Skip to main content
Cells logoLink to Cells
. 2021 Jun 27;10(7):1611. doi: 10.3390/cells10071611

Gene Expression Profile in Different Age Groups and Its Association with Cognitive Function in Healthy Malay Adults in Malaysia

Nur Fathiah Abdul Sani 1, Ahmad Imran Zaydi Amir Hamzah 1, Zulzikry Hafiz Abu Bakar 1, Yasmin Anum Mohd Yusof 2, Suzana Makpol 1, Wan Zurinah Wan Ngah 1, Hanafi Ahmad Damanhuri 1,*
Editor: Juan Pablo de Rivero Vaccari
PMCID: PMC8304476  PMID: 34199148

Abstract

The mechanism of cognitive aging at the molecular level is complex and not well understood. Growing evidence suggests that cognitive differences might also be caused by ethnicity. Thus, this study aims to determine the gene expression changes associated with age-related cognitive decline among Malay adults in Malaysia. A cross-sectional study was conducted on 160 healthy Malay subjects, aged between 28 and 79, and recruited around Selangor and Klang Valley, Malaysia. Gene expression analysis was performed using a HumanHT-12v4.0 Expression BeadChip microarray kit. The top 20 differentially expressed genes at p < 0.05 and fold change (FC) = 1.2 showed that PAFAH1B3, HIST1H1E, KCNA3, TM7SF2, RGS1, and TGFBRAP1 were regulated with increased age. The gene set analysis suggests that the Malay adult’s susceptibility to developing age-related cognitive decline might be due to the changes in gene expression patterns associated with inflammation, signal transduction, and metabolic pathway in the genetic network. It may, perhaps, have important implications for finding a biomarker for cognitive decline and offer molecular targets to achieve successful aging, mainly in the Malay population in Malaysia.

Keywords: aging, gene expression, Malay adults, cognitive decline

1. Introduction

A decline in cognitive function is the major hurdle to achieving successful aging. Malaysia is a multi-ethnic and developing country, made-up of several ethnic groups, in which Malays form 50.8% of the total population [1]. Indeed, Malaysia has made a remarkable demographic transition in the past decade. It is predicted to become an aging nation by 2050, when 15% of the population will be aged 65 and older [2]. With a rapidly growing aging population, cognitive impairment among the elderly will also increase exponentially in the coming decades. Our previous study revealed that about 15% of healthy Malay adults had cognitive decline, where cognitive domains for memory, learning, and attention skills start to deteriorate from the age of 30 [3].

Having intact cognitive capabilities is critical for older adults in maintaining functional independence [4]. Cognitive deterioration is manifested by a number of symptoms, such as memory loss, decreased ability to maintain focus, reduced problem-solving abilities, and impaired communication skills [5]. However, cognitive decline may occur in the absence of symptoms, called pre-clinical Alzheimer’s disease (AD), in a cognitively normal individual with AD neuropathology driven by the accumulation of amyloid beta (Aβ) plaque and neurofibrillary tangles (NFT) [6,7]. Some evidence reported that cognitive decline in healthy individuals might occur beginning from the late 20s, based on the regional brain volume [8,9], myelin integrity [10,11], accumulation of NFT [12,13], and concentration of brain metabolite [14,15]. Therefore, it is clearly shown that cognitive function deterioration might not be noticeable in early adulthood. Still, pathological changes are progressing at the biochemical and neuroanatomical levels.

Although age is a crucial factor affecting the rate of cognitive decline, multiple cross-sectional studies showed its progression is attributed to a range of factors, including genetics, psychological, disease-related, environmental, and lifestyle factors [16,17,18,19,20]. A study showed that global cognitive functioning among Malay, Chinese, and Indian was significantly different in less-educated elderly indivdiauls in Singapore [21]. Tan et al. (2003) conducted a community-based study that investigated Apolipoprotein E (APOE) polymorphism among three ethnic groups in Singapore found that Malays have the high frequency of the ε4 allele, associated with elevated serum cholesterol levels, by downregulation of the low-density lipoprotein (LDL) receptor, and decreased LDL clearance [22]. On the other hand, Wan et al. (2004) reported that Malay groups have a low frequency of allele ε2 compared to Indian groups, where individuals with at least one ε2 allele tend to have lower levels of total plasma cholesterol due to the reduced binding affinity for LDL receptors [23]. It is well documented that the high frequency of allele ε4 and low frequency of allele ε2 increase the risk of diseases associated with hypercholesterolemia and increase the risk of AD [24]. Several studies have also reported that a higher prevalence of cardiovascular disease in the Malay population increases susceptibility to mild cognitive decline and AD [25,26,27]. Therefore, it is interesting and noteworthy that an APOE polymorphism study showed a greater risk of Malays getting AD.

Several studies have identified pathological processes at the peripheral level associated with decreased cognitive function. A study by Janelidze et al. (2016) found that increased Aβ levels in the brain and blood plasma are associated with vascular disease that contributes to cognitive impairment [28]. Another study conducted in healthy elderly individuals showed that plasma Aβ was associated with a faster cognitive decline rate that might predict a transition to AD [29]. Using blood as a biomarker, one study found 18 potential proteins that might predict early AD by 2–6 years, with close to 90% accuracy [30], and about 133 genes were identified in Alzheimer’s patients with different expression patterns compared to healthy control subjects with 98% accuracy [31]. Moreover, a follow-up study conducted by Grünblatt et al. (2009) found five genes in peripheral blood mRNA of demented and non-demented subjects showed a significant correlation with a lower mini-mental state examination (MMSE) score [32].

RNA extracted from PBMCs had a higher abundance of gene expression and produced greater signals in microarray as compared to whole blood [33,34]. Therefore, measurement of gene expression in PBMCs may offer an effective biomarker for cognitive research, as the sample is easily accessible, less invasive, and inexpensive fluid for biomarker identification, allowing repeat sampling. PBMCs consist of cells, such as lymphocytes, monocytes, and macrophages, which play important roles in the immune system, and could exhibit inflammatory mechanisms, specifically compared to serum or plasma in the aging process. Moreover, using PBMCs as biomarkers in the development of cognitive decline has not been sufficiently investigated. Thus, in this work, we aimed to profile gene expression changes in PBMCs dedicated to elucidate the mechanism of age-related cognitive decline during aging in the Malay population in Malaysia.

2. Materials and Methods

2.1. Subjects Recruited

The data in this study were a part of the Toward Useful Aging (TUA) study, funded by the Long Term Research Grant Scheme (LRGS), Ministry of Higher Education Malaysia. The subject screening was performed from May 2013 to March 2015 in various locations around Klang Valley and Selangor. Subjects were eligible for the study if they were between the ages of 30 and 60, had no known physical or mental illness, were of the Malay race, and did not have more than 15 years of education (years of education is associated with cognitive performance and a risk factor for cognitive decline). Subjects were excluded if they were diagnosed with a psychiatric disorder or an untreatable chronic disease, such as cancer, kidney failure, coronary heart disease, or uncontrolled diabetes. Smokers and pregnant women were also excluded from this study. A total of 160 subjects were enrolled via the random sampling method. They were divided into four groups according to their age (n = 40); age intervals for group 30 was (28–34), group 40 was (35–45), group 50 was (47–54), and the group above 60 was (57–79). From the 160 subjects, 72 subjects were included for the microarray analysis. All subjects were informed of the details of the study, and their written consent was obtained before they enrolled in the study. The study’s protocol was reviewed and approved by the Research and Ethics Committee of Universiti Kebangsaan Malaysia Medical Centre (UKM 1.5.3.5/244/LRGS/BU/2012/UKM_UKM/K04).

2.2. Samples Collection and RNA Preparation

Peripheral blood samples (10 mL) were collected in an EDTA tube (BD, Franklin Lakes, NJ, USA) and processed within 4 h of procurement at room temperature. The samples were frozen at −20 °C until further process for RNA isolation. Briefly, blood was mixed with Lymphoprep buffer (Axis-Shield PoC, Oslo, Norway) to isolate peripheral blood mononuclear cells (PBMCs). Then, the mixture was centrifuged at 1500× g and 30 min at 4 °C. PBMCs formed a pellet after centrifugation, and the supernatant was removed. Then, the total RNA was extracted in the TRI-reagent (Molecular Research Center, Cincinnati, OH, USA), and the RNA was immediately stored at −80 °C until further processing. The total RNA isolation was carried out using the RNeasy kit, according to the manufacturer’s protocol (QIAGEN, Chatsworth, CA, USA). RNA concentration was quantified using NanoDrop 1000A (Thermo Scientific, Wilmington, DE, USA), while RNA quality was characterized using the Agilent 2100 Bioanalyzer and the RNA Nano Chip (Agilent technologies, Palo Alto, CA, USA). Only samples with a purity of 1.8 to 2.0 (A260/A280) and RNA Integrity Number (RIN) of 8.0 and above were selected for gene profiling. The microarray experiment was designed to compare gene expression profiles among four age groups: 30, 40, 50, and over 60. The total RNA isolation was performed for quantitative real-time PCR (qRT-PCR) validation.

2.3. RNA Amplification and Microarray Chip Hybridization

Gene expression profiling was performed using the HumanHT-12 v3 BeadChip expression kit (Illumina Inc., San Diego, CA, USA) containing 47,123 unique transcripts. A total of 200 ng of total RNA from each sample was labeled using the TargetAmp™ Nano Labeling Kit for Illumina® Expression BeadChip® (Epicentre Biotechnologies, Madison, WI, USA) to synthesize cDNA. Then, in vitro transcription was performed to generate, and labeled single-stranded RNA (cRNA) by incorporating biotin; the samples were purified using RNeasy® MinElute® Cleanup Kit (Qiagen, Hilden, Germany). A HumanHT-12 v3 BeadChip expression kit (Illumina Inc., San Diego, CA, USA) was used to hybridize the biotinylated cDNA samples at 58 °C for 17 h. The Gene Expression BeadChips were then stained with Cy3-streptavidin dye reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA). They were scanned for signal detection using an Illumina iScan and the Bead Scan Software (Illumina Inc., San Diego, CA, USA).

2.4. Real-Time QRT-PCR Validation

The genes with a different fold changed levels, had the highest statistically significant expression were selected for validation to verify the age-related changes derived from the microarray data. Genes and forward/reverse primer used are presented in Table 1. The same RNA samples used in the microarray experiments were performed using the two-step quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) using QuantiNova™ Reverse Transcription and QuantiNova™ SYBR Green PCR (Qiagen Inc., Germantown, MD, USA). Briefly, 2000 ng of total RNA was reverse transcribed according to the manufacturer’s instructions. Each 20 µL aliquot contained 1 µL reverse transcriptase, 4 µL transcriptase reaction mix, and 15 µL of total RNA or water as the negative control. The reaction mix was incubated for 5 min at 25 °C, 20 min at 45 °C, and 5 min at 85 °C to obtain the cDNA template. The gene was then amplified with a 10 µL of reaction mix consisting of 5.5 µL of 2× QuantiNova SYBR reaction mix, primers, and cDNA template. Each sample was amplified in triplicate, and the results were normalized against glyceraldehyde phosphate dehydrogenase (GAPDH) as a reference gene. FC was determined by the delta-delta-Ct comparative method, using the average of Ct values after subtraction with a Ct value of GAPDH.

Table 1.

Primers used in real-time QRT-PCR analysis.

Gene Product Forward Primer Reverse Primer
GAPDH TCCCTGAGCTGAACGGGAAG GGAGGAGTGGGTGTCGCTGT
KCNA3 AAAACGGGCAATTCCACTGC AACAAGGGCATAGGCAGACC
HIST1H1E TTCCGGCTCGAATTGCTCTC CTTCACGGGAGTCTTCTCGG
PAFAH1B3 GAATGGGGAGCTGGAACACA CGCTCATTCACCAGTTGCAC
TM7SF2 GTCGCCTGCGCTATCCTATT AGATGAAAGCGGTGAGGGTG
RGS1 TTGACTTCCGCACTCGAGAA TGTTCACCCAGGGAGCCATA
TGFBRAP1 CTTCAAGAAGCCCGTGAACGA ACATCTGGATGGTTCTGCGTT

2.5. Statistical Analysis

The SPSS version 22.0 (IBM, Armonk, NY, USA) was used to analyze real-time QRT-PCR data. All data were expressed as mean ± standard deviation. The differences were tested by one-way ANOVA, and the significance level was set at p < 0.05 for all tests.

2.6. Statistical Analysis of Gene Expression Profiling

Raw images produced were imported to Illumina Genome Studio Software Suite to obtain normalized gene expression. The final report of the normalized data was transferred to a third-party software, Partek Genomic Suite version (Partek Inc., St. Louis, MO, USA), to perform gene expression profiling analysis. A principal component analysis (PCA) plot was generated as a quality control step, and the batch effect was removed as a source of variation. Hierarchical clustering was generated to visualize gene expression patterns. A three-way ANOVA with FC −1.2 to 1.2 and p < 0.05 with the Benjamini and Hochberg false discovery rate (FDR) was performed across all samples. The differential expression genes (DEGs) were exported to Microsoft Excel to simplify the analysis further. The analysis compared DEGs between the younger group (30 year old) and the older age groups (40, 50, and 60) in aging. A Venn diagram was generated to demonstrated DEGs present in all groups. The list of DEGs was subjected to analysis further using Pathway Studio to identify biological pathways that were over-presented.

3. Results

3.1. Demographic and Cognitive Performance of the Subjects

Demographic data and cognitive function tests were reported previously [3]. All biochemical parameters in the blood were in the normative range described by [35].

3.2. Sample Characteristics

All samples had good quality RNA without degradation, as shown by the integrity number of RNA, RIN > 7 (Table 2). There was no significant difference among groups in the RIN isolated from PBMC between each group.

Table 2.

RNA samples were used in the microarray experiment.

Group Group 30 Group 40 Group 50 Group 60
RNA Integrity Number (RIN) 8.51 ± 0.58 8.33 ± 0.39 8.49 ± 0.47 7.63 ± 0.84

Data presented as mean ± SD, p < 0.05.

3.3. Gene Expression Profiling and Differentially Expressed Gene in PBMC

3.3.1. Principal Component Analysis

Data obtained from the microarray experiment went through sample quality control according to the principal component analysis (PCA) criteria and hierarchical cluster analysis. PCA is a statistical tool used to visualize unsupervised multidimensional data sets for observation of the sample variability. According to the PCA criterion, samples of the same experimental conditions are expected to be positioned with each other and grouped closer in the PCA plot. The result showed that samples from different age groups were clustered and distinguished (Figure 1 and Figure 2a–c). This result could suggest the good quality of samples used, and the samples have similar biological conditions within the same group.

Figure 1.

Figure 1

Principal component analysis (PCA) plot; age group 30 (yellow), age group 40 (pink), age group 50 (green), age group 60 (blue).

Figure 2.

Figure 2

Principal component analysis (PCA). (a) Age group 40 (blue) compared to age group 30 (red), (b) age group 50 (blue) compared to age group 30 (red), (c) age group 60 (blue) compared to age group 30 (red).

3.3.2. Hierarchical Cluster Analysis

The relationship between age groups was visualized using hierarchical cluster analysis by applying one-way ANOVA (p < 0.05) analysis across all ages. The unsupervised hierarchical cluster analysis involved un-classification of a sample into any group/experimental condition (Figure 3), whereas datasets in the supervised analysis were classified into specific groups/experimental conditions (Figure 4). Based on the observations of Figure 4, the datasets of age groups 30 and 40 were well separated, showing that there were differences in expression profiles between the age groups. However, the dataset of age group 50 presented clustered together with age group 60. Several genes in age group 50 had similar expression profiles with age 60, and these gene expressions may have similar biological functions.

Figure 3.

Figure 3

Unsupervised hierarchical cluster analysis of gene expression in age group; age 30 (yellow), age 40 (orange), age 50 (red), and age 60 (green).

Figure 4.

Figure 4

Supervised hierarchical cluster analysis of gene expression in normal aging age 30 (red), age 40 (yellow), age 50 (blue), and age 60 (orange).

3.3.3. Differential Expression Genes (DEGs)

DEGs of each age group in normal aging was statistically generated by the Benjamini–Hochberg t-test with a false discovery rate (FDR), multi-gene correction at (p < 0.05) and fold change (FC) ± 1.2 (Table 3). There were about 2478–4366 genes that were altered with the progression of age. The most significant differences found in G60 > G30 might be because of the huge age differences. The upregulated genes were more pronounced in the age group 60 vs. 30 than in age 40 vs. 30. Overall, the number of upregulated vs. downregulated genes was relatively balanced in all age groups, although most of the DEGs in each age group were upregulated.

Table 3.

Number of dysregulated genes in different age groups as compared to age 30 at FC > 1.2, FDR p ≤ 0.05.

G40 vs. G30 G50 vs. G30 G60 vs. G30
Up 1961 1318 2264
Down 1784 1160 2102
Total 3745 2478 4366

A Venn analysis was performed to determine the overlapping of the DEGs found within the pairwise comparison (Figure 5). The data demonstrated that about 405 DEGs overlapped between age groups, suggesting that common molecular mechanisms in the peripheral blood may exist during the aging process.

Figure 5.

Figure 5

Venn diagram showed a significant overlap of differential expression genes in the pairwise comparison.

The observation of these top 20 genes unexpectedly revealed that most DEGs were downregulated in all age groups (Table 4). Among the genes, only five selected DEGs attracted our interest based on a previous study on aging and their role in cognitive function; PAFAH1B3 (p = 1.82 × 10−6 PF4, FC = 1.58), TM7SF2 (p = 4.93 × 10−7, FC = 1.50429), RGS1 (p = 6.68 × 10−3, FC = 2.04), KCNA3 (p = 2.50 × 10−7, FC = 1.88), and TGFBRAP1 (p = 1.04 × 10−7, FC = −1.50426).

Table 4.

List of top 20 DEGs with FC sorted according to the highest p-value.

No G40N vs. G30N G50N vs. G30N G60N vs. G30N
Gene Symbol p-Value FC Gene Symbol p-Value FC Gene Symbol p-Value FC
1 LSM14B 1.44 × 10−7 −1.68672 LOC652537 8.23 × 10−8 1.5223 VPS13B 1.19 × 10−10 −1.56519
2 HS.574731 1.52 × 10−7 −1.64622 LSM14B 2.08 × 10−7 −1.65683 LSM14B 2.55 × 10−10 −1.90272
3 TM7SF2 4.93 × 10−7 1.50429 RNU4ATAC 4.90 × 10−7 −2.66478 SNRPD3 9.60 × 10−10 −1.65141
4 EIF3CL 1.66 × 10−6 −1.5152 EIF3CL 1.46 × 10−6 −1.50767 EIF3CL 2.33 × 10−8 −1.62575
5 PAFAH1B3 1.82 × 10−6 1.5837 LOC652455 5.79 × 10−6 −1.56269 SNORD95 2.49 × 10−8 −1.77508
6 SNORD13 2.18 × 10−6 −2.2137 TERC 1.66 × 10−5 1.97178 FLJ20309 2.73 × 10−8 −1.65312
7 BDP1 3.79 × 10−6 −1.55882 GPR183 3.56 × 10−5 1.70917 SNORD13 3.59 × 10−8 −2.5244
8 AAK1 3.91 × 10−6 −1.69422 INPP4B 7.28 × 10−5 1.68441 AAK1 4.56 × 10−8 −1.87268
9 TUBB4Q 4.34 × 10−6 1.60485 CTLA4 8.09 × 10−4 1.69249 TGFBRAP1 1.04 × 10−7 −1.50426
10 PHACTR2 5.68 × 10−6 −1.58414 HS.149244 1.69 × 10−3 1.76622 PAR5 1.13 × 10−7 −1.55457
11 KCNA3 5.68 × 10−6 −1.75129 HNRNPL 3.47 × 10−3 −2.02885 HS.438905 1.78 × 10−7 −1.62903
12 RNU4ATAC 7.31 × 10−6 −2.38473 SNORD13 4.18 × 10−3 −1.55632 KCNA3 2.50 × 10−7 −1.88146
13 DCUN1D1 1.37 × 10−5 −1.5566 KCTD12 5.77 × 10−3 −1.55619 BAGE5 2.84 × 10−7 −1.58421
14 FAM55C 1.39 × 10−5 −1.6273 RGS1 6.68 × 10−3 2.04288 SCARNA22 5.89 × 10−7 −1.74235
15 CPEB4 1.56 × 10−5 −1.58899 SIGLEC16 8.41 × 10−3 −1.51751 PAFAH1B3 3.30 × 10−6 1.53754
16 FAM82B 2.28 × 10−5 −1.58899 SNORA12 8.41 × 10−3 −1.63572 RNU4ATAC 6.85 × 10−7 −2.58193
17 UHMK1 3.64 × 10−5 −1.63527 FOS 8.51 × 10−3 −1.64007 HS.574731 1.25 × 10−6 −1.54638
18 RNF125 3.72 × 10−5 −1.54084 KIR2DL3 9.25 × 10−3 −1.56381 RNPC2 2.43 × 10−6 −1.50256
19 EP300 6.04 × 10−5 −1.52404 VNN1 1.16 × 10−2 −1.53815 FAM55C 2.67 × 10−6 −1.67387
20 RSBN1L 7.21 × 10−5 −1.52066 HIST1H2BG 1.18 × 10−2 −1.57278 ANKRD36B 3.51 × 10−6 −1.55339

3.4. Pathway Analysis and Biological Process

To gain insight into which functional annotation is most affected, the DEGs were further analyzed at the pathway level using the Pathway Studio analysis tool. Four major pathways that were involved in aging were mapped; inflammation, metabolic, signal transduction, and nociception pathway. Enrichment analysis of differentially expressed genes in the age group 40 compared to age 30 revealed that platelet activation via G-protein-coupled receptors (GPCR) signaling, p38 MAPK/MAPK14 signaling, and omega-3-fatty acid metabolism appeared to be affected (Table 5). The gene set in age 50 compared to 30 showed significant biological process involved in IL-1 signaling, JNK/MAPK signaling, and TGF-beta signaling (Table 6). The most significant biological processes involved in age group 60 compared to 30 were omega-3-fatty acid metabolism, arachidonic acid metabolism, and JNK/MAPK Signaling (Table 7).

Table 5.

A list of statistically significant biological processes in age group 40 as compared to age group 30 (p < 0.05, FDR), sorted according to the p-value by Fisher’s exact test.

Biological Process Overlapping Entities p-Value Hit Types
Platelet activation via GPCR signaling ARHGEF7; WAS; THPO; OC90; ERAS; ARPC2; HRAS; F2R; GNAI2; RAP1A; HTR2A 1.63 × 10−3 Inflammation pathways
Branched chain amino acids metabolism PCCA; VARS; HSD17B10; ACAA1; HMGCS1; HADHA; HADHB; ECHS1; HMGCL 4.62 × 10−3 Metabolic pathways
Inositol phosphate metabolism GDPD2; NUDT3; ITPKA; PI4K2A; PLCH2; ITPK1; ITPKC; IP6K3 7.48 × 10−3 Metabolic pathways
p38 MAPK/MAPK14 signaling HIST1H3D; HIST1H3C; MAP3K5; MKNK1; EIF4A1; OC90; MAP3K11; HIST3H3; ELK1 1.15 × 10−2 Signal transduction pathways
Ras-GAP regulation signaling DPYSL3; CASK; DOK2; HRAS; IL1RAPL1; ERAS; RAP1A; RASA2 1.48 × 10−2 Signal transduction pathways
Respiratory chain and oxidative phosphorylation COX4I1; SDHB; ATP6V0E1; ATP6V1E1; ATP6V1F 3.61 × 10−2 Metabolic pathways
CR3-mediated phagocytosis in neutrophils and macrophages MYO1G; C3; HRAS; ERAS; ARPC2; DES 3.88 × 10−2 Inflammation pathways
Omega-3-fatty acid metabolism ALOX15; OC90; HSD17B10; ACAA1; HADHA; HADHB; ECHS1; CYP4F12; NACA2; FADS1 3.9 × 10−2 Metabolic pathways
Leukotriene effect on vascular endothelial cell response PRKCG; MAP3K5; DOCK6; USE1; ADCY9; CDH1; BNIP1 4.01 × 10−2 Inflammation pathways
synaptic endocytosis CLTA; ARRB1; SYT1; AP2B1; HRAS; ADCY9; ERAS; RAP1A; CALML6 4.25 × 10−2 Nociception pathways
Neutrophil chemotaxis DOCK6; OC90; ERAS; ARPC2; NCF1; PF4; HRAS; ADCY9; GNAI2 4.32 × 10−2 Inflammation pathways
Activation of complement cascade by pentraxins CFB; C8G; C8B; C3; C7 4.66 × 10−2 Inflammation pathways
ERK/MAPK canonical signaling HIST1H3D; HIST1H3C; PRKCG; PLCH2; EIF4A1; OC90; ERAS; HIST3H3; MKNK1; HRAS; ADCY9; RAP1A; SPHK1 5.48 × 10−2 Signal transduction pathways
CC chemokine receptor signaling CCR4; CCL19; PRKCG; LIMK1; WAS; TIAM1; ERAS; NCF1; HRAS; ADCY9; RAP1A; CCL20 5.91 × 10−2 Inflammation pathways
Fatty acid oxidation HSD17B10; ACAA1; HADHA; HADHB; ATOX1; ECHS1 6.82 × 10−2 Metabolic pathways
Riboflavin metabolism RFK; ACP2; DAK 7.20 × 10−2 Metabolic pathways
Vascular endothelial cell activation by blood coagulation factors F10; PRKCG; OC90; ERAS; CALML6; HRAS; F2R; F2RL2 7.24 × 10−2 Inflammation pathways
MC1R-related anti-inflammatory signaling HRAS; ADCY9; IL10; RAPGEF4; ERAS; RAP1A 7.38 × 10−2 Inflammation pathways
Neutrophil recruitment and priming MAP3K5; OC90; ERAS; PF4; HRAS; GNAI2; CSF2 7.73 × 10−2 Inflammation pathways
Notch signaling MIB1; NOTCH4; FBXW7; SLC35D2; CTBP1; ADAM17 9.01 × 10−2 Signal transduction pathways

Table 6.

A list of statistically significant biological processes in the age group 50 as compared to age group 30 (p < 0.05, FDR), sorted according to the p-value by Fisher’s exact test.

Biological Process Overlapping Entities p-Value Hit Types
Mast cell activation without degranulation through IL33/IL1RL1 signaling IL1RL1; IRAK4; NFKB1; MAP3K1; MAP3K7 2.36 × 10−4 Inflammation pathways
Vitamin K metabolism F10; F7; PRRG4; VKORC1; VKORC1L1 3.64 × 10−4 Metabolic pathways
JNK/MAPK signaling MAP3K1; CDC42; MAP3K7; TP53; DUSP5; MAP3K13; ELK1; FOS 6.79 × 10−4 Signal transduction pathways
Overview of mast cell activation without degranulation IL1RL1; IRAK4; NFKB1; TLR9; MAP3K1; MAP3K7; CXCR4; CD180; FOS 9.16 × 10−4 Inflammation pathways
Toll-like receptor-independent sterile inflammation IL1RL1; IRAK4; MAPK1; NFKB1; MAP3K1; CDC42; MAP3K7; EZR; FOS 1.63 × 10−3 Inflammation pathways
Mast Cell Activation without degranulation through IL1R1 and TLR signaling IRAK4; NFKB1; TLR9; MAP3K1; MAP3K7; CD180 3.49 × 10−3 Inflammation pathways
Tight junction regulation SDC3; CASK; SDC2 4.02 × 10−3 Cell signaling
Prostaglandin E2 receptor signaling in neurons NFKB1; MAP3K7; GABRA6; GABRA5; GABRB3; TNFSF11 1.20 × 10−2 Inflammation pathways
Neutrophil recruitment and priming MAPK1; MAP3K1; FOS; IRAK4; NFKB1; PF4; MAP3K7; TP53 1.24 × 10−2 Inflammation pathways
Plasmin effects in inflammation MAPK1; MMP3; MAP3K1; CDC42; SERPINE1; FOS; NFKB1; PLCL1; CCL20; PLCE1; SPINK5 1.95 × 10−2 Inflammation pathways
Function of macrophage M1 lineage IRAK4; MAPK1; NFKB1; TLR9; MAP3K1; MAP3K7; CD180 2.16 × 10−2 Inflammation pathways
Irinotecan metabolism KL; CES2; CES1 2.63 × 10−2 Metabolic pathways
Neutrophil activation via adherence on endothelial cells MAPK1; NFKB1; CD34; CDC42; SELPLG; NCF1 2.99 × 10−2 Inflammation pathways
Mast cell activation without degranulation through tnfsf8 signaling NFKB1; MAP3K1; MAP3K7 3.14 × 10−2 Inflammation pathways
Vascular endothelial cell activation by blood coagulation factors F10; F7; MAPK1; CTGF; FOS; IRAK4; NFKB1; GNA11 3.15 × 10−2 Inflammation pathways
Inositol phosphate metabolism INPP4B; PLCL1; PIK3CA; INPP4A; PLCE1 3.77 × 10−2 Metabolic pathways
Mevalonate pathway HMGCS1; GGPS1; IDI1 4.25 × 10−2 Metabolic pathways
GABA(A) membrane hyperpolarization GABRA6; GABRA5; GABRB3 4.68 × 10−2 Nociception pathways
TGF-beta signaling MAPK1; MAP3K1; CDC42; SERPINE1; ELK1; FOS; NFKB1; MAP3K7; ANAPC5; TGFBR1 4.83 × 10−2 Signal transduction pathways
synaptic inhibition GLRA4; GLRA3 4.94 × 10−2 Nociception pathways

Table 7.

A list of statistically significant biological processes in age group 60 as compared to age group 30 (p < 0.05, FDR), sorted according to the p-value by Fisher’s exact test.

Biological Process Overlapping Entities p-Value Hit Types
Omega-3-fatty acid metabolism GGT1; CYP3A7; ELOVL2; GGT5; ALOX5; GGT7; TECR; ACOT7; CYP4A22; FADS1; CYP2D6; CYP2C18; CYP2A13 2.13 × 10−3 Metabolic pathways
Arachidonic acid metabolism CYP2E1; AKR1C3; GGT1; CYP3A7; PTGDS; GGT5; ALOX5; GGT7; ACOT7; CYP4A11; CYP4A22; CYP2D6; CYP2C18; CYP2A13 4.13 × 10−3 Metabolic pathways
JNK/MAPK signaling TRAF6; HSF1; CDC42; MAP3K3; DUSP26; DUSP9; ELK1 1.20 × 10−2 Signal transduction pathways
Proplatelet maturation RASGRP1; JAK1; FLI1; ADCY10; RASGRF1; KRAS; CSF2RB; PF4; IL11; MKL1; CSF2 1.49 × 10−2 Inflammation pathways
Neutrophil activation via adherence on endothelial cells SELL; CDC42; SELE; CR1; ACTR3; VAV1; ARPC2; NCF1 1.54 × 10−2 Inflammation pathways
Neutrophil chemotaxis CXCL5; CDC42; VAV1; MYLPF; ARPC2; NCF1; ADCY10; ITGA4; KRAS; PF4; ACTR3 1.95 × 10−2 Inflammation pathways
ERK5/MAPK7 signaling TRAF6; PML; MAP3K3; CTF1; NFE2L2 2.43 × 10−2 Signal transduction pathways
Macrophage M2-related phagocytosis MYO1G; EPS15; KRAS; CDC42; VAV1; PTPRC; MYO1H 3.05 × 10−2 Inflammation pathways
Omega-6-fatty acid metabolism CYP3A7; ELOVL2; TECR; ACOT7; CYP4A22; FADS1; CYP2D6; CYP2C18; CYP2A13 6.27 × 10−2 Metabolic pathways
Insulin action FOXK1; DUSP22; FOXS1; PTPRF; DUSP9; ADCY10; ETV3; IGFBP2; KRAS; NR2C2; DUSP26; FOXN3; FOXN4; IRS2; FOXE1; FOXD4L3; FOXD4L1; SSH1 6.34 × 10−2 Cell signaling
Glucose metabolism PFKM; ADPGK; ENO2; ALPL; PCK1; PGM3 6.38 × 10−2 Metabolic pathways
Inositol phosphate metabolism INPP4B; PIK3CD; ITPKA; INPP4A; PLCB3; MTMR3 6.38 × 10−2 Metabolic pathways
Caffeine metabolism CYP3A7; CYP4A22; CYP2D6; CYP2C18; CYP2A13 6.88 × 10−2 Metabolic pathways
CR3-mediated phagocytosis in neutrophils and macrophages MYO1G; RASGRF1; KRAS; ACTR3; ARPC2; MYO1H 7.23 × 10−2 Inflammation pathways
Adherens junction regulation DVL3; TCF7L1; CDC42; PTPRF; ZNF658; ZNF780B; SMAD5; BMP8A; HIPK3; TGFBR2; TEK; ZNF275; ZKSCAN5; NLK; WNT11; MAP3K3; MAPK4; ZNF3; ZNF563; ZNF461; HGF; ZNF418; ZNF550; RBAK; RHOQ; ARHGAP23; ARHGAP6; ARHGAP18; ARHGAP17; CRTAM; ROR2; ZNF274; IGFBP2; GDF1; PVR; ZNF417; ARHGAP22 7.23 × 10−2 Cell signaling
Platelet Activation via GPCR Signaling CDC42; WAS; RASGRP1; ARPC2; PTGIR; RASGRF1; KRAS; ACTR3 8.89 × 10−2 Inflammation pathways
Toll-like receptor-independent sterile inflammation TRAF6; BCL10; PRKCE; CDC42; HMGB1; IL1R1; KRAS 9.07 × 10−2 Inflammation pathways
Glyoxylate and glycerate metabolism HAO1; GRHPR; GLYCTK; ENO2 0.100737 Metabolic pathways

3.5. Gene Validation

To validate the age-related expression changes detected in the microarray analysis, qRT-PCR was conducted using selected genes from the top 20 most significant genes that related to aging and cognitive function. The microarray and qRT-PCR results were comparable for six genes in the age group 40 and 50 (Figure 6a–c). However, the expression of PAFAH1B3 in the age group 60 did not show a similar pattern with the microarray data. The deviation noted as the PAFAH1B3 was identified as being upregulated in the microarray, but was downregulated in age 60 by qRT-PCR analysis, demonstrating the influence of the staining dye bias, PCR primer, and microarray probe difference, efficiency of different transcriptase enzymes, and normalization procedure between these two methods [36].

Figure 6.

Figure 6

Quantitative validation of gene expression by qRT-PCR using selected genes from microarray experiment (a) age group 40 vs. age group 30, (b) age group 50 vs. age group 30, and (c) age group 60 vs. age group 30.

4. Discussion

Cognitive decline is an inevitable part of aging; however, the onset of decline can be delayed. In a previous study, we reported that advanced age was associated with increased oxidative DNA damage and protein oxidation, leading to decreased cognitive performance among healthy Malay adults in Malaysia [3]. We postulated that progressive oxidative damage induced by excessive free radicals reduced antioxidant capacity and increased proinflammatory reaction over time. Therefore, in this current study, the gene expression changes observed in the PBMCs may be linked to increased oxidative stress during aging, which may play a vital role in developing cognitive deficits. Our result also shows that DEGs found were consistent with age-related changes in ion channel activity, immune system, and cholesterol/lipid metabolism. Lu et al. (2004) proposed a clock mechanism whereby accumulating age-related DNA damage could selectively alter promoter regions of age-regulated genes [37]. Moreover, at the same time, we observed that these DEGs were highly conserved in the biological processes that were important for maintaining cognitive function, which could be the target for oxidative damage.

4.1. Alteration Patterns of Gene Expression in Different Age Groups

A gene encoded potassium voltage-gated channel (KCNA3) was differentially downregulated across ages. KCNA3 is involved in regulating neurotransmitter release [38], insulin secretion [39], neuronal excitability [40], immune response [41], apoptosis [42], and cell proliferation [43]. This ion channel gene is mainly expressed in the nervous and immune system, which alters the function or mutation, and is related to many age-related diseases (reviewed in [44]). In particular, KCNA3 hyperpolarizes the cell membrane potential and promotes Ca2+ influx through the calcium release into the cytoplasm, increasing and stimulating diverse cells signaling (reviewed in [45]). Inactivating the function may affect presynaptic action potential, increase calcium influx and neurotransmitter release, impair neuron firing, and influence synaptic transmission (reviewed in [46]). It is congruent with the data from the animal model induced-sevoflurane to impair cognition, which reported downregulation of KCNA3 at the brain hippocampus, suggesting the essential role of this gene in learning and memory [47]. Moreover, in diabetic rats with reduced insulin receptor kinase activity, the downregulated KCNA3 expression was reported associated with memory loss [48]. Conversely, in microglial, KCNA3 acts as a key regulator in neuroinflammation, whereby prolonging activated microglial may have a detrimental effect that contributes to neurodegeneration. It was reported that KCNA3 is upregulated when neurons are exposed to the β-Amyloid peptide, the main component of the senile plaques observed in the brain of AD [49]. Moreover, the immunostaining study using human brain cortices showed higher expression of KCNA3 in the cortical microglial of AD patients, strengthening the role of KCNA3 in the pathogenesis of AD [50]. Thus, it was shown that the role of KCNA3 in neurodegeneration is inconsistent, depending on the cell type.

Upregulation of the lipid mediators gene, PAFAH1B3 (platelet-activating factor acetylhydrolase), was detected in this Malay population as age increased. Expression of PAFAH1B3 was expressed primarily in the central nervous system [51], erythrocyte [52], and reproductive system [53]. This gene is known to possess a potent proinflammatory mediator in diverse physiological and pathological processes (reviewed in [54]). PAFAH acts by binding to the G-protein-coupled seven-transmembrane receptor, which activates second messenger systems [55], such as glycogen synthesis kinase (GSK-3β), which is involved in the process of phosphorylation of the microtubule-associated protein [56]. In addition, in the postmortem brains of AD patients, the activated GSK-3β inhibited Wnt signaling pathways, contributed to impaired learning and memory in hippocampal areas [57]. Moreover, high expression of PAFAH in central nervous systems, due to the phospholipase A2 (PLA2) and arachidonic acid (AA) release, may regulate inflammatory pathways, which subsequent leads to long-term neurologic deficits [51,58]. In addition, PAFAH promotes excitotoxicity by enhancing glutamate release [59] and long-term potentiation [60] and exert neurodegeneration. Various studies provided evidence that significant alteration in PAFAH expression might influence cognitive capabilities. For example, cognitive studies on patients with schizophrenia and bipolar disorder found that reduced prefrontal cognitive function was associated with genetic variation in PAFAH. The gene was reported to regulate neuronal migration, which might cause alterations to the cortical development and, subsequently, reduce GABAergic neurotransmission [61]. Meanwhile, other studies have found that increased plasma PAFAH levels in patients with CAD were associated with accelerated cognitive decline and suggested early developmental markers of AD during aging [62,63]. Interestingly, Ciabattoni et al. 2007 reported that activation of PAFAH in AD patient plasma is associated with an increase in lipid peroxidation caused by vitamin E deficiency [64]. Thus, these findings may suggest that an increase in PAFAH expression amplifies the inflammatory cascades and is implicated in neurodegeneration.

TM7sf2 was reported to be involved in cholesterol biosynthesis, which plays a vital role in cell signaling and maintenance of cell structure in the body [65]. We found that higher expression of TM7sf2 in age group 40 might be due to the high accumulation of ROS during aging. This view is supported by Belleza et al. 2013, who showed that TM7sf2 was associated with the upregulation of NF-KB and TNPα in the cellular response during stressful conditions [66]. In addition, Graham et al. (2010) observed that upregulation of TM7sf2 in response to excessive cholesterol levels exert toxicity effects by increasing oxidative stress, leading to lipid peroxidation [67]. Increased iron levels in liver tissue are also correlated with elevated cholesterol content, associated with increased expression of TM7sf2 gene, leading to increased oxidative stress responses [67]. However, the downregulation of the TM7sf2 gene was found in the astrocyte cell of AD mice, which influenced the reduction of neuron development and synaptic transmission [68,69]. However, to date, there are no reports that show the association of TM7sf2 genes with cognitive decline during aging.

In the 50-year-old subjects, the G protein-coupled regulatory gene (RGS) exhibited increased expression compared to age 30. RGS negatively modulates GPCR, a mediator of signaling transduction pathways, such as cell proliferation, cell differentiation, plasma membrane transport, and embryonic development [70]. RGS genes were reported to modulate oxidative stress and longevity in the various models, such as Drosophila models [71], astrocytoma cells [72], and Aspergillus fumigatus [73]. The finding may be explained by Wu et al. 2017, who reported that decreased RGS1 expression in insulin signaling pathways regulates the daf-16 gene and increases the expression of sod-3 and mtl-1, which play an essential role in eliminating ROS levels and promote longevity [74]. Therefore, we suggest that the high accumulation of ROS level might explain the high expression of RGS1 found in this study, as age increases. Interestingly, the transcriptomic study conducted by Leandro et al., 2018, showed promising findings that increased expression of the RGS1 gene in the PBMCs of AD patients has potential as a peripheral biomarker [75]. This supports the hypothesis that PBMCs express molecular changes that occur in the neurons of AD patients.

The growth factor beta 1 (TGF-β1) gene, an anti-inflammatory cytokine, was downregulated in the age group of 60 compared to age 30. TGFB-1 participates in regulating cell growth, apoptosis, and tissue repair after injury [76,77]. Evidence suggests that the TGF-β1 regulatory mechanism was impaired in the pathogenesis of AD, which was linked to the neuronal damage, leading to cognitive impairment [78,79,80]. Alteration in the TGFB pathway during aging causes changes in TGFB-1 release, Smad 3 activation, and microglial response during neuroinflammation [81]. It was reported that a deficiency of TGF-β1 in AD animal models was correlated with Aβ pathology and NFT formation [78,82]. In the brain, TGF-β1 is secreted by astrocytes regulating the activation of microglial, reducing the release of inflammatory cytokines and increasing reactive species. Hence, impaired TGF-β1 activation could reduce the capabilities of microglial during neuroinflammation and participating in Aβ clearance. Therefore, several studies found that TGFB-1 has potential as an anti-amyloidogenic agent by reducing Aβ, and inhibiting the formation of NFT by promoting activated microglia [83,84]. Moreover, it was found in a postmortem AD patient that the expression of mRNA TGF-β1 was negatively correlated with the formation of NFT [85], suggesting impairment of TGF-β1/Smad signaling in tau pathology. Moreover, decreased plasma levels of TGFB-1 were documented in patients with AD in multiple studies [86,87].

4.2. Biological Processes and Gene Differentially Expressed in Age

The four outstanding pathways that emerged from this study were inflammation, signal transduction, metabolic, and nociception pathways. Our data demonstrate that, in the Malay population, inflammation pathway was predominant until age 50. This may be explained as an individual progress through adulthood, with a variety of factors driving the aging process, including oxidative damage and an unhealthy lifestyle. Various studies have shown that inflammation and oxidative stress as pathophysiological processes involve cognitive decline [88,89,90]. Thus, normal aging processes associated with increased inflammation and accumulation of ROS may result in immune deficiency and drive the rapid progression of neurodegenerative disorders, such as AD [91]. However, evidence of inflammation contributing to the decline of cognitive function in healthy individuals is limited and inconsistent, although many studies in the mouse model have suggested such deficits [92]. Moreover, according to our data, when aging becomes more apparent, the metabolic pathway may become the main contributor to disease related to the progressive decline in endocrine function, body composition changes, and metabolic syndrome. Therefore, it is crucial to identify the biological processes involved in different age groups for early cognitive impairment management.

4.2.1. Platelet Activation through GPCR Signaling

We have shown that the inflammation pathway by platelet activation through GPCR signaling was affected in the age group of 40 compared to age 30. Upon cell injury, platelet agonists, such as platelet-activating factors (PAFs), secrete and bind to GPCR receptors, a family of membrane proteins with seven transmembrane domains that elicit intracellular signaling through heterotrimeric G protein [93]. As discussed earlier, PAF is a lipid second messenger in regulating inflammatory and apoptotic activity—a contributor to the neurodegenerative mechanisms associated with cognitive decline. The GPCR signaling pathway is an extremely complex pathway. It modulates diverse cellular response implicated with various pathological processes, such as obesity, type 2 Diabetes mellitus, cardiovascular, immunological disorders, infectious diseases, cancer, and neurodegenerative diseases (reviewed in [94]). In Alzheimer’s disease, GPCR is involved as a modulator of amyloid-beta generation through the modulation of α-, β-, and γ-secretases in the proteolysis of amyloid precursor protein (APP) [95].

Activation of platelets also induces the secretion of serotonin membrane receptors that modulate cell signaling. Serotonin receptor subtype 2A or 5-HTR2A belongs to the GPCR family widely distributed in the central nervous system, and has an essential role in learning and cognition (reviewed in [96]). In line with the findings of this study, several studies show age-related serotonin decline leading to cognitive decline and dementia (reviewed in [97]). A postmortem study found that loss of 5-HTR2A in the temporal lobe area, which is associated with short-term memory, is correlated with the rate of cognitive decline in AD patients [98]. Meanwhile, Lorke et al. 2006 found a decline in neurons expressing 5-HT2A in the prefrontal cortex of AD patients [99]. The severity of cognitive impairment in Alzheimer’s patients has been reported to correlate with reduced 5-HT2A binding [100]. A decrease in 5-HT2A expression is said to be directly proportional to the significant loss of neurons [101] and the formation of NFT in the AD brain (reviewed in [102]). Moreover, a cognitive study among healthy subjects reported the association of HTR2A gene variations in memory episodes [103].

4.2.2. p38 MAPK/MAPK14 Signaling

The findings from this study found that P38 mitogen activated protein kinase (MAPK) activation, as age advances, may be involved in cognitive decline progress. P38 MAPK is activated in response to inflammatory cytokines and other stimuli, including hormones, G protein-coupled ligands, and ROS [104]. Postmortem brains of AD patients confirmed that p38 MAPK activation occurs in early AD progression [105,106]. A previous study revealed that Aβ-induced P38 activation leads to increased tau phosphorylation and promotes the amyloidogenic processing of APP [107]. In addition, an increase in p38 activity was reported to be due to ROS leading to loss synapse and aggravating cognitive function [108]. Interestingly, a clinical study has reported that p38 MAPK phosphorylation in Alzheimer’s patients’ blood is positively correlated with disease duration [109].

The ASK1 gene is a member of the mitogen kinase activated protein kinase (MAPKKK or MAP3K) that activates the p38 pathway. Our data showed it was dysregulated in the age 40 group. ASK1 acts as an early sensor of ROS accumulation and plays an important role in signal transduction for homeostasis maintenance against redox imbalance [110]. Regulation of this gene is not only limited to apoptosis; it is also involved in inflammation and senescence [111]. Accumulating evidence indicates that ASK1 plays a direct role in the decline of cognitive function, especially in the pathogenesis of Alzheimer’s disease. For instance, Peel et al. (2004) found that activation of ASK1 by Aβ42 protein leading to tau phosphorylation exacerbated memory impairment in AD pathology [112]. Moreover, Aβ activates ASK1 through ROS and induces neuronal cell death [113]. The role of ROS and obesity contributing to the cognitive decline was studied by Toyama et al., 2015, showing that ASK1 is involved in cognitive decline due to long-term high-fat diets through hypoperfusion caused by hypoxia-induced injury and tumor necrosis factor alpha (TNF-α) induction [114].

4.2.3. Activation through IL-1 Signaling

Upregulation of gene interleukin-1 (IL-1) was observed in the age 50 group, and may be linked to increase IL signaling pathway activation. IL-1 is expressed by various sites, MAPK, and nuclear factor kappa B (NF-κB) cascade [115]. Previous studies have found that older individuals showed higher IL-1 expressions [116], and in AD patients, a significant elevation of circulating IL-1β serum was displayed compared to the healthy [117]. Studies on animal models implicated in IL-1 and lipopolysaccharide (LPS) have shown a role of IL-1 in decreasing specific cognitive functions, such as learning and spatial working memory [118]. These findings are also supported by several cognitive studies that report that IL-1 activation is associated with cognitive function and found that IL-1 secretion also inhibits long-term potentiation (LTP) in the hippocampus [119]. Normal or low IL-1 levels have been suggested to positively affect memory performance, but this study is limited to the animal model [119].

In the IL-1 signaling pathway, TNF-α expression was found to increase in the age of 50. TNF-α is a proinflammatory cytokine involved in mediating inflammatory responses and cognitive decline. Increased levels of TNF-α in the brain and plasma were reported to be detected in Alzheimer’s patients. Moreover, expression of TNF-α, and other systemic inflammations, such as IL-1, TGFβ, and tau protein, have been associated with MCI progression to AD [120]. A study by Sudheimer et al., 2014, supported the observation that IL-1, TNF-α, and a combination with higher cortisol, were associated with reduced hippocampal volume in healthy older participants [121]. In many brain pathologies, the TNF level-α expression was higher, which induced neuronal loss via microglial activating.

Individuals aged 50 showed dysregulation of the interleukin kinase 4 (IRAK-4) receptor expression in the IL-1 biological process. Under inflammatory conditions, IRAK4 can phosphorylate IRAK1 and induce the production of the TNF receptor associated factor 6 (TRAF6) and TGF-β kinase 1 (TAK1). This signaling molecule causes NF-κB nuclear translocation from the cytoplasm to the nucleus, resulting in the production of inflammatory cytokines and chemokines (reviewed in, [122]). From our data, the expression IRAK-4, in response to inflammation, suggests its association with cognitive decline. Studies have shown that decreased expression of IRAK-4 in mice injected with Aβ leads to a decrease in TRAF6 and NF-κB levels, which reduces gliosis by Aβ and improves mouse learning and memory [123].

4.2.4. TGF-β Signaling

Dysregulation of the TGF-β biological process was found in the age 50 group. TGF-β coordinates tissue homeostasis by regulating cytokines production, cell survival, and cell death through signal transduction, and deficit in this signaling closely relates to the inflammatory pathway and cognitive decline in AD (reviewed in [124]). In the animal model, low expression of TGF-β was associated with reduced neurogenesis and reduced response to novelty [125]. In agreement with the human study, decreased TGF-β may contribute to cognitive decline in depressed patients and Alzheimer’s patients [80]. Moreover, Alzheimer’s patients with moderate to severe NFT exhibit decreased expression of TGF-β mRNA in the superior temporal gyrus region; this deficit is closely related to NFT formation [85].

In the TGF-β signaling biological process, expression of cell division cell cycle 42 (CDC42) was found dysregulated in the age group of 50. CDC42 is a member of the Rho GTPase family, regulating various signaling pathways, including tyrosine kinase receptors, heterotrimeric G-protein coupled receptors, cytokine receptors, integrins, and responses to physical and chemical stress (reviewed in [126]. In the senescent endothelial cells, CDC42 induced upregulation of proinflammatory genes by the activation of the NF-κB pathway, contributing to chronic inflammation [127]. Moreover, other studies have shown that higher expression of CDC42 is associated with higher mortality in the human blood cells [128,129]. Deregulation of CDC42 was also reported in degenerative neuronal diseases, which act as signal transduction pathways controlling actin-microfilament organization in mediating neuronal survival, apoptosis, and dendritic growth [130]. CDC42 activity was reported to increase in hippocampal neuron cells treated with Aβ42 [131]. The neuron cells of AD patients exhibited high expression of CDC42 compared with age-matched controls [132]. Furthermore, cognitive impairment is closely correlated with synaptic loss, as reported in AD patients. Saraceno et al. 2018 reported that CDC42 expression was high in the AD brains, which postulated the synaptic compensation process to respond to the synaptic deficit [133]. However, there is no information correlating CDC42 expression in the blood to cognitive decline.

The NF-κB gene was found dysregulated in the age 50 group compared to the age 30 group. NF-κB plays an important role in the aging process as it is a key mediator of the immune response pathways, inflammation, apoptosis, and metabolism (reviewed in [134]). This is in line with the results of this study showing that expression IL-1 and TNF are also increased in this age group. Several studies have suggested that ROS might stimulate NF-κB expression, depending on cell type and pathogenesis of the disease ([135]. For example, lipid peroxidation inhibits NF-κB activity, resulting in increased neuronal death due to Aβ release [136]. The role of NF-κB subunits, such as p65, p50, and c-Rel in cognitive function has been widely reported. Cognitive impairment of cognitive memory has been found in rats with decreased expression of c-Rel [137] and decreased anxiety seen in p50-deficient mice [138]. Moreover, mice lacking p65 show deficits in spatial memory [139].

4.3. Omega-3-Fatty Acid Metabolism

Functional analysis identified that DEGs in age 60 is associated with metabolic function involving the metabolism of omega-3 long-chain polyunsaturated fatty acids (LC PUFA). Omega-3 fatty acids are composed of alpha-linolenic (ALA), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA). EPA and DHA have been widely shown to have protective effects on neurons and improve cognitive function due to their modulatory effects on synaptic plasticity and neuroinflammation [140]. The findings from epidemiological studies showed that neurological disorders, such as AD and MCI, are associated with decreased LC PUFA levels [141]. Conquer et al. (2000) reported that cognitive decline with aging is associated with a decline in plasma DHA levels [142]. In contrast, studies from Milte et al. (2011) found that MCI patients exhibited lower EPA levels in erythrocyte membranes and higher arachidonic acid (AA) levels compared to healthy control subjects [143]. However, some clinical trial studies report inconsistent findings and do not present substantial evidence to support omega-3 PUFAs as a supplement for the prevention or treatment of cognitive decline in obese adults [144].

In this omega-3-fatty acid metabolism biological process, FADS genes exhibited decreased expression in the 60-year-old group. The use of LC PUFA in the body depends on desaturase enzyme activity in the metabolic pathway of fatty acids. Dietary fatty acids are converted by the enzymes Δ-5 desaturase (D5D) and Δ-6 desaturase (D6D) through the enzymatic desaturation, and the elongation process encoded by the FADS1 and FADS2 genes [145]. Several studies reported SNPs in FAD are associated with lower lipid levels in the blood [146], glucose levels [147], and cardiovascular diseases [148]. A study by Caspi et al. (2007) reported that genetic variants modulate the effects of breastfeeding on cognitive function in the FADS gene [149] and attention-deficit hyperactivity disorder [150]. However, studies on the effects of FAD on brain integrity and cognitive function in older people are limited. It is possible that decreased FAD expression in the age 60 group impaired the desaturase enzyme function, resulting in low ALA conversion to EPA and DHA, which may affect cognitive function performance. Dietary fatty acid requirements can likely be optimized according to FAD genetic profiles, to achieve optimum intelligence.

The arachidonate 5-lipoxygenase (ALOX5) gene is one of the key regulators of cholesterol metabolism [151]. It plays a role in accelerating the conversion of arachidonic acids to leukotrienes [152]. ALOX5 expression is reported to increase in the central nervous system of Alzheimer’s patients and during the aging process. Notably, this increase was found in the hippocampus, the brain area most vulnerable to neurodegeneration, which has an important function in learning and memory formation [153]. Studies on AD transgenic mouse models prove that the ALOX5 gene is likely to modulate amyloidogenesis in AD. This is demonstrated by the genetic disruption of this gene, resulting in a significant reduction in the amyloid plaque and suggested that this effect is mediated by modulation of the γ-secretase pathway [154]. However, studies on the modulation of ALOX5 gene expression are still at an early stage, and the role of ALOX5 in cognitive decline remains unclear.

4.4. Insulin Action

Several studies have reported that aging is accompanied by insulin resistance and altered glucose metabolism. Hence, metabolic syndrome, such as diabetes, is commonly observed among elderly adults [155]. Increased ROS levels or prolonged exposure to oxidative stress during aging disrupt insulin signaling by activating a series of signaling pathways, such as NF-κB, JNK/SAPK, and p38 MAPK [156,157].

In this study, expression of the insulin-binding growth factor gene (IGFBP-2) was increased in the age group of 60. Increased expression of IGFBP-2 in individuals over age 60 may be associated with decreased insulin-like growth factor 1 (IGF-1) expression. Gockerman et al., 1995, reported a higher level of IGFBP-2 acts to suppress the biological effects of IGF-1 [158]. In the systemic circulation, the bioavailability and functions of IGF-l were mainly regulated by IGFBPs. However, the mechanism of interaction of IGF-1 activity by IGFBP-2 has not been fully elucidated.

Studies suggest that low IGF-1 contributing to cognitive decline may be due to nutrient deficiencies and deficient protein intake [159], which is commonly observed in older people [160]. A similar pattern of the result obtained in our previous work demonstrated that the age group 60 displayed significantly lower albumin concentration levels than other age groups [35]. Previous studies have shown that age and IGF-1 levels are correlated with processing speed as measured by the digit symbol test in healthy older men [161]. Lower levels of IGF-1 are associated with reduced processing speeds, but do not affect fluid intelligence and memory [162]. Furthermore, IGF-1 is directly associated with MMSE scores in older adults with cognitive impairment [163].

5. Conclusions

In conclusion, this study provides comprehensive blood transcriptomic profiling that define the gene expression changes in different age groups. We identified thousands of genes that show upregulation and downregulation of expressions enriched in inflammation, ion channel activity, signal transduction, and metabolism. We further showed that ROS accumulation during aging might activate gene sets involved in biological processes common to inflammation and the metabolic pathway in different age groups. The overall finding from this study is summarized in Figure 7. These biological processes are possibly the culprits for the vulnerability of cognitive decline during aging in the Malay population. Furthermore, it would be useful to perform a prospective study and combine blood measures across different modalities, such as proteins, metabolites, and gene expression, for further biomarker accuracy.

Figure 7.

Figure 7

The summary on the profile of gene expression changes and biological processes associated with cognitive decline in age groups.

Author Contributions

W.Z.W.N., S.M., Y.A.M.Y. and H.A.D. conceived and designed the study; N.F.A.S., Z.H.A.B. and A.I.Z.A.H. performed data collection, experiments and data analysis, and interpretation; N.F.A.S. and H.A.D. drafted and reviewed the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Ministry of Higher Education, Malaysia, under the Long-term Research Grant Scheme (LRGS/BU/2012/UKM-UKM/K/04).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and study design was approved by the Research and Ethics Committee of Universiti Kebangsaan Malaysia Medical Centre (UKM 1.5.3.5/244/LRGS/BU/2012/UKM_UKM/K04).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

Data available on request.

Conflicts of Interest

All authors declare that there is no conflict of interests.

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Department of Statistics Malaysia Official Portal . Social Statistics Bulletin, Malaysia. Department of Statistics Malaysia Official Portal; Kuala Lumpur, Malaysia: 2008. [Google Scholar]
  • 2.Mafauzy M. The problems and challenges of the aging population of Malaysia. Malays. J. Med. Sci. MJMS. 2000;7:1. [PMC free article] [PubMed] [Google Scholar]
  • 3.Abdul Sani N.F., Ahmad Damanhuri M.H., Amir Hamzah A.I.Z., Abu Bakar Z.H., Tan J.-K., Nor Aripin K.N., Mohd Rani M.D., Noh N.A., Shamaan N.A., Razali R. DNA damage and protein oxidation associated with ageing correlate with cognitive dysfunction in a Malaysian population. Free Radic. Res. 2018;52:1000–1009. doi: 10.1080/10715762.2018.1506877. [DOI] [PubMed] [Google Scholar]
  • 4.Murman D.L. The impact of age on cognition. Semin. Hear. 2015;36:111–121. doi: 10.1055/s-0035-1555115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Salthouse T.A. When does age-related cognitive decline begin? Neurobiol. Aging. 2009;30:507–514. doi: 10.1016/j.neurobiolaging.2008.09.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Tramutola A., Triplett J.C., Di Domenico F., Niedowicz D.M., Murphy M.P., Coccia R., Perluigi M., Butterfield D.A. Alteration of mTOR signaling occurs early in the progression of Alzheimer disease (AD): Analysis of brain from subjects with pre-clinical AD, amnestic mild cognitive impairment and late-stage AD. J. Neurochem. 2015;133:739–749. doi: 10.1111/jnc.13037. [DOI] [PubMed] [Google Scholar]
  • 7.Aluise C.D., Robinson R.A.S., Beckett T.L., Murphy M.P., Cai J., Pierce W.M., Markesbery W.R., Butterfield D.A. Preclinical Alzheimer disease: Brain oxidative stress, Aβ peptide and proteomics. Neurobiol. Dis. 2010;39:221–228. doi: 10.1016/j.nbd.2010.04.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Pieperhoff P., Hömke L., Schneider F., Habel U., Shah N.J., Zilles K., Amunts K. Deformation field morphometry reveals age-related structural differences between the brains of adults up to 51 years. J. Neurosci. 2008;28:828–842. doi: 10.1523/JNEUROSCI.3732-07.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Goodro M., Sameti M., Patenaude B., Fein G. Age effect on subcortical structures in healthy adults. Psychiatry Res. Neuroimaging. 2012;203:38–45. doi: 10.1016/j.pscychresns.2011.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Hsu J.-L., Leemans A., Bai C.-H., Lee C.-H., Tsai Y.-F., Chiu H.-C., Chen W.-H. Gender differences and age-related white matter changes of the human brain: A diffusion tensor imaging study. Neuroimage. 2008;39:566–577. doi: 10.1016/j.neuroimage.2007.09.017. [DOI] [PubMed] [Google Scholar]
  • 11.Bennett I.J., Madden D.J., Vaidya C.J., Howard D.V., Howard J.H., Jr. Age-related differences in multiple measures of white matter integrity: A diffusion tensor imaging study of healthy aging. Hum. Brain Mapp. 2010;31:378–390. doi: 10.1002/hbm.20872. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Braak H., Del Tredici K. The pathological process underlying Alzheimer’s disease in individuals under thirty. Acta Neuropathol. 2011;121:171–181. doi: 10.1007/s00401-010-0789-4. [DOI] [PubMed] [Google Scholar]
  • 13.Del Tredici K., Braak H. Neurofibrillary changes of the Alzheimer type in very elderly individuals: Neither inevitable nor benign: Commentary on “No disease in the brain of a 115-year-old woman”. Neurobiol. Aging. 2008;29:1133–1136. doi: 10.1016/j.neurobiolaging.2008.04.016. [DOI] [PubMed] [Google Scholar]
  • 14.Kadota T., Horinouchi T., Kuroda C. Development and aging of the cerebrum: Assessment with proton MR spectroscopy. Am. J. Neuroradiol. 2001;22:128–135. [PMC free article] [PubMed] [Google Scholar]
  • 15.Haga K.K., Khor Y.P., Farrall A., Wardlaw J.M. A systematic review of brain metabolite changes, measured with 1H magnetic resonance spectroscopy, in healthy aging. Neurobiol. Aging. 2009;30:353–363. doi: 10.1016/j.neurobiolaging.2007.07.005. [DOI] [PubMed] [Google Scholar]
  • 16.Mosca I., Wright R.E. Effect of retirement on cognition: Evidence from the Irish marriage bar. Demography. 2018;55:1317–1341. doi: 10.1007/s13524-018-0682-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Lee T., Thalamuthu A., Henry J., Trollor J., Ames D., Wright M., Sachdev P. Genetic and environmental influences on language ability in older adults: Findings from the older Australian Twins Study. Behav. Genet. 2018;48:187–197. doi: 10.1007/s10519-018-9897-z. [DOI] [PubMed] [Google Scholar]
  • 18.Ericsson M., Lundholm C., Fors S., Aslan A.K.D., Zavala C., Reynolds C.A., Pedersen N.L. Childhood social class and cognitive aging in the Swedish Adoption/Twin Study of Aging. Proc. Natl. Acad. Sci. USA. 2017;114:7001–7006. doi: 10.1073/pnas.1620603114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lim S.C., Gan W.Y., Chan Y.M. The effects of socio-demographic characteristics, nutritional status, physical activity and physical function on cognitive function of community-dwelling older adults in the Klang Valley, Malaysia. Malays. J. Med. Health Sci. 2020;16:163–169. [Google Scholar]
  • 20.Rashid A., Rahmah M. Role of family support in older adults defaulting treatment for depression: A case-control study. J. Asian J. Gerontol Geriatr. Malas. 2011;6:29–34. [Google Scholar]
  • 21.Ng T.-P., Niti M., Chiam P.-C., Kua E.-H. Ethnic and educational differences in cognitive test performance on mini-mental state examination in Asians. Am. J. Geriatr. Psychiatry. 2007;15:130–139. doi: 10.1097/01.JGP.0000235710.17450.9a. [DOI] [PubMed] [Google Scholar]
  • 22.Tan C., Tai E.S., Tan C., Chia K., Lee J., Chew S., Ordovas J. APOE polymorphism and lipid profile in three ethnic groups in the Singapore population. Atherosclerosis. 2003;170:253–260. doi: 10.1016/S0021-9150(03)00232-6. [DOI] [PubMed] [Google Scholar]
  • 23.Seet W.T., Anne T.J.A.M., Yen T.S. Apolipoprotein E genotyping in the Malay, Chinese and Indian ethnic groups in Malaysia—a study on the distribution of the different apoE alleles and genotypes. Clin. Chim. Acta. 2004;340:201–205. doi: 10.1016/j.cccn.2003.11.001. [DOI] [PubMed] [Google Scholar]
  • 24.Mahley R.W. Apolipoprotein E: From cardiovascular disease to neurodegenerative disorders. J. Mol. Med. 2016;94:739–746. doi: 10.1007/s00109-016-1427-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Heng D., Lee J., Chew S., Tan B., Hughes K., Chia K. Incidence of ischaemic heart disease and stroke in Chinese, Malays and Indians in Singapore: Singapore Cardiovascular Cohort Study. Ann. Acad. Med. Singap. 2000;29:231–236. [PubMed] [Google Scholar]
  • 26.Razali R., Baharudin A., Jaafar N.R.N., Sidi H., Rosli A.H., Hooi K.B. Factors associated with mild cognitive impairment among elderly patients attending medical clinics in Universiti Kebangsaan Malaysia Medical Centre. Sains Malays. 2012;41:641–647. [Google Scholar]
  • 27.Pu’un B.I., Othman Z., Drahman I. Dementia among elderly Melanau: A community survey of an indigenous people in East Malaysia. Int. Med. J. 2014;21:1–4. [Google Scholar]
  • 28.Janelidze S., Stomrud E., Palmqvist S., Zetterberg H., Van Westen D., Jeromin A., Song L., Hanlon D., Hehir C.A.T., Baker D. Plasma β-amyloid in Alzheimer’s disease and vascular disease. Sci. Rep. 2016;6:1–11. doi: 10.1038/srep26801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Cosentino S.A., Stern Y., Sokolov E., Scarmeas N., Manly J.J., Tang M.X., Schupf N., Mayeux R.P. Plasma β-amyloid and cognitive decline. Arch. Neurol. 2010;67:1485–1490. doi: 10.1001/archneurol.2010.189. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Ray S., Britschgi M., Herbert C., Takeda-Uchimura Y., Boxer A., Blennow K., Friedman L.F., Galasko D.R., Jutel M., Karydas A. Classification and prediction of clinical Alzheimer’s diagnosis based on plasma signaling proteins. Nat. Med. 2007;13:1359–1362. doi: 10.1038/nm1653. [DOI] [PubMed] [Google Scholar]
  • 31.Fehlbaum-Beurdeley P., Jarrige-Le Prado A.C., Pallares D., Carrière J., Guihal C., Soucaille C., Rouet F., Drouin D., Sol O., Jordan H. Toward an Alzheimer’s disease diagnosis via high-resolution blood gene expression. Alzheimer’s Dement. 2010;6:25–38. doi: 10.1016/j.jalz.2009.07.001. [DOI] [PubMed] [Google Scholar]
  • 32.Grünblatt E., Bartl J., Zehetmayer S., Ringel T.M., Bauer P., Riederer P., Jacob C.P. Gene expression as peripheral biomarkers for sporadic Alzheimer’s disease. J. Alzheimer’s Dis. 2009;16:627–634. doi: 10.3233/JAD-2009-0996. [DOI] [PubMed] [Google Scholar]
  • 33.Bondar G., Cadeiras M., Wisniewski N., Maque J., Chittoor J., Chang E., Bakir M., Starling C., Shahzad K., Ping P. Comparison of whole blood and peripheral blood mononuclear cell gene expression for evaluation of the perioperative inflammatory response in patients with advanced heart failure. PLoS ONE. 2014;9:e115097. doi: 10.1371/journal.pone.0115097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Min J.L., Barrett A., Watts T., Pettersson F.H., Lockstone H.E., Lindgren C.M., Taylor J.M., Allen M., Zondervan K.T., McCarthy M.I. Variability of gene expression profiles in human blood and lymphoblastoid cell lines. BMC Genom. 2010;11:1–14. doi: 10.1186/1471-2164-11-96. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Abu Bakar Z.H., Damanhuri H.A., Makpol S., Wan Kamaruddin W.M.A., Abdul Sani N.F., Amir Hamzah A.I.Z., Nor Aripin K.N., Mohd Rani M.D., Noh N.A., Razali R. Effect of age on the protein profile of healthy Malay adults and its association with cognitive function competency. J. Alzheimer’s Dis. 2019;70:S43–S62. doi: 10.3233/JAD-180511. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Morey J.S., Ryan J.C., Van Dolah F.M. Microarray validation: Factors influencing correlation between oligonucleotide microarrays and real-time PCR. Biol. Proced. Online. 2006;8:175–193. doi: 10.1251/bpo126. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Lu T., Pan Y., Kao S.-Y., Li C., Kohane I., Chan J., Yankner B.A. Gene regulation and DNA damage in the ageing human brain. Nature. 2004;429:883–891. doi: 10.1038/nature02661. [DOI] [PubMed] [Google Scholar]
  • 38.Birkner K., Wasser B., Ruck T., Thalman C., Luchtman D., Pape K., Schmaul S., Bitar L., Krämer-Albers E.-M., Stroh A. β1-Integrin—And K V 1.3 channel—Dependent signaling stimulates glutamate release from Th17 cells. J. Clin. Investig. 2020;130 doi: 10.1172/JCI126381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Choi B.H., Hahn S.J. Kv1. 3: A potential pharmacological target for diabetes. Acta Pharmacol. Sin. 2010;31:1031–1035. doi: 10.1038/aps.2010.133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Rasmussen H.B., Trimmer J.S. The voltage-dependent K+ channel family. Oxf. Handb. Neuronal Ion Channels. 2019 doi: 10.1093/oxfordhb/9780190669164.013.1. [DOI] [Google Scholar]
  • 41.Wang J., Xiang M. Targeting Potassium Channels K v1. 3 and KCa3. 1: Routes to Selective Immunomodulators in Autoimmune Disorder Treatment? Pharmacother. J. Hum. Pharmacol. Drug Ther. 2013;33:515–528. doi: 10.1002/phar.1236. [DOI] [PubMed] [Google Scholar]
  • 42.Leanza L., Henry B., Sassi N., Zoratti M., Chandy K.G., Gulbins E., Szabò I. Inhibitors of mitochondrial Kv1. 3 channels induce Bax/Bak-independent death of cancer cells. EMBO Mol. Med. 2012;4:577–593. doi: 10.1002/emmm.201200235. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Comes N., Bielanska J., Vallejo-Gracia A., Serrano-Albarrás A., Marruecos L., Gómez D., Soler C., Condom E., Ramón y Cajal S., Hernández-Losa J. The voltage-dependent K+ channels Kv1. 3 and Kv1. 5 in human cancer. Front. Physiol. 2013;4:283. doi: 10.3389/fphys.2013.00283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Perez-Verdaguer M., Capera J., Serrano-Novillo C., Estadella I., Sastre D., Felipe A. The voltage-gated potassium channel Kv1. 3 is a promising multitherapeutic target against human pathologies. Expert Opin. Ther. Targets. 2016;20:577–591. doi: 10.1517/14728222.2016.1112792. [DOI] [PubMed] [Google Scholar]
  • 45.Pérez-García M.T., Cidad P., López-López J.R. The secret life of ion channels: Kv1. 3 potassium channels and proliferation. Am. J. Physiol. Cell Physiol. 2018;314:C27–C42. doi: 10.1152/ajpcell.00136.2017. [DOI] [PubMed] [Google Scholar]
  • 46.Dodson P.D., Forsythe I.D. Presynaptic K+ channels: Electrifying regulators of synaptic terminal excitability. Trends Neurosci. 2004;27:210–217. doi: 10.1016/j.tins.2004.02.012. [DOI] [PubMed] [Google Scholar]
  • 47.Song S.-Y., Meng X.-W., Xia Z., Liu H., Zhang J., Chen Q.-C., Liu H.-Y., Ji F.-H., Peng K. Cognitive impairment and transcriptomic profile in hippocampus of young mice after multiple neonatal exposures to sevoflurane. Aging. 2019;11:8386. doi: 10.18632/aging.102326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Das P., Parsons A., Scarborough J., Hoffman J., Wilson J., Thompson R., Overton J., Fadool D. Electrophysiological and behavioral phenotype of insulin receptor defective mice. Physiol. Behav. 2005;86:287–296. doi: 10.1016/j.physbeh.2005.08.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Maezawa I., Jenkins D.P., Jin B.E., Wulff H. Microglial KCa3. 1 channels as a potential therapeutic target for Alzheimer’s disease. Int. J. Alzheimer’s Dis. 2012;2012 doi: 10.1155/2012/868972. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Rangaraju S., Gearing M., Jin L.-W., Levey A. Potassium channel Kv1. 3 is highly expressed by microglia in human Alzheimer’s disease. J. Alzheimer’s Dis. 2015;44:797–808. doi: 10.3233/JAD-141704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Bazan N.G. The neuromessenger platelet-activating factor in plasticity and neurodegeneration. Prog. Brain Res. 1998;118:281–291. doi: 10.1016/s0079-6123(08)63215-x. [DOI] [PubMed] [Google Scholar]
  • 52.Karasawa K., Shirakura M., Harada A., Satoh N., Yokoyama K., Setaka M., Inoue K. Red blood cells highly express type I platelet-activating factor-acetylhydrolase (PAF-AH) which consists of the α1/α2 complex. J. Biochem. 2005;138:509–517. doi: 10.1093/jb/mvi144. [DOI] [PubMed] [Google Scholar]
  • 53.Koizumi H., Yamaguchi N., Hattori M., Ishikawa T.-O., Aoki J., Taketo M.M., Inoue K., Arai H. Targeted disruption of intracellular type I platelet activating factor-acetylhydrolase catalytic subunits causes severe impairment in spermatogenesis. J. Biol. Chem. 2003;278:12489–12494. doi: 10.1074/jbc.M211836200. [DOI] [PubMed] [Google Scholar]
  • 54.Prescott S.M., Zimmerman G.A., Stafforini D.M., McIntyre T.M. Platelet-activating factor and related lipid mediators. Annu. Rev. Biochem. 2000;69:419–445. doi: 10.1146/annurev.biochem.69.1.419. [DOI] [PubMed] [Google Scholar]
  • 55.Honda Z.-I., Ishii S., Shimizu T. Platelet-activating factor receptor. J. Biochem. 2002;131:773–779. doi: 10.1093/oxfordjournals.jbchem.a003164. [DOI] [PubMed] [Google Scholar]
  • 56.Tong N., Sanchez J.F., Maggirwar S.B., Ramirez S.H., Guo H., Dewhurst S., Gelbard H.A. Activation of glycogen synthase kinase 3 beta (GSK-3β) by platelet activating factor mediates migration and cell death in cerebellar granule neurons. Eur. J. Neurosci. 2001;13:1913–1922. doi: 10.1046/j.0953-816x.2001.01572.x. [DOI] [PubMed] [Google Scholar]
  • 57.Caricasole A., Copani A., Caraci F., Aronica E., Rozemuller A.J., Caruso A., Storto M., Gaviraghi G., Terstappen G.C., Nicoletti F. Induction of Dickkopf-1, a negative modulator of the Wnt pathway, is associated with neuronal degeneration in Alzheimer’s brain. J. Neurosci. 2004;24:6021–6027. doi: 10.1523/JNEUROSCI.1381-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Aukrust P., Halvorsen B., Ueland T., Michelsen A.E., Skjelland M., Gullestad L., Yndestad A., Otterdal K. Activated platelets and atherosclerosis. Expert Rev. Cardiovasc. Ther. 2010;8:1297–1307. doi: 10.1586/erc.10.92. [DOI] [PubMed] [Google Scholar]
  • 59.Xu Y., Tao Y.-X. Involvement of the NMDA receptor/nitric oxide signal pathway in platelet-activating factor-induced neurotoxicity. Neuroreport. 2004;15:263–266. doi: 10.1097/00001756-200402090-00010. [DOI] [PubMed] [Google Scholar]
  • 60.Chen C., Magee J.C., Marcheselli V., Hardy M., Bazan N.G. Attenuated LTP in hippocampal dentate gyrus neurons of mice deficient in the PAF receptor. J. Neurophysiol. 2001;85:384–390. doi: 10.1152/jn.2001.85.1.384. [DOI] [PubMed] [Google Scholar]
  • 61.Pancoast M., Dobyns W., Golden J.A. Interneuron deficits in patients with the Miller-Dieker syndrome. Acta Neuropathol. 2005;109:400–404. doi: 10.1007/s00401-004-0979-z. [DOI] [PubMed] [Google Scholar]
  • 62.Mazereeuw G., Herrmann N., Bennett S.A., Swardfager W., Xu H., Valenzuela N., Fai S., Lanctôt K.L. Platelet activating factors in depression and coronary artery disease: A potential biomarker related to inflammatory mechanisms and neurodegeneration. Neurosci. Biobehav. Rev. 2013;37:1611–1621. doi: 10.1016/j.neubiorev.2013.06.010. [DOI] [PubMed] [Google Scholar]
  • 63.Satoh F., Imaizumi T., Kawamura Y., Yoshida H., Takamatsu S., Takamatsu M. Increased activity of the platelet-activating factor acetylhydrolase in plasma low density lipoprotein from patients with essential hypertension. Prostaglandins. 1989;37:673–682. doi: 10.1016/0090-6980(89)90104-4. [DOI] [PubMed] [Google Scholar]
  • 64.Ciabattoni G., Porreca E., Di Febbo C., Di Iorio A., Paganelli R., Bucciarelli T., Pescara L., Del Re L., Giusti C., Falco A. Determinants of platelet activation in Alzheimer’s disease. Neurobiol. Aging. 2007;28:336–342. doi: 10.1016/j.neurobiolaging.2005.12.011. [DOI] [PubMed] [Google Scholar]
  • 65.Bennati A.M., Schiavoni G., Franken S., Piobbico D., Della Fazia M.A., Caruso D., De Fabiani E., Benedetti L., Cusella De Angelis M.G., Gieselmann V. Disruption of the gene encoding 3β-hydroxysterol Δ14-reductase (Tm7sf2) in mice does not impair cholesterol biosynthesis. FEBS J. 2008;275:5034–5047. doi: 10.1111/j.1742-4658.2008.06637.x. [DOI] [PubMed] [Google Scholar]
  • 66.Bellezza I., Roberti R., Gatticchi L., Del Sordo R., Rambotti M.G., Marchetti M.C., Sidoni A., Minelli A. A novel role for Tm7sf2 gene in regulating TNFα expression. PLoS ONE. 2013;8:e68017. doi: 10.1371/journal.pone.0068017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Graham R.M., Chua A.C., Carter K.W., Delima R.D., Johnstone D., Herbison C.E., Firth M.J., O’Leary R., Milward E.A., Olynyk J.K. Hepatic iron loading in mice increases cholesterol biosynthesis. Hepatology. 2010;52:462–471. doi: 10.1002/hep.23712. [DOI] [PubMed] [Google Scholar]
  • 68.Preman P., Alfonso-Triguero M., Alberdi E., Verkhratsky A., Arranz A.M. Astrocytes in Alzheimer’s Disease: Pathological Significance and Molecular Pathways. Cells. 2021;10:540. doi: 10.3390/cells10030540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69.Orre M., Kamphuis W., Osborn L.M., Jansen A.H., Kooijman L., Bossers K., Hol E.M. Isolation of glia from Alzheimer’s mice reveals inflammation and dysfunction. Neurobiol. Aging. 2014;35:2746–2760. doi: 10.1016/j.neurobiolaging.2014.06.004. [DOI] [PubMed] [Google Scholar]
  • 70.De Vries L., Zheng B., Fischer T., Elenko E., Farquhar M.G. The regulator of G protein signaling family. Annu. Rev. Pharmacol. Toxicol. 2000;40:235–271. doi: 10.1146/annurev.pharmtox.40.1.235. [DOI] [PubMed] [Google Scholar]
  • 71.Lin Y.R., Kim K., Yang Y., Ivessa A., Sadoshima J., Park Y. Regulation of longevity by regulator of G-protein signaling protein, Loco. Aging Cell. 2011;10:438–447. doi: 10.1111/j.1474-9726.2011.00678.x. [DOI] [PubMed] [Google Scholar]
  • 72.Zmijewski J.W., Song L., Harkins L., Cobbs C.S., Jope R.S. Oxidative stress and heat shock stimulate RGS2 expression in 1321N1 astrocytoma cells. Arch. Biochem. Biophys. 2001;392:192–196. doi: 10.1006/abbi.2001.2430. [DOI] [PubMed] [Google Scholar]
  • 73.Shin K.-S., Park H.-S., Kim Y.-H., Yu J.-H. Comparative proteomic analyses reveal that FlbA down-regulates gliT expression and SOD activity in Aspergillus fumigatus. J. Proteom. 2013;87:40–52. doi: 10.1016/j.jprot.2013.05.009. [DOI] [PubMed] [Google Scholar]
  • 74.Wu M., Kang X., Wang Q., Zhou C., Mohan C., Peng A. Regulator of G protein signaling-1 modulates paraquat-induced oxidative stress and longevity via the insulin like signaling pathway in Caenorhabditis elegans. Toxicol. Lett. 2017;273:97–105. doi: 10.1016/j.toxlet.2017.03.027. [DOI] [PubMed] [Google Scholar]
  • 75.Leandro G.S., Evangelista A.F., Lobo R.R., Xavier D.J., Moriguti J.C., Sakamoto-Hojo E.T. Changes in expression profiles revealed by transcriptomic analysis in peripheral blood mononuclear cells of Alzheimer’s disease patients. J. Alzheimer’s Dis. 2018;66:1483–1495. doi: 10.3233/JAD-170205. [DOI] [PubMed] [Google Scholar]
  • 76.Li M.O., Wan Y.Y., Sanjabi S., Robertson A.-K.L., Flavell R.A. Transforming growth factor-β regulation of immune responses. Annu. Rev. Immunol. 2006;24:99–146. doi: 10.1146/annurev.immunol.24.021605.090737. [DOI] [PubMed] [Google Scholar]
  • 77.ten Dijke P., Hill C.S. New insights into TGF-β–Smad signalling. Trends Biochem. Sci. 2004;29:265–273. doi: 10.1016/j.tibs.2004.03.008. [DOI] [PubMed] [Google Scholar]
  • 78.Tesseur I., Zou K., Esposito L., Bard F., Berber E., Van Can J., Lin A.H., Crews L., Tremblay P., Mathews P. Deficiency in neuronal TGF-β signaling promotes neurodegeneration and Alzheimer’s pathology. J. Clin. Investig. 2006;116:3060–3069. doi: 10.1172/JCI27341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Block M., Zecca L., Hong J. Microglia-mediated neurotoxicity: Uncovering the molecular mechanisms. Nat. Rev. Neurosci. 2007;8:57–69. doi: 10.1038/nrn2038. [DOI] [PubMed] [Google Scholar]
  • 80.Caraci F., Spampinato S., Sortino M.A., Bosco P., Battaglia G., Bruno V., Drago F., Nicoletti F., Copani A. Dysfunction of TGF-β1 signaling in Alzheimer’s disease: Perspectives for neuroprotection. Cell Tissue Res. 2012;347:291–301. doi: 10.1007/s00441-011-1230-6. [DOI] [PubMed] [Google Scholar]
  • 81.Tichauer J.E., von Bernhardi R. Transforming growth factor-β stimulates β amyloid uptake by microglia through Smad3-dependent mechanisms. J. Neurosci. Res. 2012;90:1970–1980. doi: 10.1002/jnr.23082. [DOI] [PubMed] [Google Scholar]
  • 82.Lesné S., Docagne F., Gabriel C.l., Liot G., Lahiri D.K., Buée L., Plawinski L., Delacourte A., MacKenzie E.T., Buisson A. Transforming growth factor-β1 potentiates amyloid-β generation in astrocytes and in transgenic mice. J. Biol. Chem. 2003;278:18408–18418. doi: 10.1074/jbc.M300819200. [DOI] [PubMed] [Google Scholar]
  • 83.Wyss-Coray T., Lin C., Yan F., Yu G.-Q., Rohde M., McConlogue L., Masliah E., Mucke L. TGF-β1 promotes microglial amyloid-β clearance and reduces plaque burden in transgenic mice. Nat. Med. 2001;7:612–618. doi: 10.1038/87945. [DOI] [PubMed] [Google Scholar]
  • 84.Caraci F., Battaglia G., Busceti C., Biagioni F., Mastroiacovo F., Bosco P., Drago F., Nicoletti F., Sortino M.A., Copani A. TGF-β1 protects against Aβ-neurotoxicity via the phosphatidylinositol-3-kinase pathway. Neurobiol. Dis. 2008;30:234–242. doi: 10.1016/j.nbd.2008.01.007. [DOI] [PubMed] [Google Scholar]
  • 85.Luterman J.D., Haroutunian V., Yemul S., Ho L., Purohit D., Aisen P.S., Mohs R., Pasinetti G.M. Cytokine gene expression as a function of the clinical progression of Alzheimer disease dementia. Arch. Neurol. 2000;57:1153–1160. doi: 10.1001/archneur.57.8.1153. [DOI] [PubMed] [Google Scholar]
  • 86.De Servi B., La Porta C., Bontempelli M., Comolli R. Decrease of TGF-β1 plasma levels and increase of nitric oxide synthase activity in leukocytes as potential biomarkers of Alzheimer’s disease. Exp. Gerontol. 2002;37:813–821. doi: 10.1016/S0531-5565(02)00018-9. [DOI] [PubMed] [Google Scholar]
  • 87.Juraskova B., Andrys C., Holmerova I., Solichova D., Hrnciarikova D., Vankova H., Vasatko T., Krejsek J. Transforming growth factor beta and soluble endoglin in the healthy senior and in Alzheimer’s disease patients. J. Nutr. Health Aging. 2010;14:758–761. doi: 10.1007/s12603-010-0325-1. [DOI] [PubMed] [Google Scholar]
  • 88.Candore G., Bulati M., Caruso C., Castiglia L., Colonna-Romano G., Di Bona D., Duro G., Lio D., Matranga D., Pellicano M. Inflammation, cytokines, immune response, apolipoprotein E, cholesterol, and oxidative stress in Alzheimer disease: Therapeutic implications. Rejuvenation Res. 2010;13:301–313. doi: 10.1089/rej.2009.0993. [DOI] [PubMed] [Google Scholar]
  • 89.Baierle M., Nascimento S.N., Moro A.M., Brucker N., Freitas F., Gauer B., Durgante J., Bordignon S., Zibetti M., Trentini C.M. Relationship between inflammation and oxidative stress and cognitive decline in the institutionalized elderly. Oxidative Med. Cell. Longev. 2015;2015 doi: 10.1155/2015/804198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90.Di Penta A., Moreno B., Reix S., Fernandez-Diez B., Villanueva M., Errea O., Escala N., Vandenbroeck K., Comella J.X., Villoslada P. Oxidative stress and proinflammatory cytokines contribute to demyelination and axonal damage in a cerebellar culture model of neuroinflammation. PLoS ONE. 2013;8:e54722. doi: 10.1371/journal.pone.0054722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 91.Russo I., Barlati S., Bosetti F. Effects of neuroinflammation on the regenerative capacity of brain stem cells. J. Neurochem. 2011;116:947–956. doi: 10.1111/j.1471-4159.2010.07168.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 92.Hajjar I., Hayek S.S., Goldstein F.C., Martin G., Jones D.P., Quyyumi A. Oxidative stress predicts cognitive decline with aging in healthy adults: An observational study. J. Neuroinflamm. 2018;15:1–7. doi: 10.1186/s12974-017-1026-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 93.Perez D.M. From plants to man: The GPCR “tree of life”. Mol. Pharmacol. 2005;67:1383–1384. doi: 10.1124/mol.105.011890. [DOI] [PubMed] [Google Scholar]
  • 94.Heng B.C., Aubel D., Fussenegger M. An overview of the diverse roles of G-protein coupled receptors (GPCRs) in the pathophysiology of various human diseases. Biotechnol. Adv. 2013;31:1676–1694. doi: 10.1016/j.biotechadv.2013.08.017. [DOI] [PubMed] [Google Scholar]
  • 95.De Strooper B., Vassar R., Golde T. The secretases: Enzymes with therapeutic potential in Alzheimer disease. Nat. Rev. Neurol. 2010;6:99–107. doi: 10.1038/nrneurol.2009.218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96.Millan M., Marin P., Bockaert J., Mannoury la Cour C. Signaling at G-protein-coupled serotonin receptors: Recent advances and future research directions. Trends Pharmacol. Sci. 2008;29:454–464. doi: 10.1016/j.tips.2008.06.007. [DOI] [PubMed] [Google Scholar]
  • 97.Zhang G., Stackman R.W., Jr. The role of serotonin 5-HT2A receptors in memory and cognition. Front. Pharmacol. 2015;6:225. doi: 10.3389/fphar.2015.00225. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 98.Lai M., Tsang S., Alder J., Keene J., Hope T., Esiri M., Francis P., Chen C. Loss of serotonin 5-HT 2A receptors in the postmortem temporal cortex correlates with rate of cognitive decline in Alzheimer’s disease. Psychopharmacology. 2005;179:673–677. doi: 10.1007/s00213-004-2077-2. [DOI] [PubMed] [Google Scholar]
  • 99.Lorke D.E., Lu G., Cho E., Yew D.T. Serotonin 5-HT 2A and 5-HT 6 receptors in the prefrontal cortex of Alzheimer and normal aging patients. BMC Neurosci. 2006;7:1–8. doi: 10.1186/1471-2202-7-36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 100.Versijpt J., Van Laere K., Dumont F., Decoo D., Vandecapelle M., Santens P., Goethals I., Audenaert K., Slegers G., Dierckx R.A. Imaging of the 5-HT2A system: Age-, gender-, and Alzheimer’s disease-related findings. Neurobiol. Aging. 2003;24:553–561. doi: 10.1016/S0197-4580(02)00137-9. [DOI] [PubMed] [Google Scholar]
  • 101.Christensen R., Marcussen A., Wörtwein G., Knudsen G., Aznar S. Aβ (1–42) injection causes memory impairment, lowered cortical and serum BDNF levels, and decreased hippocampal 5-HT2A levels. Exp. Neurol. 2008;210:164–171. doi: 10.1016/j.expneurol.2007.10.009. [DOI] [PubMed] [Google Scholar]
  • 102.Curcio C.A., Kemper T. Nucleus raphe dorsalis in dementia of the Alzheimer type: Neurofibrillary changes and neuronal packing density. J. Neuropathol. Exp. Neurol. 1984;43:359–368. doi: 10.1097/00005072-198407000-00001. [DOI] [PubMed] [Google Scholar]
  • 103.de Quervain D.J., Henke K., Aerni A., Coluccia D., Wollmer M.A., Hock C., Nitsch R.M., Papassotiropoulos A. A functional genetic variation of the 5-HT2a receptor affects human memory. Nat. Neurosci. 2003;6:1141–1142. doi: 10.1038/nn1146. [DOI] [PubMed] [Google Scholar]
  • 104.Cuadrado A., Nebreda A.R. Mechanisms and functions of p38 MAPK signalling. Biochem. J. 2010;429:403–417. doi: 10.1042/BJ20100323. [DOI] [PubMed] [Google Scholar]
  • 105.Sun A., Liu M., Nguyen X.V., Bing G. P38 MAP kinase is activated at early stages in Alzheimer’s disease brain. Exp. Neurol. 2003;183:394–405. doi: 10.1016/S0014-4886(03)00180-8. [DOI] [PubMed] [Google Scholar]
  • 106.Gourmaud S., Paquet C., Dumurgier J., Pace C., Bouras C., Gray F., Laplanche J.-L., Meurs E.F., Mouton-Liger F., Hugon J. Increased levels of cerebrospinal fluid JNK3 associated with amyloid pathology: Links to cognitive decline. J. Psychiatry Neurosci. JPN. 2015;40:151. doi: 10.1503/jpn.140062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 107.Fang F., Yu Q., Arancio O., Chen D., Gore S.S., Yan S.S., Yan S.F. RAGE mediates Aβ accumulation in a mouse model of Alzheimer’s disease via modulation of β-and γ-secretase activity. Hum. Mol. Genet. 2018;27:1002–1014. doi: 10.1093/hmg/ddy017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 108.Savage M.J., Lin Y.-G., Ciallella J.R., Flood D.G., Scott R.W. Activation of c-Jun N-terminal kinase and p38 in an Alzheimer’s disease model is associated with amyloid deposition. J. Neurosci. 2002;22:3376–3385. doi: 10.1523/JNEUROSCI.22-09-03376.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 109.Wang S., Zhang C., Sheng X., Zhang X., Wang B., Zhang G. Peripheral expression of MAPK pathways in Alzheimer’s and Parkinson’s diseases. J. Clin. Neurosci. 2014;21:810–814. doi: 10.1016/j.jocn.2013.08.017. [DOI] [PubMed] [Google Scholar]
  • 110.Yu Y., Richardson D.R. Cellular iron depletion stimulates the JNK and p38 MAPK signaling transduction pathways, dissociation of ASK1-thioredoxin, and activation of ASK1. J. Biol. Chem. 2011;286:15413–15427. doi: 10.1074/jbc.M111.225946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 111.Hattori K., Naguro I., Runchel C., Ichijo H. The roles of ASK family proteins in stress responses and diseases. Cell Commun. Signal. 2009;7:1–10. doi: 10.1186/1478-811X-7-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 112.Peel A.L., Sorscher N., Kim J.Y., Galvan V., Chen S., Bredesen D.E. Tau phosphorylation in Alzheimer’s disease. Neuromolecular Med. 2004;5:205–218. doi: 10.1385/NMM:5:3:205. [DOI] [PubMed] [Google Scholar]
  • 113.Kadowaki H., Nishitoh H., Urano F., Sadamitsu C., Matsuzawa A., Takeda K., Masutani H., Yodoi J., Urano Y., Nagano T. Amyloid β induces neuronal cell death through ROS-mediated ASK1 activation. Cell Death Differ. 2005;12:19–24. doi: 10.1038/sj.cdd.4401528. [DOI] [PubMed] [Google Scholar]
  • 114.Toyama K., Koibuchi N., Hasegawa Y., Uekawa K., Yasuda O., Sueta D., Nakagawa T., Ma M., Kusaka H., Lin B. ASK1 is involved in cognitive impairment caused by long-term high-fat diet feeding in mice. Sci. Rep. 2015;5:1–12. doi: 10.1038/srep10844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 115.Hommes D., Peppelenbosch M., Van Deventer S. Mitogen activated protein (MAP) kinase signal transduction pathways and novel anti-inflammatory targets. Gut. 2003;52:144–151. doi: 10.1136/gut.52.1.144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 116.Karim S., Hopkins S., Purandare N., Crowther J., Morris J., Tyrrell P., Burns A. Peripheral inflammatory markers in amnestic mild cognitive impairment. Int. J. Geriatr. Psychiatry. 2014;29:221–226. doi: 10.1002/gps.3988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 117.Faria M.C., Gonçalves G.S., Rocha N.P., Moraes E.N., Bicalho M.A., Cintra M.T.G., de Paula J.J., de Miranda L.F.J.R., de Souza Ferreira A.C., Teixeira A.L. Increased plasma levels of BDNF and inflammatory markers in Alzheimer’s disease. J. Psychiatr. Res. 2014;53:166–172. doi: 10.1016/j.jpsychires.2014.01.019. [DOI] [PubMed] [Google Scholar]
  • 118.Scholz B., Doidge A.N., Barnes P., Hall J., Wilkinson L.S., Thomas K.L. The regulation of cytokine networks in hippocampal CA1 differentiates extinction from those required for the maintenance of contextual fear memory after recall. PLoS ONE. 2016;11:e0153102. doi: 10.1371/journal.pone.0153102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 119.Takemiya T., Fumizawa K., Yamagata K., Iwakura Y., Kawakami M. Brain interleukin-1 facilitates learning of a water maze spatial memory task in young mice. Front. Behav. Neurosci. 2017;11:202. doi: 10.3389/fnbeh.2017.00202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 120.Tarkowski E., Andreasen N., Tarkowski A., Blennow K. Intrathecal inflammation precedes development of Alzheimer’s disease. J. Neurol. Neurosurg. Psychiatry. 2003;74:1200–1205. doi: 10.1136/jnnp.74.9.1200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 121.Sudheimer K.D., O’Hara R., Spiegel D., Powers B., Kraemer H.C., Neri E., Weiner M., Hardan A., Hallmayer J., Dhabhar F.S. Cortisol, cytokines, and hippocampal volume interactions in the elderly. Front. Aging Neurosci. 2014;6:153. doi: 10.3389/fnagi.2014.00153. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 122.Liu T., Zhang L., Joo D., Sun S.-C. NF-κB signaling in inflammation. Signal. Transduct. Target Ther. 2017;2:1–9. doi: 10.1038/sigtrans.2017.23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 123.Cameron B., Tse W., Lamb R., Li X., Lamb B.T., Landreth G.E. Loss of interleukin receptor-associated kinase 4 signaling suppresses amyloid pathology and alters microglial phenotype in a mouse model of Alzheimer’s disease. J. Neurosci. 2012;32:15112–15123. doi: 10.1523/JNEUROSCI.1729-12.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 124.Vivien D., Ali C. Transforming growth factor-β signalling in brain disorders. Cytokine Growth Factor Rev. 2006;17:121–128. doi: 10.1016/j.cytogfr.2005.09.011. [DOI] [PubMed] [Google Scholar]
  • 125.Graciarena M., Depino A.M., Pitossi F.J. Prenatal inflammation impairs adult neurogenesis and memory related behavior through persistent hippocampal TGFβ1 downregulation. Brain Behav. Immun. 2010;24:1301–1309. doi: 10.1016/j.bbi.2010.06.005. [DOI] [PubMed] [Google Scholar]
  • 126.Cerione R.A. Cdc42: New roads to travel. Trends Cell Biol. 2004;14:127–132. doi: 10.1016/j.tcb.2004.01.008. [DOI] [PubMed] [Google Scholar]
  • 127.Ito T.K., Yokoyama M., Yoshida Y., Nojima A., Kassai H., Oishi K., Okada S., Kinoshita D., Kobayashi Y., Fruttiger M. A crucial role for CDC42 in senescence-associated inflammation and atherosclerosis. PLoS ONE. 2014;9:e102186. doi: 10.1371/journal.pone.0102186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 128.Florian M.C., Dörr K., Niebel A., Daria D., Schrezenmeier H., Rojewski M., Filippi M.-D., Hasenberg A., Gunzer M., Scharffetter-Kochanek K. Cdc42 activity regulates hematopoietic stem cell aging and rejuvenation. Cell Stem Cell. 2012;10:520–530. doi: 10.1016/j.stem.2012.04.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 129.Kerber R.A., O’Brien E., Cawthon R.M. Gene expression profiles associated with aging and mortality in humans. Aging Cell. 2009;8:239–250. doi: 10.1111/j.1474-9726.2009.00467.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 130.Stankiewicz T.R., Linseman D.A. Rho family GTPases: Key players in neuronal development, neuronal survival, and neurodegeneration. Front. Cell. Neurosci. 2014;8:314. doi: 10.3389/fncel.2014.00314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 131.Mendoza-Naranjo A., Gonzalez-Billault C., Maccioni R.B. Aβ1-42 stimulates actin polymerization in hippocampal neurons through Rac1 and Cdc42 Rho GTPases. J. Cell Sci. 2007;120:279–288. doi: 10.1242/jcs.03323. [DOI] [PubMed] [Google Scholar]
  • 132.Zhu X., Raina A.K., Boux H., Simmons Z.L., Takeda A., Smith M.A. Activation of oncogenic pathways in degenerating neurons in Alzheimer disease. Int. J. Dev. Neurosci. 2000;18:433–437. doi: 10.1016/S0736-5748(00)00010-1. [DOI] [PubMed] [Google Scholar]
  • 133.Saraceno C., Catania M., Paterlini A., Fostinelli S., Ciani M., Zanardini R., Binetti G., Di Fede G., Caroppo P., Benussi L. Altered expression of circulating Cdc42 in frontotemporal lobar degeneration. J. Alzheimer’s Dis. 2018;61:1477–1483. doi: 10.3233/JAD-170722. [DOI] [PubMed] [Google Scholar]
  • 134.Baker R.G., Hayden M.S., Ghosh S. NF-κB, inflammation, and metabolic disease. Cell Metab. 2011;13:11–22. doi: 10.1016/j.cmet.2010.12.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 135.Bubici C., Papa S., Dean K., Franzoso G. Mutual cross-talk between reactive oxygen species and nuclear factor-kappa B: Molecular basis and biological significance. Oncogene. 2006;25:6731–6748. doi: 10.1038/sj.onc.1209936. [DOI] [PubMed] [Google Scholar]
  • 136.Mattson M.P., Goodman Y., Luo H., Fu W., Furukawa K. Activation of NF-κB protects hippocampal neurons against oxidative stress-induced apoptosis: Evidence for induction of manganese superoxide dismutase and suppression of peroxynitrite production and protein tyrosine nitration. J. Neurosci. Res. 1997;49:681–697. doi: 10.1002/(SICI)1097-4547(19970915)49:6<681::AID-JNR3>3.0.CO;2-3. [DOI] [PubMed] [Google Scholar]
  • 137.Levenson J.M., Choi S., Lee S.-Y., Cao Y.A., Ahn H.J., Worley K.C., Pizzi M., Liou H.-C., Sweatt J.D. A bioinformatics analysis of memory consolidation reveals involvement of the transcription factor c-rel. J. Neurosci. 2004;24:3933–3943. doi: 10.1523/JNEUROSCI.5646-03.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 138.Lukiw W.J., Bazan N.G. Strong nuclear factor-κB-DNA binding parallels cyclooxygenase-2 gene transcription in aging and in sporadic alzheimer’s disease superior temporal lobe neocortex. J. Neurosci. Res. 1998;53:583–592. doi: 10.1002/(SICI)1097-4547(19980901)53:5<583::AID-JNR8>3.0.CO;2-5. [DOI] [PubMed] [Google Scholar]
  • 139.Meffert M.K., Chang J.M., Wiltgen B.J., Fanselow M.S., Baltimore D. NF-κB functions in synaptic signaling and behavior. Nat. Neurosci. 2003;6:1072–1078. doi: 10.1038/nn1110. [DOI] [PubMed] [Google Scholar]
  • 140.Luchtman D.W., Song C. Cognitive enhancement by omega-3 fatty acids from child-hood to old age: Findings from animal and clinical studies. Neuropharmacology. 2013;64:550–565. doi: 10.1016/j.neuropharm.2012.07.019. [DOI] [PubMed] [Google Scholar]
  • 141.Dacks P., Shineman D., Fillit H. Current evidence for the clinical use of long-chain polyunsaturated n-3 fatty acids to prevent age-related cognitive decline and Alzheimer’s disease. J. Nutr. Health Aging. 2013;17:240–251. doi: 10.1007/s12603-012-0431-3. [DOI] [PubMed] [Google Scholar]
  • 142.Conquer J.A., Tierney M.C., Zecevic J., Bettger W.J., Fisher R.H. Fatty acid analysis of blood plasma of patients with Alzheimer’s disease, other types of dementia, and cognitive impairment. Lipids. 2000;35:1305–1312. doi: 10.1007/s11745-000-0646-3. [DOI] [PubMed] [Google Scholar]
  • 143.Milte C.M., Sinn N., Street S.J., Buckley J.D., Coates A.M., Howe P.R. Erythrocyte polyunsaturated fatty acid status, memory, cognition and mood in older adults with mild cognitive impairment and healthy controls. Prostaglandins Leukot. Essent. Fat. Acids (PLEFA) 2011;84:153–161. doi: 10.1016/j.plefa.2011.02.002. [DOI] [PubMed] [Google Scholar]
  • 144.van de Rest O., Geleijnse J.M., Kok F.J., van Staveren W.A., Dullemeijer C., OldeRikkert M.G., Beekman A.T., De Groot C. Effect of fish oil on cognitive performance in older subjects: A randomized, controlled trial. Neurology. 2008;71:430–438. doi: 10.1212/01.wnl.0000324268.45138.86. [DOI] [PubMed] [Google Scholar]
  • 145.Nakamura M.T., Nara T.Y. Structure, function, and dietary regulation of Δ6, Δ5, and Δ9 desaturases. Annu. Rev. Nutr. 2004;24:345–376. doi: 10.1146/annurev.nutr.24.121803.063211. [DOI] [PubMed] [Google Scholar]
  • 146.Aulchenko Y.S., Ripatti S., Lindqvist I., Boomsma D., Heid I.M., Pramstaller P.P., Penninx B.W., Janssens A.C.J., Wilson J.F., Spector T. Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts. Nat. Genet. 2009;41:47. doi: 10.1038/ng.269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 147.Lattka E., Illig T., Heinrich J., Koletzko B. FADS gene cluster polymorphisms: Important modulators of fatty acid levels and their impact on atopic diseases. Lifestyle Genom. 2009;2:119–128. doi: 10.1159/000235559. [DOI] [PubMed] [Google Scholar]
  • 148.Martinelli N., Girelli D., Malerba G., Guarini P., Illig T., Trabetti E., Sandri M., Friso S., Pizzolo F., Schaeffer L. FADS genotypes and desaturase activity estimated by the ratio of arachidonic acid to linoleic acid are associated with inflammation and coronary artery disease. Am. J. Clin. Nutr. 2008;88:941–949. doi: 10.1093/ajcn/88.4.941. [DOI] [PubMed] [Google Scholar]
  • 149.Caspi A., Williams B., Kim-Cohen J., Craig I.W., Milne B.J., Poulton R., Schalkwyk L.C., Taylor A., Werts H., Moffitt T.E. Moderation of breastfeeding effects on the IQ by genetic variation in fatty acid metabolism. Proc. Natl. Acad. Sci. USA. 2007;104:18860–18865. doi: 10.1073/pnas.0704292104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 150.Brookes K.J., Chen W., Xu X., Taylor E., Asherson P. Association of fatty acid desaturase genes with attention-deficit/hyperactivity disorder. Biol. Psychiatry. 2006;60:1053–1061. doi: 10.1016/j.biopsych.2006.04.025. [DOI] [PubMed] [Google Scholar]
  • 151.Wang G., Wang Y., Sun H., Cao W., Zhang J., Xiao H., Zhang J. Variants of the arachidonate 5-lipoxygenase-activating protein (ALOX5AP) gene and risk of ischemic stroke in Han Chinese of eastern China. J. Biomed. Res. 2011;25:319–327. doi: 10.1016/S1674-8301(11)60043-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 152.Demetz E., Schroll A., Auer K., Heim C., Patsch J.R., Eller P., Theurl M., Theurl I., Theurl M., Seifert M. The arachidonic acid metabolome serves as a conserved regulator of cholesterol metabolism. Cell Metab. 2014;20:787–798. doi: 10.1016/j.cmet.2014.09.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 153.Ikonomovic M.D., Abrahamson E.E., Uz T., Manev H., DeKosky S.T. Increased 5-lipoxygenase immunoreactivity in the hippocampus of patients with Alzheimer’s disease. J. Histochem. Cytochem. 2008;56:1065–1073. doi: 10.1369/jhc.2008.951855. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 154.Giannopoulos P.F., Chu J., Joshi Y.B., Sperow M., Li J.-G., Kirby L.G., Praticò D. 5-lipoxygenase activating protein reduction ameliorates cognitive deficit, synaptic dysfunction, and neuropathology in a mouse model of Alzheimer’s disease. Biol. Psychiatry. 2013;74:348–356. doi: 10.1016/j.biopsych.2013.04.009. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 155.Bartke A., Dominici F., Turyn D., Kinney B., Steger R., Kopchick J. Insulin-like growth factor 1 (IGF-1) and aging: Controversies and new insights. Biogerontology. 2003;4:1–8. doi: 10.1023/A:1022448532248. [DOI] [PubMed] [Google Scholar]
  • 156.Rains J.L., Jain S.K. Oxidative stress, insulin signaling, and diabetes. Free Radic. Biol. Med. 2011;50:567–575. doi: 10.1016/j.freeradbiomed.2010.12.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 157.Houstis N., Rosen E.D., Lander E.S. Reactive oxygen species have a causal role in multiple forms of insulin resistance. Nature. 2006;440:944–948. doi: 10.1038/nature04634. [DOI] [PubMed] [Google Scholar]
  • 158.Gockerman A., Prevette T., Jones J., Clemmons D. Insulin-like growth factor (IGF)-binding proteins inhibit the smooth muscle cell migration responses to IGF-I and IGF-II. Endocrinology. 1995;136:4168–4173. doi: 10.1210/endo.136.10.7545099. [DOI] [PubMed] [Google Scholar]
  • 159.Thissen J.-P., Ketelslegers J.-M., Underwood L.E. Nutritional regulation of the insulin-like growth factors. Endocr. Rev. 1994;15:80–101. doi: 10.1210/edrv-15-1-80. [DOI] [PubMed] [Google Scholar]
  • 160.Morais J., Chevalier S., Gougeon R. Protein turnover and requirements in the healthy and frail elderly. J. Nutr. Health Aging. 2006;10:272. [PubMed] [Google Scholar]
  • 161.Papadakis M.A., Grady D., Tierney M.J., Black D., Wells L., Grunfeld C. Insulin-like growth factor 1 and functional status in healthy older men. J. Am. Geriatr. Soc. 1995;43:1350–1355. doi: 10.1111/j.1532-5415.1995.tb06613.x. [DOI] [PubMed] [Google Scholar]
  • 162.Aleman A., Verhaar H.J., de Haan E.H., de Vries W.R., Samson M.M., Drent M.L., van der Veen E.A., Koppeschaar H.P. Insulin-like growth factor-I and cognitive function in healthy older men. J. Clin. Endocrinol. Metab. 1999;84:471–475. doi: 10.1210/jcem.84.2.5455. [DOI] [PubMed] [Google Scholar]
  • 163.Rollero A., Murialdo G., Fonzi S., Garrone S., Gianelli M.V., Gazzerro E., Barreca A., Polleri A. Relationship between cognitive function, growth hormone and insulin-like growth factor I plasma levels in aged subjects. Neuropsychobiology. 1998;38:73–79. doi: 10.1159/000026520. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data available on request.


Articles from Cells are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES