RSV infection potentiates TRPV₁-mediated calcium transport in bronchial epithelium of asthmatic children

Abstract

The transient receptor potential vanilloid 1 (TRPV₁) channel is expressed in human bronchial epithelium (HBE), where it transduces Ca²⁺ in response to airborne irritants. TRPV₁ activation results in bronchoconstriction, cough, and mucus production, and may therefore contribute to the pathophysiology of obstructive airway disease. Since children with asthma face the greatest risk of developing virus-induced airway obstruction, we hypothesized that changes in TRPV₁ expression, localization, and function in the airway epithelium may play a role in bronchiolitis and asthma in childhood. We sought to measure TRPV₁ protein expression, localization, and function in HBE cells from children with versus without asthma, both at baseline and after RSV infection. We determined changes in TRPV₁ protein expression, subcellular localization, and function both at baseline and after RSV infection in primary HBE cells from normal children and children with asthma. Basal TRPV₁ protein expression was higher in HBE from children with versus without asthma and primarily localized to plasma membranes (PMs). During RSV infection, TRPV₁ protein increased more in the PM of asthmatic HBE as compared with nonasthmatic cells. TRPV₁-mediated increase in intracellular Ca²⁺ was greater in RSV-infected asthmatic cells, but this increase was attenuated when extracellular Ca²⁺ was removed. Nerve growth factor (NGF) recapitulated the effect of RSV on TRPV₁ activation in HBE cells. Our data suggest that children with asthma have intrinsically hyperreactive airways due in part to higher TRPV₁-mediated Ca²⁺ influx across epithelial membranes, and this abnormality is further exacerbated by NGF overexpression during RSV infection driving additional Ca²⁺ from intracellular stores.

INTRODUCTION

The transient receptor potential vanilloid subtype 1 (TRPV₁) channel belongs to a family of proteins originally characterized in neuronal cells as Ca²⁺-permeable, nonselective cation channels that sense physical and chemical stimuli such as noxious heat (>43°C), pH (<6.5 at 37°C), and vanilloid compounds like capsaicin (1). In dorsal root ganglia, TRPV₁ activity is primarily modulated by the nerve growth factor (NGF), which controls its synthesis and translocation to the axonal plasma membrane (2–4).

Recent studies have demonstrated TRPV₁ expression in nonneuronal cells (5–9). In particular, TRPV₁ has been shown to be expressed and functional in adult human bronchial epithelial (HBE) cells (10), and to play a role in airway disease through increased mucus production by epithelial cells (11), stimulation of the cough reflex by neuronal cells (12), and smooth muscle contraction (13). Furthermore, increased TRPV₁ expression has been shown by immunohistochemistry in HBE cells of bronchial biopsies from adults with severe asthma (14). Finally, a previous study from our group found that TRPV₁ function in HBE cells from children, but not from adults, increases in response to respiratory syncytial virus (RSV) infection (15).

RSV is the most prevalent respiratory pathogen causing lower respiratory tract infections (LRTI) in infants and young children (16, 17). Moreover, solid epidemiological evidence suggests that acute RSV LRTI in early life predisposes to chronic airway dysfunction throughout childhood (18). RSV preferentially infects HBE cells resulting in increased expression of NGF and its cognate receptor tropomyosin-related kinase A (TrkA) (19, 20). Signaling through the NGF/TrkA axis facilitates RSV replication by interfering with host cell apoptosis (20–22) and promoting autophagy (23), and has also been shown to contribute to airway hyperreactivity and inflammation by amplifying neuroimmune interactions (19).

Although children with asthma face the greatest risk of developing airway obstruction as a consequence of viral LRTI, the mechanisms whereby viruses induce airway obstruction has not been fully elucidated. Also, the mechanisms by which viral infections induce changes in TRPV₁ expression, localization, and function have never been studied, nor is it known if this channel is modulated by asthma predisposition. We hypothesized that, as a consequence of RSV infection, TRPV₁ expression, localization, and function in bronchial cells is altered and augments downstream Ca²⁺ influx across epithelial membranes, and these effects are amplified in children with asthma.

To test this hypothesis, we studied TRPV₁ expression, localization, and function in primary HBE cells from children with or without asthma. The goal of our study was to determine whether the observed changes in TRPV₁ expression, localization, and function are regulated by RSV and/or the asthma status of donors. Our findings provide new insights into the mechanisms underlying virus-induced bronchiolitis and asthma in pediatric patients, and may help develop precise pharmacological strategies with enhanced specificity and effectiveness. Some of the results of these studies have been reported previously in abstract form (24, 25).

METHODS

Cells

Primary HBE cells derived from White, Black, or Hispanic children with or without asthma of both sexes aged 1 day to 8 yr were obtained from Lonza (Walkersville, MD) or from the International Institute for the Advancement of Medicine (IIAM, Edison, NJ; Table 1). We chose to study this age group because several epidemiological studies have shown increased risk of postRSV wheezing until the age of 11 –13 yr, with subsequent decrease and resolution before adulthood. Cells were cultured as described previously and were used between the 2nd and 5th passage (15).

Table 1.

Sources of primary HBE cells used in this study

ID	Patient Code	Cause of Death (if provided)	Age	Sex	Race	Diagnosis	Notes	Source
1	11121X01	Anoxia	2 yr	F	B	Nonasthmatic		IIAM
2	357048	Not provided	4 yr	M	C	Nonasthmatic		Lonza
3	489938	Not provided	2 yr	F	B	Nonasthmatic		Lonza
4	441099	Not provided	3 yr	F	B	Nonasthmatic		Lonza
5	11121002	Head trauma	3 mo	M	B	Nonasthmatic		IIAM
6	ADIG208	Anoxia/asphyxia	1 mo	F	H	Nonasthmatic		IIAM
7	ADC3443	Motor vehicle accident	6 yr	M	B	Nonasthmatic		IIAM
8	451411	Not provided	2 yr	M	H	Nonasthmatic		Lonza
9	366559	Not provided	6 yr	M	B	Nonasthmatic		Lonza
10	ADHJ180	Head trauma	1 yr	M	C	Nonasthmatic		IIAM
11	ACH1200	Anencephaly	1 day	M	C	Nonasthmatic		IIAM
12	427214	Not provided	8 yr	F	H	Asthmatic		Lonza
13	228044	Not provided	2 yr	M	B	Asthmatic		Lonza
14	ADCQ492	Head trauma	4 yr	M	H	Asthmatic		IIAM
15	22121000	Head trauma	1 yr	M	B	Asthmatic	Inhaler used	IIAM

HBE, human bronchial epithelium.

Cell Isolation from Donor Lungs

Lungs or bronchi from deceased donors were received within 24 h of surgical removal and shipped on wet ice in DMEM containing antibiotics. The bronchus was isolated from the whole lung if not already dissected by the surgeon before shipment, then the connective tissue was removed. The dissected bronchus was rinsed with DMEM containing antibiotics and antimycotics, opened longitudinally, and then placed in protease solution containing 0.1% dispase (Sigma-Aldrich, St. Louis, MO) in DMEM and 1% antibiotics/antimycotics overnight at 4°C. Dispase was inactivated by addition of 1% FBS, then cells were scraped from the surface, pelleted, washed, and cultured on dishes coated with plate-coating medium (1% Vitrogen, 1% fibronectin, and 0.01% BSA in LHC basal medium).

Ethics Statement

Our study was based on primary human bronchial epithelial cells derived from anonymous patient donors and provided by the International Institute for the Advancement of Medicine (IIAM, Edison, NJ) according to procedures approved by the Cleveland Clinic. As such, this study was deemed exempt from requiring IRB approval.

Measurement of Intracellular Calcium

The calcium response to TRPV₁ channel stimulation with capsaicin was measured as described previously (15). The calcium response to TRPV₁ channel stimulation with capsaicin was measured using the Fluorogenic Imaging Plate Reader (FLIPR) assay (Molecular Devices, Sunnyvale, CA) in 80%–90% confluent HBE grown in black-walled, clear-bottom Costar 96-well plates. Cells were loaded with Calcium-6 dye for 3 h and incubated at 37°C/5%CO₂, according to manufacturer’s instructions. Plates were read in a Flexstation-3 reader, and fluorescence was measured over 3 min at 7-s intervals upon addition of ionomycin (0.5–1.0 µM in dimethyl sulfoxide; DMSO, Sigma-Aldrich, St. Louis, MO), capsaicin (150 µM in DMSO; Sigma-Aldrich), or vehicle. The ratio of maximum-minimum fluorescence/ionomycin fluorescence was used to calculate changes in intracellular Ca²⁺. For selected experiments measuring release of Ca²⁺ from intracellular stores, HBE were incubated overnight with medium from uninfected HEp-2 cells or with RSV, then loaded with Calcium-6 dye in Hanks’ balanced salt solution (HBSS) containing HEPES either with or without Ca²⁺ for 3 h.

All inhibitors were added during the last 30 min of incubation with Calcium-6 dye. An initial dose response of thapsigargin was performed where doses ranging from 0.01–5 µM was added then readings were taken at 10-s intervals over 15 min. At 15 min post thapsigargin application, intracellular calcium ([Ca²⁺]_i) levels returned to baseline levels after peaking within the first 2 min. Where ER calcium depletion was performed, thapsigargin was applied 15 min before capsaicin application. All samples were measured in quadruplicate and experiments were repeated for a minimum of three times.

Quantitative Real-Time PCR

Total RNA was isolated from the cells using the TRI Reagent (Sigma-Aldrich) following manufacturer’s instructions, and 500 ng of RNA was used in a 20-µL SuperScript III RT (Invitrogen, Carlsbad, CA) reverse transcription reaction. One microliter of this reaction was used for qPCR, with 0.4 µM each of primer and SsoAdvancedSYBR Green Supermix (Bio-Rad, Hercules, CA). Transcript expression was normalized using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the housekeeping gene. The relative change in gene expression was calculated using the following formula: % change = 2^−(ΔΔCq) = 2^{−[ΔCq (treated samples) − ΔCq (control samples)]}, where ΔCq = Cq (gene of interest) – Cq (GAPDH housekeeping gene) and Cq was the threshold number. Untreated was used to define 100% baseline for comparison purposes. Primer sequences are as follows: NGF forward 5′- TTCACCCCGTGTGCTGTTTA-3′ and reverse 5′- GAATTCGCCCCTGTGGAAGA-3′; TRPV₁ forward 5′- GCTGTCTTCATCATCCTGCTG CT-3' and reverse 5′- GTTCTTGCTCTCCTGTGCGATCTTGT-3′; GAPDH forward 5'-CTA TAAATTGAGCCCGCAGCC-3′ and reverse 5′- GCGCCCAATACGACCAAATC-3′.

Gene Silencing

Exponentially growing HBE cells were transfected with SMARTpool ON-TARGET Plus (GE Dharmacon, Lafayette, CO) small interfering (si)RNA directed against NGF (50 nM) using Lipofectamine 2000 (Life Technologies, Carlsbad, CA), or with ON-TARGET Plus nontargeting pool siRNAs (50 nM) according to manufacturer’s instructions. After 6 h of transfection, the medium was replaced with fresh culture medium. Cells were harvested 48 h later and analyzed for knockdown of mRNA expression by qPCR analysis.

Western Blot

HBE cells, 70%–80% confluent, were infected with rrRSV (MOI of 1) at times indicated. Cells were lysed in RIPA buffer containing 25 mM Tris·HCl (pH 7.6), 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS (Thermo Fisher Pierce) protease/phosphatase inhibitor cocktail (Thermo Fisher/Pierce), DNAse (Qiagen). Protein concentrations were determined using the BCA Protein assay reagent (Pierce). Equal amount of protein was separated by SDS-PAGE and transferred onto PVDF membrane (Thermo Scientific). Membranes were blocked in Tris-buffered saline (TBS)/T 5% bovine serum albumin or nonfat dry milk for 1 h at room temperature and probed with primary antibodies rabbit TRPV₁ (Alomone Labs, Jerusalem, Israel) and anti-NGF (Santa Cruz). Anti-β actin (Sigma-Aldrich) was used to ensure equal loading. Luminol (Pierce) generated signal was used to detect bands.

Reagents

Capsaicin and ionomycin were purchased from Sigma-Aldrich. Thapsigargin (TG) was purchased from Cayman Chemical (Ann Arbor, MI) and rhNGF from Alomone Labs (Jerusalem, Israel).

Virus Propagation

To easily verify active viral replication in cells, recombinant RSV strain A₂ expressing the red fluorescent protein (RFP) gene (rrRSV) was used, which was kindly provided by Dr. Mark Peeples (Nationwide Children’s Hospital, Columbus, OH) and Dr. Peter Collins (National Institutes of Health, Bethesda, MD). The rrRSV reporter gene provides direct evidence of viral replication because the transgene cannot be expressed unless the virus completes its replication cycle in the host cell cytosol (26). Thus, reporter gene expression manifested by the appearance of red fluorescence in the infected cells mirrors viral replication and can be used to monitor viral growth. The viral stock was propagated using HEp-2 cells grown at 37°C/5%CO₂ in Eagle’s minimum essential medium (MEM) supplemented with 10% fetal bovine serum (FBS) and 1% each of Glutamax, penicillin/streptomycin, and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES). Cells at ∼50% confluence were inoculated with 3 mL/dish of virus stock diluted 1/10 with heat-inactivated FBS. After incubation for 2 h at 37°C, the inoculum was removed and replaced with 25 mL of fresh medium. The medium was replaced again 2 days later, and the virus was harvested after 1 to 2 additional days of incubation, at which point all cells appeared bright red when viewed under a fluorescent microscope. To harvest the virus, infected cells were scraped from the plate, separated with a pipette, mixed at medium speed, and pelleted by centrifugation at 1,200 g for 5 min. The supernatant was collected and cell debris removed by centrifugation at 9,500 g for 20 min in a centrifuge refrigerated at 4°C. One-milliliter aliquots of the supernatant were snap-frozen in liquid nitrogen and stored at −70°C until use. The final titer was determined with a modified plaque-forming unit assay. Control experiments were performed using culture medium from uninfected HEp-2 cells after cell debris were removed by centrifugation at 9,500 g for 20 min in a centrifuge refrigerated at 4°C. One-milliliter aliquots of the supernatant were snap-frozen in liquid nitrogen and stored at −70°C until use.

Immunocytochemistry

To visualize cytosol TRPV₁ expression, HBE cells were fixed in 4% paraformaldehyde, permeabilized with 0.2% Triton X-100, and blocked with 3% BSA. Cells were then incubated with primary anti-TRPV₁ antibody followed by Alexa Fluor-conjugated secondary antibody (Molecular Probes, Carlsbad, CA). To visualize plasma membrane (PM)-associated TRPV₁, HBE cells were incubated with anti-TRPV₁ antibody (Abcam, Boston MA, Alomone Labs, Jerusalem Israel.) at 37°C/5%CO₂ for 15 min with or without WGA Alexa Fluor 594 (Molecular Probes, Carlsbad CA), then fixed in 4% PFA followed by Alexa Fluor-conjugated secondary antibody (Molecular Probes, Carlsbad, CA). Coverslips were mounted and sealed before imaging using Vectashield mounting medium with 4–6 diamidino-2-phenylindole (DAPI; Vector Labs, Burlingame, CA). Photomicrographs were taken using an upright fluorescent microscope for cytosol TRPV₁, or a confocal microscope for PM-associated TRPV₁ (Leica Microsystems, Wetzlar, Germany) with a 405-diode laser to excite DAPI and HeNe laser to excite the Alexa Fluor 488-labeled secondary antibody. Cells were visualized using a ×40 or ×63/1.4 oil objective. Intensity plot profiles were acquired using the ImageJ software (NIH, Bethesda, MD) to measure the intensity of signal per pixel across the length of the cell. A minimum of 15 cells were measured. Total intensity was calculated by averaging signal intensity in each cell. ER Staining Kit − Red Fluorescence Cytopainter (Abcam) for staining of ER was used in colocalization experiments. Pearson’s Correlation coefficient analysis was performed using Volocity image analysis (Quorum Technologies, Inc. v 6.5.1). A library of files was generated by importing the original Leica Imaging LIF files into the software. Then using the 8 bit red (ER) and green (TRPV₁) images, image sequences were generated to perform colocalization of the complete image (at ×40 magnification). Thresholding was done using area of image containing no cells set at background. A minimum of 5 images/condition/donor at ×40 magnification was analyzed.

Biotinylation and Immunoprecipitation of Plasma Membrane Proteins

HBE cells were washed twice with ice-cold PBS then incubated with sulfo-NHS-SS-biotin at 4°C with agitation. The reaction was stopped by adding the quenching solution provided with the kit (Abcam, Boston, MA). Cells were collected and washed in TBS before lysis in the buffer provided with the kit. Protein determination of the supernatant collected was performed using the BSA Protein Assay (Pierce Biotechnology, Rockford, IL), and an equal amount was incubated with streptavidin-coated beads for 60 min at room temperature with constant rotation. The beads were washed thrice in the buffer provided with the kit before elution of the labelled protein in 100 mM DTT in PBS. SDS/PAGE buffer was added to the samples and heated to 100°C for 5 min before separation on 7.5% polyacrylamide gel.

Statistical Analysis

All data are expressed as means ± SE. Comparisons between two groups were performed using the nonparametric Mann–Whitney U test. Comparisons among multiple groups were performed using the nonparametric, one-way Kruskal–Wallis test with Dunn’s multiple post hoc comparisons. Statistical analysis was performed with the software GraphPad Prism v 5.0 (La Jolla, CA). P values less than 0.05 were considered statistically significant. The box-plot graphs prepared with GraphPad Prism show whiskers down to the minimum and up to the maximum value.

RESULTS

Basal TRPV₁ Expression in Primary HBE Cells from Children

Our laboratory has previously shown that TRPV₁-dependent calcium influx increases in response to RSV infection in primary cultures of HBE cells derived from children’s lungs (15). In addition, TRPV₁ activation was greater in HBE cells from children with asthma in comparison with nonasthmatic controls. To understand the mechanisms responsible for these functional changes, we measured TRPV₁ expression at the gene and protein level. TRPV₁ mRNA (Fig. 1A) and protein (Fig. 1B) were significantly more abundant in HBE cells from children with asthma as compared with nonasthmatic controls (P < 0.05). Immunocytochemical analysis confirmed that TRPV₁ protein expression was higher in HBE cells from children with asthma as compared with nonasthmatic controls (P < 0.001; Fig. 1C). Functionally, TRPV₁ activation resulted in increased [Ca²⁺]_i, as evidenced by the movement of calcium ions across the plasma membrane and into the cytosol. We therefore investigated the subcellular distribution of TRPV₁ by immunocytochemistry. Again, under basal conditions the expression of TRPV₁ in the PM compartment was greater in HBE from children with asthma as compared with nonasthmatic controls (P < 0.001; Fig. 1D).

Figure 1.

TRPV₁ expression in HBE cells is greater in children with asthma versus without asthma. TRPV₁ mRNA from children without asthma (1, 2, 9) and with asthma (12–15) (A) and TRPV₁ protein expression in HBE cells from children without (1–3, 6, 9) and with asthma (12–15) (B) tested in two independent experiments. C: representative fluorescent micrographs of immunoreactive TRPV₁ (green) localization at baseline in permeabilized HBE cells from children without (2, 6–8, 10) and with asthma (12–14) (left). Bars show the means ± SE of densitometry measurements on a minimum of 15 cells/donor (right). D: TRPV₁ (green) abundance on plasma membranes (PMs) of nonpermeabilized HBE cells from children without (2–4, 8, 10) and with asthma (12, 13, 15). White arrowheads indicate the plasma membranes (left). Bars show the means ± SE of densitometry measurements on a minimum of 15 cells/donor (right). Data were analyzed using the nonparametric Mann–Whitney U test. #P < 0.05; ***P < 0.001; ###P < 0.001 compared with nonasthmatic controls. Scale bar = 20 µm. HBE, human bronchial epithelium; TRPV1, transient receptor potential vanilloid 1.

RSV-Mediated Changes in TRPV₁ Expression and Localization

To determine the response of HBE cells to RSV infection in children with asthma and without asthma, the cells were incubated with control medium from uninfected HEp-2 cells or with rrRSV at a multiplicity of infection of 1 (MOI = 1). The cells were then collected at different time points, and the lysates were immunoblotted to measure TRPV₁ expression. In preliminary experiments, TRPV₁ expression showed a biphasic response with peak induction at 6 h postinfection followed by a progressive decline over time (Fig. 2A), and based on these data we used 6 h as the time point for the rest of our experiments. TRPV₁ protein expression measured in response to RSV infection at 0, 3, and 6 h by Western blot (Fig. 2, B and C) and immunocytochemistry (Fig. 2, D and E) showed significantly higher expression in HBE cells from children with asthma as compared with nonasthmatic controls both with control medium (0-h time point) and in response to RSV infection (3 and 6 h time points). Next, we studied whether RSV infection modifies the relative distribution of TRPV₁ between cellular compartments depending on the asthma status of the donor using both confocal microscopy and cell surface biotinylation assays. HBE cells were infected with RSV (MOI = 1) for 0, 3, or 6 h and then tested for plasma membrane-associated TRPV₁ (TRPV_{1 PM}). RSV infection resulted in increased TRPV_{1 PM} in HBE cells from both children without and with asthma. However, TRPV_{1 PM} in asthmatic HBE cells was higher under basal conditions (albeit not significantly), and increased earlier (within 3 h post infection) and farther compared with HBE cells from nonasthmatic donors (Fig. 2, F–I).

Figure 2.

TRPV₁ expression in children’s HBE cells infected by RSV. HBE cells from children with and without asthma were infected with RSV (MOI = 1) and assessed for TRPV₁ expression at 0–24 h post infection from children without (2, 9) and with asthma (14, 15) (A) or 0, 3, and 6 h post infection from children without (2, 6, 7, 10) and with asthma (12–15) (B). TRPV₁ protein expression was measured by Western blot and normalized to actin. C: quantification of results from (A); n = 3 independent experiments. D: representative fluorescent micrographs of immunoreactive TRPV₁ (green) expression in permeabilized HBE cells from children without (2, 8, 10) and with asthma (12, 13) at 0, 3, and 6 h after infection with RSV (MOI = 1). E: quantification of results from C, showing densitometry measurements on a minimum of 15 cells/donor. F: TRPV₁ (green) expression in plasma membranes (PMs, red) of nonpermeabilized HBE of children without (2, 8, 10) and with asthma (12–14) at 0, 3, and 6 h post infection with RSV. White arrowheads indicate the plasma membranes. G: quantification of results from F showing TRPV_1PM calculated as the average of densitometric measurements on a minimum of 15 cells/donor. Scale bar = 20 µm. H: TRPV₁ expression in the biotinylated plasma membrane fraction of HBE cells from children without (2, 4, 7) and with asthma (12, 13, 15) incubated with sterile medium or RSV (MOI = 1) for 6 h. Cells were labeled with sulfo-NHS-biotin and purified with streptavidin. Input lysates are shown in the lower bands. I: quantification of the results from G normalized to flotillin. Data are expressed as means ± SE and were analyzed using the Kruskal–Wallis test with Dunn’s multiple comparisons. *P < 0.05, ***P < 0.001, ****P < 0.0001 compared with the 0-h time point; #P < 0.05, ##P < 0.01, ###P < 0.001 compared with nonasthmatic controls. HBE, human bronchial epithelium; MOI, multiplicity of infection; RSV, respiratory syncytial virus; TRPV1, transient receptor potential vanilloid 1.

Altered TRPV₁ Function in Response to RSV and Asthma Status

To determine the effects of TRPV₁ cellular localization on its ion channel function, HBE cells were assessed for [Ca²⁺]_i changes after stimulation with the selective TRPV₁ agonist capsaicin, in the presence or absence of extracellular calcium ([Ca²⁺]_ec). We have previously shown using pharmacological inhibition with capsazepine or siRNA-mediated gene knockdown, that RSV-mediated increase in TRPV₁ activation is greater in HBE cells from children with asthma as compared with nonasthmatic controls when the assay is performed in the presence of [Ca²⁺]_ec (19). Consistent with our previous findings, when TRPV₁ activity was measured in the presence of [Ca²⁺]_ec, HBE cells from children with asthma exhibited higher RSV-mediated increase in [Ca²⁺]_i at 6 h after infection as compared with the control cells from children without asthma (Fig. 3A, left). In contrast, when TRPV₁ activity was assessed in the absence of [Ca²⁺]_ec, the [Ca²⁺]_i increase noted in HBE cells from children with asthma upon RSV infection was reduced (Fig. 3A, right). These findings suggest that RSV-mediated increase in [Ca²⁺]_i in HBE cells from children with asthma results primarily from TRPV₁-dependent [Ca²⁺]_ec influx, whereas basal elevated [Ca²⁺]_i results primarily from internal stores. As TRPV₁ localization and TRPV₁-mediated release of Ca²⁺ from the endoplasmic reticulum (ER) has been demonstrated in sensory neurons (27, 28) and we saw an increase in [Ca²⁺]_i in response to capsaicin in HBE cells upon depletion of [Ca²⁺]_ec, this prompted an investigation into the source of increased [Ca²⁺]_i in asthmatic cells upon RSV infection. HBE cells were immunostained for TRPV₁ and costained with the red fluorescent ER marker CytoPainter (Abcam, Cambridge, MA) to determine if TRPV₁ is localized to the ER (TRPV_{1 ER}, Fig. 3B). HBE cells from both children with and without asthma confirmed TRPV₁ localization within the ER, with a greater fraction of TRPV₁ localized to the ER in HBE from children with asthma as compared with children without asthma (P < 0.05). After RSV infection (MOI = 1) for 6 h, both groups of HBE cells exhibited a reduction in TRPV_{1 ER} localization (Fig. 3C). To determine if the TRPV_{1 ER} was functional, HBE cells were treated with TG in order to deplete the ER of calcium. A dose-response curve of TG effect yielded an EC₅₀ value of ∼1.5 µM for ER calcium depletion, and this concentration was used for all subsequent experiments (Fig. 3D). Pretreatment with TG for 30 min before the addition of capsaicin abrogated the TRPV₁-mediated increase in [Ca²⁺]_i when assayed in the absence of [Ca²⁺]_ec regardless of RSV or asthma status (Fig. 3E), suggesting that ER-localized TRPV₁ channels contribute to or interact with TRPV_{1 PM} channels in response to capsaicin.

Figure 3.

Role of ER in TRPV₁-mediated [Ca²⁺]_i. HBE cells from either children without or with asthma were infected with sterile medium or RSV (MOI = 1) for 6 h before activation of TRPV₁ with vehicle (DMSO) or capsaicin (150 µM) in the presence (left) or in the absence (right) of [Ca²⁺]_ec (A). Calcium influx was measured using Calcium 6 dye after TRPV₁ activation by vehicle or capsaicin of nonasthmatic (2–4, 7, 10) or asthmatic (12, 13, 15) intact HBE cells. B: representative fluorescent micrographs of colocalization of TRPV₁ expression (green) with the ER (Cytopainter ER tracking Dye, red). Images shown are at ×100 magnification and insets are zoomed ×2. Scale bar = 15 µm in ×100 images; scale bar = 5 µm in the zoomed panels. C: Pearson’s correlation coefficient calculated for the colocalization of TRPV₁ with ER using Volocity. HBE cells from children without (2–4, 7, 10) and with asthma (12–15) were used in the analysis. D: HBE cells were treated with increasing amounts of TG and calcium levels were measured over 15 min. Calcium influx was measured using Calcium-6 dye after vehicle or TG in intact HBE cells (2, 15). The Softmax-Pro software was used to calculate EC₅₀ = 1.41 µM. Samples were run in triplicate. E: [Ca²⁺]_i in HBE cells stimulated in the absence of [Ca²⁺]_ec. HBE cells from children without (1–4, 7) and with asthma (12, 13, 15) were incubated with sterile medium or RSV (MOI = 1) for 6 h, then pretreated with vehicle or thapsigargin (TG, 1.5 µM) for 30 min before activation of TRPV₁ with capsaicin (150 µM). Data are expressed as means ± SE and were analyzed using the Kruskal–Wallis test with Dunn’s multiple comparisons. *P < 0.05, **P < 0.01, ***P < 0.001 compared with noninfected controls; #P < 0.05, ###P < 0.001 compared with nonasthmatic controls. All experiments were repeated ≥2 times in triplicate. [Ca²⁺]_i, intracellular calcium; ER, endoplasmic reticulum; HBE, human bronchial epithelium; MOI, multiplicity of infection; RSV, respiratory syncytial virus; TRPV1, transient receptor potential vanilloid 1.

Role of NGF in TRPV₁ Expression and Function

As NGF is known to be upregulated by RSV infection in HBE cells (29) and also controls TRPV₁ translocation to the PM in neuronal cells by binding its cognate TrkA receptor (3), we investigated the role of NGF in regulating TRPV₁ expression and function in HBE. To this end, the cells were infected with RSV (MOI = 1) and their lysates obtained at different time points were immunoblotted for NGF. Although RSV infection in HBE cells from nonasthmatic controls induced a time-dependent increase in NGF expression, NGF expression was significantly higher at baseline and remained higher upon RSV infection in HBE cells from children with asthma (Fig. 4, A and B). Next, we assessed NGF-mediated changes in capsaicin-induced Ca²⁺ influx. Although the administration of exogenous rhNGF (1 h before capsaicin) increased capsaicin-induced Ca²⁺ influx in both asthmatic HBE cells (P < 0.001, Fig. 4C) and nonasthmatic controls (P < 0.05), this effect was 3.5-fold larger in the asthmatic cells (P < 0.001). Silencing NGF expression with a specific siRNA (Fig. 4D) selectively abolished the effect of RSV infection on capsaicin-induced Ca²⁺ influx in asthmatic HBE cells, suggesting that NGF is both sufficient and necessary for the RSV-mediated increase of TRPV₁ function in the bronchial epithelium of children with asthma (P < 0.001; Fig. 4E).

Figure 4.

NGF effect on TRPV₁-mediated Ca²⁺ influx in children’s HBE. A: NGF protein expression measured by Western blot in primary HBE cells from children without (1, 2, 5, 11) and with asthma (12–15) infected with RSV (MOI = 1). B: quantification of results from A; n = 3 independent experiments. #P < 0.05, ##P < 0.01 non-asthmatic compared with asthmatic. C: [Ca²⁺]_i in primary HBE cells from children without (1, 2, 5, 11) and with asthma (12–15) after treatment with rhNGF (50 ng/mL) for 1 h before activation of TRPV₁ with capsaicin (150 µM); n = 3 independent experiments. D: primary HBE cells from children without asthma (1, 2) or with asthma (13, 15) were transiently transfected with nontargeting siRNA (NTsiRNA) or 50 nM of NGF-specific siRNA (NGFsiRNA) for 48 h, then infected with sterile medium or RSV (MOI = 1) for 12 h, and tested by qPCR for NGF mRNA expression normalized to GAPDH as the housekeeping gene. Data are expressed as means ± SE. *P < 0.05, **P < 0.01, ***P < 0.001. E: inhibition of [Ca²⁺]_i in primary HBE from children with asthma (12–15) transiently transfected with NGF-specific siRNA (NGFsiRNA, 50 nM) for 48 h, then incubated with RSV (MOI = 1) or sterile medium for 12 h before activation of TRPV₁ with capsaicin. Controls were transfected with nontargeting siRNA (NTsiRNA). All experiments were repeated ≥2 times in quadruplicate. Data are expressed as means ± SE and were analyzed using the Kruskal–Wallis test with Dunn’s multiple comparisons. *P < 0.05, ***P < 0.001 compared with untreated controls; ###P < 0.001 compared with controls treated with NTsiRNA. [Ca²⁺]_i, intracellular calcium; HBE, human bronchial epithelium; MOI, multiplicity of infection; NGF, nerve growth factor; qPCR, quantitative polymerase chain reaction; rhNGF, recombinant human nerve growth factor; RSV, respiratory syncytial virus; TRPV1, transient receptor potential vanilloid 1.

DISCUSSION

Our previous work revealed that the lower airway epithelium from patients with asthma displays increased capsaicin-mediated Ca²⁺ inflow compared with nonasthmatic controls, and that RSV infection leads to further significant increase in the effect of capsaicin in children but not in adults. Although capsaicin is a fairly selective ligand of the TRPV₁ Ca²⁺ channel, that initial study was unable to provide conclusive evidence of a direct effect of asthma predisposition and RSV on TRPV₁ expression and function because other calcium channels might have contributed to the increase in [Ca²⁺]_i. For example, TRPA₁ is activated upon rise in [Ca²⁺]_i, and therefore activation of TRPV₁ with consequent increase in [Ca²⁺]_i may in turn activate TRPA₁ leading to a greater effect. Our previous and present findings are important in that increased intracellular calcium in the airway epithelium has been shown to cause increased mucus production, disrupted barrier permeability, and increased bronchoconstriction—all of which are typical of the asthmatic phenotype—independently from the atopic diathesis that frequently underlies the pathophysiology of asthma in older children and adults.

Our current study took a deeper dive into the mechanisms underlying this different behavior of the asthmatic epithelium, demonstrating for the first time that the previously reported changes in Ca²⁺ permeability observed in HBE cells from children with asthma is due at least in part to intrinsically higher gene and protein expression of TRPV₁. More importantly, TRPV₁ expression also increases during infection with RSV—the most common lower respiratory tract pathogen in infants and young children—and the combined effect of underlying asthma predisposition and acute RSV infection synergistically increase Ca²⁺ entry into the bronchial epithelium. Another critical factor affecting TRPV₁ function is its localization within the cell, and specifically whether it is expressed on the PM or within the cytosol. We show in this study that RSV infection of HBE cells results in increased TRPV_{1 PM}, which is more pronounced in the cells derived from children with asthma compared with nonasthmatic controls and is critical for the RSV-mediated influx of [Ca²⁺]_ec. As previous studies suggested that stimulation of PM-bound TRPV₁ can induce epithelial cell apoptosis as well as the release of cytokines and tachykinins (10, 30), the observed TRPV_{1 PM} overexpression in RSV-infected HBE cells could indirectly drive cytokine-induced goblet cell metaplasia, smooth muscle cell hyperreactivity, and increased vascular permeability (14).

Under basal conditions, TRPV₁-mediated rise of [Ca²⁺]_i in HBE cells from children with asthma is due in part to the release of Ca²⁺ from ER stores, as demonstrated by the loss of signal upon ER depletion with TG. In contrast, the increase in [Ca²⁺]_i during RSV infection originates from the extracellular calcium pool, as demonstrated by loss of signal in the absence of [Ca²⁺]_ec. These data suggest that the inflammatory effects of RSV involve TRPV₁-mediated movement of Ca²⁺ from both extracellular and intracellular storage pools. Although previously shown in neuronal cells, our study is the first to suggest TRPV₁ is capable of mediating the release of calcium from the ER of primary bronchial epithelial cells. However, caution must be taken in considering these conclusions, as we did not assess the potential role of other ion transporters, such as the NCX transporter or the ORAI family of channels that could be activated upon depletion of ER calcium by TG.

Finally, this study demonstrates that TRPV₁ expression and translocation with consequent Ca²⁺ entry into the lower airway epithelium of children with asthma is modulated by signaling through the NGF/TrkA axis, and can be abolished by selective pharmacologic inhibition of the same pathway. NGF has been shown to contribute to airway inflammation and hyperreactivity in acute bronchiolitis and chronic asthma (29, 31, 32), and it was found to be elevated in the serum of patients with asthma and other inflammatory diseases of the lungs (33, 34). Importantly, NGF sensitizes nonadrenergic-noncholinergic neurons to capsaicin by increasing the expression and function of TRPV₁ channels (35), and several lines of evidence in this study suggest it may exert a similar effect on the lower airway epithelium: 1) TRPV₁ activity in children’s HBE is enhanced by the addition of rhNGF, and this effect is much stronger in asthmatic cells; 2) the effect of RSV on TRPV₁ activity is abolished by silencing NGF gene expression; and 3) rhNGF mimics the effects of RSV on TRPV₁ protein expression.

It is possible that other respiratory viruses might affect TRPV₁ differently from RSV. In particular, human rhinovirus (HRV) becomes the more common respiratory pathogen after the first years of life and is predominant in adults. Therefore, a head to head comparison between RSV and different strains of HRV is needed and will require a separate study. We also recognize that the present studies were performed in vitro, which may not fully recapitulate what occurs in vivo. Finally, the HBE cells used in these studies were derived from deidentified donors, for whom we had no access to medical history. This was necessary because the availability of diseased samples is very limited, donors are deceased, and families must be consented.

Conclusions

As illustrated in our schematic model (Fig. 5), the results of this study show for the first time that the lower airway epithelium from children with asthma displays elevated basal and RSV-induced TRPV₁ expression compared with nonasthmatic controls. This increase was measured both in total TRPV₁ and TRPV₁ localized to the plasma membrane. We have also shown that RSV-mediated increased TRPV₁ expression and activation is a consequence of increased NGF-TrkA signaling. Finally, we have shown that TRPV₁-mediated increase in [Ca²⁺]_i can originate from either the extracellular pool or intracellular stores depending on asthma status and RSV infection. We speculate the virus-induced increase in [Ca²⁺]_i mediated by TRPV₁ activation might contribute to the clinical manifestations of asthma, including increased synthesis and release of TH₂ cytokines, mucus overproduction, breakdown in barrier permeability, and increased bronchoconstriction in the context of endogenous TRPV₁ activators known to be present in the inflamed airways of asthmatics. The present data are timely and important because of the increased morbidity for RSV bronchiolitis and asthma among pediatric patients (36). In addition, this study can shed light into the limited efficacy of the currently available therapies (37). More importantly, pharmacological inhibition of the NGF-TrkA-TRPV1 axis may become in the future a novel strategy to limit the impact of RSV infections in both children with and without asthma.

Figure 5.

Modulation of TRPV₁-mediated Ca²⁺ influx in bronchial epithelium. RSV infection of nonasthmatic bronchial epithelial cells induces NGF synthesis. NGF binding to its high-affinity TrkA receptor starts a signaling cascade that leads to TRPV₁ expression and its translocation to the plasma membrane, where it can be stimulated by multiple physical or chemical irritants and initiate the inward transfer of Ca²⁺ from the extracellular compartment to the cytosol. In contrast, basal expression of NGF is already increased at baseline in bronchial epithelial cells from children with asthma, which results in more TRPV₁ channels expressed on the plasma membranes and lower threshold of activation. In addition, there is increased expression of intracellular TRPV₁ localized to the ER, where it can release Ca²⁺ from the intracellular storage sites into the cytosol and lead to higher cytosolic Ca²⁺ concentration at rest. During RSV infection there is a shift of Ca²⁺ influx from both intracellular stores and extracellular sources to predominantly extracellular sources. Increased intracellular calcium stimulates mucus production, bronchoconstriction, airway barrier permeability, and release of proinflammatory cytokines resulting in the clinical manifestations of airway obstruction in bronchiolitis and asthma. ER, endoplasmic reticulum; NGF, nerve growth factor; RSV, respiratory syncytial virus; TrkA, tropomyosin-related kinase A; TRPV1, transient receptor potential vanilloid 1.

GRANTS

This work was supported in part by National Institutes of Health National Heart, Lung, and Blood Institute (NHLBI) grants: NHLBI R01 HL-061007 (to G.P.); NHLBI R01 HL148057 (to F.R.); NHLBI R01 HL133721 and NHLBI R01 HL11972 (to M.A.O.); and NHLBI K08 HL133380 (to R.S.). Funding was also provided by the Cystic Fibrosis Foundation Grant PIEDIM16G0 (to G.P.).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

T.J.H., L.G., R.S., M.A.O., and G.P. conceived and designed research; T.J.H. performed experiments; T.J.H., M.A.O., and G.P. analyzed data; T.J.H., L.G., M.A.O., and G.P. interpreted results of experiments; T.J.H. prepared figures; T.J.H., M.A.O., and G.P. drafted manuscript; T.J.H., F.R., M.A.O., and G.P. edited and revised manuscript; T.J.H., L.G., F.R., R.S., M.A.O., and G.P. approved final version of manuscript.