Abstract
Simple Summary
Functional meat has become an important issue in the poultry industry because chicken meat is a rich source of carnosine. Additionally, carnosine synthesis is regulated by an ATP-grasp domain-containing protein 1 (CARNS1). However, no studies have elucidated the role of carnosine content and CARNS1 in Thai native and black-bone chicken. Thus, the aim of this study was to select and develop mating programs for functional meat in Thai chicken populations. Our results indicated that different breeds and ages of chickens have different amounts of carnosine and levels of CARNS1 expression. The carnosine content and CARNS1 expression decreased linearly as chicken age increased. Moreover, a moderate correlation was observed between carnosine content and CARNS1 expression levels. Therefore, the CARNS1 gene could be used to study marker assistant selection in the future.
Abstract
This study aimed to investigate the carnosine content and ATP-grasp domain-containing protein 1 (CARNS1) gene expression and their relationship with breast meat of Black Chinese (BC), KU-Phuparn (KP), Pradu Hang Dam (PD), and Black Chinese × Pradu Hang Dam (Sri Mok: SM) to aid in the selection and mating programs for developing functional meat in Thai chicken populations. The results show that the carnosine content in each breed and breed group varied from 428.08 to 553.93 mg/100 g, whereas the relative expression of CARNS1 ranged from 0.84 to 1.56. The BC and KP chicken breeds had a higher carnosine content (p < 0.01) and higher CARNS1 expression level (p < 0.05) than the SM and PD chicken breeds. The carnosine content and relative gene expression for each age ranged from 423.02 to 577.83 mg/100 g and 0.68 to 1.83, respectively. At 4 weeks of age, the carnosine content (p < 0.01) and gene expression (p < 0.05) were the highest. However, they decreased as chicken age increased further. The carnosine content and gene expression linearly decreased as chicken age increased (p < 0.01). The correlation coefficient between the level of gene expression and carnosine content was moderately positive. The results from this study showed that different breeds and ages of chickens have different amounts of carnosine, and CARNS1 could act as a biomarker to study marker-assisted selection to improve functional meat in the chicken population in Thailand.
Keywords: carnosine, CARNS1, gene expression, black-bone chicken, Thai native chicken
1. Introduction
Recently, functional meat has become an important issue in the poultry industry worldwide with the increase in consumer demand for high-quality, healthy poultry products. Generally, the skeletal muscles of vertebrate animals have numerous bioactive compounds, especially in chicken meat, which is considered a source of some important bioactive substances such as carnosine [1].
Carnosine is an abundant dipeptide in the skeletal muscle and brain of vertebrates which is synthesized from β-alanine and L-histidine by carnosine synthase [2]. It plays an important role in physiological functions such as pH buffering, anti-aging, anti-glycation, anti-inflammation, and antioxidation and has anti-fatigue and neurotransmitter functions [3,4]. Carnosine is used in medicinal applications for treating diseases such as diabetes, Alzheimer’s disease, aging, cancer, and other chronic diseases [5,6]. In addition, it is used in muscle rehabilitation for athletes and the elderly [7,8]. At present, poultry producers aim to increase the carnosine content in chicken meat to meet the consumer demands for healthy food. Several studies have reported that approaches for the development of high nutrient meat such as the supplementation of precursors in the synthesis of carnosine in the feed [9,10] and using breeding programs can be implemented to improve genes related to bioactive compounds [1]. Selection programs have been employed to develop native chicken breeds in numerous Asian countries because the meat quality of the native chicken was popular with consumers and some bioactive substances were higher than those in broiler chickens [11,12].
Recently, several studies reported that the carnosine content in chicken breast meat ranged from 130.00 to 798.30 mg/100 g [1,11]. The variations in the amount of carnosine in chicken breast meat differ based on the breed, sex, and age [13,14,15]. Previous studies on broiler breast muscle found that the carnosine synthase 1 (CARNS1) gene, also known as ATP-grasp domain-containing protein 1 (ATPGD1) gene, is involved in the synthesis of carnosine using ATP [2]. No studies have investigated the expression of CARNS1 in chicken breast muscles. Thailand is considered a genetically diverse source of chickens among Asian countries. Currently, researchers have attempted to extract benefits from native chickens in the country by producing functional meat to meet the increase in consumers’ demand around the world by focusing on the development of Thai native and black-bone chicken breeds that contain high bioactive substances.
However, no study has focused on the carnosine content and the expression of CARNS1 with respect to carnosine syntheses in Thai native and black-bone chicken breeds in Thailand. Thus, the objective of this study was to assess the carnosine content, CARNS1 expression, and their relationship with breast meat of two black-bone chicken breeds (Black Chinese and KU-Phuparn), one Thai native chicken breed (Pradu Hang Dam), and one crossbred group (Black Chinese × Pradu Hang Dam, or Sri Mok) to aid in the selection and in mating programs for developing functional meat from Thai chicken populations.
2. Materials and Methods
2.1. Animal Management
This study was approved by the ethics committee of Khon Kaen University (Approval no. IACUC-KKU-35/62). Four genotypes of chicken were evaluated in this study, including the two black-bone chicken breeds (Black Chinese: BC and KU-Phuparn: KP), one native chicken breed (Pradu Hang Dam: PD), and one crossbred group (Black Chinese × Pradu Hang Dam or Sri Mok: SM). One hundred chickens per breed or breed group were used in this study. The housing was an open-air system under typical conditions of Thailand. There were four pens per breed or breed group and 25 chickens per pen (day-old mixed sex). The chickens were fed ad libitum with commercial diets formulated for the native chicken: first period 21% CP, 3200 kcal metabolizable energy (ME)/kg (0–4 weeks), and second period 18% CP, 3200 kcal ME/kg (4–16 weeks) (Table 1).
Table 1.
Commercial diets formulated for the native chicken.
| Details | First Period (0–4 Weeks) | Second Period (4–16 Weeks) |
|---|---|---|
| Crude protein (CP) (%) | 21 | 18 |
| Metabolizable energy (ME) (kcal/kg) | 3200 | 3200 |
| Crude fat (%) | 3 | 2 |
| Crude fiber (%) | 6 | 7 |
| Moisture (%) | 13 | 13 |
2.2. Tissue Collection
Sixteen chickens (8 male and 8 female chickens) of each breed/or breed group were randomly selected and slaughtered at 4, 8, 12, and 16 weeks of age; thus, a total of 64 samples per breed were used. The breast muscle samples were immediately collected and stored at −80 °C until further laboratory processing and analysis.
2.3. Carnosine Extraction and Purification
Extraction and purification were performed using the method described in [14] and [16] with slight modifications. Minced breast meat samples (2.5 g) were homogenized in 10 mL deionized distilled water using a WiseTis HG-15 D homogenizer (Wisd, Witeg, Wertheim, Germany) at 25,000 rpm for 1 min in a 15 mL polyethylene tube and centrifuged at 9989× g for 5 min at 4 °C. The supernatant was collected and incubated at 80 °C for 10 min in a temperature-controlled water bath, followed by centrifugation at 9989× g for 5 min at 4 °C. Then, 1 mL supernatant was filtered through a nylon syringe filter (0.45 µm, Whatman, Maidstone, UK) into a vial tube of 1.5 mL and stored at −20 °C for HPLC analysis.
2.4. HPLC Analysis
An Agilent 1260 Infinity High Performance Autosampler (Agilent Technologies Deutschland GmbH, Waldbronn, Germany), a ZORBAX Eclipse Plus C18 column (4.6 × 150 mm, 5 µm; Agilent, Santa Clara, CA, USA), and a diode array detector (Agilent, Santa Clara, CA, USA) were used for HPLC analysis. Twenty microliters of the extracted solution were injected into the HPLC column with 0.05 M K2HPO4 as a mobile phase at a flow rate of 0.8 mL/min. The detection was conducted at 211 nm. The content of compounds was calculated using the standard curve for L-carnosine (r2 = 0.99) obtained from Sigma-Aldrich Co. (St. Louis, MO, USA).
2.5. RNA Extraction
Total RNA was extracted from frozen breast muscle tissue (200 mg) samples. Eight breast muscle tissue samples (from 4 male and 4 female chickens) were randomly selected from each breed or breed group at 4, 8, 12, and 16 weeks of age using the GeneJET RNA Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s instructions. The RNA purification and concentration were verified using a spectrophotometer (NanoDrop™ 2000/2000c, Thermo Fisher Scientific, Waltham, MA, USA) where absorbance was measured at 260 and 280 nm. The extracted RNA concentration was at least 100 ng/μL. High-quality RNA should have an A260/A280 ratio greater than 1.9, indicating that the RNA is high purity.
2.6. Quantification of mRNA Expression
The one-step quantitative reverse transcription PCR (qRT-PCR) technique was used to measure gene expression level using Bio-Rad CFX96 Touch Real-Time PCR Systems (Bio-Rad, Hercules, CA, USA). The reaction was performed in a volume of 20 μL containing 10 µL of 2× SensiFAST™ SYBR® No-ROX One-Step Mix (Bioline, Taunton, MA, USA), 1 µL (400 nM) of each primer, 0.2 µL reverse transcriptase, 0.4 µL RiboSafe RNase inhibitor, 3.4 µL DEPC-treated water, and 4 µL (20 ng/µL) RNA template. The cycling condition consisted of a cDNA synthesis step at 50 °C for 10 min, a polymerase activation step at 95 °C for 5 min, and then PCR cycling for 40 cycles of 95 °C for 10 s, 58 °C for 25 or 30 s. Melting curves were generated at 65 °C to 95 °C. Each sample was analyzed in duplicate. The relative amount of mRNA expression was expressed as quantification cycle (Cq) values obtained by quantitative real-time PCR (qPCR) analysis and were normalized to the corresponding values of the housekeeping genes (18 S rRNA). The relative gene expression value was calculated using the 2−ΔΔCT method [17] and used the PD breed as the control. Gene-specific primers were designed using Primer-BLAST NCBI, and the primer sequences are described in Table 2.
Table 2.
Gene and primer sequences used for qRT-PCR.
| Gene | Primer Sequence (5′--> 3′) | Chr | GeneBankID | Product (bp) |
|---|---|---|---|---|
| CARNS1 | F: TGCCCTGGAAGAATTTGTGC | 5 | NM_001172593.1 | 170 |
| R: ACAGCAACCAGCGAGAGAG | ||||
| 18 S rRNA | F: CGGCGACGACCCATTCGAAC | 16 | XR_003078044.1 | 99 |
| R: GAATCGAACCCTGATTCCCCGTC |
2.7. Statistical Analysis
Carnosine content and the relative gene expression values (2−ΔΔCT) were analyzed using the generalized linear model to investigate the effects of breed, age, sex, and all interactions. The impact of age on the gene expression was analyzed by evaluation using orthogonal polynomials, and the correlation between carnosine content and relative gene expression value was analyzed using Pearson correlation (SAS V.9.4, SAS Institute, Cary, NC, USA).
3. Results
3.1. Carnosine Content in Breast Meat
In this study, the carnosine contents of breast meat analyzed by HPLC (Figure 1) varied from 352.9 to 637.2 mg/100 g (Table 3). All possible interactions among breed, sex, and age did not significantly affect the carnosine content in chicken breast meat (p > 0.05). The main factors evaluated in this study showed that the influence of breed and age significantly affected the carnosine content (p < 0.001) (Table 3). BC and KP did not differ in terms of the carnosine content; however, their carnosine contents were higher than those of SM and PD (p < 0.001). Meanwhile, SM and PD were not different in terms of the carnosine content. Additionally, we studied the effect of age on the carnosine content. At 4 and 8 weeks of age, a higher carnosine content was observed when compared to that at 12 and 16 weeks of age. The carnosine content response decreased as age increased; that is, a negative linearity was observed between carnosine content and age (p < 0.0001) (Figure 2).
Figure 1.
HPLC chromatogram of carnosine extracted from breast muscle samples.
Table 3.
Carnosine content (mg/100 g) (Mean ± SD) of breast meat from Pradu Hang Dam (PD), Sri Mok (SM), Black-Chinese (BC), and KU-Phuparn (KP) chickens at different ages and sexes of chickens.
| Breeds | Sexes | Ages (Weeks) | AVG (B) 1 | SEM | Effect 2 | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| 4 | 8 | 12 | 16 | B | A | S | Intac | ||||
| PD | M | 505.5 ± 140.7 | 490.5 ± 83.6 | 336.4 ± 87.2 | 373.0 ± 85.3 | 428.08 ± 126.9 y | |||||
| F | 510.7 ± 51.6 | 489.8 ± 102.4 | 369.5 ± 156.4 | 349.1 ± 134.1 | |||||||
| SM | M | 537.9 ± 91.4 | 521.0 ± 87.9 | 400.5 ± 135.3 | 401.9 ± 69.4 | 458.82 ± 124.2 y | |||||
| F | 531.5 ± 138.6 | 511.7 ± 117.1 | 375.3 ± 108.0 | 390.6 ± 115.0 | |||||||
| BC | M | 638.6 ± 119.3 | 593.0 ± 104.3 | 506.1 ± 131.8 | 480.2 ± 136.2 | 553.93 ± 139.8 x | |||||
| F | 635.6 ± 94.1 | 594.8 ± 119.5 | 501.5 ± 119.7 | 481.3 ± 159.1 | |||||||
| KP | M | 626.7 ± 75.3 | 592.7 ± 73.9 | 491.4 ± 153.9 | 443.6 ± 126.7 | 546.98 ± 129.5 x | |||||
| F | 635.6 ± 124.6 | 593.4 ± 152.2 | 527.7 ± 83.8 | 464.5 ± 96.4 | |||||||
| AVG (A) 1 | 577.8 ± 117.5 a | 548.4 ± 111.6 a | 438.6 ± 137.5 b | 423.0 ± 121.7 b | 15.8 | ||||||
| SEM | 15.8 | ||||||||||
| p-value | *** | *** | ns | ns | |||||||
1 AVG (B) = Mean ± SD of breed and breed group; AVG (B) = Mean ± SD of ages; SEM = standard error of mean. 2 P = effect of pen, B = breed or breed group, A = age, S = sex, Intac = All levels of interaction (P × B, …, P × B × A × S), ns = not significant differences; *** p < 0.001. a,b Means within a column lacking a common superscript differ (p < 0.01); x,y Means within a row lacking a common superscript differ (p < 0.01).
Figure 2.
Trends of carnosine content with increasing age. PD = Pradu Hang Dam breed (Thai native chicken); SM = Sri Mok crossbred (crossbred between BC and PD); BC = Black-Chinese breed (black-bone chicken); KP = KU-Phuparn breed (black-bone chicken). A significant negative linearity was observed in this study (p < 0.0001).
Mobile phase: 0.05 M K2HPO4; flow rate: 0.8 mL/min; detection: UV absorbance at 211 nm.
3.2. Expression Level of CARNS1
In the present study, we evaluated the expression of CARNS1 in chicken breast meat. The relative expression level of CARNS1 for carnosine content for the different ages is shown in Figure 3. At 4 and 8 weeks of age, BC had the greatest gene expression level, but it did not differ from that of KP. The gene expression levels of both BC and KP were higher than those of PD and SM. In contrast, at 8 weeks of age, SM was not different from KP. At 12 weeks of age, KP had a higher gene expression level than PD and SM; however, it did not differ from that of BC. At 16 weeks of age, the gene expression level of BC was higher than that of PD, but not different from those of KP and SM. At all weeks of age, PD had the lowest gene expression level, but it did not differ from that of SM. Additionally, the gene expression had a negative linear relationship with increasing age (p < 0.0001) (Figure 4).
Figure 3.
Gene expression level of CARNS1 in breast meat from Pradu Hang Dam (PD), Sri Mok (SM), Black-Chinese (BC), and KU-Phuparn breeds (KP). a,b,c Means within a column lacking a common superscript differ (p < 0.01).
Figure 4.
Trend of expression level of CARNS1 with increasing age. PD = Pradu Hang Dam breed (Thai native chicken); SM = Sri Mok breed (crossbred between BC and PD); BC = Black-Chinese breed (black-bone chicken); KP = KU-Phuparn breed (black-bone chicken). A significant negative linearity was observed in this study (p < 0.0001).
3.3. Correlation between Gene Expression Level and Carnosine Content
The results of the correlation analysis show that the expression level of CARNS1 significantly affected the variability of carnosine content in breast muscle of all chicken breeds used in this study (p < 0.01), and the correlation coefficient showed a moderate to high correlation ranging from 0.48 to 0.90 (Figure 5). The expression level of CARNS1 can explain 48% to 90% of the variance in the carnosine content. Additionally, the correlation coefficient value had a decreasing trend with increasing age.
Figure 5.
Correlation between carnosine content and expression level of CARNS1. PD = Pradu Hang Dam breed (Thai native chicken); SM = Sri Mok breed (crossbred between BC and PD); BC = Black-Chinese breed (black-bone chicken); KP = KU-Phuparn breed (black-bone chicken); 4 WK = 4 weeks of age; 8 WK = 8 weeks of age; 12 WK = 12 weeks of age; 16 WK = 16 weeks of age; r = correlation coefficient: * p < 0.05, ** p < 0.01.
4. Discussion
In this study, we observed higher levels of carnosine content than those observed in previous studies in commercial Korean native chicken [18], 5 lines of Korean native chicken [1], black-bone Silky fowl [14], and broiler chicken [11]. However, the content was lower than that reported in Thai indigenous and hybrid native chickens [13] and Silky fowl [11]. Therefore, this implied that variations in the amount of carnosine may be caused by different genetic backgrounds, which may be a key determinant.
Previously, several studies reported that the carnosine content was affected by breed, sex, and age (13–15). The authors of [11] studied the effects of chicken breed on carnosine content and reported that the Silky fowl—a member of the black-bone chicken—had a higher amount of carnosine when compared to the Japanese native chicken and broiler. In [14], the amount of carnosine in muscle was compared between Silky fowl and White Plymouth Rock; the authors reported that Silky fowl had a higher carnosine content by approximately 2.2-fold than White Plymouth Rock. The results of this study corresponded with those of previous studies, confirming that the black-bone chicken (BC and KP chicken breeds) had higher carnosine content than other breeds used in this study which were raised under the same conditions. Therefore, the breed affected the carnosine content in each chicken breed because of the internal factors involved such as enzymes and transporters in the carnosine synthesis pathway such as carnosine synthase (CARNS), carnosinase-2 (CNDP2), beta-alanine transaminase (ABAT), histidine decarboxylase (HDC), the beta-alanine transporters (TauT ATB0 + and PAT1), and the carnosine or histidine transporters (PEPT1, PEPT2, PHT1 and PHT2) [19] and the composition of muscle fiber types [20]. In [21], the authors reported that type II muscle fiber contains more carnosine than muscle fiber type I. Therefore, further studies are required to elucidate the different biological basis related to carnosine content among the chicken breeds.
Additionally, we showed that increased age affected the carnosine content. Our results were in agreement with [5], who reported that the amounts of carnosine in chicken meat decreased as age increased. Previous studies demonstrated the effects of age on the carnosine content in skeletal muscles. In [20], the authors reported that carnosine content decreased when age increased because of a reduction in the proportion of type II muscle fiber in chicken muscle. Moreover, in [22], the authors observed a strong positive correlation between carnosine content and the type II muscle fiber fraction in human muscle. However, the proportion of muscle fiber type depends on the activities of each age of chicken such as fighting, flying, and feed searching and survival behaviors. These activities increase physical activity, leading to the proliferation of blood capillaries to supply oxygen to muscle fibers, which changes the glycolytic muscle fibers to oxidative muscle fibers, resulting in a change in the muscle fiber type [20,23]. This may be one reason that explains the decline in carnosine levels with increasing age; however, the exact reason remains unclear. As the organisms mature, numerous metabolic changes become involved.
The effect of sex on the carnosine content in this study agreed with the results of [24], in which it was reported that there was no significant effect of sex on the carnosine content in Korean native chicken meat. Additionally, a previous study reported the same result in a bovine sample [25]. In contrast, Ref. [13] showed that sex had a significant effect on the carnosine content in Thai indigenous and hybrid native chickens and was consistent with the results of [1], who reported that the carnosine content in females was higher than that in males in five lines of the Korean native chicken. Therefore, these results suggest that the effect of sex on the carnosine content in animal skeletal muscle may differ depending on the strain and species.
The varying gene expression in chicken breeds from this study may be due to the diverse genetic background. Additionally, the increased age affected the expression levels of the CARNS1 gene. This result demonstrated that this gene played an important function in the early stage of development in chicken muscle. Currently, several studies have reported that age-related gene expression levels are important for the survival of organisms. In [26], it was reported that as the cells of an organism age, a process of homeostasis controls the concentration of reactive oxygen species (ROS) and other metabolites involving numerous metabolic pathways, and these processes are specific to species and tissue, which leads to changes in the gene expression in the regulatory network, which vary with age. Additionally, [27] reported that genetic changes occurring during aging affect an organism’s survival such as DNA damage and telomere shortening, resulting in the alteration of gene expression. Furthermore, [28] reported that epigenetic modifications are regulated by the metabolism process and play a key role in the aging process, thus leading to a difference in gene expression levels during the cell cycle. Numerous aging variables are associated with gene expression levels. However, there is no evidence of age-related expression level of CARNS1 in chickens. Therefore, further studies are required to investigate the cause of the phenomenon. In addition, no study has reported the relationship between sex and CARNS1 expression in chickens and other species. Therefore, the result of CARNS1 expression levels obtained in this study was consistent with the carnosine content level in breast muscle not being different between males and females in the population of chickens used in this study.
Currently, Ref. [29] reported that in a general organism, the concentrations of proteins correlated with the mRNA level were approximately 40%, and the variation in the protein levels in the cell cannot be explained by mRNA levels only. The carnosine synthesis and content in muscle involves many factors including enzymes and protein transporters that are regulated by many genes [19]; in addition, the beta-alanine concentration in the body leads to variations in the mRNA level of the carnosine-synthesis gene [10]. Additionally, gene expression involves the activity rate of cellular processes including transcription, mRNA degradation, and translation, and the protein level depends on the translation and protein degradation rate [30]. Moreover, Ref. [31] reported that the varying ratio of muscle fiber types might influence the variation in the gene expression associated with carnosine synthesis. At present, no study has focused on the correlation of mRNA levels of CARNS1 and carnosine content in chickens and other species.
5. Conclusions
This study showed that breed and age had significant effects on the levels of carnosine content (p < 0.01) and CARNS1 gene expression (p < 0.01). BC and KP breeds, which are a group of black-bone chicken breeds, can be considered a superior source of carnosine when compared to SM and PD breeds. In addition, the correlation between carnosine content and CARNS1 gene expression levels decreased as age increased with a negative linearity. Furthermore, CARNS1 gene expression was significantly correlated with carnosine content with a moderate to high positive correlation (p < 0.01). Therefore, the carnosine content could be possibly employed as an economic trait in the breeding plan, and CARNS1 could be used as a gene marker to study marker-assisted selection to improve functional meat quality of the chicken population in Thailand.
Acknowledgments
We wish to thank the Network Center for Animal Breeding and Omics Research, Faculty of Agricultural, Khon Kaen University (KKU) for providing the animals and material through the Food and Functional Food Research Cluster of Khon Kaen University.
Author Contributions
Conceptualization, P.K. and M.D.; methodology and analysis, P.K., M.D., Y.P.; writing—original draft preparation, P.K. and M.D.; writing—review and editing, P.K. and M.D.; supervision, M.D.; funding acquisition, M.D. All authors have read and agreed to the published version of the manuscript.
Funding
This research was financially supported by the Royal Golden Jubilee Ph.D. Program, grant number PHD00972558.
Institutional Review Board Statement
All chickens were cared for under the guidelines of the Institutional Animal Care and Use Committee of Khon Kaen University (IACUC-KKU-35/62) within Network Center for Animal Breeding and Omics Research, Faculty of Agricultural, Khon Kaen University, Khon Kaen, Thailand.
Data Availability Statement
Additional data are available on request from the corresponding authors.
Conflicts of Interest
The authors declare that they have no competing interest.
Footnotes
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Jung S., Bae Y.S., Kim H.J., Jayasena D.D., Lee J.H., Park H.B., Heo K.N., Jo C. Carnosine, anserine, creatine, and inosine 5′-monophosphate contents in breast and thigh meats from 5 lines of Korean native chicken. Poult. Sci. 2003;92:3275–3282. doi: 10.3382/ps.2013-03441. [DOI] [PubMed] [Google Scholar]
- 2.Drozak J., Veiga-da-Cunha M., Vertommen D., Stroobant V., Van S.E. Molecular identification of carnosine synthase as ATP-grasp domain-containing protein 1 (ATPGD1) J. Biol. Chem. 2010;285:9346–9356. doi: 10.1074/jbc.M109.095505. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Menon K., Mousa A., de Courten B. Effects of supplementation with carnosine and other histidine-containing dipeptides on chronic disease risk factors and outcomes: Protocol for a systematic review of randomised controlled trials. BMJ. 2018;8:e020623. doi: 10.1136/bmjopen-2017-020623. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Caruso G., Fresta C.G., Musso N., Giambirtone M., Grasso M., Spampinato S.F., Merlo S., Drago F., Lazzarino G., Sortino M.A., et al. Carnosine Prevents Aβ-Induced Oxidative Stress and Inflammation in Microglial Cells: A Key Role of TGF-β1. Cells. 2019;8:64. doi: 10.3390/cells8010064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Kim S.K., Kim Y., Baek I.K., Auh J.H. Carnosine and anserine in chicken: Distribution, age-dependency and their anti-glycation activity. Korean J. Food Sci. Anim. Resour. 2012;32:45–48. doi: 10.5851/kosfa.2012.32.1.45. [DOI] [Google Scholar]
- 6.Derave W., Courten B.D., Baba S.P. An update on carnosine and anserine research. Amino Acids. 2019;51:1–4. doi: 10.1007/s00726-018-02689-9. [DOI] [PubMed] [Google Scholar]
- 7.Baguet A., Bourgois J., Vanhee L., Achten E., Derave W. Important role of muscle carnosine in rowing performance. J. Appl. Physiol. 2010;109:1096–1101. doi: 10.1152/japplphysiol.00141.2010. [DOI] [PubMed] [Google Scholar]
- 8.del Favero S., Roschel H., Solis M.Y., Hayashi A.P., Artioli G.G., Otaduy M.C., Benatti F.B., Harris R.C., Wise J.A., Leite C.C., et al. Beta-alanine (CarnosynTM) supplementation in elderly subjects (60–80 years): Effects on muscle carnosine content and physical capacity. Amino Acids. 2012;43:49–56. doi: 10.1007/s00726-011-1190-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kai S., Watanabe G., Kubota M., Kadowaki M., Fujimura S. Effect of dietary histidine on contents of carnosine and anserine in muscles of broilers. Anim. Sci. J. 2015;86:541–546. doi: 10.1111/asj.12322. [DOI] [PubMed] [Google Scholar]
- 10.Qi B., Wang J., Ma Y., Wu S., Qi G., Zhang H. Effect of dietary β-alanine supplementation on growth performance, meat quality, carnosine content, and gene expression of carnosine-related enzymes in broilers. Poult. Sci. 2018;97:1220–1228. doi: 10.3382/ps/pex410. [DOI] [PubMed] [Google Scholar]
- 11.Kojima S., Saegusa H., Sakata M. Histidine-containing dipeptide concentration and antioxidant effects of meat extracts from Silky Fowl: Comparison with meat-type chicken breast and thigh meats. Food Sci. Technol. Res. 2014;20:621–628. doi: 10.3136/fstr.20.621. [DOI] [Google Scholar]
- 12.Jaturasitha S., Chaiwang N., Kreuzer M. Thai native chicken meat: An option to meet the demands for specific meat quality by certain groups of consumers; a review. Anim. Prod. Sci. 2016;57:1582–1587. doi: 10.1071/AN15646. [DOI] [Google Scholar]
- 13.Intarapichet K.O., Maikhunthod B. Genotype and gender differences in carnosine extracts and antioxidant activities of chicken breast and thigh meats. Meat Sci. 2005;71:634–642. doi: 10.1016/j.meatsci.2005.05.011. [DOI] [PubMed] [Google Scholar]
- 14.Tian Y., Xie M., Wang W., Wu H., Fu Z., Lin L. Determination of carnosine in Black-Bone Silky Fowl (Gallus gallus domesticus Brisson) and common chicken by HPLC. Eur. Food Res. Technol. 2007;226:311–314. doi: 10.1007/s00217-006-0528-1. [DOI] [Google Scholar]
- 15.Ali M., Lee S.Y., Park J.Y., Jung S., Jo C., Nam K.C. Comparison of functional compounds and micronutrients of chicken breast meat by breeds. Food Sci. Anim. Resour. 2019;39:632–642. doi: 10.5851/kosfa.2019.e54. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Maikhunthod B., Intarapichet K.O. Heat and ultrafiltration extraction of broiler meat carnosine and its antioxidant activity. Meat Sci. 2005;71:364–374. doi: 10.1016/j.meatsci.2005.04.017. [DOI] [PubMed] [Google Scholar]
- 17.Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−ΔΔC(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 18.Jayasena D.D., Jung S., Bae Y.S., Kim S.H., Lee S.K., Lee J.H., Jo C. Changes in endogenous bioactive compounds of Korean native chicken meat at different ages and during cooking. Poult. Sci. 2014;93:1842–1849. doi: 10.3382/ps.2013-03721. [DOI] [PubMed] [Google Scholar]
- 19.Everaert I., Naeyer H.D., Taes Y., Derave W. Gene expression of carnosine-related enzymes and transporters in skeletal muscle. Eur. J. Appl. Physiol. 2013;113:1169–1179. doi: 10.1007/s00421-012-2540-4. [DOI] [PubMed] [Google Scholar]
- 20.Lokman I.H., Jawad H.S.A., Goh Y.M., Sazili A.Q., Noordin M.M., Zuki A.B.Z. Morphology of breast and thigh muscles of Red Jungle Fowl (Gallus gallus spadiceus), Malaysian village chicken (Gallus gallus domesticus) and commercial broiler chicken. Int. J. Poult. Sci. 2016;15:144–150. doi: 10.3923/ijps.2016.144.150. [DOI] [Google Scholar]
- 21.Boldyrev A.A., Aldini G., Derave W. Physiology and pathophysiology of carnosine. Physiol. Rev. 2013;93:1803–1845. doi: 10.1152/physrev.00039.2012. [DOI] [PubMed] [Google Scholar]
- 22.Baguet A., Everaert I., Hespel P., Petrovic M., Achten E., Derave W. A new method for non-invasive estimation of human muscle fiber type composition. PLoS ONE. 2011;6:e21956. doi: 10.1371/journal.pone.0021956. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Ismail I., Joo S.T. Poultry meat quality in relation to muscle growth and muscle fiber characteristics. Korean J. Food Sci. Anim. Resour. 2017;37:873–883. doi: 10.5851/kosfa.2017.37.6.87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Jayasena D.D., Jung S., Kim S.H., Kim H.J., Alahakoon A.U., Lee J.H., Jo C. Endogenous functional compounds in Korean native chicken meat are dependent on sex, thermal processing and meat cut. J. Sci. Food Agri. 2015;95:771–775. doi: 10.1002/jsfa.6882. [DOI] [PubMed] [Google Scholar]
- 25.Mateescu R.G., Garmyn A.J., O’Neil M.A., Tait R.G., Abuzaid A., Mayes M.S., Garrick D.J., Van Eenennaam A.L., VanOverbeke D.L., Hilton G.G., et al. Genetic parameters for carnitine, creatine, creatinine, carnosine, and anserine concentration in longissimus muscle and their association with palatability traits in Angus cattle. J. Anim. Sci. 2012;90:4248–4255. doi: 10.2527/jas.2011-5077. [DOI] [PubMed] [Google Scholar]
- 26.Brink T.C., Demetrius L., Lehrach H., Adjaye J. Age-related transcriptional changes in gene expression in different organs of mice support the metabolic stability theory of aging. Biogerontology. 2009;10:549–564. doi: 10.1007/s10522-008-9197-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Cararo J.H., Streck E.L., Schuck P.F., Ferreira G.C. Carnosine and related peptides: Therapeutic potential in age-related disorders. Aging Dis. 2015;6:369–379. doi: 10.14336/ad.2015.0616. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ren R., Ocampo A., Liu G.H., Izpisua B.J.C. Regulation of stem cell aging by metabolism and epigenetics. Cell Metab. 2017;26:460–474. doi: 10.1016/j.cmet.2017.07.019. [DOI] [PubMed] [Google Scholar]
- 29.Vogel C., Marcotte E.M. Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat. Rev. Genet. 2012;13:227–232. doi: 10.1038/nrg3185. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Schwanhäusser B., Busse D., Li N., Dittmar G., Schuchhardt J., Wolf J., Chen W., Selbach M. Global quantification of mammalian gene expression control. Nature. 2011;473:337–342. doi: 10.1038/nature10098. [DOI] [PubMed] [Google Scholar]
- 31.Cong J., Zhang L., Li J., Wang S., Gao F., Zhou G. Effects of dietary supplementation with carnosine on growth performance, meat quality, antioxidant capacity and muscle fiber characteristics in broiler chickens. J. Sci. Food Agric. 2017;97:3733–3741. doi: 10.1002/jsfa.8236. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
Additional data are available on request from the corresponding authors.





