schulman H, Meyer T. Selective regulation of neurite extension and synapse formation by the beta but not the alpha isoform of CaMKII. Neuron. 2003;39:283–297. doi: 10.1016/S0896-6273(03)00428-8. [DOI] [PubMed] [Google Scholar]
  15. Firat-Karalar EN, Hsiue PP, Welch MD. The actin nucleation factor JMY is a negative regulator of neuritogenesis. Molecular Biology of the Cell. 2011;22:4563–4574. doi: 10.1091/mbc.e11-06-0585. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Gaudillière B, Konishi Y, de la Iglesia N, Yao G, Bonni A. A CaMKII-NeuroD signaling pathway specifies dendritic morphogenesis. Neuron. 2004;41:229–241. doi: 10.1016/S0896-6273(03)00841-9. [DOI] [PubMed] [Google Scholar]
  17. Gillman ACT, Parker G, Allday MJ, Bazot Q. Epstein-Barr virus nuclear antigen 3C inhibits expression of COBLL1 and the ADAM28-ADAMDEC1 Locus via Interaction with the Histone Lysine Demethylase KDM2B. Journal of Virology. 2018;92:e01362. doi: 10.1128/JVI.01362-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gordon GJ, Jensen RV, Hsiao LL, Gullans SR, Blumenstock JE, Richards WG, Jaklitsch MT, Sugarbaker DJ, Bueno R. Using gene expression ratios to predict outcome among patients with mesothelioma. JNCI Journal of the National Cancer Institute. 2003;95:598–605. doi: 10.1093/jnci/95.8.598. [DOI] [PubMed] [Google Scholar]
  19. Gordon GJ, Dong L, Yeap BY, Richards WG, Glickman JN, Edenfield H, Mani M, Colquitt R, Maulik G, Van Oss B, Sugarbaker DJ, Bueno R. Four-gene expression ratio test for survival in patients undergoing surgery for mesothelioma. JNCI Journal of the National Cancer Institute. 2009;101:678–686. doi: 10.1093/jnci/djp061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Haag N, Schwintzer L, Ahuja R, Koch N, Grimm J, Heuer H, Qualmann B, Kessels MM. The actin nucleator cobl is crucial for purkinje cell development and works in close conjunction with the F-actin binding protein Abp1. Journal of Neuroscience. 2012;32:17842–17856. doi: 10.1523/JNEUROSCI.0843-12.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Haag N, Schüler S, Nietzsche S, Hübner CA, Strenzke N, Qualmann B, Kessels MM. The actin nucleator cobl is critical for centriolar positioning, postnatal planar cell polarity refinement, and function of the cochlea. Cell Reports. 2018;24:2418–2431. doi: 10.1016/j.celrep.2018.07.087. [DOI] [PubMed] [Google Scholar]
  22. Han SH, Kim S-H, Kim H-J, Lee Y, Choi S-Y, Park G, Kim D-H, Lee A, Kim J, Choi J-M, Kim Y, Myung K, Kim H, Kim D-W. Cobll1 is linked to drug resistance and blastic transformation in chronic myeloid leukemia. Leukemia. 2017;31:1532–1539. doi: 10.1038/leu.2017.72. [DOI] [PubMed] [Google Scholar]
  23. Holderith N, Lorincz A, Katona G, Rózsa B, Kulik A, Watanabe M, Nusser Z. Release probability of hippocampal glutamatergic terminals scales with the size of the active zone. Nature Neuroscience. 2012;15:988–997. doi: 10.1038/nn.3137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Hou W, Izadi M, Nemitz S, Haag N, Kessels MM, Qualmann B. The actin nucleator cobl is controlled by calcium and calmodulin. PLOS Biology. 2015;13:e1002233. doi: 10.1371/journal.pbio.1002233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Hou W, Nemitz S, Schopper S, Nielsen ML, Kessels MM, Qualmann B. Arginine methylation by PRMT2 controls the functions of the actin nucleator cobl. Developmental Cell. 2018;45:262–275. doi: 10.1016/j.devcel.2018.03.007. [DOI] [PubMed] [Google Scholar]
  26. Itoh T, Erdmann KS, Roux A, Habermann B, Werner H, De Camilli P. Dynamin and the actin cytoskeleton cooperatively regulate plasma membrane invagination by BAR and F-BAR proteins. Developmental Cell. 2005;9:791–804. doi: 10.1016/j.devcel.2005.11.005. [DOI] [PubMed] [Google Scholar]
  27. Izadi M, Schlobinski D, Lahr M, Schwintzer L, Qualmann B, Kessels MM. Cobl-like promotes actin filament formation and dendritic branching using only a single WH2 domain. Journal of Cell Biology. 2018;217:211–230. doi: 10.1083/jcb.201704071. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kessels MM, Engqvist-Goldstein AE, Drubin DG. Association of mouse actin-binding protein 1 (mAbp1/SH3P7), an src kinase target, with dynamic regions of the cortical actin cytoskeleton in response to Rac1 activation. Molecular Biology of the Cell. 2000;11:393–412. doi: 10.1091/mbc.11.1.393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Kessels MM, Engqvist-Goldstein AEY, Drubin DG, Qualmann B. Mammalian Abp1, a Signal-Responsive F-Actin–Binding Protein, Links the Actin Cytoskeleton to Endocytosis via the Gtpase Dynamin. Journal of Cell Biology. 2001;153:351–366. doi: 10.1083/jcb.153.2.351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kessels MM, Schwintzer L, Schlobinski D, Qualmann B. Controlling actin cytoskeletal organization and dynamics during neuronal morphogenesis. European Journal of Cell Biology. 2011;90:926–933. doi: 10.1016/j.ejcb.2010.08.011. [DOI] [PubMed] [Google Scholar]
  31. Kessels MM, Qualmann B. Syndapins integrate N-WASP in receptor-mediated endocytosis. The EMBO Journal. 2002;21:6083–6094. doi: 10.1093/emboj/cdf604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Kessels MM, Qualmann B. The syndapin protein family: linking membrane trafficking with the cytoskeleton. Journal of Cell Science. 2004;117:3077–3086. doi: 10.1242/jcs.01290. [DOI] [PubMed] [Google Scholar]
  33. Kessels MM, Qualmann B. Syndapin oligomers interconnect the machineries for endocytic vesicle formation and actin polymerization. Journal of Biological Chemistry. 2006;281:13285–13299. doi: 10.1074/jbc.M510226200. [DOI] [PubMed] [Google Scholar]
  34. Kessels MM, Qualmann B. Different functional modes of BAR domain proteins in formation and plasticity of mammalian postsynapses. Journal of Cell Science. 2015;128:3177–3185. doi: 10.1242/jcs.174193. [DOI] [PubMed] [Google Scholar]
  35. Koch D, Spiwoks-Becker I, Sabanov V, Sinning A, Dugladze T, Stellmacher A, Ahuja R, Grimm J, Schüler S, Müller A, Angenstein F, Ahmed T, Diesler A, Moser M, tom Dieck S, Spessert R, Boeckers TM, Fässler R, Hübner CA, Balschun D, Gloveli T, Kessels MM, Qualmann B. Proper synaptic vesicle formation and neuronal network activity critically rely on syndapin I. The EMBO Journal. 2011;30:4955–4969. doi: 10.1038/emboj.2011.339. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Mancina RM, Burza MA, Maglio C, Pirazzi C, Sentinelli F, Incani M, Montalcini T, Pujia A, Congiu T, Loche S, Pilia S, Wiklund O, Borén J, Romeo S, Baroni MG. The COBLL1 C allele is associated with lower serum insulin levels and lower insulin resistance in overweight and obese children. Diabetes/Metabolism Research and Reviews. 2013;29:413–416. doi: 10.1002/dmrr.2408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Montaville P, Jégou A, Pernier J, Compper C, Guichard B, Mogessie B, Schuh M, Romet-Lemonne G, Carlier MF. Spire and formin 2 synergize and antagonize in regulating actin assembly in meiosis by a ping-pong mechanism. PLOS Biology. 2014;12:e1001795. doi: 10.1371/journal.pbio.1001795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Nakamura Y, Harada H, Kamasawa N, Matsui K, Rothman JS, Shigemoto R, Silver RA, DiGregorio DA, Takahashi T. Nanoscale distribution of presynaptic ca(2+) channels and its impact on vesicular release during development. Neuron. 2015;85:145–158. doi: 10.1016/j.neuron.2014.11.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Okada K, Bartolini F, Deaconescu AM, Moseley JB, Dogic Z, Grigorieff N, Gundersen GG, Goode BL. Adenomatous polyposis coli protein nucleates actin assembly and synergizes with the formin mDia1. Journal of Cell Biology. 2010;189:1087–1096. doi: 10.1083/jcb.201001016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Peter BJ, Kent HM, Mills IG, Vallis Y, Butler PJ, Evans PR, McMahon HT. BAR domains as sensors of membrane curvature: the amphiphysin BAR structure. Science. 2004;303:495–499. doi: 10.1126/science.1092586. [DOI] [PubMed] [Google Scholar]
  41. Pfender S, Kuznetsov V, Pleiser S, Kerkhoff E, Schuh M. Spire-Type Actin Nucleators Cooperate with Formin-2 to Drive Asymmetric Oocyte Division. Current Biology. 2011;21:955–960. doi: 10.1016/j.cub.2011.04.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Pinyol R, Haeckel A, Ritter A, Qualmann B, Kessels MM. Regulation of N-WASP and the Arp2/3 Complex by Abp1 Controls Neuronal Morphology. PLOS ONE. 2007;2:e400. doi: 10.1371/journal.pone.0000400. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Plešingerová H, Janovská P, Mishra A, Smyčková L, Poppová L, Libra A, Plevová K, Ovesná P, Radová L, Doubek M, Pavlová S, Pospíšilová S, Bryja V. Expression of COBLL1 encoding novel ROR1 binding partner is robust predictor of survival in chronic lymphocytic leukemia. Haematologica. 2018;103:313–324. doi: 10.3324/haematol.2017.178699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Qualmann B, Roos J, DiGregorio PJ, Kelly RB. Syndapin I, a synaptic dynamin-binding protein that associates with the neural Wiskott-Aldrich syndrome protein. Molecular Biology of the Cell. 1999;10:501–513. doi: 10.1091/mbc.10.2.501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Qualmann B, Boeckers TM, Jeromin M, Gundelfinger ED, Kessels MM. Linkage of the actin cytoskeleton to the postsynaptic density via direct interactions of Abp1 with the ProSAP/Shank family. Journal of Neuroscience. 2004;24:2481–2495. doi: 10.1523/JNEUROSCI.5479-03.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Qualmann B, Koch D, Kessels MM. Let's go bananas: revisiting the endocytic BAR code. The EMBO Journal. 2011;30:3501–3515. doi: 10.1038/emboj.2011.266. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Qualmann B, Kelly RB. Syndapin isoforms participate in Receptor-Mediated endocytosis and actin organization. Journal of Cell Biology. 2000;148:1047–1062. doi: 10.1083/jcb.148.5.1047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Qualmann B, Kessels MM. New players in actin polymerization – WH2-domain-containing actin nucleators. Trends in Cell Biology. 2009;19:276–285. doi: 10.1016/j.tcb.2009.03.004. [DOI] [PubMed] [Google Scholar]
  49. Quinlan ME, Hilgert S, Bedrossian A, Mullins RD, Kerkhoff E. Regulatory interactions between two actin nucleators, Spire and Cappuccino. Journal of Cell Biology. 2007;179:117–128. doi: 10.1083/jcb.200706196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Rajan I, Cline HT. Glutamate receptor activity is required for normal development of tectal cell dendrites in vivo. The Journal of Neuroscience. 1998;18:7836–7846. doi: 10.1523/JNEUROSCI.18-19-07836.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Schneider K, Seemann E, Liebmann L, Ahuja R, Koch D, Westermann M, Hübner CA, Kessels MM, Qualmann B. ProSAP1 and membrane nanodomain-associated syndapin I promote postsynapse formation and function. Journal of Cell Biology. 2014;205:197–215. doi: 10.1083/jcb.201307088. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Schwintzer L, Koch N, Ahuja R, Grimm J, Kessels MM, Qualmann B. The functions of the actin nucleator Cobl in cellular morphogenesis critically depend on syndapin I. The EMBO Journal. 2011;30:3147–3159. doi: 10.1038/emboj.2011.207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Seemann E, Sun M, Krueger S, Tröger J, Hou W, Haag N, Schüler S, Westermann M, Huebner CA, Romeike B, Kessels MM, Qualmann B. Deciphering caveolar functions by syndapin III KO-mediated impairment of caveolar invagination. eLife. 2017;6:e29854. doi: 10.7554/eLife.29854. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. SenGupta B, Friedberg F, Detera-Wadleigh SD. Molecular analysis of human and rat calmodulin complementary DNA clones. Evidence for additional active genes in these species. Journal of Biological Chemistry. 1987;262:16663–16670. doi: 10.1016/S0021-9258(18)49306-4. [DOI] [PubMed] [Google Scholar]
  55. Sharma V, Sharma I, Sethi I, Mahajan A, Singh G, Angural A, Bhanwer AJS, Dhar MK, Singh V, Rai E, Sharma S. Replication of newly identified type 2 diabetes susceptible loci in northwest indian population. Diabetes Research and Clinical Practice. 2017;126:160–163. doi: 10.1016/j.diabres.2017.02.013. [DOI] [PubMed] [Google Scholar]
  56. Shimada A, Niwa H, Tsujita K, Suetsugu S, Nitta K, Hanawa-Suetsugu K, Akasaka R, Nishino Y, Toyama M, Chen L, Liu ZJ, Wang BC, Yamamoto M, Terada T, Miyazawa A, Tanaka A, Sugano S, Shirouzu M, Nagayama K, Takenawa T, Yokoyama S. Curved EFC/F-BAR-domain dimers are joined end to end into a filament for membrane invagination in endocytosis. Cell. 2007;129:761–772. doi: 10.1016/j.cell.2007.03.040. [DOI] [PubMed] [Google Scholar]
  57. Sholl DA. Dendritic organization in the neurons of the visual and motor cortices of the cat. Journal of Anatomy. 1953;87:387–406. [PMC free article] [PubMed] [Google Scholar]
  58. Takayama K, Suzuki T, Fujimura T, Takahashi S, Inoue S. COBLL1 modulates cell morphology and facilitates androgen receptor genomic binding in advanced prostate cancer. PNAS. 2018;115:4975–4980. doi: 10.1073/pnas.1721957115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Tanaka J, Matsuzaki M, Tarusawa E, Momiyama A, Molnar E, Kasai H, Shigemoto R. Number and density of AMPA receptors in single synapses in immature cerebellum. The Journal of Neuroscience. 2005;25:799–807. doi: 10.1523/JNEUROSCI.4256-04.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Wang Q, Navarro MV, Peng G, Molinelli E, Goh SL, Judson BL, Rajashankar KR, Sondermann H. Molecular mechanism of membrane constriction and tubulation mediated by the F-BAR protein pacsin/Syndapin. PNAS. 2009;106:12700–12705. doi: 10.1073/pnas.0902974106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Wang Z, Yan Z, Zhang B, Rao Z, Zhang Y, Liu J, Yu L, Zhao Y, Yang B, Wu T, Gao J. Identification of a 5-gene signature for clinical and prognostic prediction in gastric cancer patients upon microarray data. Medical Oncology. 2013;30:678–688. doi: 10.1007/s12032-013-0678-5. [DOI] [PubMed] [Google Scholar]
  62. Wolf D, Hofbrucker-MacKenzie SA, Izadi M, Seemann E, Steiniger F, Schwintzer L, Koch D, Kessels MM, Qualmann B. Ankyrin repeat-containing N-Ank proteins shape cellular membranes. Nature Cell Biology. 2019;21:1191–1205. doi: 10.1038/s41556-019-0381-7. [DOI] [PubMed] [Google Scholar]
  63. Zuchero JB, Coutts AS, Quinlan ME, Thangue NBL, Mullins RD. p53-cofactor JMY is a multifunctional actin nucleation factor. Nature Cell Biology. 2009;11:451–459. doi: 10.1038/ncb1852. [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision letter

Editor: Alphee Michelot1
Reviewed by: Alphee Michelot2

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

Your work provides additional insight into how the different actin regulators are coordinated to power dendritogenesis. Your live-cell imaging data represent an important first effort to determine the temporal sequence of events occurring at the membrane.

Decision letter after peer review:

Thank you for submitting your article "Functional interdependence of the actin nucleator Cobl and Cobl-like in dendritic arbor development" for consideration by eLife. Your article has now been reviewed by 3 peer reviewers, including Alphee Michelot as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by and Catherine Dulac as the Senior Editor.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission. This decision letter is long and detailed, but main comments 1 to 4 should be easy to address and only main comments 5 and 6 would require additional experiments.

Essential Revisions:

1. Some results appear inconsistent between different Figures. For example, in Figure 1D, Cobl RNAi shifts numbers of dendritic branch points from 10 to 6, while in Figure 2E, Cobl RNAi leaves numbers of dendritic branch points pretty much unchanged (around 7 or 8). Could you make sure that all data are consistent between Figures or explain apparent inconsistencies?

2. We find experiments of Figure 2 insufficient to conclude that Cobl and Cobl-like factors depend strictly on each other. One could imagine scenarios where effects of Cobl or Cobl-like are highly concentration dependent, and lead to detectable effects in cells only below or above certain thresholds (especially for multi-domain binding proteins such as Cobl and Cobl-like, which are likely to undergo complex phase transition behaviors when clustering at the membrane).

Therefore, we would recommend here simply to be very careful with wording in the conclusions of these experiments.

Other mentions such as (line 328) "their functions were cooperative", should also be avoided unless you provide further explanations; Mentions such as (line 101) "Functional redundancy seemed unlikely, because both individual loss-of-function phenotypes were severe." should be explained so that readers can assess whether functional redundancy is indeed unlikely or not (for example by referencing a paper describing mild versus severe phenotypes).

3. Some findings presented in the current manuscript were already published. While it is perfectly logical to base a study on previous findings and results, in the current manuscript the fraction of findings already published in previous manuscripts is non-negligible, which in some ways hides the originality of the data presented in the study.

For instance, the findings that Cobl-like is involved in the formation of dendritic branches and its localization at branch points (Figure 1, current manuscript) were already showed in a previous article from your group (Izadi et al., JCB 2018; Figure 3, Figure 4). The coordination of Cobl-like and ca2+/CaM in this process was already demonstrated in the same article (Figure 9, CaM inhibitor CGS9343B), even though in the previous article you focused more on the Cter ca2+/CaM binding site. Likewise, the coordinated role of Cobl and syndapin in the formation of dendritic branches and their localization at branch points was already demonstrated in previous studies (Schwintzer et al., EMBO J 2011; Hou et al., PlosBiol 2015). In these two articles you also demonstrated the crucial role of ca2+/CaM in that process.

As the current manuscript is very long (11 Figures), could you please present only new data and refer to previous papers when needed? We believe that this would give you an opportunity to limit the number of Figures and that the manuscript would overall gain in clarity.

4. The reviewers agree that a discussion on the role of various actin nucleation factors in neuronal development could benefit uninitiated readers. Could you also please discuss in more details other potential mechanisms of coordination between actin regulators based on your extensive previous studies and the existing literature?

5. In the present manuscript, you show, using fluorescence time-lapses, the co-localization of Cobl-like/Cobl, Cobl-like/Syndapin at branch points. In previous articles, your group demonstrated the localization at branching points of ca2+ spikes (using GCaMP), actin (using LifeAct), CaM, Cobl (Hou et al., Blos Biol 2015); co-localization of Cobl/Syndapin (Schwintzer et al., EMBO J 2011); co-localization of Cobl-like/Actin (LifeAct), Cobl-like/CaM (Izadi et al., JCB 2018).

However, in these previous studies and in the present manuscript, no quantifications were made concerning the spatio-temporal recruitments of these molecules. In this manuscript, it seems on top of that Cobl-like appears before syndapin, which would not be quite coherent with a recruitement of Cobl-like through syndapin.

Therefore, it would be important to quantify here more precisely the spatiotemporal relationship between Cobl, Cobl-like, syndapin and CaM (and ideally ca2+) during the formation of dendritic branches. This would require to record data at shorter time intervals, but you should have all the biological material necessary to do these experiments. You could use if possible the initiation of the protrusions as a time reference to then quantify the assembly and disassembly of the different molecular actors. This type of analysis has been performed previously for clathrin-mediated endocytosis (e.g. Taylor et al., Plos Biol 2011). For instance, you could measure evolutions of the fluorescence signals (e.g. fluorescence enrichment fluo foci/fluo outside) as a function of time before and after branch formation. It would also be very interesting to quantify the fraction of aborted or effective formation of branches according to the spatiotemporal evolution of the different molecular actors.

6. Another missing experiment in this story is whether this strong effect of ca2+/CaM in promoting Cobl-like's interaction with syndapin I through the first of the three "KRAP" motifs is indeed critical for Cobl-like recruitement at the membrane in cells. Could you provide experimental evidence that KRAP1 is directly involved in the ca2+/CaM-mediated recruitment of Cobl-like at the plasma membrane?

Reviewer #1:

This work investigates at the molecular and cellular levels the functional dependence of two actin filament nucleation factors, Cobl and Cobl-like proteins, in the formation of protrusive dendritic structures. Depletion of Cobl or Cobl-like lead to roughly similar phenotypes; overexpression of Cobl or Cobl-like induces excessive dendrite formation when the other protein is expressed at normal levels, but not when this other protein is depleted. Altogether, these observations lead the authors to conclude that these proteins work strictly interdependently. The authors then investigate how Cobl and Cobl-like are recruited, and identify syndapin as an essential component to bring Cobl and Cobl-like together at the membrane. This interaction is beautifully documented through a large number of pulldown experiments in vitro, and critical domains for these interactions are identified. These interactions are also confirmed in physiological conditions through ectopic localization experiments of those components to mitochondria. Syndapin I is identified as clusters at dendritic initiation sites by electron microscopy and all three components colocalize at the same nascent dendritic branch sites. In the last part of the manuscript, the authors further document the interaction between Cobl-like and syndapin, and find that calcium-dependent calmodulin binding to Cobl-like increases syndapin I's association through the first of the three KRAP's domains.

Comments to be addressed in a revised manuscript:

1. Some results appear inconsistent between different Figures. For example, in Figure 1D, Cobl RNAi shifts numbers of dendritic branch points from 10 to 6, while in Figure 2E, Cobl RNAi leaves numbers of dendritic branch points pretty much unchanged (around 7 or 8). Could the authors make sure that all data are consistent between Figures or explain apparent inconsistencies?

2. I find experiments of Figure 1 and 2 insufficient to conclude that Cobl and Cobl-like factors depend strictly on each other. One could imagine many scenarios where effects of Cobl or Cobl-like are highly concentration dependent, and lead to detectable effects in cells below or under certain thresholds (especially for multi-domain binding proteins such as Cobl and Cobl-like, which are likely to undergo complex phase transition behaviors when clustering at the membrane). Therefore, I would recommend the authors to be very careful with wording and conclusions of their experiments, and stick to what can strictly be concluded.

Other mentions such as (line 328) "their functions were cooperative", should also be avoided without any further explanations; Mentions such as (line 101) "Functional redundancy seemed unlikely, because both individual loss-of-function phenotypes were severe." should be explained so that readers can assess whether functional redundancy is indeed unlikely or not (for example by referencing a paper describing mild versus severe phenotypes).

3. One missing experiment in this story is whether this important effect of ca2+/CaM signaling promoting syndapin I's association with the first of the three "KRAP" motifs is key to account for Cobl-like's clustering at the plasma membrane. Could the authors measure the effect of calcium for Cobl-like (KRAP1 deleted) clustering at the plasma membrane (as compared to wild-type Cobl-like)?

4. I regret sometimes the lack of quantification for some experiments. For example, protein colocalization in cells should be quantified (for example by calculating Pearson's correlation coefficients of red and green signals at mitochondrial sites) because colocalization (or absence of) is not always obvious for non-expert eyes.

5. Figure 6 is beautiful, but I am wondering if these data could be exploited better. Is it possible to record data at shorter time intervals? It seems that Cobl-like appears before syndapin. Is that correct and if so, how is this coherent with a recruitement of Cobl-like through syndapin?

Recommendations for the authors:

1. Graph bar representation is not recommended nowadays. Please show individual data points with box and whisker plots to represent the variability of the data (and asymmetry of distributions). Also it would be useful to provide significance levels (α factors) in addition to p-values, and indicate exact α/p values in legends in addition of the stars in the Figures. On the contrary, statements such as "highly statistically significantly" (line 106) should be avoided. How p-values were calculated should also be mentioned.

2. Please make sure that all abbreviations are explained when mentioned first.

3. Mentions to unpublished efforts is not recommended anymore. Please show results from these efforts in a Supplementary Figure or do not mention them.

4. Please correct the following inaccuracy:

"Two powerful molecular machines for actin filament formation": These proteins are not machines, because they do not consume energy to form new filaments.

5. Figure 5A: Is it possible to present both gels with the same molecular weight scale so that corresponding bands are aligned?

Reviewer #2:

The manuscript by Izadi et al., "Functional interdependence of the actin nucleator Cobl and Cobl-like in dendritic arbor development" deals with the fundamental question of how actin regulators are orchestrated to control the formation of membranes protrusions during cells morphogenesis. In particular, the authors explored how actin nucleators are coordinated to trigger the formation of branches in neuronal dendritic arbor.

In that context, Cobl have a crucial role in dendritic arbor formation in neuronal cells. Cobl contains a repeat of three WH2 domains interacting with actin and enabling nucleation of new actin filaments (F-actin). The initial idea was that tandem repeat of WH2 domains could be sufficient to trigger F-actin nucleation. However, other studies have shown that the WH2 repeat of Cobl has no nucleation activity of its own. Importantly, Cobl activity was shown to work in coordination with other actin regulators including the F-actin-binding protein Abp1 (Haag, J Neuro 2012) and the BAR domain protein syndapin (Schwintzer, EMBO J 2011).

The manuscript of Izadi et al. builds on previous articles from the same group, in particular a study demonstrating that Cobl-like, an evolutionary ancestor of Cobl, is also crucial for dendritic branching (Izadi et al., 2018 JCB). This previous article showed that like Cobl (Haag, J Neuro 2012), Cobl-like protein works in coordination with the F-actin-binding protein Abp1 and ca2+/CaM to promote dendritic branching through regulation of F-actin nucleation or/and assembly. In the current manuscript the authors showed that the two actin nucleators Cobl and Cobl-like proteins are interdependent to trigger dendritic branching.

The authors used functional assays by quantifying the formation of dendritic branches in primary hippocampal neurons. Using fluorescence microscopy and siRNA-based knockdowns, the authors showed that Cobl and Cobl-like are functionally interdependent during dendritic branch formation in dissociated hippocampal neurons. They showed that siRNA decreasing Cobl or Cobl-like expression reduced the number of dendritic branch points to the same extent. Fluorescence time-lapses indicated that Cobl and Cobl-like proteins co-localized at abortive and effective branching points. Furthermore, they showed that the increase in branching induced by Cobl-like overexpression is reversed by using a siRNA that decreases Cobl expression, they also performed the reciprocal experiments. Using a variety of biochemistry assays (co-immunoprecipitation, in vitro reconstitutions with purified components…) the authors demonstrated that Cobl and Cobl-like do not interact directly, but that Cobl-like associates with syndapins, as previously shown for Cobl (Schwintzer et al., 2011; Hou et al., 2015). Thus, syndapin is the molecular and functional link between Cobl and Cobl-like proteins. The authors performed a very thorough characterisation of the biochemical interactions between the Cobl-like protein and syndapins. Syndapins and Cobl-like interactions were direct and based on SH3 domain/Prolin rich motif interactions respectively on syndapins and Cobl-like. The Prolin rich motifs were located in 3 KRAP domains at the Nter of Cobl-like proteins. The authors also showed that the interaction of the Nter proximal KRAP domain with syndapin is ca2+/CaM dependent, and that this ca2+/CaM dependent interaction is crucial for the function of the Cobl-like protein in the regulation of dendritic arbor formation. The authors confirmed most of their biochemical results by visualizing the formation of protein complexes on the surface of mitochondria in intact COS-7 cells. They also used time-lapse fluorescent microscopy to demonstrate that Syndapin and Cobl-like are co-localized at sites of dendritic branch induction. Importantly, the authors used Immunogold labeling of freeze-fractured plasma membranes combined with electron microscopy. Using this strategy, they showed that membrane-bound syndapin nanoclusters are preferentially located at the base of protrusive membrane topologies in developing neurons. Throughout the manuscript, the authors confronted their biochemistry experiments with functional assays quantifying the formation of dendritic branches.

The overall conclusion of the manuscript is that a molecular complex involving Cobl, Cobl-like and syndapin and regulated by ca2+/CaM, promotes the formation of actin networks leading to dendritic protrusions to initiate dendritic branches. Importantly, this manuscript demonstrated that multiple actin nucleators can be coordinated in neurons to trigger the formation of subcellular structures.

The conclusions of the manuscript are, in most cases, convincingly supported by the results. In particular, the authors have performed a very comprehensive characterization of the biochemical interactions between Cobl, Cobl-like and syndapin, which are well supported by the functional results. However, the results found concerning the spatiotemporal relationship between Cobl, Cobl-like and syndapin during dendritic branch formation are more preliminary and do not take into account the roles of ca2+/CaM. In addition, some of the findings were already published by the same group in previous articles. Thus, there are a number of issues that need to be addressed by the authors. These critical points are the following: (1) Need for quantifications concerning the spatiotemporal relationship between Cobl, Cobl-like and syndapin during the formation of dendritic branches. (2) Some of the findings presented in this manuscript have already been published by the same group, which diminishes the inherent originality of this manuscript. Apart from the main points raised above, the manuscript is experimentally solid and contains interesting results that are likely to stimulate further experiments in the fields of actin cytoskeleton but also in the fields of cellular neurobiology and neurodevelopment.

1) Need for quantifications concerning the spatiotemporal relationship between Cobl, Cobl-like, syndapin, ca2+, CaM during the formation of dendritic branches.

In the present manuscript, the authors have shown, using fluorescence time-lapses, the co-localization of Cobl-like/Cobl, Cobl-like/Syndapin at branch points. In previous articles, the same group demonstrated the localization at branching points of ca2+ spikes (using GCaMP), actin (using LifeAct), CaM, Cobl (Hou et al., Blos Biol 2015); co-localization of Cobl/Syndapin (Schwintzer et al., EMBO J 2011); co-localization of Cobl-like/Actin (LifeAct), Cobl-like/CaM (Izadi et al., JCB 2018). However, in these previous studies and in the present manuscript, no quantifications were made concerning the spatio-temporal recruitments of these biomolecules.

The authors have emphasized the complex and subtle regulations of these biochemical interactions leading to the functional coordination of these actin regulators. This is actually one of the key points of the manuscript, the demonstration that Cobl, Cobl-like, Syndapin and ca2+/CaM are orchestrated at the molecular level to control dendritic branching.

It would be very interesting to quantify the spatiotemporal relationship between the formation of the branch point and the specific recruitment of all these molecular actors. The authors should use the initiation of the protrusion as a time reference to then quantify the assembly and disassembly of the different molecular actors. This type of analysis has been performed previously for clatherin-mediated endocytosis (e.g. Taylor et al., Plos Biol 2011). For instance, the authors could measure evolutions of the fluorescence signals (e.g. fluorescence enrichment fluo foci/fluo outside) as a function of time before and after branch formation. For this specific manuscript, the authors should quantify this for at least Cobl, Cobl-like, Syndapin, and CaM. It would also be very interesting to quantify the fraction of aborted or effective formation of branches according to the spatiotemporal evolution of the different molecular actors.

2) Some findings presented in the current manuscript were already published by the same group:

While it is perfectly logical to base a study on previous findings and results, in the current manuscript the fraction of findings already published in previous manuscripts is non-negligible, which in some ways limits the originality of the data presented in the study.

For instance, the findings that Cobl-like is involved in the formation of dendritic branches and its localization at branch points (Figure 1, current manuscript) were already showed in a previous article from the same group (Izadi et al., JCB 2018; Figure 3, Figure 4). The coordination of Cobl-like and ca2+/CaM in this process was already demonstrated in the same article (Figure 9, CaM inhibitor CGS9343B), even though in the previous article the focused more on the Cter ca2+/CaM binding site. Likewise, the coordinated role of Cobl and syndapin in the formation of dendritic branches and their localization at branch points were already demonstrated in previous studies form the same group (Schwintzer et al., EMBO J 2011; Hou et al., PlosBiol 2015). In these two articles they also demonstrated the crucial role of ca2+/CaM in that process.

The manuscript would gain in strength and originality if the authors could deepen their molecular understanding of the branching process. One way could be to quantify the spatiotemporal coordination of these different molecular players (Cobl, Cobl-like, Syndapin, CaM, ca2+, actin, N-WASP, Arp2/3…) in that process, as suggested in the point #1.

Reviewer #3:This manuscript by Izadi et al., explores the contribution of two actin nucleating proteins, Cobl and Cobl-like, to dendritic arborization. This work links CaCaM signaling with different post-translation modes of Cobl at the plasma membrane via a physical linkage between Cobl and Cobl-like proteins mediated by the F-BAR protein Syndapin I and coordination with the actin disassembly factor Cyclin-dependent kinase 1 (Srv2/CAP) to ultimately dictate actin-based neuromorphogenesis. The strength of this study includes a robust set of imaging and molecular biology analyses to show the localization and interaction of Cobl, Cobl-like, and Syndapin I. A potential weak point in this work is a lacking comparison between this actin nucleation mode and other neuronal actin nucleation proteins (i.e., Spire, Arp2/3 complex, or formin). This could allow readers to assess and/or compare the effectiveness of the Cobl and Cobl-like to previously discovered single actin-nucleation protein activities on neurogenesis.

– The authors claim this work is the first demonstration of actin nucleation factors working in concert to promote neuronal morphology. Synergistic promotion of actin assembly by netrin/WASP/Arp2/3 and combinations of Spire / formins and other ligands are essential for several cell processes including vesicle trafficking, DNA repair and neuronal morphology in purkingee neurons (Wagner et al., 2011, Pfender et al., 2011; Schuh, 2011; Montaville et al., 2014; Belin et al., 2015; Sundararajan 2019), although perhaps not shown as clearly as these authors in this work. They show many careful details of the interaction of cobl and cobl-like in neuronal morphology but do not compare how these nucleation effects compare to more other nucleation factors.

– All figures and images throughout this manuscript should be recolored to avoid red/green for comparison to allow to allow for interpretation by color blind individuals.

– In several instances throughout the manuscript the authors refer to "highly significant" results based on statistical analyses. For accuracy and clarity, the authors should refer to results as "significant" or "not significant" as the statical tests used do not indicate more than this.

– For the ease of the reader the N values for each analysis should be listed in each figure legend rather than the methods section.

– More discussion on the role of various actin nucleation factors in neuronal development could benefit uninitiated readers. What are the contributions of Arp2/3, formins, spire? For example, a preprint (Bradley et al. 2019) suggests the formin Capu and spire cooperate to stimulate actin nucleation from both (barbed and pointed) ends of actin filaments.

– The images of hippocampal neurons shown in each of the figures are gorgeous!

– Additional quantitative analysis of co localization could strengthen the localization argument presented in Figure 1H.

– The interdependence of Cobl and Cobl-like could be more convincing at more timepoints than the single- 34 h one. Is the interdependence consistent on different days of neuronal development?

– A direct binding event doesn't mediate the interdependent morphological phenotype. Thus, the authors explore whether Syndapin proteins are responsible for linking Cobl and Cobl-like from previous observations demonstrating a direct relationship between Syndapin I and Cobl at the plasma membrane. Could other proteins particularly spire or formin proteins also mediate connections between Cobl and Cobl-like?

– Lines 106-107: I think the authors mean to say "all were statistically significant compared to neurons cotransfected…"

– Line 150 "artifacts" is misspelled.

– Line 226 there is no "highly significant" result in statistics, it is either significant or not based on the p-value cut off used. Please reword accordingly.

– Define KO on line 381.

eLife. 2021 Jul 15;10:e67718. doi: 10.7554/eLife.67718.sa2

Author response


Essential Revisions:

1. Some results appear inconsistent between different Figures. For example, in Figure 1D, Cobl RNAi shifts numbers of dendritic branch points from 10 to 6, while in Figure 2E, Cobl RNAi leaves numbers of dendritic branch points pretty much unchanged (around 7 or 8). Could you make sure that all data are consistent between Figures or explain apparent inconsistencies?

It is correct that the both the absolute numbers of dendritic branches, terminal points and dendritic length and also the relative effects of Cobl and Cobl-like RNAi differ in particular between former Figure 1 and 2. Roughly, one can say that the RNAi effects in former Figure 1,9 and 10 are about twice as strong as in the former Figure 2. There are two simple reasons for this, which we unfortunately failed to communicate properly in our original manuscript:

i) time frame of phenotype development and suppression, respectively and

ii) expression of only one versus two plasmids in the different types of experiments

Concerning i): The former Figure 2 and actually also the former Figure 4 (suppression by syndapin I RNAi) both are suppressions of gain-of-function phenotypes, whereas the former Figures 1, 9 and 10 are loss-of-function experiments. Because the gain-of-function effects represent strong and fast inductions of dendritic arborization it suffices to do a short transfection (max. 34 h) and then evaluate. Loss-of-function effects in conditions using the RNAi tools alone are not very strong at such short times when compared to control (all three analyzed parameters are -15-25% for the stronger Cobl-like RNAi and 0 to -10% for the weaker Cobl RNAi at this short time; former Figure 1, please see Figure 1—figure supplement 2 of the revised manuscript).

The loss-of-function experiments (former Figure 1, 9, 10) are different. The times need to be longer, as the phenotype is the normal growth of the dendritic arbor in controls vs. the putative suppression of this developmental process upon RNAi. Thus, transfections in these experiments usually need to be substantially longer (37-46 h) to show loss-of-function phenotypes compared to control – which then also may be more obvious (Cobl-like RNAi, -30 to -40 %; Cobl RNAi, -33% (***), -20% (**) and -10% (n.s.); former Figure 1D-F – now Figure 1—figure supplement 2).

Concerning ii): Suppression of gain-of-function experiments require the coexpression of two plasmids (one for the induction of the gain-of-function phenotype and the second for the RNAi (including reporter expression)), whereas we are able to drive loss-of-function/rescue experiments from only one plasmid driving both RNAi and the expression of a reporter or rescue mutant. Such transfections with two plasmids usually leads to gain-of-function but also suppression effects that are weaker than the effects of either overexpressing or knocking down proteins alone.

The revised manuscript now provides information on the different time frames of transfection (see improved and expanded Figure legends and Material and Method section) and also briefly touches on the coexpression issue leading to different numbers in the different types of experiments.

2. We find experiments of Figure 2 insufficient to conclude that Cobl and Cobl-like factors depend strictly on each other. One could imagine scenarios where effects of Cobl or Cobl-like are highly concentration dependent, and lead to detectable effects in cells only below or above certain thresholds (especially for multi-domain binding proteins such as Cobl and Cobl-like, which are likely to undergo complex phase transition behaviors when clustering at the membrane).

Therefore we would recommend here simply to be very careful with wording in the conclusions of these experiments.

We share the reviewer’s concerns that suppression experiments are sometimes difficult to interpret, if the experiments are not designed in a careful manner and/or show a complex outcome. This is not the case in our experiments, however (see details below).

Of strong concern would be the following outcome: A presence of significant RNAi effect(s) alone compared to control and the results of the suppression attempt and the RNAi run for comparison are not equal but the effects of conducting RNAi alone are stronger. In this case of experimental outcome, one should rather abstain from any interpretation and try to adapt the experimental design to reach a clear conclusion. The reason is that, in this particular case, two processes (one positive, the other one negative) could simply operate in parallel, may not necessarily have anything to do with each other directly and may potentially be affected by unspecifiable dose effects as well – thus the experiment is not informative.

In our experiments, the situation is different and the revised manuscript now contains an elucidation of the considerations required for a correct interpretation for the two vice versa suppression experiments we conducted and reported in the former Figure 2 (Figure 1C-P in the revised manuscript).

In general, the reviewers will acknowledge that when component A is able to elicit a certain cell biological effect and this does not happen when component B is not present, then component A’s functions depend on B. This is a very classical experimental design and conclusion. The same can also be done with inhibitors – then A’s functions depend on B’s activity. However, it is absolutely crucial that the individual effects of the manipulations as well as the baseline control values are considered in the interpretation, too. If the suppression of the overexpression effect is larger than any putative RNAi effects compared to control or there is no such RNAi effect, the experiment and interpretation actually is very straight forward.

In our study, this is the case for Cobl RNAi in the suppression of Cobl-like functions (Figure 1C-I in the revised manuscript): We observed complete suppression of Cobl-like’s effects with Cobl-like RNAi. Yet, the effects of GFP+Cobl RNAi expression are not distinguishable from control and the result thus is straight forward to interpret. We actually designed the experiment in a way that the individual RNAi conditions remained neglectable to reach this straight forward interpretation scenario.

The same applies to the suppression of Cobl-like effects by syndapin I RNAi (Figure 3 in the revised manuscript). Under the conditions shown, syndapin I RNAi would not cause any phenotypes, yet, it completely suppressed the strong Cobl-like-mediated effects on all four parameters of dendritic arborization determined (former Figure 4; now Figure 3 in the revised manuscript).

For the suppression of the Cobl gain-of-function phenotypes by Cobl-like RNAi (Figure 1J-P in the revised manuscript) the situation is a bit less obvious and we understand the concern of the reviewer that this may need a more detailed look. Here, in all three parameters shown, GFP+Cobl-like RNAi causes a relatively mild but significant phenotype when compared to GFP+Scrambled control. However, the reviewer will acknowledge that the RNAi effects deviating negatively from the GFP+Scrambled control are much smaller than the suppression of the Cobl-mediated effects on dendritic arborization, which are twice as high (branch points; total dendritic length) and three times as high (terminal branches), respectively. Thus, also here, we clearly observe a suppression of specifically Cobl functions and can exclude additive actions in opposite directions. Importantly, this conclusion is formally further underscored by the fact that in all three phenotypical analyses GFP-Cobl+Cobl-like RNAi and GFP+Cobl-like RNAi are not statistically different from one another but equal (Figure 1J-P in the revised manuscript). This makes the interpretation of the results of also this suppression experiment straight forward again.

Other mentions such as (line 328) "their functions were cooperative", should also be avoided unless you provide further explanations.

Please see our statement above. If A needs B to work and B relies on A, that simply means A and B work together and not in parallel – and working in together is nothing else than cooperation. The revised manuscript now contains an elucidation of the considerations required for a correct interpretation for the two vice versa suppression experiments.

Mentions such as (line 101) "Functional redundancy seemed unlikely, because both individual loss-of-function phenotypes were severe." should be explained so that readers can assess whether functional redundancy is indeed unlikely or not (for example by referencing a paper describing mild versus severe phenotypes).

We apologize for the too much shortened argumentation in the original manuscript. A parallel action of Cobl and Cobl-like appeared unlikely because the DIV4-to-DIV6 developmental phenotypes of both components were so severe that a third of the entire arborization normally reached at DIV6 was lacking when only one of the two components was knocked down.

This paragraph has been changed in the revised manuscript and now explains better why parallel action of Cobl and Cobl-like appeared unlikely and why we thus addressed the alternative hypothesis.

3. Some findings presented in the current manuscript were already published. While it is perfectly logical to base a study on previous findings and results, in the current manuscript the fraction of findings already published in previous manuscripts is non-negligible, which in some ways hides the originality of the data presented in the study.

For instance, the findings that Cobl-like is involved in the formation of dendritic branches and its localization at branch points (Figure 1, current manuscript) were already showed in a previous article from your group (Izadi et al., JCB 2018; Figure 3, Figure 4). The coordination of Cobl-like and ca2+/CaM in this process was already demonstrated in the same article (Figure 9, CaM inhibitor CGS9343B), even though in the previous article you focused more on the Cter ca2+/CaM binding site. Likewise, the coordinated role of Cobl and syndapin in the formation of dendritic branches and their localization at branch points was already demonstrated in previous studies (Schwintzer et al., EMBO J 2011; Hou et al., PlosBiol 2015). In these two articles you also demonstrated the crucial role of ca2+/CaM in that process.

As the current manuscript is very long (11 Figures), could you please present only new data and refer to previous papers when needed? We believe that this would give you an opportunity to limit the number of Figures and that the manuscript would overall gain in clarity.

We have to admit that we are a bit irritated to be confronted with the claim that our manuscript to a “non-negligible” part contains data already published before. We usually carefully avoid publishing redundant data.

i) Concerning Figure 1: We acknowledge that the initial side-by-side comparison of Cobl and Cobl-like loss-of-function phenotypes can be considered as partially redundant with the literature, as the Cobl-like phenotype has been reported as an IMARIS-based evaluation before (Izadi et al., 2018 J Cell Biol.). However, the Cobl loss-of-function phenotype has not been evaluated in detail before, as all previous publications unfortunately only included a very limited manual analyses of branch points and of the number of primary dendrites (Ahuja et al., 2007 Cell; Schwintzer et al., 2011 EMBO J; Haag et al., 2012 J. Neurosci.; Hou et al., 2015 PLoS; Hou et al., 2018 Dev Cell) – it thus was impossible to compare the phenotypes of Cobl to Cobl-like loss-of-function because neither terminal points, the total dendritic length nor Sholl analyses of the entire dendritic arbor have ever been analyzed before. Besides this obvious novelty, we have described which hypothesis led to the necessity of a full evaluation of Cobl loss-of-function effects in early neuronal development and of a side-by-side comparison with full consistency on the cell, method and experimenter sides. Since this work is the logical starting point of our study we cannot omit this data entirely but moved this block of data into the Supplemental Material (please see new Figure 1-Supplement2) and fused the remaining panels of the former Figure 1 with Figure 2 (now Figure 1 in revised manuscript) to additionally reduce the numbers of main figures from formerly 11 to now 10, as demanded.

ii) Concerning Figure 9: It is correct that we have demonstrated before by the use of the CaM inhibitor CGS9343B that Cobl-like functions require ca2+/CaM signaling (Izadi et al., 2018 J. Cell Biol.). However, these data are NOT recapitulated here. In the current study we instead identify a binding site of CaM in the N terminal part of Cobl-like and address the functions of specifically this site by in vitro, in vivo and functional analyses using a mutant that specifically lacks this site. None of this has been published before. The allegation of redundant publishing of data thus is completely unfounded.

In case the reviewer meant to question the novelty that Cobl-like functions in principle have something to do with ca2+/CaM signaling, we herewith stress that nowhere in the manuscript such general novelty was claimed but that we exclusive focused at the newly identified ca2+/CaM binding site and its molecular and cell biological functions.

Furthermore, we would like to remind the reviewer that it is valuable for a cell biological understanding of a given protein to evaluate a second site of binding to some interaction partner or a second or third site of modification mechanistically and functionally – please e.g. just have a look at all the individual phosphorylation sites of the many tyrosine kinase receptors and their (in part) different functions, which have been published in a plethora of independent publications over decades.

iii) Likewise, it is correct that it is known that syndapin interacts with Cobl (Schwintzer et al., 2011 EMBO J.). Here, however, we for the first time show an interaction of Cobl-like with syndapin I. Furthermore, we unveil that syndapin I can physically link and thereby coordinate Cobl with syndapin I’s new binding partner Cobl-like. And finally we demonstrate how this novel Cobl-like interaction with syndapin I is regulated.

All three points are novel and we thus fail to understand the background of the reviewer’s allegation of redundant publishing of data.

iv) Concerning reducing the figure number and citing more literature: The manuscript does refer to data previously reported wherever possible (the originally submitted manuscript already had more than 60 literature citations).

In order to comply with the suggestion to reduce the figure number, the revised manuscript now presents the former Figure 1 in the Supplemental Material (new Figure 1-Supplement). Despite the fact that the reviewers also asked for additional examinations to be included (see below), the revised manuscript therefore now contains 10 instead of 11 figures.

4. The reviewers agree that a discussion on the role of various actin nucleation factors in neuronal development could benefit uninitiated readers. Could you also please discuss in more details other potential mechanisms of coordination between actin regulators based on your extensive previous studies and the existing literature?

The revised manuscript now covers ten papers suggesting some crosstalk between actin nucleators in the discussion.

Most of these studies are not studying any processes in hippocampal neurons, still, though, they serve as great examples for valuable hints towards the fact that there may be much more complexity and coordination of different players leading to the formation of actin filaments than we currently think.

5. In the present manuscript, you show, using fluorescence time-lapses, the co-localization of Cobl-like/Cobl, Cobl-like/Syndapin at branch points. In previous articles, your group demonstrated the localization at branching points of ca2+ spikes (using GCaMP), actin (using LifeAct), CaM, Cobl (Hou et al., Blos Biol 2015); co-localization of Cobl/Syndapin (Schwintzer et al., EMBO J 2011); co-localization of Cobl-like/Actin (LifeAct), Cobl-like/CaM (Izadi et al., JCB 2018).

However, in these previous studies and in the present manuscript, no quantifications were made concerning the spatio-temporal recruitments of these molecules. In this manuscript, it seems on top of that Cobl-like appears before syndapin, which would not be quite coherent with a recruitement of Cobl-like through syndapin.

Therefore, it would be important to quantify here more precisely the spatiotemporal relationship between Cobl, Cobl-like, syndapin and CaM (and ideally ca2+) during the formation of dendritic branches. This would require to record data at shorter time intervals, but you should have all the biological material necessary to do these experiments. You could use if possible the initiation of the protrusions as a time reference to then quantify the assembly and disassembly of the different molecular actors. This type of analysis has been performed previously for clathrin-mediated endocytosis (e.g. Taylor et al., Plos Biol 2011). For instance, you could measure evolutions of the fluorescence signals (e.g. fluorescence enrichment fluo foci/fluo outside) as a function of time before and after branch formation. It would also be very interesting to quantify the fraction of aborted or effective formation of branches according to the spatiotemporal evolution of the different molecular actors.

We thank the reviewers for these further suggestion. It is indeed obvious that spatiotemporal analyses of different factors in dendritic branch induction is an attractive area of research offering a chance of a deeper understanding of the process. It seems to be a complex process involving quite a variety of molecular players. At the moment, one has to admit that we are mostly still at the stage of identifying critical and involved players and of investigating their individual properties and interactions, respectively. With the current study, we for the first time put three of these players and their CaM-coordinated action into the spot light. The revised manuscript now also contains some quantitative spatiotemporal data showing and comparing the degree of accumulation of these players and their average peak time prior to branch induction (please see newly added data panels Figure 5C and D).

We used the first morphological protrusion as reference point for the analysis of the critical time period prior to this, as suggested by the reviewers. As the reviewers will see from the new data added our data nicely confirms that not only Cobl (Hou et al., 2015) and Cobl-like (Izadi et al., 2018) show elevated values of accumulation prior to branch induction but that also syndapin I and even also CaM do so (see newly added Figure 5C).

Although the technical challenges were significant (primary neurons are hard to transfect, the developmental processes of dendritic branching occurs with rather moderate frequency somewhere in the extended dendritic arbor of a given neurons, and the analysis nevertheless requires a time resolution in the range of seconds and quite some 3D spatial resolution), we nevertheless were able to obtain n numbers of protrusions high enough to evaluate for each of these four proteins. The newly added data clearly makes the point that syndapin I, Cobl-like, Cobl and CaM in average show spatiotemporal overlap in a time window ranging from about -30 to -10 seconds prior to branch initiation (see newly added Figure 5D).

Interestingly, it furthermore seemed that Cobl-like together with syndapin I appeared earlier than Cobl, while CaM seemed to peak inbetween. The latter may be related to complex formations of CaM with both Cobl and Cobl-like and with the coordination of all three components by CaM signaling we revealed in our study.

Beyond these additional efforts made in our revision work for all four components studied here (Cobl-like, syndapin I, Cobl and CaM), we agree with the reviewer that comprehensive and detailed spatiotemporal analyses of all – in part yet to be identified – molecular players in dendritic branch induction will in the future certainly represent a powerful research avenue towards a better understanding of the temporal order of the actions of these players, of how they may be coordinated to bring about a new dendritic branch during development but may be also during repair processes of neurons.

6. Another missing experiment in this story is whether this strong effect of ca2+/CaM in promoting Cobl-like's interaction with syndapin I through the first of the three "KRAP" motifs is indeed critical for Cobl-like recruitement at the membrane in cells. Could you provide experimental evidence that KRAP1 is directly involved in the ca2+/CaM-mediated recruitment of Cobl-like at the plasma membrane?

In order to address a putative impact of the first, ca2+/CaM-regulated KRAP motif on the membrane recruitment of Cobl-like, we knocked-down endogenous Cobl-like and then quantified the membrane-association of reexpressed, RNAi-insensitive Cobl-like lacking KRAP1 at the plasma membrane of neurons in comparison to wild-type Cobl-like. Although KRAP1 is only one out of three identified syndapin I binding sites, we observed that deletion of merely this one site had a profound, statistically significant (p<0.0001; ****) impact on Cobl-like’s membrane localization in developing hippocampal neurons. This data obtained in our revision work is reported as Figure 9G-I in the revised manuscript.

Reviewer #1:

This work investigates at the molecular and cellular levels the functional dependence of two actin filament nucleation factors, Cobl and Cobl-like proteins, in the formation of protrusive dendritic structures. Depletion of Cobl or Cobl-like lead to roughly similar phenotypes; overexpression of Cobl or Cobl-like induces excessive dendrite formation when the other protein is expressed at normal levels, but not when this other protein is depleted. Altogether, these observations lead the authors to conclude that these proteins work strictly interdependently. The authors then investigate how Cobl and Cobl-like are recruited, and identify syndapin as an essential component to bring Cobl and Cobl-like together at the membrane. This interaction is beautifully documented through a large number of pulldown experiments in vitro, and critical domains for these interactions are identified. These interactions are also confirmed in physiological conditions through ectopic localization experiments of those components to mitochondria. Syndapin I is identified as clusters at dendritic initiation sites by electron microscopy and all three components colocalize at the same nascent dendritic branch sites. In the last part of the manuscript, the authors further document the interaction between Cobl-like and syndapin, and find that calcium-dependent calmodulin binding to Cobl-like increases syndapin I's association through the first of the three KRAP's domains.

Comments to be addressed in a revised manuscript:

1. Some results appear inconsistent between different Figures. For example, in Figure 1D, Cobl RNAi shifts numbers of dendritic branch points from 10 to 6, while in Figure 2E, Cobl RNAi leaves numbers of dendritic branch points pretty much unchanged (around 7 or 8). Could the authors make sure that all data are consistent between Figures or explain apparent inconsistencies?

We thank the reviewer for his/her careful evaluation of our data. The discrepancy noticed, however, is only an apparent inconsistency, as the experimental set-ups and purposes were different. Please see our above detailed answer to Essential revision list point 1.

2. I find experiments of Figure 1 and 2 insufficient to conclude that Cobl and Cobl-like factors depend strictly on each other. One could imagine many scenarios where effects of Cobl or Cobl-like are highly concentration dependent, and lead to detectable effects in cells below or under certain thresholds (especially for multi-domain binding proteins such as Cobl and Cobl-like, which are likely to undergo complex phase transition behaviors when clustering at the membrane). Therefore, I would recommend the authors to be very careful with wording and conclusions of their experiments, and stick to what can strictly be concluded.

We share the reviewer’s concerns that suppression experiments are sometimes difficult to interpret. Please see our detailed response to this topic above (Essential Revision list point 2).

We hope the reviewer will be content with the revised version of our manuscript.

Other mentions such as (line 328) "their functions were cooperative", should also be avoided without any further explanations; Mentions such as (line 101) "Functional redundancy seemed unlikely, because both individual loss-of-function phenotypes were severe." should be explained so that readers can assess whether functional redundancy is indeed unlikely or not (for example by referencing a paper describing mild versus severe phenotypes).

As already written in the Essential Revision list above, we apologize for the too much shortened argumentation in the original manuscript. This paragraph has been changed in the revised manuscript and now explains better why parallel action of Cobl and Cobl-like appeared unlikely and why we thus addressed the alternative hypothesis.

3. One missing experiment in this story is whether this important effect of ca2+/CaM signaling promoting syndapin I's association with the first of the three "KRAP" motifs is key to account for Cobl-like's clustering at the plasma membrane. Could the authors measure the effect of calcium for Cobl-like (KRAP1 deleted) clustering at the plasma membrane (as compared to wild-type Cobl-like)?

We thank the reviewer for his/her suggestion of experiments suitable to significantly strengthen the manuscript. Please see our above response to the Essential revision list point 6.

In brief, this type of experimentation was done as part of our revision efforts during the last weeks. It demonstrated a remarkable strong impact of deletion of KRAP1 on Cobl-like’s membrane localization in developing hippocampal neurons and is now reported in the newly added revised Figure 9G-I.

4. I regret sometimes the lack of quantification for some experiments. For example, protein colocalization in cells should be quantified (for example by calculating Pearson's correlation coefficients of red and green signals at mitochondrial sites) because colocalization (or absence of) is not always obvious for non-expert eyes.

It may have been overlooked that calculating Pearson's correlation coefficients is not useful in our case, as we are not addressing a correlation of the occurrence of individual signals of one type with another type but are addressing coaccumulations of components under a given condition versus a more diffuse localization under other condition.

The original manuscript highlighted such coaccumulations by false-color heat map representations and marking sites of interest in two of our main figures.

In order to also comply with the reviewer’s request concerning the other figures (the in vivo protein complex reconstitutions at mitochondrial membrane surfaces), we added high-magnification insets to all of these figures in the main manuscript and in the Supplementary information visualizing in a more easily accessible manner than in the small full-size images whether the respective mitochondrial patterns are occurring or only a diffuse localization pattern prevails. We furthermore conducted line scans to quantitative visualize coincidences of elevated or diminished signal intensities. We hope that the reviewer is content with these additional figure panels added to many of our revised figures.

5. Figure 6 is beautiful, but I am wondering if these data could be exploited better. Is it possible to record data at shorter time intervals? It seems that Cobl-like appears before syndapin. Is that correct and if so, how is this coherent with a recruitement of Cobl-like through syndapin?

Please see our response to the Essential Revision list point 5 above. We acknowledge that analysis of the spatiotemporal relationship of molecular players involved in dendritic branch induction only is in its infancy, as at the current stage of research not even all important players of this process are known and this type of analysis is technically challenging to do in a quantitative manner in neurons.

The revised manuscript does now clearly demonstrate by quantitative evaluations of peak signal intensities that all four components studied (Cobl, Cobl-like, syndapin I and CaM) indeed show accumulation at branch induction sites prior to branch initiation. These data are quite well in line with the relative accumulation data collected for two of the components at the 30 s time point prior to protrusion initiation for Cobl (Hou et al., 2015 PLoS Biol.) and for Cobl-like (Izadi et al., 2018 J. Cell Biol.).

Furthermore the revised manuscript now contains a preliminary assessment of the average peak times of all for components highlighting that they indeed do not only show spatial but also temporal overlap at branch initiation sites, as it can be expected from our finding that Cobl-like and Cobl can be interconnected by Cobl-like’s novel interaction partner syndapin I in a CaM-regulated mechanism converging on one particular of the three syndapin I binding motifs we identified in Cobl-like. The Cobl-like and the syndapin I data hereby showed significant variances and a surprisingly early appearance of both components together. The data obtained thus far do not suggest that Cobl-like is recruited before syndapin but in average showed the same peak time (please see revised Figure 5C,D; former Figure 6). Thus, while we honestly do not claim that we have detailed enough data on the different aspects of the spatiotemporal behaviors of all players in dendritic branch initiation and this will definitively require further studies focusing on these aspects specifically, there at least is no discrepancy with any of the molecular mechanisms involving Cobl-like and syndapin I, which we demonstrate in this manuscript.

Recommendations for the authors:

1. Graph bar representation is not recommended nowadays. Please show individual data points with box and whisker plots to represent the variability of the data (and asymmetry of distributions). Also it would be useful to provide significance levels (α factors) in addition to p-values, and indicate exact α/p values in legends in addition of the stars in the Figures. On the contrary, statements such as "highly statistically significantly" (line 106) should be avoided. How p-values were calculated should also be mentioned.

We hope that the reviewer is content with the accessibility of individual data points in our revised manuscript.

2. Please make sure that all abbreviations are explained when mentioned first.

This should be taken care of in the revised manuscript.

3. Mentions to unpublished efforts is not recommended anymore. Please show results from these efforts in a Supplementary Figure or do not mention them.

Done.

4. Please correct the following inaccuracy:

"Two powerful molecular machines for actin filament formation": These proteins are not machines, because they do not consume energy to form new filaments.

Done.

5. Figure 5A: Is it possible to present both gels with the same molecular weight scale so that corresponding bands are aligned?

Done.

Reviewer #2:

The manuscript by Izadi et al., "Functional interdependence of the actin nucleator Cobl and Cobl-like in dendritic arbor development" deals with the fundamental question of how actin regulators are orchestrated to control the formation of membranes protrusions during cells morphogenesis. In particular, the authors explored how actin nucleators are coordinated to trigger the formation of branches in neuronal dendritic arbor.

In that context, Cobl have a crucial role in dendritic arbor formation in neuronal cells. Cobl contains a repeat of three WH2 domains interacting with actin and enabling nucleation of new actin filaments (F-actin). The initial idea was that tandem repeat of WH2 domains could be sufficient to trigger F-actin nucleation. However, other studies have shown that the WH2 repeat of Cobl has no nucleation activity of its own. Importantly, Cobl activity was shown to work in coordination with other actin regulators including the F-actin-binding protein Abp1 (Haag, J Neuro 2012) and the BAR domain protein syndapin (Schwintzer, EMBO J 2011).

The manuscript of Izadi et al. builds on previous articles from the same group, in particular a study demonstrating that Cobl-like, an evolutionary ancestor of Cobl, is also crucial for dendritic branching (Izadi et al., 2018 JCB). This previous article showed that like Cobl (Haag, J Neuro 2012), Cobl-like protein works in coordination with the F-actin-binding protein Abp1 and ca2+/CaM to promote dendritic branching through regulation of F-actin nucleation or/and assembly. In the current manuscript the authors showed that the two actin nucleators Cobl and Cobl-like proteins are interdependent to trigger dendritic branching.

The authors used functional assays by quantifying the formation of dendritic branches in primary hippocampal neurons. Using fluorescence microscopy and siRNA-based knockdowns, the authors showed that Cobl and Cobl-like are functionally interdependent during dendritic branch formation in dissociated hippocampal neurons. They showed that siRNA decreasing Cobl or Cobl-like expression reduced the number of dendritic branch points to the same extent. Fluorescence time-lapses indicated that Cobl and Cobl-like proteins co-localized at abortive and effective branching points. Furthermore, they showed that the increase in branching induced by Cobl-like overexpression is reversed by using a siRNA that decreases Cobl expression, they also performed the reciprocal experiments. Using a variety of biochemistry assays (co-immunoprecipitation, in vitro reconstitutions with purified components…) the authors demonstrated that Cobl and Cobl-like do not interact directly, but that Cobl-like associates with syndapins, as previously shown for Cobl (Schwintzer et al., 2011; Hou et al., 2015). Thus, syndapin is the molecular and functional link between Cobl and Cobl-like proteins. The authors performed a very thorough characterisation of the biochemical interactions between the Cobl-like protein and syndapins. Syndapins and Cobl-like interactions were direct and based on SH3 domain/Prolin rich motif interactions respectively on syndapins and Cobl-like. The Prolin rich motifs were located in 3 KRAP domains at the Nter of Cobl-like proteins. The authors also showed that the interaction of the Nter proximal KRAP domain with syndapin is ca2+/CaM dependent, and that this ca2+/CaM dependent interaction is crucial for the function of the Cobl-like protein in the regulation of dendritic arbor formation. The authors confirmed most of their biochemical results by visualizing the formation of protein complexes on the surface of mitochondria in intact COS-7 cells. They also used time-lapse fluorescent microscopy to demonstrate that Syndapin and Cobl-like are co-localized at sites of dendritic branch induction. Importantly, the authors used Immunogold labeling of freeze-fractured plasma membranes combined with electron microscopy. Using this strategy, they showed that membrane-bound syndapin nanoclusters are preferentially located at the base of protrusive membrane topologies in developing neurons. Throughout the manuscript, the authors confronted their biochemistry experiments with functional assays quantifying the formation of dendritic branches.

The overall conclusion of the manuscript is that a molecular complex involving Cobl, Cobl-like and syndapin and regulated by ca2+/CaM, promotes the formation of actin networks leading to dendritic protrusions to initiate dendritic branches. Importantly, this manuscript demonstrated that multiple actin nucleators can be coordinated in neurons to trigger the formation of subcellular structures.

The conclusions of the manuscript are, in most cases, convincingly supported by the results. In particular, the authors have performed a very comprehensive characterization of the biochemical interactions between Cobl, Cobl-like and syndapin, which are well supported by the functional results. However, the results found concerning the spatiotemporal relationship between Cobl, Cobl-like and syndapin during dendritic branch formation are more preliminary and do not take into account the roles of ca2+/CaM. In addition, some of the findings were already published by the same group in previous articles. Thus, there are a number of issues that need to be addressed by the authors. These critical points are the following: (1) Need for quantifications concerning the spatiotemporal relationship between Cobl, Cobl-like and syndapin during the formation of dendritic branches. (2) Some of the findings presented in this manuscript have already been published by the same group, which diminishes the inherent originality of this manuscript. Apart from the main points raised above, the manuscript is experimentally solid and contains interesting results that are likely to stimulate further experiments in the fields of actin cytoskeleton but also in the fields of cellular neurobiology and neurodevelopment.

We thank the reviewer for the positive assessment of the quality and impact of our work.

As far as the first point of the reviewer is concerned, the spatiotemporal relationship between Cobl, Cobl-like and syndapin I, please see our response to the Essential Revision list point 5 above.

We acknowledge that analysis of the spatiotemporal relationship of molecular players involved in dendritic branch induction only is in its infancy, as at the current stage of research not even all important players of this process are known and this type of analysis is technically challenging to do in a quantitative manner in neurons.

The revised manuscript does now clearly demonstrate by quantitative evaluations of peak signal intensities that all four components studied (Cobl, Cobl-like, syndapin I and CaM) indeed show accumulation at branch induction sites prior to branch initiation. These data are quite well in line with the relative accumulation data collected for two of the components at the 30 s time point prior to protrusion initiation for Cobl (Hou et al., 2015 PLoS Biol.) and for Cobl-like (Izadi et al., 2018 J. Cell Biol.).

Furthermore the revised manuscript now contains a preliminary assessment of the average peak times of all for components highlighting that they indeed do not only show spatial but also temporal overlap at branch initiation sites, as it can be expected from our finding that Cobl-like and Cobl can be interconnected by Cobl-like’s novel interaction partner syndapin I in a CaM-regulated mechanism converging on one particular of the three syndapin I binding motifs we identified in Cobl-like. The Cobl-like and the syndapin I data hereby showed significant variances and a surprisingly early appearance of both components together. The data obtained thus far suggest that Cobl-like and syndapin I are in average recruited at the same peak time, whereas Cobl may perhaps peak a bit later (n.s.) and CaM overlaps with both (please see revised Figure 5C,D).

However, even with these additional efforts we made during our revision work, one has to honestly admit that it is too early to claim that we have detailed enough data on the different aspects of the spatiotemporal behaviors of all players in dendritic branch initiation (which currently we may not all even have identified, yet). Although technically challenging to do at high enough resolution, with large enough time frames to capture the only relatively rare events of dendritic branch induction, at sufficient frame rates to not miss key events and with high enough numbers of transfected primary neurons of suitable developmental stages to reach sound quantitative data, this will require further comprehensive studies focusing on these aspects specifically.

As far as the second point of the reviewer is concerned, the criticism that some of the findings presented in this manuscript have already been published, please see our response to the Essential Revision list point 3 above.

As all other points presented are novel, this probably refers to the side-by-side, software-based, detailed evaluation of Cobl and Cobl-like loss-of-function phenotypes during early dendritic arborization originally presented in Figure 1. This data has been moved to the Supplemental Material (Figure 1—figure supplement 1) in the revised manuscript, as one half of the data set of course indeed merely is a reproduction of the Cobl-like phenotype identified by the same method before (Izadi et al., 2018).

However, the reviewers will acknowledge and readers will immediately understand that, without this comparison revealing the high degree of phenotypical copy, we would not have followed up and discovered the coordinated action of the two components powering actin filament formation during dendritic branch initiation we report here.

1) Need for quantifications concerning the spatiotemporal relationship between Cobl, Cobl-like, syndapin, ca2+, CaM during the formation of dendritic branches.

In the present manuscript, the authors have shown, using fluorescence time-lapses, the co-localization of Cobl-like/Cobl, Cobl-like/Syndapin at branch points. In previous articles, the same group demonstrated the localization at branching points of ca2+ spikes (using GCaMP), actin (using LifeAct), CaM, Cobl (Hou et al., Blos Biol 2015); co-localization of Cobl/Syndapin (Schwintzer et al., EMBO J 2011); co-localization of Cobl-like/Actin (LifeAct), Cobl-like/CaM (Izadi et al., JCB 2018). However, in these previous studies and in the present manuscript, no quantifications were made concerning the spatio-temporal recruitments of these biomolecules.

The authors have emphasized the complex and subtle regulations of these biochemical interactions leading to the functional coordination of these actin regulators. This is actually one of the key points of the manuscript, the demonstration that Cobl, Cobl-like, Syndapin and ca2+/CaM are orchestrated at the molecular level to control dendritic branching.

It would be very interesting to quantify the spatiotemporal relationship between the formation of the branch point and the specific recruitment of all these molecular actors. The authors should use the initiation of the protrusion as a time reference to then quantify the assembly and disassembly of the different molecular actors. This type of analysis has been performed previously for clatherin-mediated endocytosis (e.g. Taylor et al., Plos Biol 2011). For instance, the authors could measure evolutions of the fluorescence signals (e.g. fluorescence enrichment fluo foci/fluo outside) as a function of time before and after branch formation. For this specific manuscript, the authors should quantify this for at least Cobl, Cobl-like, Syndapin, and CaM. It would also be very interesting to quantify the fraction of aborted or effective formation of branches according to the spatiotemporal evolution of the different molecular actors.

Please see our response to the Essential Revision list point 5 above. Please also see our response to this point in the review provided by the reviewer.

2) Some findings presented in the current manuscript were already published by the same group:

While it is perfectly logical to base a study on previous findings and results, in the current manuscript the fraction of findings already published in previous manuscripts is non-negligible, which in some ways limits the originality of the data presented in the study.

For instance, the findings that Cobl-like is involved in the formation of dendritic branches and its localization at branch points (Figure 1, current manuscript) were already showed in a previous article from the same group (Izadi et al., JCB 2018; Figure 3, Figure 4). The coordination of Cobl-like and ca2+/CaM in this process was already demonstrated in the same article (Figure 9, CaM inhibitor CGS9343B), even though in the previous article the focused more on the Cter ca2+/CaM binding site. Likewise, the coordinated role of Cobl and syndapin in the formation of dendritic branches and their localization at branch points were already demonstrated in previous studies form the same group (Schwintzer et al., EMBO J 2011; Hou et al., PlosBiol 2015). In these two articles they also demonstrated the crucial role of ca2+/CaM in that process.

The manuscript would gain in strength and originality if the authors could deepen their molecular understanding of the branching process. One way could be to quantify the spatiotemporal coordination of these different molecular players (Cobl, Cobl-like, Syndapin, CaM, ca2+, actin, N-WASP, Arp2/3…) in that process, as suggested in the point #1.

Reviewer #3:

This manuscript by Izadi et al., explores the contribution of two actin nucleating proteins, Cobl and Cobl-like, to dendritic arborization. This work links CaCaM signaling with different post-translation modes of Cobl at the plasma membrane via a physical linkage between Cobl and Cobl-like proteins mediated by the F-BAR protein Syndapin I and coordination with the actin disassembly factor Cyclin-dependent kinase 1 (Srv2/CAP) to ultimately dictate actin-based neuromorphogenesis. The strength of this study includes a robust set of imaging and molecular biology analyses to show the localization and interaction of Cobl, Cobl-like, and Syndapin I. A potential weak point in this work is a lacking comparison between this actin nucleation mode and other neuronal actin nucleation proteins (i.e., Spire, Arp2/3 complex, or formin). This could allow readers to assess and/or compare the effectiveness of the Cobl and Cobl-like to previously discovered single actin-nucleation protein activities on neurogenesis.

– The authors claim this work is the first demonstration of actin nucleation factors working in concert to promote neuronal morphology. Synergistic promotion of actin assembly by netrin/WASP/Arp2/3 and combinations of Spire / formins and other ligands are essential for several cell processes including vesicle trafficking, DNA repair and neuronal morphology in purkingee neurons (Wagner et al., 2011, Pfender et al., 2011; Schuh, 2011; Montaville et al., 2014; Belin et al., 2015; Sundararajan 2019), although perhaps not shown as clearly as these authors in this work. They show many careful details of the interaction of cobl and cobl-like in neuronal morphology but do not compare how these nucleation effects compare to more other nucleation factors.

Please see our response to Essential revision list point 4: The revised manuscript covers nine papers suggesting some crosstalk between actin nucleators in the discussion. These papers e.g. include the seminal work highlighting the cooperation of the actin nucleator Spire with formin 2 and for this also cites some of the literature the reviewer mentioned (Quinlan et al., 2007; Pfender et al., 2011; Montaville et al., 2014). The Belin et al. 2015 work on Spire and formin 2 in DNA damage repair is now also cited in the revised manuscript and expands the biological range of cooperations of these two actin nucleators.

Wagner et al., 2011 – in case the reviewer is referring to Wolfgang Wagner, Stephan D. Brenowitz, and John A. Hammer, III 2011 Nat. Cell Biol. – is a great paper but is dealing with mammalian Myosin-Va motor protein-driven transport of endoplasmic reticulum into spines in Purkinje cells and we failed to see the connection to actin nucleation. Sundararajan 2019, in case the reviewer referred to the PLoS Genetic paper, studies a set of mutants affecting actin filament dynamics in PVD neurons of C. elegans but to which extent and by which mechanisms these may or may not directly cooperate with each other remained somewhat unclear to us.

In general, we hope that the quite extensive and broad literature we report and cite highlights that there may be much more complexity and coordination of different players leading to the formation of actin filaments than we currently think and that this topic is an exciting field of contemporary research.

– All figures and images throughout this manuscript should be recolored to avoid red/green for comparison to allow to allow for interpretation by color blind individuals.

Taken care of.

– In several instances throughout the manuscript the authors refer to "highly significant" results based on statistical analyses. For accuracy and clarity, the authors should refer to results as "significant" or "not significant" as the statical tests used do not indicate more than this.

The word “highly” has been deleted from the revised manuscript, as the reviewer requested. However, the reviewer may acknowledge that a probability of error of almost 5% (P<0.05; *) clearly is less trustworthy than a probability of error of 0.1% (P<0.001; ***) or even 0.01% (P<0.0001; ****), as in our data. Thus, a finding never is just statistically significant or not (convention P<0.05) but the levels of statistical significance also need to be mentioned.

– For the ease of the reader the N values for each analysis should be listed in each figure legend rather than the methods section.

We would like to refer the reviewers to the fact that the n numbers for all of our quantitative evaluations were not only described in full detail in our Material and Method section but also reported directly in the figures.

If for editorial/journal style reasons indeed considered necessary, we shall be happy to repeat this information in all the figure legends yet again.

– More discussion on the role of various actin nucleation factors in neuronal development could benefit uninitiated readers. What are the contributions of Arp2/3, formins, spire? For example, a preprint (Bradley et al. 2019) suggests the formin Capu and spire cooperate to stimulate actin nucleation from both (barbed and pointed) ends of actin filaments.

This certainly is a research question that is not completely answered, as there are several cell biological processes in developing neurons that seem to be powered by actin filament formation and the list of actin filament formation-promoting factors discovered is still growing. As the topic is rather broad and in part also still in its infancy, we have not extensively covered this aspect but just wrote some introductory words about this and besides this rather focused on further hints on crosstalk between different actin nucleators in general to relate our work to observations made for other actin nucleators in different cell systems. We hope the reviewer is content with this solution.

– The images of hippocampal neurons shown in each of the figures are gorgeous!

We thank the reviewer for his/her appreciation of the beauty of nature.

– Additional quantitative analysis of co localization could strengthen the localization argument presented in Figure 1H.

As the distributions of both components previously shown in Figure 1H (now revised Figure 1A) are actually relatively continuously, quantitative analyses are not so easy, as e.g. calculating Pearson's correlation coefficients for example tests the coincidence of the occurrence or absence of two signals at one spot but not levels of coaccumulation. In the other figures we have added additional line scans of fluorescence signal intensity to provide quantitative access to correlating or not correlating peaks of signal intensities. Here, the best one can do to highlight the accumulation of both Cobl and Cobl-like at one spot is false-color heat map representations of signal intensities and marking of sites to show the perfect spatial fit.

We hope the reviewers will be content with the efforts made to visualize coaccumulations of the different proteins studied at particular sites within both COS-7 cells and primary hippocampal neurons.

– The interdependence of Cobl and Cobl-like could be more convincing at more timepoints than the single- 34 h one. Is the interdependence consistent on different days of neuronal development?

We have not addressed whether the interdependence of the two components would also be detectable at some other day of neuronal development, as we have little knowledge of the functions of Cobl or Cobl-like at other stages of development – let alone about any putative functional crosstalk to each other, to syndapin I, to Abp1, to PRMT2, to CaM or to some other components still to be identified. Thus, although this is an interesting question, due to this lack of basic knowledge, addressing any putative crosstalk would not represent a research question addressable in a sound manner at this stage.

– A direct binding event doesn't mediate the interdependent morphological phenotype. Thus, the authors explore whether Syndapin proteins are responsible for linking Cobl and Cobl-like from previous observations demonstrating a direct relationship between Syndapin I and Cobl at the plasma membrane. Could other proteins particularly spire or formin proteins also mediate connections between Cobl and Cobl-like?

In theory of course, yes. However, thus far we have no evidence that any spire or formin protein associates with Cobl or Cobl-like, although we are of course actively searching for further components interacting with Cobl and Cobl-like to better understand by which molecular mechanisms and accessory components they execute their cell biological functions.

– Lines 106-107: I think the authors mean to say "all were statistically significant compared to neurons cotransfected…"

The sentence has been changed in the revised manuscript. It should now be correct and easier to understand.

– Line 150 "artifacts" is misspelled.

We thank the reviewer for noticing this. The British spelling of the word has been changed to the American spelling in the revised manuscript.

– Line 226 there is no "highly significant" result in statistics, it is either significant or not based on the p-value cut off used. Please reword accordingly.

The word “highly” has been deleted in the revised manuscript, as the reviewer requested. However, the reviewer may acknowledge that a probability of error of almost 5% (P<0.05; *) clearly is less trustworthy than a probability of error of merely 0.1% (P<0.001; ***) or even 0.01% (P<0.0001; ****), as in our data. Thus, a finding never is just statistically significant or not (convention P<0.05) but the levels of statistical significance also need to be described and considered.

– Define KO on line 381.

Done.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 1—source data 1. Raw data and numerical data graphically presented in Figure 1G–I.
    Figure 1—source data 2. Raw data and numerical data graphically presented in Figure 1N–P.
    Figure 1—figure supplement 2—source data 1. Raw data and numerical data graphically presented in Figure 1—figure supplement 2 A-D.
    Figure 1—figure supplement 2—source data 2. Raw data and numerical data graphically presented in Figure 1—figure supplement 2E-G.
    Figure 3—source data 1. Raw data and numerical data graphically presented in Figure 3D–F.
    Figure 3—source data 2. Raw data and numerical data graphically presented in Figure 3G.
    Figure 5—source data 1. Raw data and numerical data graphically presented in Figure 5C,D.
    Figure 6—source data 1. Raw data and numerical data graphically presented in Figure 6B–D.
    Figure 7—source data 1. Raw data and numerical data graphically presented in Figure 7E.
    Figure 8—source data 1. Raw data and numerical data graphically presented in Figure 8D–F.
    Figure 8—source data 2. Raw data and numerical data graphically presented in Figure 8G.
    Figure 9—source data 1. Raw data and numerical data graphically presented in Figure 9D.
    Figure 9—source data 2. Raw data and numerical data graphically presented in Figure 9F.
    Figure 9—source data 3. Raw data and numerical data graphically presented in Figure 9I.
    Figure 9—source data 4. Raw data and numerical data graphically presented in Figure 9J–L.
    Transparent reporting form

    Data Availability Statement

    All data generated or analysed during this study are included in the manuscript and supporting files. Source data files have been provided and cover all quantitative data shown in the figures and their supplements.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES