Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2021 Jul 23;11:15090. doi: 10.1038/s41598-021-93909-y

Loss of αklotho causes reduced motor ability and short lifespan in zebrafish

Yurie Ogura 1, Ryoji Kaneko 1, Kota Ujibe 1, Yuma Wakamatsu 1, Hiromi Hirata 1,✉
PMCID: PMC8302672  PMID: 34301962

Abstract

The klotho gene encodes a transmembrane protein αKlotho that interacts with a fibroblast growth factor (FGF) receptor in renal tubular epithelial cells and functions as a co-receptor for FGF23, which is an osteocytes-derived hormone. This bone-to-kidney signal promotes urinary phosphate excretion. Interestingly, αKlotho knockout mice show an accelerated aging and a shortened life span. Similarly, C. elegans lacking the αklotho homologue showed a short life span. However, the physiological basis of aging-related function of αklotho remain unclear. The αklotho-deficient vertebrate animals other than mice have been awaited as an alternative model of premature aging. We here employed zebrafish in our study and revealed that αklotho mutant zebrafish appeared to be normal at 3 months postfertilization (mpf) but eventually underwent premature death by 9 mpf, while normal zebrafish is known to survive for 42 months. We also assessed the motor ability of zebrafish in a forced swimming assay and found that αklotho mutant zebrafish displayed reduced swimming performance before their survival declined. A recent study also reported a similar finding that αklotho-deficient zebrafish exhibited a short life span and reduced spontaneous movements. Taken together, these results suggest that αKlotho mutant zebrafish show premature aging and are useful to investigate aging in vertebrates.

Subject terms: Developmental biology, Disease model

Introduction

Senescence is a process of cell cycle arrest, while aging is a process of gradual deterioration of tissue functions. In human aging, a number of physiological decline of tissue functions occur over time, accompanying the increase of skin wrinkling, soft tissue calcification, neural degeneration, muscle weakness and motor deterioration1. Numerous aging-related disorders and premature aging diseases have been pathologically identified in human. Although it has been suggested that aging is triggered by an accumulation of DNA/cell damage or by a genetic limitation of cell proliferation, the physiological basis and causes of aging are still largely unknown1. To investigate aging-related genes and to fight against aging, several animal models such as mice, fruit flies and C. elegans have been used to assay longevity and premature death2–5. Zebrafish (Danio rerio), which is an emerging alternative vertebrate model, has also been used to study the progressive deterioration of biological functions in aging6, 7.

The klotho (kl) gene was originally identified as an aging-suppressor in mutant mice that showed an accelerated aging and a short lifespan8. The kl gene encodes a single-pass transmembrane protein αklotho and is predominantly expressed in the distal convoluted tubules. The αklotho protein binds to fibroblast growth factor (FGF) receptors and functions as a co-receptor for FGF23, which is secreted from osteocytes in bone9. This bone-to-kidney signal is activated by an increase of serum phosphorus, promoting phosphate discharge from blood to urine10. The αklotho-deficient mice as well as FGF23 knockout mice exhibited an increase of blood phosphate that resulted in arteriosclerosis and vascular calcification11, 12. In addition to these blood vessel disorders, multiple aging phenotypes such as skin atrophy, auditory disturbance, osteopenia, sarcopenia and premature death has been reported in these mutant mice13. Conversely, transgenic mice that overexpress αklotho displayed longevity compared to normal mice14. Thus, one important contributing factor to αklotho-mediated suppression of aging appears to be the regulation of phosphate levels. But how phosphate homeostasis determines the life span remains unclear15. The αklotho-deficient vertebrate animals other than mice would contribute toward understanding aging.

Here, we employed zebrafish in our αklotho study and found that αklotho mutant zebrafish (Y306X) showed a shortened lifespan. A recent study reported the same finding that αklotho-deficient zebrafish (S179frameshift) underwent a premature death16. We also assessed swimming performance of zebrafish in a forced swimming assay and demonstrated that αklotho mutant zebrafish display a reduced swimming ability before their survival declined.

Results

Zebrafish klotho gene and klotho mutation

To study αklotho in zebrafish, we first retrieved klotho gene information of zebrafish and the other vertebrate animals from NCBI database. An amino acid alignment of the αklotho showed that αklotho protein is conserved among vertebrates from zebrafish to human, especially in two glycosidase domains (Supplemental Fig. 1). Although amino acid residues of the transmembrane domain at the C-terminus of the αklotho appeared to be less conserved in chicken, frog and zebrafish, online prediction tools of the protein secondary structure such as PredictProtein and SOSUI suggested that this region is a putative membrane-spanning domain in these non-mammalian animals, verifying that αklotho is overall conserved among vertebrates.

To investigate the physiological function of αklotho in zebrafish, we next obtained an αklotho mutant allele klsa18644, which was identified in a targeting induced local lesions in genomes (TILLING) project17. This allele harbors a T to A base substitution that generates a premature nonsense codon (Y306X) in the middle of the first glycosidase domain (Fig. 1a). This mutation also generated an MseI restriction site that enabled genotyping by a restriction enzyme digestion of the genomic PCR products (Fig. 1b,c).

Figure 1.

Figure 1

A nonsense mutation of zebrafish kl gene. (a) The αklotho protein has a signal peptide, two glycosidase domains and a transmembrane domain. A nonsense mutation caused a truncation in the first glycosidase domain. (b) The T-to-A mutation generated an MseI restriction enzyme site. (c) The size of the genomic PCR products was 240 bp. The PCR products amplified from mutant alleles were digested by MseI to generate two 120-bp fragments.

Zebrafish klotho mutants exhibit short life spans

By crossing heterozygous kl mutant carrier fish, we obtained homozygous kl mutants (kl−/−). The kl−/− embryos showed no apparent defects and grew up to become adults. The ratio of kl−/− mutants in a progeny of a heterozygous carrier cross was about one quarter (23%, 23/100) at 4 months postfertilization (mpf), indicating that the loss of kl does not affect development or survival of zebrafish in both females and males until they become young adults (Fig. 2a–d) as reported recently16. Although the skin of the previously reported kl-deficient zebrafish appeared to be pale at 5 mpf16, we did not see apparent reduction of the skin tone in kl−/− compared to kl+/+ fish at any age. Intriguingly, we noticed that some mutant female displayed protruding eye at 5 mpf (30%, 6/20) just like a telescope goldfish (Fig. 2e–l). This malformation of the eye was not seen in mutant male fish (n = 30). We also recapitulated that our kl−/− fish become thinner after 5 months of age and die within 9 months (Fig. 2m–p). To detail the short life span of kl−/− zebrafish, we monitored the survival of our kl+/+ and kl−/− fish from 2 mpf (Fig. 2q). We found that all of the kl−/− fish (n = 28) died between 4 and 9 mpf, whereas all kl+/+ fish (n = 32) kept living after 9 mpf. It has been reported that the mean life span of zebrafish is 42 months18. These results indicate that kl−/− zebrafish undergo premature aging and death.

Figure 2.

Figure 2

Zebrafish kl mutants become thinner and undergo premature death. (a–d) The kl+/+ female (a), kl+/+ male (b), kl−/− female (c) and kl−/− male (d) zebrafish at 4 mpf. The kl−/− fish showed no morphological defects at this stage. (e–l) Lateral and dorsal views of head in kl+/+ female (e,i), kl+/+ male (f,j), kl−/− female (g,k) and kl−/− male (h,l) at 5 mpf. Note that the eyeball is protruding to the outside in the kl−/− female. (m–p) The kl+/+ female (m), kl+/+ male (n), kl−/− female (o) and kl−/− male (p) zebrafish at 6 mpf. The kl−/− fish became skinny. (q) The kl+/+ fish (n = 32) survived over 9 mpf. All of the kl−/− fish (n = 28) underwent premature death before 9 mpf.

Zebrafish klotho mutants show reduced motor ability

Since aging affects the motor system19, we addressed whether motor ability is impaired in kl−/− zebrafish. As swimming ability of adult zebrafish is governed by the body size especially by the caudal fin length20, we began with a physical measurement. We measured the standard length and caudal fin length, which are defined as the length from the head to the root of the caudal fin and from the root of the caudal fin to the edge of the fin, respectively21. Both standard length and caudal fin length of kl+/+ and kl−/− fish were comparable in both females and males at 3 mpf and 4 mpf. These data confirm that kl−/− fish are indistinguishable from kl+/+ fish by appearance at both 3 mpf and 4 mpf.

To quantify the swimming performance of adult zebrafish, we then employed a swimmill, which is a treadmill for aquatic animals20. A zebrafish was put in a swimming chamber, where water flow is generated by a voltage-controlled spinning propeller. Since fish swim against current to maintain the position in the water flow, zebrafish in the chamber swim at the water velocity. The water velocity was initially set to 10 cm/s for 1 min and successively set to 15 cm/s for 1 min. Eventually, the water velocity increased 1 cm/s every 1 min and the water velocity at when zebrafish could no longer keep swimming was defined as the critical swimming speed (Ucrit) as described previously22. At 3 mpf, the Ucrit of kl−/− zebrafish (female 22.2 ± 2.9 cm/s, n = 4; male 22.0 ± 2.8 cm/s, n = 3; Fig. 3) were comparable to those of kl+/+ fish (female 24.0 ± 3.3 cm/s, n = 3, P = 0.70; male 24.0 ± 2.2 cm/s, n = 4; P = 0.59). At 4 mpf, however, the Ucrit of kl−/− zebrafish (female 18.6 ± 0.8 cm/s, n = 9; male 15.0 ± 2.5 cm/s, n = 3) were significantly lower than those of kl+/+ fish (female 26.4 ± 0.6 cm/s, n = 13, P < 0.001; male 27.4 ± 1.6 cm/s, n = 6; P < 0.01). These results demonstrate that the swimming performance of kl−/− fish starts to decline between 3 and 4 mpf when they do not exhibit premature death.

Figure 3.

Figure 3

Swimming performance in kl mutants declines by 4 mpf. The critical swimming speed (Ucrit) of 3 mpf and 4 mpf zebrafish were measured using a swimmill. The kl+/+ female (n = 3), kl+/+ male (n = 4), kl−/− female (n = 4) and kl−/− male (n = 3) were assayed at 3 mpf. The kl+/+ female (n = 13), kl+/+ male (n = 9), kl−/− female (n = 6) and kl−/− male (n = 3) were assayed at 4 mpf. Open black (kl+/+) and red (kl−/−) circles indicate Ucrit of individual samples. Closed black (kl+/+) and red (kl−/−) circles with error bars indicate mean ± sem.

Discussion

In this study, we investigated a nonsense mutant allele of kl in zebrafish and found that kl−/− fish showed a shortened life span. Recently, Singh and his colleagues have reported the other kl mutant zebrafish allele, which harbors a CRISPR-mediated 5-bp deletion and thus creates a frameshift in the first glycosidase domain16. Although age-related frailty and premature death in our kl−/− fish were recapitulations of a recent report, we uniquely examined swimming performance of kl−/− fish using a swimmill and demonstrated that kl−/− fish initially exhibited comparable motor performance with kl+/+ fish at 3 mpf and eventually showed a compromised swimming at 4 mpf before they become thinner and undergo premature death at 5–8 mpf. Taken together, we conclude that αklotho mutant zebrafish show premature aging phenotypes and that αklotho-deficient zebrafish can be an animal model of progeria.

Conservation of the αklotho in vertebrates

While invertebrate animals use calcium carbohydrate for exoskeleton, vertebrate animals utilize calcium phosphate for endoskeleton but with a risk of phosphate toxicity23. Since αklotho plays an essential role in discharging excess phosphate from blood to prevent unwanted ectopic calcification, it is reasonable that αklotho function is conserved among vertebrates24. Our amino acid alignment revealed that αklotho proteins have two putative glycosidase domains that are highly conserved among vertebrates. These domains share the highest homology with lactase, which hydrolyses lactose to produce galactose and glucose25, 26. Interestingly however, the catalytic glutamate residues in both glycosidase domains in αklotho were substituted to the other residues; i.e. N239 and S872 in human, N241 and A874 in mice and N208 and A849 in zebrafish. Instead of losing glycosidase activities, these domains appeared to acquire an affinity to a calciotropic hormone FGF23, enabling αklotho to function as a co-receptor of FGF23 for the excretion of phosphate from renal tubules9. These amino acid substitution might have been critical for αklotho function in vertebrates. An αklotho homologue gene (klo1) was also found in C. elegans, and klo1-deficient worms showed short life spans27, 28. The αklotho protein in C. elegans has only one glycosidase domain with its catalytic residue intriguingly maintained as glutamate, potentially possessing the glycosidase activity. But how αklotho-mediated suppression of aging takes place in C. elegans remains unsolved. Our kl mutant allele harbored a nonsense mutation in the first putative glycosidase domain, while the other allele reported by Singh et al. carried a frameshift mutation in the same glycosidase domain16. Both of these mutant alleles appear to disrupt the putative glycosidase domain and eliminate the transmembrane domain at the C-terminus and thus are likely unfunctional as a co-receptor for FGF23.

Telescope eye phenotype in kl−/− female zebrafish

The telescope eye goldfish strain was established 300 years ago and maintained in East Asia29. This developmental malformation of the eye is inherited to both female and male offspring in a recessive manner. A recent study revealed that nonsense mutations or a retrotransposon insertion in goldfish lrp2al gene, which encodes a low density lipoprotein receptor-related protein, was responsible for the telescope eye30. Likewise, the lrp2a mutation in zebrafish caused the protruding eye phenotype, which is often referred to as bugeye, in both female and male individuals with a variable penetration rate31–33. In our zebrafish kl−/− case, telescope eye phenotype was seen in 30% of kl−/− female but not in any kl−/− male. Similarly, fgf23-deficient zebrafish exhibited the protruding eye only in the female16. Collectively, the αklotho-FGF23 signals may potentially regulate the expression or function of lrp2a in cooperation with the female-specific endocrine regulation, thereby affecting the eye development in female.

Decline of motor performance in kl−/− zebrafish

Previous in situ hybridization analyses revealed that kl gene is expressed by the brain, pancreas, liver and pronephros in embryonic and larval zebrafish and by the liver and mesonephric kidney tubules in adult zebrafish34. The kl−/− zebrafish did not show any apparent defects during development and in young adults. But they eventually showed the decline of motor ability at 4 mpf, became thinner at 6 mpf and underwent premature death by 9 mpf. Although mutant phenotypes in zebrafish larvae can be generally rescued by mRNA injection-mediated overexpression of the gene product, this does not work in kl−/− zebrafish, because all of the defects in kl−/− were adult onset.

Since kl gene is expressed only by the liver and kidney in adult zebrafish34, the motor impairment, which is attributable to the neuronal dysfunction, muscle weakness or cardiovascular defects, could be a secondary phenotype caused through a perturbation of the endocrine system. Our future histological and physiological studies of neurons and muscles as well as metabolomic analyses at 3–4 mpf will clarify the basis of the motor deterioration. In our forced swimming assay, the decline of the motor ability was evaluated by the maximum swimming speed Ucrit. It has been reported that the reduction of Ucrit accompanies with aging in zebrafish35, implying that motor deterioration in kl−/− fish is a premature aging phenotype. Taken together, the decline of motor performance is likely one of the earliest physiological phenotype of premature aging in kl−/− zebrafish.

Pathology of αklotho

Kuro-o and his colleagues have demonstrated that αklotho mutant mice showed cellular senescence such as the upregulation of a cyclin-dependent kinase inhibitor p21 and cell cycle arrest as well as age-related disorders including the ectopic calcification and hypokinesis8. The life span of the mutant mice was approximately 60 days with no mice surviving over 100 days. A population-based association study suggested that a SNP that generates an F352V missense variant in human αklotho is implicated in a short life span36. In addition, a 13-year-old girl who carries a homozygous H193R missense variant in αklotho showed premature tumoral calcinosis with dural and carotid artery calcifications37. Thus, physiological symptoms linked to αklotho mutations appear to be common in vertebrates. Although pathological studies of αklotho deficiency has only been done in human, mice and C. elegans until recently, the latest publication of αklotho mutant zebrafish16 and our current study demonstrated pathologically-relevant progressive motor deterioration and premature death in zebrafish kl mutants. Collectively, zebrafish αklotho mutants provide an alternative animal model to study cellular senescence, aging and progeria in vertebrates.

Materials and methods

Animals

Zebrafish (Danio rerio) were reared and maintained in 1.7 L tanks in a recirculating Meito System (Meito System) under a 14 h light and 10 h dark photoperiod according to the standard protocol38. Larvae were fed paramecia and Gemma Micro ZF 75 (Funakoshi) twice a day from 5 days postfertilization to 1 mpf. Juvenile fish (1–3 mpf) were fed brine shrimp (Tokai Guppy) and Gemma Micro ZF 75 twice a day. Adults fish (3 mpf–) were fed brine shrimp and Otohime B2 (Marubeni Nissin Feed) twice a day. Zebrafish αklotho mutant line (klsa18644) and wild-type AB line, the latter for the line maintenance, was purchased from Zebrafish International Resource Center (https://zebrafish.org/home/guide.php).

Genotyping

The missense region of kl gene was amplified by genomic PCR using KAPA Taq Extra PCR Kit (Kapa Biosystems) in ProFlex PCR System (Thermo Fisher Scientific). Following program was used for amplification: 94 °C 2 min; 94 °C 10 s, 63 °C 20 s, 72 °C 30 s, 35 cycles; 72 °C 1 min; 4 °C forever. Following primers were used; kl genotyping forward: CTCTGGGATCTCACTGGATC; kl genotyping reverse: AACTAAGAGCAGGTCCATGAGAC. PCR products were digested with MseI restriction enzyme (Takara) and separated by 15% polyacrylamide gel electrophoresis at 300 V for 90 min as described previously39. The gel images were captured using the Printgraph AE-6933FXCF (Atto).

Image capture

Zebrafish were anesthetized in 0.004% Tricaine (MS-222, Sigma-Aldrich) for 1 min. Images of zebrafish were captured using a digital camera SONY α5000.

Survival

Adult zebrafish obtained by a cross of kl+/− fish were maintained in the regular care. Genotyping was done at 2 mpf. Zebrafish (kl+/+ and kl−/−) that kept floating at water surface or sinking at the bottom without swimming for 1 min were judged as reaching the end point and subjected to euthanasia and genotyping. Number of zebrafish reaching the end point was counted everyday until all of the kl−/− fish died.

Swimmill analysis

Motor ability of zebrafish was quantified using a swimmill system Swim tunnel respirometer 170 ml (Loligo System) as described previously20. In brief, an adult zebrafish, which was kept unfed for 24 h, was put under a propeller-driven water flow in a chamber, and fish was compelled to swim in the water flow. The water velocity increased 1 cm/s every 1 min after initial warming up of 10 cm/s flow for 1 min and successive 15 cm/s flow for 1 min. Zebrafish swam at the speed of water flow until the water velocity reach the maximum swimming capability of the fish. The water velocity at when zebrafish can no longer keep swimming was defined as critical swimming speed Ucrit. The standard and caudal fin lengths were measured by analyzing frames of swimming movies as described previously20.

Statistics

The quantitative data were given as mean ± sem. All error bars in graphs indicate the sem. The sample numbers are shown in Figure legends. The quantitative data were tested for normality by Shapiro–Wilk test (P < 0.05). Statistical significance was determined by multiple comparison tests using the analysis of variance (ANOVA).

Ethics statement

This study was approved by Animal Care and Use Committee of Aoyama Gakuin University (A9/2020) and carried out according to the Aoyama Gakuin University Animal Care and Use Guideline.

Supplementary Information

Acknowledgements

We thank Dr. Makoto Kashima (Aoyama Gakuin University) for fruitful discussion and Hirata Lab members for fish care. This work was supported by KAKENHI (Grant-in-Aid for Scientific Research B from the MEXT, Japan: 19H03329), the Takeda Science Foundation, the Naito Foundation.

Author contributions

H.H. designed research; Y.O., R.K., K.U. and Y.W. performed research and analyzed data; Y.O. and H.H. wrote the manuscript.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-021-93909-y.

References

  • 1.Lopez-Otin C, Blasco MA, Partridge L, Serrano M, Kroemer G. The hallmarks of aging. Cell. 2013;153:1194–1217. doi: 10.1016/j.cell.2013.05.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Clancy DJ, et al. Extension of life-span by loss of CHICO, a Drosophila insulin receptor substrate protein. Science. 2001;292:104–106. doi: 10.1126/science.1057991. [DOI] [PubMed] [Google Scholar]
  • 3.Festing MF, Blackmore DK. Life span of specified-pathogen-free (MRC category 4) mice and rats. Lab Anim. 1971;5:179–192. doi: 10.1258/002367771781006564. [DOI] [PubMed] [Google Scholar]
  • 4.Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang RA. C. elegans mutant that lives twice as long as wild type. Nature. 1993;366:461–464. doi: 10.1038/366461a0. [DOI] [PubMed] [Google Scholar]
  • 5.Tatar M, et al. A mutant Drosophila insulin receptor homolog that extends life-span and impairs neuroendocrine function. Science. 2001;292:107–110. doi: 10.1126/science.1057987. [DOI] [PubMed] [Google Scholar]
  • 6.Gerhard GS, Cheng KC. A call to fins! Zebrafish as a gerontological model. Aging Cell. 2002;1:104–111. doi: 10.1046/j.1474-9728.2002.00012.x. [DOI] [PubMed] [Google Scholar]
  • 7.Grunwald DJ, Eisen JS. Headwaters of the zebrafish—Emergence of a new model vertebrate. Nat. Rev. Genet. 2002;3:717–724. doi: 10.1038/nrg892. [DOI] [PubMed] [Google Scholar]
  • 8.Kuro-o M, et al. Mutation of the mouse klotho gene leads to a syndrome resembling ageing. Nature. 1997;390:45–51. doi: 10.1038/36285. [DOI] [PubMed] [Google Scholar]
  • 9.Kurosu H, et al. Regulation of fibroblast growth factor-23 signaling by klotho. J. Biol. Chem. 2006;281:6120–6123. doi: 10.1074/jbc.C500457200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Kuro-o M. Klotho, phosphate and FGF-23 in ageing and disturbed mineral metabolism. Nat. Rev. Nephrol. 2013;9:650–660. doi: 10.1038/nrneph.2013.111. [DOI] [PubMed] [Google Scholar]
  • 11.Shimada T, et al. Targeted ablation of Fgf23 demonstrates an essential physiological role of FGF23 in phosphate and vitamin D metabolism. J. Clin. Investig. 2004;113:561–568. doi: 10.1172/JCI19081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Sitara D, et al. Homozygous ablation of fibroblast growth factor-23 results in hyperphosphatemia and impaired skeletogenesis, and reverses hypophosphatemia in Phex-deficient mice. Matrix Biol. 2004;23:421–432. doi: 10.1016/j.matbio.2004.09.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Edmonston D, Wolf M. FGF23 at the crossroads of phosphate, iron economy and erythropoiesis. Nat. Rev. Nephrol. 2020;16:7–19. doi: 10.1038/s41581-019-0189-5. [DOI] [PubMed] [Google Scholar]
  • 14.Kurosu H, et al. Suppression of aging in mice by the hormone Klotho. Science. 2005;309:1829–1833. doi: 10.1126/science.1112766. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Kuro-o M. The Klotho proteins in health and disease. Nat. Rev. Nephrol. 2019;15:27–44. doi: 10.1038/s41581-018-0078-3. [DOI] [PubMed] [Google Scholar]
  • 16.Singh AP, et al. alphaKlotho regulates age-associated vascular calcification and lifespan in zebrafish. Cell Rep. 2019;28:2767–2776 e2765. doi: 10.1016/j.celrep.2019.08.013. [DOI] [PubMed] [Google Scholar]
  • 17.Kettleborough RN, et al. A systematic genome-wide analysis of zebrafish protein-coding gene function. Nature. 2013;496:494–497. doi: 10.1038/nature11992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Gerhard GS, et al. Life spans and senescent phenotypes in two strains of Zebrafish (Daniorerio) Exp. Gerontol. 2002;37:1055–1068. doi: 10.1016/s0531-5565(02)00088-8. [DOI] [PubMed] [Google Scholar]
  • 19.Brunet A. Old and new models for the study of human ageing. Nat. Rev. Mol. Cell Biol. 2020 doi: 10.1038/s41580-020-0266-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wakamatsu Y, Ogino K, Hirata H. Swimming capability of zebrafish is governed by water temperature, caudal fin length and genetic background. Sci. Rep. 2019;9:16307. doi: 10.1038/s41598-019-52592-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Plaut I. Effects of fin size on swimming performance, swimming behaviour and routine activity of zebrafish Daniorerio. J. Exp. Biol. 2000;203:813–820. doi: 10.1242/jeb.203.4.813. [DOI] [PubMed] [Google Scholar]
  • 22.Brett JR. The respiratory metabolism and swimming performance of young sockeye salmon. J. Fish. Res. Board Can. 1964 doi: 10.1139/f64-103. [DOI] [Google Scholar]
  • 23.Stenvinkel P, et al. Novel treatment strategies for chronic kidney disease: Insights from the animal kingdom. Nat. Rev. Nephrol. 2018;14:265–284. doi: 10.1038/nrneph.2017.169. [DOI] [PubMed] [Google Scholar]
  • 24.Kuro OM, Moe OW. FGF23-alphaKlotho as a paradigm for a kidney-bone network. Bone. 2017;100:4–18. doi: 10.1016/j.bone.2016.11.013. [DOI] [PubMed] [Google Scholar]
  • 25.Ito S, Fujimori T, Hayashizaki Y, Nabeshima Y. Identification of a novel mouse membrane-bound family 1 glycosidase-like protein, which carries an atypical active site structure. Biochim. Biophys. Acta. 2002;1576:341–345. doi: 10.1016/s0167-4781(02)00281-6. [DOI] [PubMed] [Google Scholar]
  • 26.Sugano Y, Lardelli M. Identification and expression analysis of the zebrafish orthologue of Klotho. Dev. Genes Evol. 2011;221:179–186. doi: 10.1007/s00427-011-0367-3. [DOI] [PubMed] [Google Scholar]
  • 27.Chateau MT, Araiz C, Descamps S, Galas S. Klotho interferes with a novel FGF-signalling pathway and insulin/Igf-like signalling to improve longevity and stress resistance in Caenorhabditiselegans. Aging (Albany NY) 2010;2:567–581. doi: 10.18632/aging.100195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Polanska UM, Edwards E, Fernig DG, Kinnunen TK. The cooperation of FGF receptor and Klotho is involved in excretory canal development and regulation of metabolic homeostasis in Caenorhabditiselegans. J. Biol. Chem. 2011;286:5657–5666. doi: 10.1074/jbc.M110.173039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Chen SC. A history of the domestication and the factors of the varietal formation of the common goldfish, Carassius auratus. Sci. Sin. 1956;5:287–321. [Google Scholar]
  • 30.Kon T, et al. The genetic basis of morphological diversity in domesticated goldfish. Curr. Biol. 2020;30:2260–2274 e2266. doi: 10.1016/j.cub.2020.04.034. [DOI] [PubMed] [Google Scholar]
  • 31.Sherpa T, Hunter SS, Frey RA, Robison BD, Stenkamp DL. Retinal proliferation response in the buphthalmic zebrafish, bugeye. Exp. Eye Res. 2011;93:424–436. doi: 10.1016/j.exer.2011.06.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Stujenske JM, Dowling JE, Emran F. The bugeye mutant zebrafish exhibits visual deficits that arise with the onset of an enlarged eye phenotype. Investig. Ophthalmol. Vis. Sci. 2011;52:4200–4207. doi: 10.1167/iovs.10-6434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Veth KN, et al. Mutations in zebrafish lrp2 result in adult-onset ocular pathogenesis that models myopia and other risk factors for glaucoma. PLoS Genet. 2011;7:e1001310. doi: 10.1371/journal.pgen.1001310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Mangos S, et al. Expression of fgf23 and alphaklotho in developing embryonic tissues and adult kidney of the zebrafish, Daniorerio. Nephrol. Dial. Transplant. 2012;27:4314–4322. doi: 10.1093/ndt/gfs335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Gilbert MJH, Zerulla TC, Tierney KB. Zebrafish (Daniorerio) as a model for the study of aging and exercise: Physical ability and trainability decrease with age. Exp. Gerontol. 2014;50:106–113. doi: 10.1016/j.exger.2013.11.013. [DOI] [PubMed] [Google Scholar]
  • 36.Arking DE, et al. Association of human aging with a functional variant of klotho. Proc. Natl. Acad. Sci. U.S.A. 2002;99:856–861. doi: 10.1073/pnas.022484299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ichikawa S, et al. A homozygous missense mutation in human KLOTHO causes severe tumoral calcinosis. J. Clin. Investig. 2007;117:2684–2691. doi: 10.1172/JCI31330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Westerfield M. The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Daniorerio) 5. University of Oregon; 2007. [Google Scholar]
  • 39.Ogino K, et al. RING finger protein 121 facilitates the degradation and membrane localization of voltage-gated sodium channels. Proc. Natl. Acad. Sci. U.S.A. 2015;112:2859–2864. doi: 10.1073/pnas.1414002112. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES