Skip to main content
Pathogens logoLink to Pathogens
. 2021 Jul 12;10(7):880. doi: 10.3390/pathogens10070880

An Investigation of the Relationship between Cyniclomyces guttulatus and Rabbit Diarrhoea

Tuanyuan Shi 1,, Xinlei Yan 2,, Hongchao Sun 1, Yuan Fu 1, Lili Hao 3, Yongxue Zhou 1, Yan Liu 1, Wenying Han 2, Guolian Bao 1,*, Xun Suo 4,*
Editors: Lawrence S Young, Abdul Jabbar
PMCID: PMC8308713  PMID: 34358030

Abstract

Cyniclomyces guttulatus is usually recognised as an inhabitant of the gastrointestinal (GI) tract in rabbits. However, large numbers of C. guttulatus are often detected in the faeces of diarrhoeic rabbits. The relationship of C. guttulatus with rabbit diarrhoea needs to be clearly identified. In this study, a C. guttulatus Zhejiang strain was isolated from a New Zealand White rabbit with severe diarrhoea and then inoculated into SPF New Zealand white rabbits alone or co-inoculated with Eimeria intestinalis, another kind of pathogen in rabbits. Our results showed that the optimal culture medium pH and temperature for this yeast were pH 4.5 and 40–42 °C, respectively. The sequence lengths of the 18S and 26S ribosomal DNA fragments were 1559 bp and 632 bp, respectively, and showed 99.8% homology with the 18S ribosomal sequence of the NRRL Y-17561 isolate from dogs and 100% homology with the 26S ribosomal sequence of DPA-CGR1 and CGDPA-GP1 isolates from rabbits and guinea pigs, respectively. In animal experiments, the C. guttulatus Zhejiang strain was not pathogenic to healthy rabbits, even when 1 × 108 vegetative cells were used per rabbit. Surprisingly, rabbits inoculated with yeast showed a slightly better body weight gain and higher food intake. However, SPF rabbits co-inoculated with C. guttulatus and E. intestinalis developed more severe coccidiosis than rabbits inoculated with C. guttulatus or E. intestinalis alone. In addition, we surveyed the prevalence of C. guttulatus in rabbits and found that the positive rate was 83% in Zhejiang Province. In summary, the results indicated that C. guttulatus alone is not pathogenic to healthy rabbits, although might be an opportunistic pathogen when the digestive tract is damaged by other pathogens, such as coccidia.

Keywords: rabbit, diarrhoea, Cyniclomyces guttulatus, Eimeria intestinalis, opportunistic pathogen

1. Introduction

Diarrhoea is very common in rabbits, especially in weanling rabbits, and causes huge losses in rabbit production. According to some reports, more than 50% of mortalities in rabbits may be caused by intestinal disease with diarrhoea [1,2,3]. Currently, more than twenty microorganisms, including viruses (e.g., Lapine rotavirus), bacteria (e.g., Escherichia coli, Salmonella typhimurium, Clostridium welchii and Pasteurella multocida) and parasites (e.g., Eimeria spp., Passalurus ambiguus, Cryptosporidium spp. and Giardia duodenalis) have been identified as pathogens which cause diarrhoea in rabbits [4,5,6,7,8,9,10,11,12,13,14,15]. In addition to the above pathogens, Cyniclomyces guttulatus, a commensal yeast in the rabbit gastrointestinal tract, is also commonly seen in diarrhoea cases. However, it is unclear whether this organism causes or is a co-cause of diarrhoea with other pathogens. Some researchers believe that C. guttulatus is not a pathogen which causes diarrhoea, but is probably a salubrious normal inhabitant based on its common existence in healthy animals and the absence of clinical signs in experimental rabbits inoculated with C. guttulatus isolates [16,17]. However, other researchers believe this organism could be an opportunistic pathogen based on the large numbers of yeast cells in the faeces of diarrhoeic animals and the positive response of some diarrhoeic cases to antifungal treatment with nystatin [18,19,20,21,22]. To clearly establish the relationship between C. guttulatus and diarrhoea in rabbits, a C. guttulatus strain was isolated and identified from a New Zealand White rabbit with severe diarrhoea, and the culture conditions were optimised. Then, its relationship with rabbit diarrhoea was investigated through the inoculation of C. guttulatus alone and coinoculation with an intestinal protozoan, Eimeria intestinalis. In addition, the prevalence of C. guttulatus in rabbits was surveyed in Zhejiang Province, China.

2. Results

2.1. A Cyniclomyces guttulatus Zhejiang Strain Was Isolated, and The Culture Conditions Were Optimised

A C. guttulatus Zhejiang strain was isolated from a diarrhoeic rabbit, cultivated in YPG medium at low pH, and then identified by light microscopy. Microscopically, the vegetative cells of C. guttulatus were ellipsoid, colourless and approximately 20–50 μm in length and occupied two large vacuoles in the cytoplasm [Figure 1A,C]. C. guttulatus formed pseudohyphae when it was cultivated in a stationary culture station [Figure 1B]. When it was cultivated with rotation, free vegetative cells were clearly visible. This organism could aerobically grow at a temperature range of 36 to 42 °C and a pH range of 1.5 to 4.5 in liquid YPG medium [Figure 1D,E]. The optimal culture medium pH was 4.5 [Figure 1D]. The logarithmic growth phase was 24 to 60 h at various temperatures and a pH value of 4.5 [Figure 1E]. At a culture temperature of 40 °C and pH 4.5, the cell density of C. guttulatus reached 4.62 × 107 ± 3.98 × 106 cells/mL over 60 h from the initial culture density of 1 × 104 cells/mL [Figure 1E].

Figure 1.

Figure 1

Cyniclomyces guttulatus was isolated from a rabbit with diarrhoea, and culture conditions were optimised. (A) C. guttulatus vegetative cells in the faeces of a diarrhoeic rabbit. (B) Pseudohyphae formed when C. guttulatus was cultivated under stationary culture conditions. (C) Free vegetative cells formed when C. guttulatus was cultivated with rotation. (D) Growth curves of C. guttulatus at different pH values. (E) Growth curves of C. guttulatus at different incubation temperatures. Bar: 20 μm.

2.2. The C. guttulatus Zhejiang Strain Showed a Close Relationship with Reference Strains Originating from Herbivores

The sequence length of the 18S fragment of the C. guttulatus Zhejiang strain was 1559 bp. It showed 98% sequence identity and 100% coverage with that of the C. guttulatus NRRL Y-17561 strain reported in GenBank (accession number JQ698886.1) [Figure 2A]. In the phylogenetic tree based on the 18S fragment, the Zhejiang strain was clustered and formed a sister clade with the NRRL Y-17561 strain. The sequence length of the 26S fragment of the strain was 632 bp and showed 100% (95% coverage), 100% (93% coverage), 97.2% (84% coverage), 96.6% (96% coverage) and 95.9% (95% coverage) identity with those of the CGDPA-GP1, DPA-CGR1, Dog-1, DPA-CGD1 and NRRL Y-17561 strains, respectively. In the 26S phylogenetic tree, this strain was positioned in the same clade as CGDPA-GP1 and DPA-CGR1 and formed a sister clade with the Dog-1, DPA-CGD1 and NRRL Y-17561 strains [Figure 2B]. According to data in GenBank, the C. guttulatus CGDPA-GP1 and DPA-CGR1 strains originate from herbivores, guinea pigs and rabbits, respectively, whereas the C. guttulatus Dog-1 and DPA-CGD1 strains originate from dogs. Thus, the C. guttulatus Zhejiang strain showed a closer phylogenetic relationship with the strains originating from herbivores than those from carnivores.

Figure 2.

Figure 2

Phylogenetic analysis of the Cyniclomyces guttulatus Zhejiang isolate based on 26S and 18S ribosomal RNA gene sequences. (A) Phylogenetic tree of the C. guttulatus Zhejiang isolate and 5 other isolates of C. guttulatus and 3 other yeast species based on the 26S ribosomal gene sequence. (B) Phylogenetic tree of the C. guttulatus Zhejiang isolate, one isolate of C. guttulatus and 3 other yeast species based on the 18S ribosomal gene sequence.

2.3. The C. guttulatus Zhejiang Strain Is Nonpathogenic to Healthy Rabbits

All SPF rabbits were healthy and were negative for C. guttulatus before the experiment. Two days after inoculation, C. guttulatus was found in rabbit faeces of all three groups (G1–G3) that were inoculated with 1 × 106, 1 × 107 and 108 C. guttulatus vegetative cells per rabbit. However, no rabbits in these groups showed clinical signs of illness. Interestingly, the C. guttulatus-inoculated groups (G1–G3) had less feed waste than the control group (G4) [Figure 3B,C]. The mean body weight of the inoculated groups was slightly higher than that of the control group, although the difference was not statistically significant (p > 0.05) [Figure 3A]. Autopsy showed no macroscopic or microscopic lesions in the GI tracts of inoculated rabbits despite a large number of C. guttulatus cells in the gastric and intestinal contents. In particular, a thick layer of C. guttulatus cells colonised the gastric mucosa [Figure 3D–F]. PAS-stained gastric tissue sections showed a dense layer of saccharides on the gastric mucosa and on the cell wall of C. guttulatus [Figure 3G]. The C. guttulatus cells probably attached to the stomach mucosa through these filamentous saccharides, as shown by transmission electron microscopy [Figure 3H,I]. Our findings indicated that the C. guttulatus Zhejiang strain colonised the gastric mucosa, but it was nonpathogenic to healthy rabbits.

Figure 3.

Figure 3

Effects of the Cyniclomyces guttulatus Zhejiang isolate in healthy SPF rabbits. (A) Mean body weight of rabbits inoculated with 1 × 106 (G1), 1 × 107 (G2) and 1 × 108 (G3) C. guttulatus vegetative cells per rabbit and the control group (G4). (B,C) Excreta trays for rabbits uninoculated and inoculated with C. guttulatus, respectively, showing unconsumed feed in the tray of the uninoculated group. (D,E) Microscopic observation of a frozen cross-section of gastric pylorus from a rabbit inoculated with 1 × 108 C. guttulatus at 40 and 100× magnification. (F) Microscopic observation of the gastric fundic mucosa layer from a rabbit inoculated with C. guttulatus at 200× magnification. (G) Microscopic observation of a paraffin section of the gastric fundus from a rabbit inoculated with 1 × 108 C. guttulatus with PAS staining. (H,I) Transmission electron microscopic observation of the gastric fundus from a rabbit inoculated with 1 × 108 C. guttulatus.

2.4. C. guttulatus May Be an Opportunistic Pathogen in Rabbits Infected with E. intestinalis

All SPF rabbits were healthy and were negative for C. guttulatus and E. intestinalis before the experiment. Rabbits preinoculated with C. guttulatus (CG/EI group) developed more severe illness and intestinal lesions following E. intestinalis infection than those not inoculated with C. guttulatus (EI group). Compared with the EI group, more severe diarrhoea, loss of appetite and constipation were observed in the CG/EI group. The number of C. guttulatus vegetative cells in the faeces of the CG/EI group was significantly higher than that of the CG group (p < 0.05) at 9 and 10 days after E. intestinalis infection. No C. guttulatus was detected in the EI and NON groups [Figure 4A]. The mean cells per gram of faeces in the CG/EI group were 1.22 × 107 ± 1.38 × 106 on day 9 and 8.55 × 106 ± 5.52 × 105 on day 10, 4.7-fold and 3.2-fold higher than those of the EI group, respectively. In contrast, coccidian reproduction was lower in co-inoculated rabbits than in rabbits inoculated with E. intestinalis alone, as shown by a markedly lower oocyst output in the CG/EI group than in the EI group; the total faecal oocyst count per rabbit on day 10 was 2.87 × 109 ± 8.13 × 107 in the coinoculated group compared with 4.57 × 109 ± 6.83 × 107 in the group without yeast inoculation. No E. intestinalis was detected in either the CG or NON groups [Figure 4B]. In addition, the peak oocyst excretion of the CG/EI group was also lower than that of the EI group (1.04 × 109 ± 2.45 × 107 on day 11 and 1.61 × 109 ± 3.43 × 107 on day 13). Faecal oocyst excretion in the CG/EI group peaked and cleared earlier than that in the EI group [Figure 4B]. Thus, C. guttulatus proliferation was enhanced by E. intestinalis infection, whereas E. intestinalis reproduction was suppressed by C. guttulatus. In addition, one rabbit in the CG/EI group died on the 10th day post-infection. The dead rabbit had disseminated haemorrhage and nodules in the lower jejunum and ileum, and a large number of E. intestinalis oocysts and C. guttulatus vegetative cells were detected in the small intestine [Figure 4D,E]. In addition, the mean body weight of the CG/EI group was slightly lower than that of the CG group 11 to 17 days post-infection [Figure 4C]. In summary, rabbits inoculated with both E. intestinalis and C. guttulatus developed more severe clinical signs and intestinal lesions (and one death) than rabbits inoculated with E. intestinalis only, associated with higher C. guttulatus and lower E. intestinalis output. The findings suggested that C. guttulatus might be an opportunistic pathogen in rabbits with coccidia.

Figure 4.

Figure 4

Effects of co-inoculation of SPF rabbits with C. guttulatus and E. intestinalis. (A) Faecal excretion of C. guttulatus in rabbits inoculated with C. guttulatus only (CG) or inoculated with C. guttulatus and E. intestinalis (CG/EI). dbi/dpi= days before the infection of E. intestinalis/days after the infection of E. intestinalis. (B) Faecal oocyst counts in rabbits 10 to 16 days after infection with E. intestinalis without preinoculation with C. guttulatus (EI) or inoculation with both C. guttulatus and E. intestinalis (CG/EI). (C) Body weight of rabbits inoculated with C. guttulatus only (CG), co-inoculated with C. guttulatus and E. intestinalis (CG/EI), or with E. intestinalis only (EI), and control rabbits (NON) (D,E) Gross lesions of the small intestine and C. guttulatus vegetative cells and E. intestinalis oocysts in faeces of the dead rabbit co-inoculated with C. guttulatus and E. intestinalis. “*” indicated significant difference of datas between CG/EI and CG or EI groups (p ≤ 0.05).

2.5. C. guttulatus Was Highly Prevalent in Rabbits

We conducted a survey of rabbits carrying C. guttulatus by analysing C. guttulatus cells in faeces. C. guttulatus was detected in 210 of 253 faecal samples from rabbits over 30 days old in Zhejiang Province, and the positive rate was 83%. In this survey, the positive rate for rabbits over 60 days old was 69.7% (46/66), and for rabbits under than 60 days old, it was 87.7% (164/187). The number of rabbits with a high C. guttulatus load (>100 cells per microscopic field at 200× magnification) was 59 (23.3%), consisting of 4 rabbits under 60 days old and 55 rabbits over 60 days old (6.1% and 29.4% of the age group, respectively). Thus, C. guttulatus was highly prevalent in healthy rabbits, especially in older rabbits.

3. Discussion

C. guttulatus is a monotypic yeast genus of the Saccharomycetaceae family and inhabits the GI tract of many animal species, including rabbits, dogs and guinea pigs [17,22,23]. C. guttulatus was first described more than 60 years ago and is commonly found in rabbit faeces. A large number of C. guttulatus cells are often found in the faeces of diarrhoeic rabbits, but it is unknown whether C. guttulatus causes diarrhoea in rabbits. We isolated a C. guttulatus Zhejiang strain from a rabbit with severe diarrhoea. At optimised culture pH and temperature, a single clone was expanded and studied for its pathogenicity in rabbits. We demonstrated that the C. guttulatus Zhejiang strain is not a primary pathogen which causes diarrhoea in healthy SPF rabbits. An inoculation rate as high as 1×108 vegetative cells per rabbit did not result in any clinical signs of illness or gastrointestinal lesions. This is consistent with previously reported studies, where rabbits orally or intravenously inoculated with C. guttulatus isolates showed no clinical signs of illness [16,17,24]. Unexpectedly, we found that rabbits inoculated with C. guttulatus showed better performance in terms of body weight gain and food intake. C. guttulatus seems to be a probiotic microorganism in rabbits, especially in weanling rabbits. However, the abundant vegetative cells of C. guttulatus commonly seen in the faeces of rabbits with diarrhoea suggest that it may be a causative microorganism of GI tract disturbance.

Some authors have proposed that C. guttulatus could be an opportunistic pathogen or play a co-causative role in diarrhoea of its host based on indirect evidence that anti-fungal agents, such as nystatin, are effective in the treatment of some diarrhoeic cases [19,20,21,22]. In our study, C. guttulatus was proven to be an opportunist through coinfection with the coccidian species E. intestinalis, a parasite which causes diarrhoea and intestinal lesions in rabbits. Mortality and more severe clinical signs and intestinal lesions were observed in rabbits coinfected with C. guttulatus and E. intestinalis than in rabbits inoculated with E. intestinalis only. Compared with rabbits inoculated with C. guttulatus alone, vegetative cells of C. guttulatus prolifically multiplied in the coinfection group, peaking at 9–10 days post-E. intestinalis infection. This time period is consistent with that of intestinal lesions of E. intestinalis infection [25,26]. The substantial multiplication of C. guttulatus was probably a consequence of the altered GI environment in the rabbits from E. intestinalis infection. Compared with rabbits with E. intestinalis infection alone, E. intestinalis oocyst excretion in coinfected rabbits decreased by 37%. We speculate that the rapid and considerable multiplication of C. guttulatus vegetative cells could contribute to severe symptoms in coinfected rabbits, and this multiplication of C. guttulatus also limited the reproduction of E. intestinalis.

In addition, our epidemiological survey showed that C. guttulatus was prevalent in rabbits in Zhejiang, China. The positive rate in rabbits was as high as 83%. This rate was significantly higher than that in other host animals, such as dogs, in which a prevalence of 14–21% has been reported [20,21,27]. Coccidia are also highly prevalent in rabbits. According to a previous study, the overall prevalence of rabbit coccidia is 41.9% in China and as high as 70% in some regions [12]. Therefore, C. guttulatus may contribute to the morbidity and mortality of rabbits with coccidiosis.

4. Materials and Methods

4.1. Study Design

This study was divided into two parts. In the first part, the relationship between C. guttulatus and rabbit diarrhoea was investigated. A C. guttulatus strain was first isolated and identified from a diarrhoeic rabbit with special YPG medium (pH 1.5). To investigate the pathogenicity of C. guttulatus alone on rabbits, sixteen SPF rabbits were randomly divided into 4 groups with 4 rabbits per group. Three groups of SPF rabbits were inoculated with 1 × 106, 1 × 107 or 1 × 108 C. guttulatus vegetative cells per rabbit. One group was used as an uninoculated control. The physical state of the rabbits and possible clinical signs were observed every day post-inoculation. To observe possible pathological changes in the GI tract, all of the experimental rabbits were administered dexmedetomidine hydrochloride (5 μg/kg IM; Dexdomitor®, OrionPharma, Finland) and tiletamine hydrochloride-zolamide hydrochloride (0.5 mg/kg IM; Zoletil®50, Virbac, France) before euthanasia through air injection (20 mL/kg, IV) with sterile syringes (Haiers, Changzhou, China) in the animal diagnosis and treatment centre of our institute 18 days after inoculation according to the method of Close B. (1997) [28]. Then, the GI tracts were obtained through abdominal operation and prepared as tissue slices or wet mounts. To investigate whether C. guttulatus is an opportunistic pathogen, another sixteen SPF rabbits were used. They were divided into 4 groups with 4 rabbits per group. Two groups of SPF rabbits were inoculated with 1 × 107 C. guttulatus vegetative cells per rabbit, and the other two groups were uninoculated. Fourteen days later, one of the inoculated and uninoculated groups was infected with 1×104 E. intestinalis oocysts per rabbit. Clinical signs, oocyst output and C. guttulatus cells in faeces were examined post-inoculation/infection. In the second part, to survey the prevalence of C. guttulatus in rabbits, fresh faecal samples collected from rabbitries in Zhejiang Province, China were examined.

4.2. Rabbit Management

Thirty-two SPF New Zealand White rabbits (all male, 17 to 25 days old, weighing 0.2 to 1 kg) were acquired from Pizhou Dongfang Rabbit Breeding Co., Ltd. (Pizhou, China) and reared in our institute. Three days before the experiment, all rabbits were given itraconazole with free access to water by adding a dosage of 100 mg/L to avoid contamination by C. guttulatus during transportation, and the faeces of the experimental rabbits were examined every day under microscopy to check the existence of oocysts. They were reared within RBC6H5-independent ventilation cages (Suzhou Suhang Technology Equipment Co., Ltd., Suzhou, China at room temperature of 20 to 25 °C, with one rabbit per cage and allowed access to pathogen-free food and drinking water that was sterilised in an oven before use. Their physical condition was monitored every day during all experimental procedures. In addition, pre-weaned SPF rabbits were supplied with carrots and 0.5% milk powder in their drinking water. All animals were confirmed to be negative for C. guttulatus and coccidia in faeces with microscopy examination before use.

4.3. Isolation and Cultivation

A C. guttulatus Zhejiang strain was isolated from a severely diarrhoeic rabbit. Approximately 0.5 g of intestinal content was diluted to approximately 500 vegetative cells of C. guttulatus/mL with sterilised distilled water. Then, a 20 μL suspension was added to 10 mL YPG (pH 1.5) medium supplemented with 100 mg/L ampicillin. The strain was cultured in a 96-well culture plate with 100 μL of medium per well at 37 °C with 10% CO2 for 2 h. Wells with a single C. guttulatus vegetative cell were further cultured for 5 days before monoclonal cells of C. guttulatus were smeared and cultivated on solid YPG plates (pH 4.5) supplemented with 100 mg/L ampicillin at 37 °C with 10% CO2. A single colony of C. guttulatus was transferred to liquid YPG medium (pH 4.5) and cultivated at 37 °C on an orbital shaker (Zhichu, China) at a constant rotating speed of 200 rpm. Yeast multiplication was monitored using an automatic microbial growth curve analyser (Bioscreen, Helsinki, Finland) and an optical density scanner (Bug Lab, Raleigh, NC, USA). Culture conditions were optimised by varying the medium pH and culture temperature.

4.4. Morphological and Molecular Identification

The morphology of the C. guttulatus Zhejiang strain was observed under a light microscope at 400× magnification. Molecular identification was performed by PCR and gene sequencing. Two specific primer pairs for the small subunit (18S) and large subunit (26S) ribosomal RNA genes were synthesised according to Kurtzman C.P. (1998) [29]. The primer pairs were as follows: 18S upper primer (TACGGTGAAACTGCGAATGG), 18S lower primer (GCTGATGACTTGCGCTTACT), 26S upper primer (GCATATCAATAAGCGGAGGAAAAG) and 26S lower primer (GGTCCGTGTTTCAAGACGG). The PCR conditions for the 18S DNA fragment were an initial denaturation at 95 °C for 5 min, followed by 30 cycles of 94 °C denaturation for 45 s, primer annealing at 55 °C for 45 s, and extension at 72 °C for 90 s. A final primer extension of 10 min at 72 °C completed the amplification process. The amplification for 26S was the same as that for 18S, although the extension at 72 °C was extended to 120 s during the PCR cycles. C. guttulatus vegetative cells were directly used as the template for PCR. The PCR products were examined and separated by 1% agarose gel electrophoresis. The target bands were purified by a gel extraction kit and sequenced by Sangon Biotech (Shanghai, China). The sequenced 18S and 26S gene fragments of the C. guttulatus Zhejiang isolates were submitted to GenBank with the Bankit procedure and blasted in the NCBI (National Center for Biotechnology Information, Bethesda, MD, USA) database. Similar reference sequences were retrieved. Phylogenetic analysis was performed using the MegAlign program (DNAstar Inc., Madison, WI, USA). The phylogenetic tree was constructed using the Clustal W method. Information about C. guttulatus isolates and other yeast species used in the construction of the phylogenetic trees is listed in Table 1.

Table 1.

GenBank sequences used in the construction of the phylogenetic tree.

Species/Isolate Location/Source Genbank Accession No.
Cyniclomyces guttulatus Zhejiang strain Intestinal content of rabbit in China MN633294/ MN625917
Cyniclomyces guttulatus isolate DPA-CGR1 Rabbit faeces in Brazil JQ861267.1
Cyniclomyces guttulatus isolate DPA-CGD1 Dog faeces in Brazil JQ861266.1
Cyniclomyces guttulatus isolate NRRL Y -17561 - U76196.1/ JQ698886.1
Cyniclomyces guttulatus isolate CGDPA-GP1 Guinea pig in Brazil KC484339.1
Cyniclomyces guttulatus dog-1 Dog faeces in Norway FJ755179.1
Nakaseomyces delphensis - JQ689014.1
Saccharomyces cerevisiae - JQ689017.1
Pichia pastoris - U75963.1

Note: “-” indicates no information detailed.

4.5. Inoculation of Cyniclomyces guttulatus in Rabbits and Examination of Yeast Colonisation in the GI Tract

Three groups of 20-day-old SPF rabbits (n = 4) were orally inoculated with 1 × 106, 1 × 107 or 1 × 108 C. guttulatus vegetative cells per rabbit and designated G1, G2 and G3, respectively. Another group (G4) was not inoculated with yeast and served as the control. Body weight, activities, appetite and excreta were recorded before and after yeast inoculation. Faeces from all groups were collected daily and examined for yeast cells under a light microscope.

All rabbits were euthanised 18 days after inoculation according to the study design. The contents and the mucous layer of the stomach, duodenum, jejunum, and ileum were collected, smeared and microscopically examined. Yeast was observed in the stomach (see the Results section); therefore, tissues from different regions of the stomach were immediately frozen for microscopic examination and fixed in 10% formalin for the preparation of paraffin sections for microscopic observation after staining with PAS (periodic acid–Schiff) and in 5% glutaraldehyde for the preparation of electron microscopy sections for observation by transmission electron microscopy.

4.6. Coinfection of Cyniclomyces guttulatus and Eimeria intestinalis in Rabbits

Two groups (designated CG and CG/EI) of 28-day-old SPF rabbits were orally inoculated with 4 × 107 C. guttulatus cells per rabbit (n = 4). After 14 days, CG/EI and another group (designated EI, without C. guttulatus inoculation) were infected with 1×104 sporulated oocysts of E. intestinalis. One group (designated NON) served as the uninfected control. Body weight, activity, appetite and excreta of animals were recorded before and after inoculation. Faeces were collected for coccidial oocysts and yeast cell counting. E. intestinalis oocysts in faeces were counted between 10 and 16 days after infection using the McMaster method as described previously [30]. Vegetative cells of C. guttulatus were counted from 2 days before to 14 days after the infection of E. intestinalis. Briefly, 1 g of faeces was mashed with a glass stick and mixed with 60 mL of tap water. The faecal suspension was filtered through a 100-mesh sieve. C. guttulatus cells in the filtrate were counted in a haemocytometer under a light microscope at 100× magnification.

4.7. Prevalence Survey

Faecal samples were collected from 253 healthy rabbits in four regions, including Fuyang, Haining, Deqing and Wencheng (abbreviated: FY, HN, ZX and WC), in Zhejiang Province, China. The sample numbers from FY, HN, DQ and WC were 50, 50, 49 and 104, respectively. Among the surveyed rabbits, 66 were under 60 days old, and 187 were over 60 days old. The collected samples were stored at 4 °C and examined within one week. The examination was performed as follows: 2 g faeces was mixed with 60 mL of tap water. The mixture was filtered through a 100-mesh sieve. Then, 100 μL filtrate was collected for wet mount examination under a light microscope at 100× magnification. Twenty fields were observed for each sample.

4.8. Statistical Analysis

Statistical analyses were performed for C. guttulatus cell counts, rabbit body weight, and E. intestinalis oocyst counts by GraphPad Prism 5.01. Data are expressed as the mean ± standard deviation of four replicates, and experimental groups were compared by using paired-samples t-tests. Differences between groups with p-values < 0.05 were considered statistically significant.

5. Conclusions

As a commensal yeast, C. guttulatus is very common in rabbits and is usually not pathogenic even when the dosage is up to 1 × 108 in healthy rabbits; this species seems to be a probiotic microorganism in rabbits, but it may be an opportunistic pathogen when the GI environment is altered by enteric pathogens such as coccidia. Considering the high prevalence of both C. guttulatus and coccidia in rabbits, the potential harm of C. guttulatus to the rabbit industry warrants attention and needs further study.

Abbreviations

GI: gastrointestinal; NCBI: National Center for Biotechnology Information; PCR: polymerase chain reaction; SPF: specific pathogen-free; YPG: yeast medium including 1% yeast autolysate, 1% proteose peptone and 2% glucose; 16S: a small subunit of ribosome; 26S: a large subunit of ribosome.

Author Contributions

Conceptualisation, T.S., G.B. and X.S.; Investigation, T.S., H.S., Y.F., L.H., Y.Z. and Y.L.; Supervision, G.B. and X.S.; Writing—original draft preparation, T.S., X.Y.; Writing—review and editing, T.S., W.H. and X.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was mainly supported by the National Natural Science Foundation of China (Project number 32072883, 31101810), Zhejiang Province Public Welfare Technology Application Research Project (Project number 2017C32037), Agricultural Research System of China (Project number nycytx-44-3-2), Key Research and Development Plan of Zhejiang Province (Project numbers 2016C02054-10, 2019C02052) and the research project of high level talents of Inner Mongolia Agricultural University (No. RZ1900002817). None of the funders had any influence on any aspect of the study. They were not involved in designing the study, carrying out the experiments, analysis of the data, or writing of the manuscript.

Institutional Review Board Statement

All experimental procedures were approved by the Zhejiang Academy of Agricultural Science Animal Ethics Committee (approval number, 20191904), and due attention was given to the welfare of the animals. The rabbits were reared in a stress-free environment, eliminating strong light and noise, with one rabbit per cage. Their physical condition was monitored every day during all experimental procedures. Euthanasia was performed in accordance with the experimental design.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data supporting the conclusions of this article are included within the article and the additional files. The newly generated sequences were submitted to the GenBank database under the accession numbers MN633294 and MN625917.

Conflicts of Interest

The authors declare that they have no competing interests.

Footnotes

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

  • 1.Hu B., Fan Z.-Y., Wei H.-J., Song Y.-H., Qiu R.-L., Chen M.-M., Xu W.-Z., Xue J.-B., Wang F. Detection of mucoid enteropathy syndrome disease in rabbit farms in East China. Res. Vet. Sci. 2018;119:259–261. doi: 10.1016/j.rvsc.2018.07.011. [DOI] [PubMed] [Google Scholar]
  • 2.Marlier D., Dewree R., Lassence C., Licois D., Mainil J., Coudert P., Meulemans L., Ducatelle R., Vindevogel H. Infectious agents associated with epizootic rabbit enteropathy: Isolation and attempts to reproduce the syndrome. Vet. J. 2006;172:493–500. doi: 10.1016/j.tvjl.2005.07.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Dong Y.-F. Pathogens of Diarrhea in rabbits and its control measures. Chin. J. Rabbit Farming. 1998;2:3–5. (In Chinese) [Google Scholar]
  • 4.Petric M., Middleton P.J., Grant C., Tam J.S., Hewitt C.M. Lapine rotavirus: Preliminary studies on epizoology and transmission. Can. J. Comp. Med. 1978;42:143–147. [PMC free article] [PubMed] [Google Scholar]
  • 5.Ciarlet M., Gilger M.A., Barone C., McArthur M., Estes M.K., Conner M.E. Rotavirus disease, but not infection and development of intestinal histopathological lesions, is age restricted in rabbits. Virology. 1998;251:343–360. doi: 10.1006/viro.1998.9406. [DOI] [PubMed] [Google Scholar]
  • 6.Peeters J.E., Pohl P., Okerman L., Devriese L.A. Pathogenic properties of Escherichia coli strains isolated from diarrheic commercial rabbits. J. Clin. Microbiol. 1984;20:34–39. doi: 10.1128/jcm.20.1.34-39.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Peeters J.E., Geeroms R., Orskov F. Biotype, serotype, and pathogenicity of attaching and effacing enteropathogenic Escherichia coli strains isolated from diarrheic commercial rabbits. Infect. Immun. 1988;56:1442–1448. doi: 10.1128/iai.56.6.1442-1448.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Borrelli L., Fioretti A., Ruggiero V., Santaniello A., Cringoli G., Ricci A., Barco L., Menna L.F., Dipineto L. Salmonella typhimurium DT104 in farmed rabbits. J. Vet. Med. Sci. 2011;73:385–387. doi: 10.1292/jvms.10-0315. [DOI] [PubMed] [Google Scholar]
  • 9.Djukovic A., Garcia-Garcera M., Martinez-Paredes E., Isaac S., Artacho A., Martinez J., Ubeda C. Gut colonization by a novel Clostridium species is associated with the onset of epizootic rabbit enteropathy. Vet. Res. 2018;49:123. doi: 10.1186/s13567-018-0617-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Massacci F.R., Magistrali C.F., Cucco L., Curcio L., Bano L., Mangili P., Scoccia E., Bisgaard M., Aalbaek B., Christensen H. Characterization of Pasteurella multocida involved in rabbit infections. Vet. Microbiol. 2018;213:66–72. doi: 10.1016/j.vetmic.2017.11.023. [DOI] [PubMed] [Google Scholar]
  • 11.Pakandl M. Coccidia of rabbit: A review. Folia Parasitol. 2009;56:153–166. doi: 10.14411/fp.2009.019. [DOI] [PubMed] [Google Scholar]
  • 12.Jing F., Yin G.-W., Liu X.-Y., Suo X., Qin Y.-H. Large-scale survey of the prevalence of Eimeria infections in domestic rabbits in China. Parasitol. Res. 2012;110:1495–1500. doi: 10.1007/s00436-011-2653-4. [DOI] [PubMed] [Google Scholar]
  • 13.Abdel-Gaber R., Ataya F., Fouad D., Daoud M., Alzuhairy S. Prevalence, Morphological and Molecular Phylogenetic Analyses of the Rabbit Pinworm, Passalurus ambiguus Rudolphi 1819, in the Domestic Rabbits Oryctolagus cuniculus. Acta Parasitol. 2019;64:316–330. doi: 10.2478/s11686-019-00047-7. [DOI] [PubMed] [Google Scholar]
  • 14.Zhang W.-Z., Shen Y.-J., Wang R.-J., Liu A.-Q., Ling H., Li Y.-H., Cao J.-P., Zhang X.-Y., Shu J., Zhang L.-X. Cryptosporidium cuniculus and Giardia duodenalis in rabbits: Genetic diversity and possible zoonotic transmission. PLoS ONE. 2012;7:e31262. doi: 10.1371/journal.pone.0031262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Zhang X.-Q., Qi M., Jing B., Yu F.-C., Wu Y.-Y., Chang Y.-K., Zhao A.-Y., Wei Z.-L., Dong H.-J., Zhang L.-X. Molecular Characterization of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in Rabbits in Xinjiang, China. J. Eukaryot. Microbiol. 2018;65:854–859. doi: 10.1111/jeu.12629. [DOI] [PubMed] [Google Scholar]
  • 16.Burgisser H. Is Saccharomycopsis guttulatus really pathogenic for the rabbit? Pathol. Microbiol. 1961;24:357–362. (In French) [PubMed] [Google Scholar]
  • 17.Zierdt C.H., Detlefson C., Muller J., Waggie K.S. Cyniclomyces guttulatus (Saccharomycopsis guttulata)–culture, ultrastructure and physiology. Antonie Van Leeuwenhoek. 1988;54:357–366. doi: 10.1007/BF00393526. [DOI] [PubMed] [Google Scholar]
  • 18.Hersey-Benner C. Diarrhea in a rabbit. Cyniclomyces guttulatus yeast. Lab. Anim. 2008;37:347–349. doi: 10.1038/laban0808-347. [DOI] [PubMed] [Google Scholar]
  • 19.Peters S., Houwers D.J. A cat with diarrhoea associated with the massive presence Of Cyniclomyces guttulatus in the faeces. Tijdschr. Diergeneesk. 2009;134:198–199. (In Dutch) [PubMed] [Google Scholar]
  • 20.Flausino G., Leal P.D.S., McIntosh D., Amaral L.G., Teixeira W.L., Flausino W., Lopes C.W.G. Isolation and characterization of Cyniclomyces guttulatus (Robin) Van Der Walt and Scott, 1971 in dogs in Brazil. Curr. Microbiol. 2012;65:542–546. doi: 10.1007/s00284-012-0184-6. [DOI] [PubMed] [Google Scholar]
  • 21.Mandigers P.J.J., Duijvestijn M.B.H.M., Ankringa N., Maes S., van Essen E., Schoormans A.H.W., German A.J., Houwers D.J. The clinical significance of Cyniclomyces guttulatus in dogs with chronic diarrhoea, a survey and a prospective treatment study. Vet. Microbiol. 2014;172:241–247. doi: 10.1016/j.vetmic.2014.05.018. [DOI] [PubMed] [Google Scholar]
  • 22.Winston J.A., Piperisova I., Neel J., Gookin J.L. Cyniclomyces guttulatus Infection in Dogs: 19 Cases (2006–2013) J. Am. Anim. Hosp. Assoc. 2016;52:42–51. doi: 10.5326/JAAHA-MS-6307. [DOI] [PubMed] [Google Scholar]
  • 23.Kurtzman C.P., Fell J.W., Boekhout T., editors. The Yeasts: A Taxonomic Study. 5th ed. Volume 2. Elsevier BV; Amsterdam, The Netherlands: 2011. pp. 357–359. [Google Scholar]
  • 24.Richle R., Scholer H.J. Saccharomycopsis guttulata in rabbits: Cultural properties and possible significance. Pathol. Microbiol. 1961;24:783–793. (In German) [PubMed] [Google Scholar]
  • 25.Shi T.-Y., Bao G.-L., Fu Y., Suo X., Hao L.-L. A low-virulence Eimeria intestinalis isolate from rabbit (Oryctolagus cuniculus) in China: Molecular identification, pathogenicity, and immunogenicity. Parasitol. Res. 2014;113:1085–1090. doi: 10.1007/s00436-013-3744-1. [DOI] [PubMed] [Google Scholar]
  • 26.Shi T.-Y., Tao G.-R., Bao G.-L., Suo J.-X., Hao L.-L., Fu Y., Suo X. Stable Transfection of Eimeria intestinalis and Investigation of Its Life Cycle, Reproduction and Immunogenicity. Front. Microbiol. 2016;7:807. doi: 10.3389/fmicb.2016.00807. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Han Y.-X., Jiang X., Ge X.-G., An X.-K., Zhu Z.-D., Zhao R.-L., Ma J.-F., Li Y., Wang C., Xu L.-L. The epidemiological investigation and pathogenicity study on Cyniclomyces guttulatus of police dogs in Tianjin area. J. Tianjin Agric. Univ. 2018;25:44–47. (In Chinese) [Google Scholar]
  • 28.Close B., Banister K., Baumans V., Bernoth E.M., Bromage N., Bunyan J., Erhardt W., Flecknell P., Gregory N., Hackbarth H., et al. Recommendations for euthanasia of experimental animals: Part 2. DGXT of the European Commission. Lab. Anim. 1997;31:1–32. doi: 10.1258/002367797780600297. [DOI] [PubMed] [Google Scholar]
  • 29.Kurtzman C.P., Robnett C.J. Identification and phylogeny of ascomycetous yeasts from analysis of nuclear large subunit(26S) ribosomal DNA partial sequences. Antonie Van Leeuwenhoek. 1998;73:331–371. doi: 10.1023/A:1001761008817. [DOI] [PubMed] [Google Scholar]
  • 30.Hodgson J.N. Coccidiosis: Oocyst counting technique for coccidiostat evaluation. Exp. Parasitol. 1970;28:99–102. doi: 10.1016/0014-4894(70)90073-1. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Data supporting the conclusions of this article are included within the article and the additional files. The newly generated sequences were submitted to the GenBank database under the accession numbers MN633294 and MN625917.


Articles from Pathogens are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES