Skip to main content
PLOS One logoLink to PLOS One
. 2021 Jul 26;16(7):e0254936. doi: 10.1371/journal.pone.0254936

Dietary supplementation of alpha-lipoic acid mitigates the negative effects of heat stress in broilers

Sanjeev Wasti 1, Nirvay Sah 1, Chin N Lee 1, Rajesh Jha 1, Birendra Mishra 1,*
Editor: Arda Yildirim2
PMCID: PMC8312949  PMID: 34310622

Abstract

Heat stress accounts for substantial economic loss in the poultry industry by altering the health and performance of chickens. Alpha-lipoic acid (ALA) is a water and fat-soluble antioxidant which is readily absorbed from the intestine resulting in maximum bioavailability. Moreover, ALA acts as a coenzyme in glucose metabolism and helps generate other antioxidants. Considering these benefits, we hypothesized that dietary supplementation of ALA would help mitigate heat stress in poultry. A total of 72 Day-old broiler chicks were randomly assigned into three treatment groups: no heat stress (NHS), heat stress with basal diet (HS), and heat stress with alpha-lipoic acid (HS+ALA); each treatment group had 6 replicate pens with 4 birds in each pen (n = 24/group). The allocated birds were raised under standard husbandry practices for 3 weeks. After 21 d, birds in the HS and HS+ALA groups were exposed to heat stress (33°C for 8 hours during the day) for 3 weeks, while the NHS group was reared under normal conditions (22–24°C). The HS+ALA group received a basal finisher diet fortified with ALA (500 mg/kg) during the treatment period (22 to 42 d), while other birds were provided with the basal finisher diet. Weekly body weight and feed intake were recorded. The cecum digesta for volatile fatty acids (VFAs) analysis and 16S rRNA sequencing for the gut microbiota analysis; and the ileum tissue samples for histological and gene expression analyses were collected on d 42. Exposure to heat stress decreased (P<0.05) average daily gain (ADG) and final body weight (FBW) in the HS group compared to the NHS group, the supplementation of ALA improved (P<0.05) ADG and FBW in heat-stressed birds. Furthermore, birds in the HS+ALA group had increased (P<0.05) expression of HSP90, PRDX1, GPX3, SOD2, OCLN, and MUC2 genes and higher (P<0.05) concentrations of major VFAs (acetate, propionate, and butyrate). The dietary ALA supplementation also improved the villus height and villus height to crypt depth ratio in the HS+ALA group. The microbial diversity analysis revealed significant abundance (P<0.05) of beneficial bacteria Lactobacillus and Peptostreptococcaceae in the cecum of the ALA group. These results indicate that dietary ALA supplementation effectively mitigates the negative effects of heat stress in broilers by improving the expression of heat-shock, tight-junction, antioxidants, and immune-related genes in the intestine, improving villus structures, increasing concentration of major VFAs, and enriching the beneficial microbiota.

Introduction

Poultry meat is a good source of white meat containing a low amount of fat and high proteins. Considering this benefit of poultry meat, the consumers’ preference for poultry meat has rapidly increased in the past decade. This demand has been largely fulfilled by intensive selection and breeding of the chickens for rapid growth and heavier breast muscle [1]. However, these improved breeding are accompanied by one major problem, i.e., highly susceptible to higher environmental temperature due to higher metabolic rate, lack of sweat glands, and the presence of feathers [2]. Thus, with the rising global temperature, heat stress is a significant problem in the poultry industry resulting in massive economic loss in the tropical regions [3]. Heat stress exhibits negative effects on poultry health and production performance by altering different physiological, neuroendocrine, immunological, and behavior responses [2]. As a result, there has been a huge surge in the research regarding mitigating the heat stress in poultry. Researchers have recently tried and tested different compounds such as polyphenols and antioxidants to ameliorate the heat stress in poultry [2, 4–7].

Alpha-lipoic acid (ALA), also known as Universal antioxidant, is produced in small amounts inside the cell [8]. ALA is both water and fat-soluble antioxidants, are readily absorbed from the intestine, and can easily cross the blood-brain barrier resulting in optimum bioavailability. Besides this, both ALA and dihydrolipoic acid (DHLA)- the reduced form of ALA, can quench free radicals both in the liquid and aqueous domains [9]. Moreover, ALA and DHLA also possess metal-chelating activity, acts as a coenzyme in glucose metabolism, and generates other antioxidants such as ascorbate, vitamin E, and glutathione (GST) [8, 10]. Considering these benefits, ALA has recently gained huge attention in normal and heat stress conditions as a potential feed supplement in poultry.

Studies have shown that dietary fortification of ALA was able to improve the growth performance indices, immunological and biochemical characteristics, lipid metabolism, and oxidative stress in the poultry [9]. Likewise, the storability of poultry meat and meat product was also found to increase with the fortification of ALA in the feed [9]. However, there has not been any study focusing on ALA supplementation on gastrointestinal physiology and the growth performance in heat-stressed broiler birds. Thus, this study was carried out to unveil ALA supplementation’s mitigatory effects on the growth performance, immune parameters, gut microbiota, and gut health of heat-stressed broiler birds.

Material and methods

Birds and husbandry

The animal experimentation was carried out at the small animal facility of the University of Hawaii at Manoa, and the experimental protocol was approved by the Institutional Animal Care and Use Committee of the University of Hawaii (Approval no. 17–2605). A total of 72 day-old Cobb-500 unsexed chicks were sourced from a local hatchery (Asagi Hatchery Inc., Honolulu, HI). On d 1, birds were weighed individually, winged tagged, and placed equally and randomly to one of 3 treatments with 6 replicates of each treatment (n = 24 birds/treatment; 4 birds/pen). The treatment groups were: 1) No heat stress (NHS), 2) Heat stress with basal diet (HS), and 3) heat stress with alpha-lipoic acid (HS+ALA). For the first 21 d, all the birds were raised following the standard broiler rearing guidelines on the floor pen system with access to ad libitum feed and water. After 21 d, birds in the HS, and HS+ALA were exposed to the heat of 33–35°C (8 am to 6 pm) and 21–22°C (6 pm to 8 am) with 50% relative humidity for 3 weeks. Birds in the NHS group were reared at the normal room temperature (22°C-24°C) with 50% relative humidity. The lighting regime was 23 h light and 1 h dark periods. The size of the pen was 1 m x 0.71 m, and the stocking density was 1500 cm2/bird.

Diets

Birds were fed the corn-soybean meal-based mash diets in two phases, starter (1–21 d) and finisher (22–42 d), to meet the nutrients requirements of broilers [11]. The energy and protein requirements of the diet was met following the NRC (1994); however, Ca and P level was lower than the commercial requirements. All the birds were provided with the normal starter diet for the first 14 d; afterward, 500 mg/kg ALA was supplemented on the starter diet of the HS+ALA group from 14 to 21 d, while the other two groups (HS and NHS) were provided with the normal starter diet. From 22 to 42 d, NHS and HS birds were fed with the basal finisher diets, and 500 mg/kg ALA was supplemented in the finisher diet of the HS+ALA group. The dose rate of ALA was considered as 500 mg/kg feed based on a previous study [12] in the broiler birds. The diet formulation and their nutrient profiles are presented in Table 1.

Table 1. Ingredients and nutrient composition of the experimental diets.

  Starter Finisher
Ingredients % Basal Basal+ALA Basal Basal+ ALA
Corn 54.86 54.86 63.14 63.14
SBM 39.5 39.5 29.6 29.6
Soybean oil 2 2 4.5 4.5
Limestone 1.27 1.27 0.85 0.85
Monocalcium phosphate 0.75 0.75 0.5 0.5
Lysine 0.23 0.23 0.18 0.18
Methionine 0.14 0.14 0.12 0.12
Threonine 0.2 0.2 0.16 0.16
NaCl 0.43 0.43 0.35 0.35
Sodium bicarbonate 0.12 0.12 0.1 0.1
Vitamin + Mineral mix* 0.5 0.5 0.5 0.5
ALA, mg/kg (top dressing) 0 500 0 500
Calculated nutrient content, %
MEn, kcal/kg 2909 2909 3203 3203
CP 22.09 22.09 18.07 18.07
Ca 0.75 0.75 0.52 0.52
Total P 0.57 0.57 0.47 0.47
Available P 0.3 0.3 0.23 0.23
Lysine 1.39 1.39 1.10 1.10
Methionine 0.48 0.48 0.41 0.41
Cystine 0.43 0.43 0.38 0.38
Threonine 1.03 1.03 0.85 0.85
Tryptophan 0.33 0.33 0.26 0.26
Methionine + Cysteine 0.91 0.91 0.8 0.8
Arginine 1.61 1.61 1.31 1.31
Valine 1.22 1.22 1.03 1.03
Isoleucine 0.93 0.93 0.76 0.76
Leucine 1.89 1.89 1.63 1.63
dig Lys 1.25 1.25 0.99 0.99
dig Met 0.45 0.45 0.39 0.39
dig Thr  0.85 0.85 0.69 0.69
NDF 9.13 9.13 8.78 8.78
CF 3.97 3.97 3.46 3.46
Na 0.22 0.22 0.18 0.18
Cl 0.30 0.30 0.25 0.25
Choline (mg/kg) 1419 1419 1200 1200

*Providing the following (per kg of diet): vitamin A (trans-retinyl acetate), 10,000 IU; vitamin D3 (cholecalciferol), 3,000 IU; vitamin E (all-rac-tocopherol-acetate), 30 mg; vitamin B1, 2 mg; vitamin B2, 8 mg; vitamin B6, 4 mg; vitamin B12 (cyanocobalamin), 0.025 mg; vitamin K3 (bisulphatemenadione complex), 3mg; choline (choline chloride), 250 mg; nicotinic acid, 60 mg; pantothenic acid (D-calcium pantothenate), 15 mg; folic acid, 1.5 mg; betaíne anhydrous, 80 mg; D-biotin, 0.15 mg; zinc (ZnO), 80 mg; manganese (MnO), 70 mg; iron (FeCO3), 60 mg; copper (CuSO4·5H2O), 8 mg; iodine (KI), 2 mg; selenium (Na2SeO3), 0.2 mg.

Growth performance

The birds were individually weighed on d 1, 7, 14, 21, 28, 35, and 42. Feed provided to the individual pen was noted, and leftover feed in the pen was also weighed weekly. The feed intake per replicate pen was determined by subtracting the leftover feed over to the total feed consumed during the week. The mortality of the birds was monitored daily. The ADG, ADFI, and FCR were calculated after adjusting for mortality, if any.

Sample collection

At 42 d, two birds/pen (n = 12) from each treatment group were selected randomly and were euthanized by carbon dioxide asphyxiation. A small piece of the ileum (5 cm posterior to the ileocecal transition) was collected (n = 6/treatment; one from each pen), snap-frozen in liquid nitrogen, and stored at -80°C for subsequent gene expression study. The cecum was excised, snap-frozen, and placed at -80°C for microbiota (n = 6/treatment; one from each pen) and VFA (n = 12/treatment; two from each pen) analysis while, approximately 1 cm of the ileum sample (6 cm posterior to the ileocecal junction) was excised, washed with normal saline and preserved in 10% neutral buffered formalin (NBF, pH 7) for the ileum histomorphology analysis (n = 4/treatment).

Total RNA extraction

The 50–100 mg of frozen ileum tissues were used for the total RNA extraction. The total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions. The RNA concentration was determined using NanoDrop one (Thermo Fisher Scientific, Madison, WI), while quality was accessed by running RNA samples on 2% agarose gel. Extracted RNA was stored at -80°C until further analysis.

Quantitative real-time PCR (qPCR) assay

The specific oligonucleotide primers used for the qPCR assay were designed using the NCBI Primer-Blast tool and are presented in Table 2. The gene expression analysis was carried out as previously described [13]. In short, for cDNA synthesis, 1 μg of total RNA (20 μL reaction of reverse transcriptase mixture) was reverse transcribed using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). The newly synthesized cDNA (20 μL) was diluted (25X) with 480 μL of nuclease-free water and was stored at -20°C until further analysis. The qPCR was carried out by using StepOne Plus real-time PCR system (Applied Biosystems, Foster City, CA) where10 μL reaction mixture containing 3 μL of cDNA, 5 μL of PowerUp SYBR Green Master Mix (Applied Biosystems, Foster City, CA), and 1 μL each of forward and reverse primers specific to the gene target was used. The amplification conditions were 50°C for 2 minutes (hold), 95°C for 2 minutes (hold), followed by 40 repeat cycles of 95°C for 15 seconds (denaturation), 60°C for 15 seconds (annealing), and 72°C for 1 minute (extension). Based on the consistency of expression in the ileum tissue, β-actin was chosen for normalization. The target genes were analyzed in duplicates, and an average value was taken from the experimental replicate. The expression level of target genes was determined using the cycle threshold (Ct) values and changes in the gene expression were calculated by the 2-ΔΔCt method compared to the control group. The relative mRNA expression was normalized to the endogenous reference gene B-actin.

Table 2. Primers used to quantify the expression of the genes by qPCR.

Gene Accession no. Primer Sequence Amplicon (bp)
SOD1 NM_205064.1 F: CAACACAAATGGGTGTACCA 119
R: CTCCCTTTGCAGTCACATTG
SOD2 NM_204211.1 F: CCTTCGCAAACTTCAAGGAG 160
R: AGCAATGGAATGAGACCTGT
GPX1 NM_001277853.2 F: AATTCGGGCACCAGGAGAA 101
R: CTCGAACATGGTGAAGTTGG
GPX3 NM_001163232.2 F: GAGGGAGAAGGTGAAATGCT 192
R: CCCAGCTCATTTTGTAGTGC
TXN NM_205453.1 F: GGCAATCTGGCTGATTTTGA 79
R: ACCATGTGGCAGAGAAATCA
PRDX1 NM_001271932.1 F: GGTATTGCATACAGGGGTCT 101
R: AGGGTCTCATCAACAGAACG
NRF2 NM_205117.1 F: CCCTGCCCTTAGAGATTAGAC 248
R: CAAGTTCATGTCCTTTTCTCTGC
HSF1 NM_001305256.1 F: AAGGAGGTGCTCCCAAAGTA 221
R: TTCTTTATGCTGGACACGCTG
HSF3 NM_001305041.1 F: TTCAGCGATGTGTTTAACCCT 244
R: GGAGGTCTTTTGGATCCTCT
HSP90 NM_001109785.1 F: GATAACGGTGAACCTTTGGG 120
R: GGGTAGCCAATGAACTGAGA
HSP70 NM_001006685.1 F: TCTCATCAAGCGTAACACCAC 104
R: TCTCACCTTCATACACCTGGAC
OCLN NM_205128 F: CCGAGGACAGCCCTCAATAC 82
R: CTTTGGTAGTCTGGGCTCCG
CLDN1 NM_001013611 F: TACCCCAAAAATGCCCCCTC 109
R: GCGGCATTGTAGTGTCCTCT
MUC2 NM_001318434 F: GTGGTCTGTGTGGCAACTT 71
R: GTCTCTTGCAGCCCATTCCT
IL4 NM_001030693 F: TGTGCCCACGCTGTGCTTACA 155
R: CTTGTGGCAGTGCTGGCTCTCC

*F = Forward; R = Reverse.

Ileum histomorphology

The 10% NBF fixed ileal tissues were shipped to the Histology core facility, John A. Burns School of Medicine, UH Manoa, where samples were dehydrated with the series of ethanol solutions (70%, 80%, 95%, and 100%) and embedded in paraffin blocks. The embedded ileum tissue was sectioned at 6 μm thickness and stained with hematoxylin and eosin staining. A total of 18 well oriented villus-crypts unit per sample was selected and observed under an 8× objective lens by using an Olympus microscope (U-TV0.63XC, Tokyo, Japan). Different intestinal morphological parameters such as villus height (VH)- distance from the tip of villus to the crypt, crypt depth (CD)- distance from villus base to the muscularis mucosa, and villus height to crypt depth ratio (VH/CD) [14] were measured along with the apparent villus surface area by using Infinite Analyze software (Lumenera Corporation, Ottawa, ON, Canada).

Volatile fatty acid

The VFA analysis was carried out as previously described [15]. The VFA profile was analyzed by using gas chromatography (Trace 1300, Thermo Scientific, Waltham, MA) equipped with a flame ionization detector (FID), AS 1310 series automatic liquid sampler, and a 30 m × 0.53 mm internal diameter column (Stabilwax-DA, Restek, Restek Corporation, Bellefonte, PA). Helium was supplied as a carrier gas at a flow rate of 14.5 mL/min, and run time was set for 15 min. The temperature of the injector port and detector port was set at 200°C and 240°C, respectively. Trimethyl acetate (TMA) was used as an internal standard. Data handling and processing were performed on ChromeleonTM 7.2 software (Thermo Scientific, Waltham, MA).

DNA extraction and 16S rRNA gene sequencing

Total genomic DNA was extracted from the cecal content using the QIAamp® DNA Stool Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instruction. The extracted bacterial DNA concentration was determined using NanoDrop one (Thermo Fisher Scientific, Madison, WI) and stored at -20°C until further analysis. The V3 and V4 hypervariable regions of the 16S rRNA gene were amplified as outlined in Illumina 16S Metagenomic Sequencing Library guideline (Illumina) with the following modifications: Platinum Taq DNA Polymerase High Fidelity (Invitrogen, Life Technologies Corporation, Grand Island, NY) was used to set up the PCR reaction, and Mag-Bind Total Pure NGS beads (Omega Bio-Tek) were used for PCR Clean-Ups, and 35 cycles were used in the PCR. Briefly, 16S rRNA sequencing involved the following steps: 1) 1st stage PCR: Amplicon PCR, 2) PCR Clean-Up, 3) 2nd Stage PCR: Index PCR, 4) 2nd PCR Clean-Up 5) Library quantification, normalization, and pooling, and 6) Library denaturing and MiSeq sample loading. The specific sequence of 16S rRNA gene used for amplified were forward primer (5′-CCTACGGGNGGCWGCAG-3′) and reverse primer (5′GACTACHVGGGTATCTAATCC- 3′) [16]. Finally, amplicons were normalized and pooled, and subsequently sequenced on the Illumina MiSeq sequencer at the University of Hawaii at Manoa in Genomics, Proteomics, and Bioinformatics core facility.

Sequencing processing

The Qiagen CLC Genomics Workbench 12.0.1 and the CLC Microbial Genomics module was used for microbial bioinformatics. The sequencing analysis procedures were followed as described in the OTU clustering step-by-step tutorial (Qiagen, Hilden, Germany). The sequencing files (ending with ‘fastq’) were imported in the CLC workbench; files were then paired, setting the minimum distance to 200 and maximum distance to 500. The reads were then trimmed, and the read with the low coverage was removed from the analysis. Thus, obtained reads were clustered as operational taxonomical units (OTUs), based on 97% sequence similarity against the Greengenes v13_8 97% database using the CLC Microbial Genomics module. Chimeras and OTUs with lower abundance (less than 10 reads) were removed. For alpha and beta diversity analysis, the phylogenetic tree was constructed using a maximum likelihood approach based on multiple sequence alignment (MSA) of the OTU sequences generated by MUSCLE in the workbench. The Simpson’s index and Shanon entropy were calculated to determine alpha diversity, while the unweighted UniFrac and weighted UniFrac distances were calculated to determine beta diversity. Permutational multivariate analysis of variance (PERMANOVA) analysis was carried out to measure the significance of beta diversity. Differences in microbiome among treatment groups were analyzed by one-way ANOVA to determine significant difference at different taxa level.

Statistical analysis

Growth performance, gene expression, ileum histomorphology, and significantly abundant microbiome were analyzed using the R-studio and presented as mean ± SEM. These data were analyzed by using one-way analysis of variance (ANOVA), and mean separation between treatment groups was done by the Tukey-Kramer test. Kruskal-Wallis pairwise test and pairwise PERMANOVA test were carried out for alpha and beta diversity to determine the potential difference between treatment groups using the CLC Microbial Genomics module. The spearman correlation analysis was conducted to analyze associations between differential abundance taxonomic groups and measured change parameters using statistical software JMP v14 (SAS Institute Inc., Cary, NC). Values with P<0.05 were regarded as statistically significant.

Results

Effects of alpha-lipoic acid in growth performance

The growth performance of birds in different treatment groups is shown in Fig 1. Supplementation of the ALA significantly improved (P<0.05) the final bodyweight in the heat-stressed broiler birds as compared to the HS group. There was no significant difference (P>0.05) in body weight between the treatment groups until 28 days. However, on 35 d, body weight was significantly decreased (P<0.05) in the HS group compared to the NHS group; dietary ALA supplementation in the heat-stressed broiler birds could not significantly improve the body weight. Nevertheless, on d 42, dietary ALA supplementation significantly improved (P<0.05) the bodyweight in the heat-stressed broiler birds. During the heat stress period (21–42 d), the ADFI was significantly lowered (P<0.05) in both HS and HS+ALA groups as compared to the NHS group. The ADG, on the other hand, was significantly lowered (P<0.05) in the HS group as compared to the NHS group, and dietary supplementation of ALA significantly improved (P<0.05) ADG in heat-stressed broiler birds during the heat stress period (21–42 d). FCR was significantly high (P<0.05) in the HS group and the ALA group compared to the NHS group. Dietary ALA supplementation was not able to significantly improve (P>0.05) the FCR in the heat-stressed broiler birds. There was no mortality in the NHS group, while one bird died in the HS group and the ALA group.

Fig 1. Effects of ALA on the growth performance of heat-stressed broilers.

Fig 1

(A) Bodyweight, (B) FCR, (C) ADG, and (D) ADFI. Data presented as the mean± SEM (n = 24/treatment). The effect of treatment was statistically different at * P<0.05 for body weight, ADG, ADFI, and FCR. Different letters indicate the significant difference among the treatments.

Effects of ALA on the intestinal gene expression

Expression of heat shock protein-related genes

The mRNA expression of heat shock protein-related genes (HSF1, HSF3, HSP70, and HSP90) in the ileum of birds in different treatment groups is shown in Fig 2(A). The mRNA expression of HSF1, HSF3, and HSP70 remains unchanged across the treatment groups. The mRNA expression of HSP90 was significantly decreased (P<0.05) in the HS group as compared to the NHS group, while dietary ALA supplementation significantly increased (P<0.05) the mRNA expression of HSP90 in heat-stressed broiler birds.

Fig 2. Effects of ALA supplementation on the ileal gene expression of heat-stressed broilers.

Fig 2

(A) heat sock protein, (B) tight-junction related, (C) antioxidants related, and (D) immune-related genes. Data presented as the mean ±SEM (n = 6/treatment). Different letters indicate the significant difference among the treatments (* P<0.05).

Expression of tight-junction related genes

The mRNA expression of the tight-junction related genes (OCLN and CLDN1) in the ileum of birds in different treatment groups is shown in Fig 2(B). The heat stress significantly decreased (P<0.05) the mRNA expression of OCLN in the HS group as compared to the NHS group, while dietary ALA supplementation significantly increased (P<0.05) the expression of OCLN in heat-stressed broiler birds. The mRNA expression of CLDN1 remains unchanged between treatment groups.

Expression of antioxidant related genes

The mRNA expression of the antioxidant-related genes (SOD1, SOD2, PRDX1, TXN, GPX1, GPX3, and NRF2) in the ileum of birds in different treatment groups are shown in Fig 2(C). The mRNA expression of the SOD2 and PRDX1 was significantly decreased (P<0.05) in the HS group as compared to the NHS group, while ALA supplementation significantly increased (P<0.05) their expressions in heat-stressed birds. Dietary ALA supplementation in the heat-stressed birds significantly increased (P<0.05) the mRNA expression of GPX3 as compared to the NHS group. The mRNA expression of the SOD1, TXN, GPX1, and NRF2 remain unchanged between the treatment groups.

Expression of immune-related genes

The mRNA expression of the immune-related genes (IL4 and MUC2) between different treatment groups is shown in Fig 2(D). Dietary ALA supplementation in the heat-stressed broiler birds significantly increased (P<0.05) the expression of MUC2 in heat-stressed broiler birds, as compared to the heat-stressed birds provided with just basal diet (HS group). The mRNA expression of the IL4 remained unchanged between the treatment groups.

Ileum histomorphology

The ileum histomorphology of birds in different treatment groups is shown in Fig 3. Villus height and Villus height to crypt depth ratio were significantly lowered (P<0.05) in the HS group as compared to the NHS group, while ALA supplementation significantly improved (P>0.05) these parameters in heat-stressed broiler birds. The villus surface area was significantly decreased (P<0.05) in the heat-stressed birds compared to the NHS group. Dietary ALA supplementation did not improve (P>0.05) the surface area in heat-stressed broiler birds. The crypt depth remained unchanged across the treatment groups.

Fig 3. Effects of ALA supplementation on the ileum histomorphology of the heat-stressed broilers.

Fig 3

(A) Villus height (VH), (B) Crypt depth (CD), (C) Villus surface area, (D) Villus height (VH): Crypt depth (CD). Data presented as the mean ±SEM (n = 4/treatment). The effect of treatment was statistically different at * P<0.05. Different letters indicate the significant difference among the treatments.

Volatile fatty acids

The major VFA in the cecal digesta of birds in different treatment groups is shown in Fig 4. The amount of propionate was significantly decreased (P<0.05) in the HS groups as compared to the NHS groups. Simultaneously, dietary ALA supplementation significantly increased (P<0.05) propionate concentration in the cecal digesta compared to the HS group. The amount of acetate was significantly decreased (P<0.05) in the HS group as compared to the NHS group, while dietary ALA supplementation in heat-stressed broiler birds significantly increased its amount as compared to the HS group. Dietary ALA supplementation in the heat-stressed broiler birds also significantly increased (P<0.05) the concentration of butyrate as compared to the other two groups. Overall, total VFA was significantly lower (P<0.05) in the HS group as compared to the NHS group, and dietary ALA supplementation significantly increased (P<0.05) the concentration of the total VFA.

Fig 4. Effects of ALA supplementation on the major volatile fatty acids in the cecal digesta of the heat-stressed broilers.

Fig 4

(A) Acetate, (B) Propionate, (C) Butyrate, and (D) Total VFA. Data presented as the mean ±SEM (n = 12/treatment). The effect of treatment was statistically different at * P<0.05. Different letters indicate the significant difference among the treatments.

Alpha and beta diversity of cecal microbiota

Shannon entropy was significantly higher (P<0.05) in the HS+ALA group as compared to the NHS group, while no differences (P>0.05) were observed in the Simpson index between these two groups (Fig 5). The unweighted UniFrac based PCoA revealed that bacterial composition in cecal content was significantly different (PERMANOVA analysis, P value = 0.01687) between the treatments, while no difference was observed in weighted UniFrac (Fig 6).

Fig 5. Box plot showing the effects of ALA supplementation on microbial alpha diversity in heat-stressed broilers.

Fig 5

(A) Shannon entropy, and (B) Simpson’s index.

Fig 6. Effects of ALA supplementation on microbial beta diversity in heat-stressed broilers.

Fig 6

(A) weighted UniFrac, and (B) unweighted UniFrac.

Cecal microbial composition

At the phylum level, HS and HS+ALA groups were dominated by Firmicutes (63%, 63%), followed by Bacteroidetes (36%, 35%), while the NHS group has an almost equal abundance of Firmicutes (49%) and Bacteroidetes (50%) (Fig 7(A)). At the class level, the taxon-based analysis revealed that Clostridia and Bacteroidia were dominant classes across different treatment groups. However, these dominant taxa were not significantly different (P>0.05) across treatment groups (Fig 7(B)). At the order level, Clostridales and Bacteroidales were dominant in different treatment groups (Fig 7(C)). These dominant orders were not statistically different between treatments. Dietary ALA supplementation, however, significantly increased (P<0.05) Lactobacillales in the heat-stressed birds (Fig 7(D)) as compared to the HS group.

Fig 7. Cecal microbial compositions.

Fig 7

(A) Relative abundance at Phylum level, (B) Relative abundance at Class level, (C) Relative abundance at the Order level, and (D) Significantly abundance of Lactobacillales.

The Porphyromonadaceae, Ruminococcaceae, Lachnospiraceae, and unknown Family of Clostridiales were the dominant family found across the treatment groups. The families Lactobacillaceae and Peptostreptococcaceae were significantly enriched (P<0.05) in the HS+ALA group compared to other groups (Fig 8).

Fig 8. Cecal microbial composition at the family level. (A) Relative abundance of microbiota, and (B) Significantly abundance microbiota within the family level.

Fig 8

At the genus level, Parabacteroides was the most dominant genus across all groups- HS (29%), HS+LA (24%), and NHS (44%), followed by unknown family_Clostridales. The relative abundance of these dominant genera was not significantly different among the groups. Dietary ALA supplementation, however, significantly enriched (P<0.05) the Lactobacillus and unknown genus of Peptostreptococcaceae in the heat-stressed birds (Fig 9).

Fig 9. Cecal microbial composition at the genus level. (A) Relative average abundance of microbiota, and (B) significantly abundance microbiota at the genus level.

Fig 9

Correlation between the differential microbial species and measured parameters

The significant correlations observed after performing Spearman correlation analysis are shown in Table 3. The results showed that the expression of SOD2 and OCLN were positively (P<0.05) associated with order Lactobacillales. Acetate, butyrate, and total VFAs were positively correlated (P<0.05) with order Lactobacillales, family Lactobacillaceae, family Peptostreptococcaceae, genus Lactobacillus, and unknown_genus_Peptostreptococcaceae; While propionate was positively correlated (P<0.05) only with order Lactobacillales.

Table 3. Spearman correlation between the differential microbial species and changed measure parameters.

Variables Differential enriched microbes Spearman ρ Prob>|ρ
SOD2 O_Lactobacillales 0.5119 0.0299*
OCLN O_Lactobacillales 0.4891 0.0394*
Acetate O_Lactobacillales 0.5595 0.0158*
Acetate F_Lactobacillaceae 0.7004 0.0012*
Acetate F_Peptostreptococcaceae 0.5199 0.0270*
Acetate G_Lactobacillus 0.7004 0.0012*
Acetate G_Unknown_Genus_Peptostreptococcaceae 0.5199 0.0270*
Propionate O_Lactobacillales 0.4871 0.0404*
Butyrate O_Lactobacillales 0.5429 0.0199*
Butyrate F_Lactobacillaceae 0.6715 0.0023*
Butyrate F_Peptostreptococcaceae 0.4795 0.0441*
Butyrate G_Lactobacillus 0.6715 0.0023*
Butyrate G_Unknown_Genus_Peptostreptococcaceae 0.4795 0.0441*
Total VFA O_Lactobacillales 0.5905 0.0099*
Total VFA F_Lactobacillaceae 0.7128 0.0009*
Total VFA F_Peptostreptococcaceae 0.471 0.0485*
Total VFA G_Lactobacillus 0.7128 0.0009*
Total VFA G_Unknown_Genus_Peptostreptococcaceae 0.471 0.0485*

Discussion

This study was carried out to evaluate the effectiveness of ALA (500 mg/kg of feed) to mitigate the negative effects of heat stress in poultry by observing growth performance along with different GI physiological parameters. Dietary supplementation of the ALA (500 mg/kg) significantly improved the final body weight, ADG, expressions of antioxidant, heat-shock, tight-junction, and immune-related genes, increased concentration of VFAs, and enriched beneficial gut microbiota in the heat-stressed broiler birds.

Heat stress negatively affects the production performance of broilers by decreased feed intake and growth [2, 17]. We also observed a decreased growth performance of broilers under heat stress. Several nutritional strategies are employed to mitigate the negative effects of heat stress in poultry. Among them, dietary supplementation of ALA as potential feed additives during heat stress has gained popularity in recent years and is found effective in mitigating the negative effects of heat stress in poultry [9]. In accord with those, we also observed significant improvement in the final body weight and ADG in heat-stressed broiler birds supplemented with ALA.

Further, we were interested in delineating the underlying GI physiological changes, leading to improved growth performance in heat-stressed birds supplemented with ALA. The intestine is an important organ that helps in nutrient digestion and absorption. High environmental temperature is found to have detrimental effects on the intestine [18]. Amongst different intestine parts, the ileum, a terminal part of the small intestine, is mainly susceptible to heat stress [19]. Different groups of genes (heat shock protein, antioxidant, tight junction, and immune-related genes) were then analyzed to detail the effects of ALA on heat-stressed broiler birds.

Heat shock proteins (HSPs)–chaperons–are the proteins that help properly fold the protein during the stress condition and possess cytoprotective action [20]. Different HSPs and their transcriptional factors were analyzed to determine the protective action of ALA during stress. Unlike previous studies [19, 21], in acute stress, where expression of HSP90 was higher in heat-stressed birds, expression HSP90 was lowered in this study. There have been varied expressions of HSFs and HSPs regarding tissue sample and the stress duration (i.e., acute vs. chronic stress) [22]. The spatiotemporal expression study of the HSPs and HSFs is therefore warranted. The lower expression of these genes in our study may be due to the exhaustion of the protective mechanism within the cells during chronic stress. Interestingly, dietary supplementation of ALA significantly increased the expression of HSP90.

Antioxidants are the molecules that scavenge the free radicals produced inside the cell. Heat stress elicits oxidative stress resulting in excess production of free radicals within the cell [23]. Therefore, different antioxidant-related genes were analyzed in this study to determine the effectiveness of ALA at the cellular level. The expressions of SOD2, PRDX1, and GPX3 were significantly improved in the heat-stressed broiler birds supplemented with ALA. SOD2 is mitochondrial manganese (Mn) containing enzymes that dismutase the superoxide radicals into hydrogen peroxide [24]. GPX3 reduces hydroperoxides and H2O2 by glutathione [25], while PRDX1 reduces H2O2 and hydroperoxides by using thioredoxin [26]. Like this study, previous studies have also demonstrated beneficial effects of ALA in improving total antioxidant capacity and antioxidant enzyme activity in oxidative stress conditions in broilers [27, 28].

The expression of tight junction protein and immune-related genes was then analyzed. The OCLN, a transmembrane protein, is one of the major tight junction protein that regulates paracellular permeability and also plays a role in barrier functions [29]. Heat stress impairs the tight-junction protein in the intestine by reducing the blood flow and ultimately generating hypoxia in the intestine [30]. In light of that, the OCLN was lowered in the heat-stressed broiler birds in this study, while ALA supplementation improved the expression of OCLN in heat-stressed broiler birds. Besides, MUC2 expression was also improved in ALA supplemented heat-stressed broiler birds. Mucin is essential in protecting the gut from pathogens, acidic environment, digestive enzymes, and nutrient digestion and absorption [31]. These results indicate that ALA supplementation improved the intestinal membrane integrity and protected the gut from pathogen and acidic environment, which might be one reason for improving the body weight and ADG in heat-stressed birds.

Heat stress impairs the intestinal morphology, decreases villus height, and villus height to crypt depth ratio [32–34]. In this study, heat stress altered the villus’ morphology in the ileum, which may be due to intestinal ischemia, leading to epithelial shedding [35]. Although not statistically significant, the dietary ALA supplementation improved villus height and villus height to crypt depth ratio in heat-stressed birds. The improvement observed in the villus structure was possibly due to the VFAs produced in the gut as VFAs are exerting trophic effects on the intestinal morphology [36]. This observation drove us to analyze the major VFAs produced in the gut of heat-stressed birds. All major VFAs (acetate, propionate, and butyrate) concentrations were significantly increased in heat-stressed broiler birds supplemented with ALA. The improvement in the VFAs in heat-stressed birds was possibly due to the change in the microbiota as VFA is the microbial fermentation product [37]. Thus, we directed our study towards analyzing the microbiota changes in heat-stressed birds supplemented with ALA.

Dietary ALA supplementation significantly improved the relative abundance of Lactobacillales (order), Lactobacillaceace (family), Peptostreptococcaceae (family), Lactobacillus, and unknown genus of Peptostreptococcaceae in the heat-stressed broiler birds.

Peptostreptococcaceae belong to the phylum Firmicutes and play a role in gut homeostasis [38]. They are also found to produce VFAs in the intestine [39]. Spearman’s correlation analysis in this study too revealed a positive association between Peptostreptococcaceae and acetate, butyrate, and total VFAs. Lactobacillus is the gram-positive bacteria that produce lactic acid, which reduces the pH and prevents the growth of pathogenic bacteria [40]. Thus, significant dominance of the Lactobacillus probably reduced the risk of pathogen amplification and invasion in heat-stressed birds supplemented with ALA. Besides, lactobacillus is found to have antioxidant capacity and remove the ROS to mitigate the damage induced by oxidative stress [41]. Moreover, Lactobacillus is also considered as a potent probiotic to improve gut health [42, 43]. Additionally, a positive association was observed between Lactobacillus and different gut health parameters such as expressions of SOD2 and OCLN; and concentration of acetate, propionate, butyrate, and total VFAs. Considering these results, improved body weight and ADG in heat-stressed broilers supplemented with the ALA can be mainly attributed to improved gut microbiota and VFAs. More specifically, Lactobacillus and Peptostreptococcaceae might have played a vital role in improving growth performance in heat-stressed birds.

The alteration of the microbiota on supplementation of ALA can be attributed to the difference in acquisition and use of the lipoic acid among the different microbial species. There is diversity in the lipoate metabolism among different microbial species. One such example is a difference in lipoate metabolism between Helicobacter pylori and Pseudomonas aeruginosa. Protein encoding the lipoate metabolism is absent in the H. pylori, while P. aeruginosa contains the genome that encodes both the lipoate synthesis and lipoate scavenging enzymes as well as the components of the five lipoate complexes [44].

Conclusion

The results of this study revealed that the dietary supplementation of ALA (500 mg/kg) significantly improved the final body weight and ADG; improved expressions of antioxidant, heat shock, immune-related, and tight-junction related genes in the ileum; increased concentration of VFAs and enriched the beneficial bacteria in the gut of heat-stressed broilers. Thus, ALA supplementation can be considered as one of the potential strategies to mitigate heat stress in broilers.

Supporting information

S1 Data

(XLSX)

Acknowledgments

We sincerely thank Socorro Tauyan for helping in animal experimentation, Dr. Amit Singh in sampling, and Dr. Mohammad Arif for providing the facilities for Microbiome Analysis.

Data Availability

Additional supplemental files having the minimal data set is submitted along with this manuscript.

Funding Statement

This work was supported by a Start-up grant from CTAHR University of Hawaii at Manoa, and USDA Multistate (2052R) to B.M.

References

  • 1.Griffin H, Goddard C. Rapidly growing broiler (meat-type) chickens. Their origin and use for comparative studies of the regulation of growth. Int J Biochem. 1994;26: 19–28. doi: 10.1016/0020-711x(94)90190-2 [DOI] [PubMed] [Google Scholar]
  • 2.Wasti S, Sah N, Mishra B. Impact of heat stress on poultry health and performances, and potential mitigation strategies. Animals. 2020;10. doi: 10.3390/ani10081266 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.St-Pierre NR, Cobanov B, Schnitkey G. Economic Losses from Heat Stress by US Livestock Industries. J Dairy Sci. 2003;86: E52–E77. doi: 10.3168/JDS.S0022-0302(03)74040-5 [DOI] [Google Scholar]
  • 4.Lin H, Jiao HC, Buyse J, Decuypere E. Strategies for preventing heat stress in poultry. Worlds Poult Sci J. 2006;62: 71–86. doi: 10.1079/WPS200585 [DOI] [Google Scholar]
  • 5.Shimamoto S, Nakamura K, Tomonaga S, Furukawa S, Ohtsuka A, Ijiri D. Effects of Cyclic High Ambient Temperature and Dietary Supplementation of Orotic Acid, a Pyrimidine Precursor, on Plasma and Muscle Metabolites in Broiler Chickens. Metabolites. 2020;10: 189. doi: 10.3390/metabo10050189 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Saleh AA, Eltantawy MS, Gawish EM, Younis HH, Amber KA, El-Moneim A, et al. Impact of Dietary Organic Mineral Supplementation on Reproductive Performance, Egg Quality Characteristics, Lipid Oxidation, Ovarian Follicular Development, and Immune Response in Laying Hens Under High Ambient Temperature. Biol Trace Elem Res. 2019; 1–9. doi: 10.1007/s12011-019-01861-w [DOI] [PubMed] [Google Scholar]
  • 7.Saleh AA, Kirrella AA, O Dawood MA, Ebeid TA, Ahmed Ali Saleh C. Effect of dietary inclusion of cumin seed oil on the performance, egg quality, immune response and ovarian development in laying hens under high ambient temperature. J Anim Physiol Anim Nutr. 2019;103: 1810–1817. doi: 10.1111/jpn.13206 [DOI] [PubMed] [Google Scholar]
  • 8.Packer L, Witt EH, Tritschler HJ. ALPHA-LIPOIC ACID AS A BIOLOGICAL ANTIOXIDANT. Free Radic Biol Med. 1995;19: 227–250. doi: 10.1016/0891-5849(95)00017-r [DOI] [PubMed] [Google Scholar]
  • 9.Sohaib M, Anjum FM, Nasir M, Saeed F, Arshad MS, Hussain S. Alpha-lipoic acid: An inimitable feed supplement for poultry nutrition. J Anim Physiol Anim Nutr (Berl). 2017;102: 33–40. doi: 10.1111/jpn.12693 [DOI] [PubMed] [Google Scholar]
  • 10.Bilska A, Wodek L. Lipoic acid–the drug of the future? Pharamacological Reports. 2005;57: 570–577. [PubMed] [Google Scholar]
  • 11.NRC. Nutrient Requirements of Poultry. Ninth Revi. Washington, DC: National Academies Press; 1994. [Google Scholar]
  • 12.Guo ZY, Li JL, Zhang L, Jiang Y, Gao F, Zhou GH. Effects of alpha-lipoic acid supplementation in different stages on growth performance, antioxidant capacity and meat quality in broiler chickens. Br Poult Sci. 2014;55: 635–643. doi: 10.1080/00071668.2014.958057 [DOI] [PubMed] [Google Scholar]
  • 13.Sah N, Kuehu DL, Khadka VS, Deng Y, Peplowska K, Jha R, et al. RNA sequencing-based analysis of the laying hen uterus revealed the novel genes and biological pathways involved in the eggshell biomineralization. Sci Rep. 2018;8: 16853. doi: 10.1038/s41598-018-35203-y [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Sharma MK, Dinh T, Adhikari PA. Production performance, egg quality, and small intestine histomorphology of the laying hens supplemented with phytogenic feed additive. J Appl Poult Res. 2020. doi: 10.1016/j.japr.2019.12.001 [DOI] [Google Scholar]
  • 15.Singh AK. In Ovo and Post-hatch Nutritional Programming to Improve Broiler Performance and Gut Health. University of Hawai’i at Manoa. 2019. [Google Scholar]
  • 16.Klindworth A, Pruesse E, Schweer T, Peplies J, Quast C, Horn M, et al. Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic acids Res. 2013;41: e1–e1. doi: 10.1093/nar/gks808 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wasti S, Sah N, Singh AK, Lee CN, Jha R, Mishra B. Dietary supplementation of dried plum: a novel strategy to mitigate heat stress in broiler chickens. J Anim Sci Biotechnol. 2021;12: 1–17. doi: 10.1186/s40104-020-00531-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Lambert GP. Stress-induced gastrointestinal barrier dysfunction and its inflammatory effects. J Anim Sci. 2009;87: E101–E108. doi: 10.2527/jas.2008-1339 [DOI] [PubMed] [Google Scholar]
  • 19.Varasteh S, Braber S, Akbari P, Garssen J, Fink-Gremmels J. Differences in susceptibility to heat stress along the chicken intestine and the protective effects of galacto-oligosaccharides. PLoS One. 2015;10: e0138975. doi: 10.1371/journal.pone.0138975 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wegele H, Müller L, Buchner J. Hsp70 and Hsp90—a relay team for protein folding. In Reviews of physiology, biochemistry and pharmacology. Berlin, Heidelberg: Springer; 2004. pp. 1–44. [DOI] [PubMed] [Google Scholar]
  • 21.Flees J, Rajaei-Sharifabadi H, Greene E, Beer L, Hargis BM, Ellestad L, et al. Effect of Morinda citrifolia (Noni)-enriched diet on Hepatic Heat Shock protein and lipid metabolism-related genes in heat stressed broiler chickens. Front Physiol. 2017;8: 919. doi: 10.3389/fphys.2017.00919 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Xie J, Tang L, Lu L, Zhang L, Xi L, Liu HC, et al. Differential expression of heat shock transcription factors and heat shock proteins after acute and chronic heat stress in laying chickens (Gallus gallus). PLoS One. 2014;9. doi: 10.1371/journal.pone.0102204 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Mishra B, Jha R. Oxidative stress in the poultry gut: Potential challenges and interventions. Frontiers in Veterinary Science. Frontiers Media S.A.; 2019. doi: 10.3389/fvets.2019.00060 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Surai PF. Antioxidant systems in poultry biology: superoxide dismutase. J Anim Res Nutr. 2016;1: 8. [Google Scholar]
  • 25.Surai PF, Kochish II, Fisinin VI. Glutathione peroxidases in poultry biology: Part 1. Classification and mechanisms of action. Worlds Poult Sci J. 2018;74: 185–198. [Google Scholar]
  • 26.Neumann CA, Krause DS, Carman CV, Das S, Dubey DP, Abraham JL, et al. Essential role for the peroxiredoxin Prdx1 in erythrocyte antioxidant defence and tumour suppression. Nature. 2003;424: 561. doi: 10.1038/nature01819 [DOI] [PubMed] [Google Scholar]
  • 27.Li W, Wei F, Xu B, Sun Q, Deng W, Ma H, et al. Effect of stocking density and alpha-lipoic acid on the growth performance, physiological and oxidative stress and immune response of broilers. Asian-Australasian J Anim Sci. 2019;32: 1914–1922. doi: 10.5713/ajas.18.0939 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.El-Senousey HK, Chen B, Wang JY, Atta AM, Mohamed FR, Nie QH. Effects of dietary Vitamin C, Vitamin E, and alpha-lipoic acid supplementation on the antioxidant defense system and immune-related gene expression in broilers exposed to oxidative stress by dexamethasone. Poult Sci. 2018;97: 30–38. doi: 10.3382/ps/pex298 [DOI] [PubMed] [Google Scholar]
  • 29.Lee SH. Intestinal permeability regulation by tight junction: implication on inflammatory bowel diseases. Intest Res. 2015;13: 11. doi: 10.5217/ir.2015.13.1.11 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Pearce SC, Mani V, Boddicker RL, Johnson JS, Weber TE, Ross JW, et al. Heat stress reduces intestinal barrier integrity and favors intestinal glucose transport in growing pigs. PLoS One. 2013;8: e70215. doi: 10.1371/journal.pone.0070215 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Montagne L, Piel C, Lalles JP. Effect of diet on mucin kinetics and composition: nutrition and health implications. Nutr Rev. 2004;62: 105–114. doi: 10.1111/j.1753-4887.2004.tb00031.x [DOI] [PubMed] [Google Scholar]
  • 32.Burkholder KM, Thompson KL, Einstein ME, Applegate TJ, Patterson JA. Influence of stressors on normal intestinal microbiota, intestinal morphology, and susceptibility to Salmonella enteritidis colonization in broilers. Poult Sci. 2008;87: 1734–1741. doi: 10.3382/ps.2008-00107 [DOI] [PubMed] [Google Scholar]
  • 33.Sohail MU, Hume ME, Byrd JA, Nisbet DJ, Ijaz A, Sohail A, et al. Effect of supplementation of prebiotic mannan-oligosaccharides and probiotic mixture on growth performance of broilers subjected to chronic heat stress. Poult Sci. 2012;91: 2235–2240. doi: 10.3382/ps.2012-02182 [DOI] [PubMed] [Google Scholar]
  • 34.Yi D, Hou Y, Tan L, Liao M, Xie J, Wang L, et al. N-acetylcysteine improves the growth performance and intestinal function in the heat-stressed broilers. Anim Feed Sci Technol. 2016;220: 83–92. [Google Scholar]
  • 35.Rivera LR, Thacker M, Pontell L, Cho HJ, Furness JB. Deleterious effects of intestinal ischemia/reperfusion injury in the mouse enteric nervous system are associated with protein nitrosylation. Cell Tissue Res. 2011;344: 111–123. doi: 10.1007/s00441-010-1126-x [DOI] [PubMed] [Google Scholar]
  • 36.Wong JM, De Souza R, Kendall CW, Emam A, Jenkins DJ. Colonic health: fermentation and short chain fatty acids. J Clin Gastroenterol. 2006;40: 235–243. doi: 10.1097/00004836-200603000-00015 [DOI] [PubMed] [Google Scholar]
  • 37.Jha R, Fouhse JM, Tiwari UP, Li L, Willing BP. Dietary fiber and intestinal health of monogastric animals. Front Vet Sci. 2019;6. doi: 10.3389/fvets.2019.00006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Leng Y, Yi M, Fan J, Bai Y, Ge Q, Yao G. Effects of acute intra-abdominal hypertension on multiple intestinal barrier functions in rats. Sci Rep. 2016;6: 22814. doi: 10.1038/srep22814 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Kisuse J, La-ongkham O, Nakphaichit M, Therdtatha P, Momoda R, Tanaka M, et al. Urban diets linked to gut microbiome and metabolome alterations in children: A comparative cross-sectional study in Thailand. Front Microbiol. 2018;9: 1345. doi: 10.3389/fmicb.2018.01345 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.He J, He Y, Pan DD, Cao J, Sun YY, Zeng X. Associations of gut microbiota with heat stress-induced changes of growth, fat deposition, intestinal morphology and antioxidant capacity in ducks. Front Microbiol. 2019;10: 903. doi: 10.3389/fmicb.2019.00903 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Xin J, Zeng D, Wang H, Ni X, Yi D, Pan K, et al. Preventing non-alcoholic fatty liver disease through Lactobacillus johnsonii BS15 by attenuating inflammation and mitochondrial injury and improving gut environment in obese mice. Appl Microbiol Biotechnol. 2014;98: 6817–6829. doi: 10.1007/s00253-014-5752-1 [DOI] [PubMed] [Google Scholar]
  • 42.Martín R, Chamignon C, Mhedbi-Hajri N, Chain F, Derrien M, Escribano-Vázquez U, et al. The potential probiotic Lactobacillus rhamnosus CNCM I-3690 strain protects the intestinal barrier by stimulating both mucus production and cytoprotective response. Sci Rep. 2019;9: 5398. doi: 10.1038/s41598-019-41738-5 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Jha R, Das R, Oak S, Mishra P. Probiotics (Direct-Fed Microbials) in Poultry Nutrition and Their Effects on Nutrient Utilization, Growth and Laying Performance, and Gut Health: A Systematic Review. Animals. 2020;10: 1863. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Spalding MD, Prigge ST. Lipoic Acid Metabolism in Microbial Pathogens. Microbiol Mol Biol Rev. 2010;74: 200–228. doi: 10.1128/MMBR.00008-10 [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision Letter 0

Arda Yildirim

9 Apr 2021

PONE-D-21-05713

Dietary Supplementation of Alpha-lipoic Acid Mitigates the Negative Effects of Heat Stress in Poultry

PLOS ONE

Dear Dr. Mishra,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

The manuscript should be revised deeply. The main problem found in the manuscript is related to the some aspects of methodology and redaction style. The manuscript should be presented according to guidelines for authors of Plos One. Please review the referee comments and make your peer revision. Thanks for your hard work.

Please submit your revised manuscript by May 22 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Arda Yildirim, Ph.D.

Academic Editor

PLOS ONE

https://www.researchgate.net/profile/Arda_Yildirim2

Additional Editor Comments:

Firstly, thank you for your suggestion as an academic editor. This MS deals with an interesting and important topic in poultry production. Nevertheless there are still some points of concern from the reviewers, before the manuscript can be accepted for publication. Please make MS title specific because of focusing on animal material that is broiler. As there are some points unclear to me regarding the trial execution, sampling and statements in the MS, I recommend major revision.

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. In your Data Availability statement, you have not specified where the minimal data set underlying the results described in your manuscript can be found. PLOS defines a study's minimal data set as the underlying data used to reach the conclusions drawn in the manuscript and any additional data required to replicate the reported study findings in their entirety. All PLOS journals require that the minimal data set be made fully available. For more information about our data policy, please see http://journals.plos.org/plosone/s/data-availability.

Upon re-submitting your revised manuscript, please upload your study’s minimal underlying data set as either Supporting Information files or to a stable, public repository and include the relevant URLs, DOIs, or accession numbers within your revised cover letter. For a list of acceptable repositories, please see http://journals.plos.org/plosone/s/data-availability#loc-recommended-repositories. Any potentially identifying patient information must be fully anonymized.

Important: If there are ethical or legal restrictions to sharing your data publicly, please explain these restrictions in detail. Please see our guidelines for more information on what we consider unacceptable restrictions to publicly sharing data: http://journals.plos.org/plosone/s/data-availability#loc-unacceptable-data-access-restrictions. Note that it is not acceptable for the authors to be the sole named individuals responsible for ensuring data access.

We will update your Data Availability statement to reflect the information you provide in your cover letter.

3. Thank you for stating the following in the Acknowledgments Section of your manuscript:

[This work was supported by a Start-up grant from CTAHR University of Hawaii at Manoa, and USDA Multistate (2052R) to B.M.Apart from providing funds, these organizations were not involved in any experimental procedure and manuscript preparation.]

We note that you have provided funding information that is not currently declared in your Funding Statement. However, funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form.

Please remove any funding-related text from the manuscript and let us know how you would like to update your Funding Statement. Currently, your Funding Statement reads as follows:

 [N/A]

Please include your amended statements within your cover letter; we will change the online submission form on your behalf.

4. We noticed you have some minor occurrence of overlapping text with the following previous publication(s), which needs to be addressed:

- https://scholarspace.manoa.hawaii.edu/handle/10125/63507

Lines 184 - 194

In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Partly

Reviewer #4: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

Reviewer #4: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The design and objectives of this study is interesting, and it is expected to contribute further to the knowledge base of improving broiler health by providing nutritional strategies to tackle heat-stress problem. The authors have done good work to make a comprehensive story of microbiota, immunity, heat stress parameters and performance. However, authors need to revise their work and correct some inherent concerns in the feed formulation. The other general comments and minor corrections are listed pointwise.

Major comments

1. What standard requirement was followed for this diet formulation? The calcium and phosphorus are extremely low.

The starter diet has high protein but comparatively low energy which is not as the right recommended ratio.

2. Were the birds weighed individually to show the standard deviation in each pen?

3. Confirm whether the gene expression calculation was based on relative standard curve or the comparative CT

method. Describe more specifically what represents the gene expression value.

4. Line 153. The citation for embedding is not properly attributed. The reviewer was not able to locate the information in

the cited article or in the reference attributed in the cited article!

5. Since the authors have stated that ALA would have improved performance via microbiota-VFA modulation, it is

expected that they provide some insight into why ALA potentially modify microbiota.

Minor comments

Line 17: add ‘is’ between ‘which’ and ‘readily’

Line 20: State clearly the adaptation and allocation period along with the replication of the treatments.

Line 48: Better say heavier breast meat. Also, it should be improved breeding and not improved chicken.

Line 50: Insert ‘the’ between ‘and’ and ‘presence’.

Line 51: High temperature is the problem of tropical condition in the context of chicken.

Line 59: Check whether it will be is or are with ALA.

Line 82: Use n for experimental unit. Either state total number of birds per treatment or just mention birds per experimental unit.

Line 91: Remove ‘with’ after ‘fed’.

Line 110: Change ‘reducing’ to ‘subtracting’.

Line 158: Is it muscularis mucosae or submucosa?

Line 200-2001: Were the reads trimmed before pairing or after pairing?

Line 227: Add significance statistics.

Line 238: Remove numerical improvement. This means there was high variation among the replicates.

Line 244-245: Check grammar.

Line 262: Change ‘remains’ to ‘remain’.

Line 273: Use correct preposition after ‘compared’. Add significance statistics.

Line 288: Remove ‘total’ before ‘concentration’.

Line 298: Change ‘have’ to ‘had’.

Line 305: Add ‘the’ before ‘heat-stressed’.

Line 378: Is decreasing crypt depth an impairment?

Figure 5: Define the box plot. State whether the whiskers are error or data range. If the whiskers are range, then why are no data points on NHS box plot whisker?

Figure 7: What is the unit of relative abundance of Lactobacillales? Is it any fractions?

Reviewer #2: Dear Authors Regarding the manuscript title Dietary Supplementation of Alpha-lipoic Acid Mitigates the Negative Effects of Heat Stress in Poultry

The scientific background of the topic was well mentioned in the introduction part. The experiment design, as well as the replicates and methods used, were very good. The results obtained were presented in tables well discussed with other author’s results. However, some observation in the present paper should be corrected and add to improve the quality of the paper.

• The title (Dietary Supplementation of Alpha-lipoic A 1 cid Mitigates the Negative Effects of Heat Stress in Poultry) it will be better if you replacing Poultry to broilers

• Table 1 Ingredients and nutrient composition of the experimental diets, need to carful checking for the following :

1- SBM , add the crude protein level 44 or 46%?

2- MEn, kcal/kg, Ca, digP , not according to the Cobb-500 requirement.

• Introduction and Discussion

Need some other references about the impact of heat stress and Growth and Lipid Metabolism Marker Genes in Broiler Chickens in poultry I recommend you read the following references:

Saki Shimamoto 1,2, Kiriko Nakamura 1, Shozo Tomonaga 3, Satoru Furukawa 4, Akira Ohtsuka and Daichi Ijiri. Effects of Cyclic High Ambient Temperature and Dietary Supplementation of Orotic Acid, a Pyrimidine Precursor, on Plasma and Muscle Metabolites in Broiler Chickens. Metabolites 2020, 10, 189; doi:10.3390/metabo10050189

Saleh, Ahmed A.; Shukry, Mustafa; Farrag, Foad; Soliman, Mohamed M.; Abdel-Moneim, Abdel-Moneim E. (2021) "Effect of Feeding Wet Feed or Wet Feed Fermented by Bacillus licheniformis on Growth Performance, Histopathology and Growth and Lipid Metabolism Marker Genes in Broiler Chickens" Animals 11, no. 1: 83.

Ahmed A. Saleh , Mohammed S. Eltantawy , Esraa M. Gawish , Hassan H. Younis , Khairy A. Amber , Abd El-Moneim E. Abd El-Moneim & Tarek A. Ebeid (2020) Impact of Dietary Organic Mineral Supplementation on Reproductive Performance, Egg Quality Characteristics, Lipid Oxidation, Ovarian Follicular Development, and Immune Response in Laying Hens Under High Ambient Temperature. Biological Trace Element Research. 195:506–514.

Inoue H, Shimamoto S, Takahashi H, et al. Effects of astaxanthin-rich dried cell powder from Paracoccus carotinifaciens on carotenoid composition and lipid peroxidation in skeletal muscle of broiler chickens under thermo-neutral or realistic high temperature conditions. Anim Sci J. 2018;00:1–8.

Ahmed A. Saleh , Abeer A. Kirrella, Mahmoud A. O. Dawood, Tarek A. Ebeid (2019) Effect of dietary inclusion of cumin seed oil on the performance, egg quality, immune response and ovarian development in laying hens under high ambient temperature. Animal Physiology and Animal Nutrition. 103(6):1810-1817.

• Results: it will be better if you present the data for performance in table.

Reviewer #3: Heat stress is a practical problem to broiler chicks which results in over $128 million in losses for the poultry industry in the United States. The manuscript by Wasti et al examines whether using alpha lipoic acid (ALA) mitigated negative effects of heat stress in poultry chickens. The results document the beneficial effects of ALA in broiler chickens by improving gut health. The manuscript has been written in a well-orchestrated manner. However, some points have to be discussed and manuscript could be accepted only after major revisions.

General Comments:

Line 91: Remove the space error after “phases”, and also throughout the manuscript.

Line 97: Add space between “study[9]”

Line 111: No need to explain abbreviation ADG again once it already mentioned in the abstract section.

Line 238: Dietary ALA supplementation o was able to improve the FCR. What is supplementation o? Please remove it from text.

Specific Comments:

Comment 1: Figure 1,2,3,4 No word about sample size based on which the means and SEM were computed. Please add.

Comment 2: Most of the figures do not have the superscripts. Authors have to correct those figures.

Comment 3: The exact computed P-value at least for significant ones should be shown not only (P<0.05) which is a theoretical value.

Comment 4: Can authors please describe more for antioxidant defence system and its significance in poultry?

Comment 5: Please elaborate the ALA mechanism in improving growth performance of heat stress chickens in the discussion section.

Comment 6: Authors have not mentioned any dehydration-related parameters which is the most important factor to study the heat stress-related study as this causes dehydration in animals.

Comment 7: During dehydration, mainly epithelial cells hampered. Tight junction plays a major role during heat stress. The authors focused on the claudin and occludin molecules. Results showing that insignificant changes in claudin molecule but occludin is significantly higher in the treatment group. Tight junction maintains by both of these molecules. It is assuming from this result that due to heat stress, epithelial cells in the HS group individuals may experience dehydration condition which may lead to the loss of experimental animals. Is there so? If no, then how it will be justified? However, how it will be justified about the findings of villus height (higher in NHS), crypt depth (higher in NHS), and villus surface area (same in HS and ALA+HS) in relation to claudin and occludin level? Meantime, IL-4 is reduced which is an anti-inflammatory marker in the HS group.

Comment 8: Insert superscripts in Heat shock protein-related graph (Figure 2A). How it is possible the same level of HSP70 in the NHS and HS groups? It seems that the protein folding process will be the same in the control and HS group of animals. Then how HSP90 levels get reduced in the HS group?

Comment 9: Peroxiredoxin level showing different levels in the graph but it is showing the same superscripts? Why?

Comment 10: Most of the antioxidant-related parameter levels are higher in the treatment group. Meantime SOD1 and SOD2 are higher in the NHS group. How it will be justified?

Reviewer #4: It is a well-written manuscript. The study design and data collection are sufficient. The only concern is the number of animals used in the current study is low, and the growth performance data may not be representative. There are some minor comments:

Please indicate the sample number/statistical unit in each result. For example, if you collect two samples from each replicate. The data need to be averaged within each replicate upon analysis.

Is there any reason why ALA was not fed to the birds from the beginning of the trial?

It would be great if the author could present the morality from each treatment since it may impact the performance calculation due to low birds no.

Please also describe the raising environment, such as pen size and type (batter, cage or floor pen, litter, etc. )

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: Yes: Sahil Kalia

Reviewer #4: Yes: Chongxiao Chen

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: Plos One review.docx

PLoS One. 2021 Jul 26;16(7):e0254936. doi: 10.1371/journal.pone.0254936.r002

Author response to Decision Letter 0


19 May 2021

Reviewer #1:

The design and objectives of this study is interesting, and it is expected to contribute further to the knowledge base of improving broiler health by providing nutritional strategies to tackle heat-stress problem. The authors have done good work to make a comprehensive story of microbiota, immunity, heat stress parameters and performance. However, authors need to revise their work and correct some inherent concerns in the feed formulation. The other general comments and minor corrections are listed pointwise.

Response: We highly appreciate the reviewer's thorough reading and insightful comments and suggestions on our manuscript. Based on the reviewer's suggestions, we have modified our manuscript, and highlighted it in “yellow” in the text of the manuscript.

Major comments

1. What standard requirement was followed for this diet formulation? The calcium and phosphorus are extremely low. The starter diet has high protein but comparatively low energy which is not as the right recommended ratio.

Response: Although official guidelines are still NRC 1994, we believe that is outdated. So, we formulate a ration based on the commercial birds' recommendation. Yet, mention as “meet or exceed the recommended requirements of NRC” (which is common among poultry researchers). In such a case, for starters, we target to have 21-22% CP and ~2900 Kcal/kg MEn diets. Also, there is debate on the Ca and P requirements with no any concrete recommendation. So, we are using a relatively lower dose of Ca and P in our formulation for broiler ration and go at the upper level in layer ration (to be safe). It seems that there was a little low in the finisher, though. However, we believe that it will not affect the result of this study, as it was similar in both the heat-stressed and control birds.

2. Were the birds weighed individually to show the standard deviation in each pen?

Response: Yes, birds were weighed individually in each pen.

3. Confirm whether the gene expression calculation was based on relative standard curve or the comparative CT method. Describe more specifically what represents the gene expression value.

Response: Gene expression calculation in our study was based on the comparative CT method. We confirmed the specificity of primers by running the melt curve, and gel electrophoresis for the specific product size.

4. Line 153. The citation for embedding is not properly attributed. The reviewer was not able to locate the information in the cited article or in the reference attributed in the cited article.

Response: Additional information has now been added, and the cited reference has been deleted from the text.

5. Since the authors have stated that ALA would have improved performance via microbiota-VFA modulation, it is expected that they provide some insight into why ALA potentially modify microbiota.

Response: Thank you for your suggestion. We have added explanation for the change in microbiota on supplementation of the VFA.

“The alteration of the microbiota on supplementation of ALA can be attributed to the difference in acquisition and use of the lipoic acid among the different microbial species. There is diversity in the lipoate metabolism among different microbial species. One such example is in between Helicobacter pylori and Pseudomonas aeruginosa. Protein encoding the lipoate metabolism is absent in the H. pylori, while P. aeruginosa contains the genome that encodes both the lipoate synthesis and lipoate scavenging enzymes as well as the components of the five lipoate complexes”.

Minor comments

Line 17: add ‘is’ between ‘which’ and ‘readily’

Response: Corrected

Line 20: State clearly the adaptation and allocation period along with the replication of the treatments.

Response: Additional information about the replication and the adaptation is now provided in the text (Line 21-22).

Line 48: Better say heavier breast meat. Also, it should be improved breeding and not improved chicken.

Response: We have made changes as per the reviewer’s suggestion.

Line 50: Insert ‘the’ between ‘and’ and ‘presence’.

Response: ‘the’ is now added in the text between ‘and’ and ‘presence’.

Line 51: High temperature is the problem of tropical condition in the context of chicken.

Response: We have now mentioned tropical regions in the text.

Line 59: Check whether it will be is or are with ALA.

Response: It is ‘is’.

Line 82: Use n for experimental unit. Either state total number of birds per treatment or just mention birds per experimental unit.

Response: It is now used in the text.

Line 91: Remove ‘with’ after ‘fed’.

Response: It is now removed from the text.

Line 110: Change ‘reducing’ to ‘subtracting’.

Response: It is now changed.

Line 158: Is it muscularis mucosae or submucosa?

Response: Crypt depth was measured from the villus base to the muscularis mucosa.

Line 200-2001: Were the reads trimmed before pairing or after pairing?

Response: It was paired and then trimmed.

Line 227: Add significance statistics.

Response: It is now added in the text.

Line 238: Remove numerical improvement. This means there was high variation among the replicates.

Response: The numerical improvement is now removed from the text.

Line 244-245: Check grammar.

Response: We have corrected the sentence.

Line 262: Change ‘remains’ to ‘remain’.

Response: The change is made in the text.

Line 273: Use correct preposition after ‘compared’. Add significance statistics.

Response: Correct preposition and statistical statistics is now added in the text.

Line 288: Remove ‘total’ before ‘concentration’.

Response: It is now removed from the text.

Line 298: Change ‘have’ to ‘had’.

Response: It is now changed in the text.

Line 305: Add ‘the’ before ‘heat-stressed’.

Response: It is now added in the text.

Line 378: Is decreasing crypt depth an impairment?

Response: It depends on the context. We have removed the word from the text.

Figure 5: Define the box plot. State whether the whiskers are error or data range. If the whiskers are range, then why are no data points on NHS box plot whisker?

Response: Thank you for the feedback. We have generated the new boxplot images using the R. In this boxplot; the whiskers represent the range of the data.

Figure 7: What is the unit of relative abundance of Lactobacillales? Is it any fractions?

Response: Yes, it is a fraction of Lactobacillales present in the particular treatment group.

Reviewer #2:

Dear Authors Regarding the manuscript title Dietary Supplementation of Alpha-lipoic Acid Mitigates the Negative Effects of Heat Stress in Poultry. The scientific background of the topic was well mentioned in the introduction part. The experiment design, as well as the replicates and methods used, were very good. The results obtained were presented in tables well discussed with other author’s results. However, some observation in the present paper should be corrected and add to improve the quality of the paper.

Response: We highly appreciate the reviewer's thorough reading and insightful comments and suggestions on our manuscript. Based on the reviewer's suggestions, we have modified our manuscript, and highlighted it in “yellow” in the text of the manuscript.

• The title (Dietary Supplementation of Alpha-lipoic A 1 cid Mitigates the Negative Effects of Heat Stress in Poultry) it will be better if you replacing Poultry to broilers

Response: We have made changes in our title according to reviewer’s suggestion.

• Table 1 Ingredients and nutrient composition of the experimental diets, need to carful checking for the following :

1- SBM , add the crude protein level 44 or 46%?

2- MEn, kcal/kg, Ca, digP , not according to the Cobb-500 requirement.

Response: 1. We agreed with the reviewer that SBM is typically labeled as 44 to 48, depending on supplies. However, we used the analyzed value, which was 45% (although claimed 46%). So, we suggest not adding the protein value in the ingredient, like others, rather provide the nutrient content in the formulated diets.

2. “Although official guidelines is still NRC 1994, we believe that is outdated. So, we formulate ration based on the commercial birds' recommendation. Yet, mention as “meet or exceed the recommended requirements of NRC” (which is common among poultry researchers). For starters, we target to have 21-22% CP and ~2900 Kcal/kg MEn diets. Also, there is debate on the Ca and P requirements with no any concrete recommendation. So, we are using a relatively lower dose of Ca and P in our formulation for broiler ration and go at the upper level in layer ration (to be safe). It seems that there was a little low in the finisher, though. However, we believe that it will not affect the result of this study, as it was similar in both heat-stressed and normal burds group.”

• Introduction and Discussion

Need some other references about the impact of heat stress and Growth and Lipid Metabolism Marker Genes in Broiler Chickens in poultry I recommend you read the following references:

Response: We have now included the following references in our manuscript.

• Saki Shimamoto 1,2, Kiriko Nakamura 1, Shozo Tomonaga 3, Satoru Furukawa 4, Akira Ohtsuka and Daichi Ijiri. Effects of Cyclic High Ambient Temperature and Dietary Supplementation of Orotic Acid, a Pyrimidine Precursor, on Plasma and Muscle Metabolites in Broiler Chickens. Metabolites 2020, 10, 189; doi:10.3390/metabo10050189

• Saleh, Ahmed A.; Shukry, Mustafa; Farrag, Foad; Soliman, Mohamed M.; Abdel-Moneim, Abdel-Moneim E. (2021) "Effect of Feeding Wet Feed or Wet Feed Fermented by Bacillus licheniformis on Growth Performance, Histopathology and Growth and Lipid Metabolism Marker Genes in Broiler Chickens" Animals 11, no. 1: 83.

• Ahmed A. Saleh , Mohammed S. Eltantawy , Esraa M. Gawish , Hassan H. Younis , Khairy A. Amber , Abd El-Moneim E. Abd El-Moneim & Tarek A. Ebeid (2020) Impact of Dietary Organic Mineral Supplementation on Reproductive Performance, Egg Quality Characteristics, Lipid Oxidation, Ovarian Follicular Development, and Immune Response in Laying Hens Under High Ambient Temperature. Biological Trace Element Research. 195:506–514.

• Inoue H, Shimamoto S, Takahashi H, et al. Effects of astaxanthin-rich dried cell powder from Paracoccus carotinifaciens on carotenoid composition and lipid peroxidation in skeletal muscle of broiler chickens under thermo-neutral or realistic high temperature conditions. Anim Sci J. 2018;00:1–8.

• Ahmed A. Saleh , Abeer A. Kirrella, Mahmoud A. O. Dawood, Tarek A. Ebeid (2019) Effect of dietary inclusion of cumin seed oil on the performance, egg quality, immune response and ovarian development in laying hens under high ambient temperature. Animal Physiology and Animal Nutrition. 103(6):1810-1817.

• Results: it will be better if you present the data for performance in table.

Response: For better visibility of growth performance data, we presented the findings in bar graphs. A supplemental file is now submitted along with the manuscript, which includes performance data in a tabular format.

 

Reviewer #3:

Heat stress is a practical problem to broiler chicks which results in over $128 million in losses for the poultry industry in the United States. The manuscript by Wasti et al examines whether using alpha lipoic acid (ALA) mitigated negative effects of heat stress in poultry chickens. The results document the beneficial effects of ALA in broiler chickens by improving gut health. The manuscript has been written in a well-orchestrated manner. However, some points have to be discussed and manuscript could be accepted only after major revisions.

Response: We highly appreciate the reviewer's thorough reading and insightful comments and suggestions on our manuscript. Based on the reviewer's suggestions, we have modified our manuscript, and highlighted it in “yellow” in the text of the manuscript.

General Comments:

Line 91: Remove the space error after “phases”, and also throughout the manuscript.

Response: We have now corrected it throughout the manuscript.

Line 97: Add space between “study[9]”

Response: Added

Line 111: No need to explain abbreviation ADG again once it already mentioned in the abstract section.

Response: Corrected

Line 238: Dietary ALA supplementation o was able to improve the FCR. What is supplementation o? Please remove it from text.

Response: Corrected

Specific Comments:

Comment 1: Figure 1,2,3,4 No word about sample size based on which the means and SEM were computed. Please add.

Response: We appreciate the reviewer for pointing out this issue. Information about the sample size is now provided in the figure.

Comment 2: Most of the figures do not have the superscripts. Authors have to correct those figures.

Response: Thank for your suggestion. However, we have used the different letters/ superscripts only in the figures where there is statistically significance. We believe that will make the reader easily visualize the main findings of the figure, and there is no point in using the superscript in the figures where there is not statistically significant.

Comment 3: The exact computed P-value at least for significant ones should be shown not only (P<0.05) which is a theoretical value.

Response: Thank you for your suggestion. We have now included that information in the supplemental data provide along with this manuscript.

Comment 4: Can authors please describe more for antioxidant defense system and its significance in poultry?

Response: Thanks for your suggestion. Information about the antioxidant defense system is provided in the discussion section.

Comment 5: Please elaborate the ALA mechanism in improving growth performance of heat stress chickens in the discussion section.

Response: Besides observing the growth performance, the objective of this paper was to delineate the mechanism the beneficial aspects of the ALA in heat-stressed birds. We have tried to incorporate the mechanism by measuring different parameters – VFAs, gene expression, histomorphology and microbiota. All these aspects have been discussed in the discussion section. Moreover, the mechanism by which ALA helped in the improvement of microbiota is also now included in the manuscript.

Comment 6: Authors have not mentioned any dehydration-related parameters which is the most important factor to study the heat stress-related study as this causes dehydration in animals.

Response: Yes, we agreed with the reviewer’s point that we should have included dehydration-related parameters such as – water intake etc. We were not able to precisely collect those data because of our animal experimentation facility. All the birds in HS group were provided with ad libitum of water. We are, however, planning to include those parameters in our future experiments.

Comment 7: During dehydration, mainly epithelial cells hampered. Tight junction plays a major role during heat stress. The authors focused on the claudin and occludin molecules. Results showing that insignificant changes in claudin molecule but occludin is significantly higher in the treatment group. Tight junction maintains by both of these molecules. It is assuming from this result that due to heat stress, epithelial cells in the HS group individuals may experience dehydration condition which may lead to the loss of experimental animals. Is there so? If no, then how it will be justified? However, how it will be justified about the findings of villus height (higher in NHS), crypt depth (higher in NHS), and villus surface area (same in HS and ALA+HS) in relation to claudin and occludin level? Meantime, IL-4 is reduced which is an anti-inflammatory marker in the HS group.

Response: Yes, there was mortality. One of the birds died in the HS and the ALA group. Besides Occludin and Claudin, there are a lot of other molecules that affect the morphology of the villi in the intestine. Occludin and claudin are only a few tight-junction proteins chosen to observe the beneficial effect of ALA in heat-stressed birds. A comprehensive study needs to be undertaken if we want to delineate the exact mechanism of how HS is affecting the villus height and crypt depth at the molecular level. We won’t be able to come up with a concrete interpretation just by observing these two molecules.

IL-4 has many biological roles inside the cell. It is involved in the T-cell proliferation and differentiation of B cells into the plasma cells. Besides, IL-4 also induces B-cell class switching to IgE. Taken together, decreased IL-4 level in the HS group shows the lower immunity of the birds during the high temperature.

Comment 8: Insert superscripts in Heat shock protein-related graph (Figure 2A). How it is possible the same level of HSP70 in the NHS and HS groups? It seems that the protein folding process will be the same in the control and HS group of animals. Then how HSP90 levels get reduced in the HS group?

Response: Studies have revealed that the expression of these molecules varies with the intensity of the stress, i.e., either acute or chronic. In our study, we did not find a significant difference in the expression of HSP70 between the treatment groups. In our opinion, to justify the same level of expression of the HSP70 gene in between NHS and HS, spatiotemporal expression of this gene needs to be carried out, which can come up with any conclusive statements about its expression pattern. Moreover, in our follow-up study, we plan to study the spatiotemporal expression of these genes in heat-stressed birds.

Comment 9: Peroxiredoxin level showing different levels in the graph but it is showing the same superscripts? Why?

Response: It is so because of the error bars (variation). If you look at the error bars of NHS and HS+ALA groups, they coincide, which indicates that they were not statistically different. That is the reason the same superscript was given in between two groups – NHS and HS+ALA.

Comment 10: Most of the antioxidant-related parameter levels are higher in the treatment group. Meantime SOD1 and SOD2 are higher in the NHS group. How it will be justified?

Response: The higher level of the SOD1 and SOD2 in the NHS group observed in this study was in agreement with our expectation. The higher of SOD1 and SOD2 indicates the high amount of this antioxidant inside the cell; when we exposed the animal to the heat stress condition, the relative expression of these genes went down, which we expect in the heat stress. Again, on supplementing ALA, the level of these genes went up. These findings reflect the perfect antioxidant mechanism inside the stressed cell.

Reviewer #4:

It is a well-written manuscript. The study design and data collection are sufficient. The only concern is the number of animals used in the current study is low, and the growth performance data may not be representative. There are some minor comments:

Response: We highly appreciate the reviewer's thorough reading and insightful comments and suggestions on our manuscript. Based on the reviewer's suggestions, we have modified our manuscript and highlighted it in “yellow” in the text of the manuscript.

Please indicate the sample number/statistical unit in each result. For example, if you collect two samples from each replicate. The data need to be averaged within each replicate upon analysis.

Response: The sample number is now mentioned below the figure in the result section.

Is there any reason why ALA was not fed to the birds from the beginning of the trial?

Response: The objective of this study was to observe the mitigatory effects of ALA in heat-stressed broilers. We exposed the birds to the heat stress condition only after 21 days, so we choose to provide them only during the heat stress period. Also, in a real-life practical scenario, farmers will prefer to supplement the products only at the HS time.

It would be great if the author could present the morality from each treatment since it may impact the performance calculation due to low birds no.

Response: We really appreciate your comment regarding mortality. One bird died from the HS group and the HS+ALA group. This information is now provided in the result section.

Please also describe the raising environment, such as pen size and type (batter, cage or floor pen, litter, etc. )

Response: The birds were raised on the floor pen system, the size of the individual pen was 1 m x 0.71 m, and the stocking density was 1500 cm2/bird. These informations are now added to the text.

Attachment

Submitted filename: Reviewers response_PONE-D-21-05713R1.pdf

Decision Letter 1

Arda Yildirim

25 Jun 2021

PONE-D-21-05713R1

Dietary Supplementation of Alpha-lipoic Acid Mitigates the Negative Effects of Heat Stress in Broilers

PLOS ONE

Dear Dr. Mishra,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please provide clear information on whether the non-standard requirement of a commercial hybrid broiler for calcium and phosphorus (available) values is met.

Please submit your revised manuscript by Aug 09 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Arda Yildirim, Ph.D.

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments (if provided):

For your guidance, you can check the reviewers' comments.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: All comments have been addressed

Reviewer #3: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: 1. More specifically, the calcium and phosphorus values are not formulated according to the commercial birds recommendation (in this case Cobb 500). So, the authors answer is not correct. It is true that there is variation in the inclusion level of calcium and phosphorus. The authors must mention in the manuscript that they formulated a low calcium and phosphorus diet and if possible, should provide the reason for such formulation. Low Ca and P do not necessarily keep the birds safe. This is not going to affect the outcome of this study but would provide a wrong reference for other researchers that low Ca and P diet would be required to yield a standard growth performance. The authors should provide correct information. They cannot cite one reference for meeting requirement and provide reason that it is outdated, and they considered commercial recommendation, surprisingly which was even not followed. Cobb guidelines state Ca requirement to be 0.9% in the starter and 0.8% in the finisher, available phosphorus is around 0.45%. The authors have formulated the diet containing 0.75% Ca in the starter and 0.52% in the finisher, while the available phosphorus is 0.3% in the starter and 0.23% in the finisher. There is a typo: it should be available phosphorus and not dig. If the authors provide correct information in the draft and state the reason for this inclusion level then it would be ok otherwise it would be understood as a mistake in their feed formulation.

2. Also, authors should have removed 'standard curve method' from line 146 if they calculated gene expression by the comparative CT method. Figure 2 does not show any fold change (as stated in line 147) as none of the treatment has a normalized value of 1. So, it would be better to remove the fold change from the materials and methods. Besides, the authors should mention the treatment (may be the control group) that was used to calculate the ΔΔ CT.

Reviewer #2: Dear Authors Regarding the manuscript title Dietary Supplementation of Alpha-lipoic Acid Mitigates the Negative Effects of Heat Stress in Broilers

The scientific background of the topic was well mentioned in the introduction part. The experiment design, as well as the replicates and methods used, were very good. The results obtained were presented in tables well discussed with other author’s results. In addition the authors answered all inquiries and the manuscript may accept in this form.

Reviewer #3: (No Response)

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: Yes: Sahil Kalia

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment

Submitted filename: Reviewer report revision 1.docx

PLoS One. 2021 Jul 26;16(7):e0254936. doi: 10.1371/journal.pone.0254936.r004

Author response to Decision Letter 1


2 Jul 2021

Reviewer #1

More specifically, the calcium and phosphorus values are not formulated according to the commercial birds’ recommendation (in this case Cobb 500). So, the authors answer is not correct. It is true that there is variation in the inclusion level of calcium and phosphorus. The authors must mention in the manuscript that they formulated a low calcium and phosphorus diet and if possible, should provide the reason for such formulation. Low Ca and P do not necessarily keep the birds safe. This is not going to affect the outcome of this study but would provide a wrong reference for other researchers that low Ca and P diet would be required to yield a standard growth performance. The authors should provide correct information. They cannot cite one reference for meeting requirement and provide reason that it is outdated, and they considered commercial recommendation, surprisingly which was even not followed. Cobb guidelines state Ca requirement to be 0.9% in the starter and 0.8% in the finisher, available phosphorus is around 0.45%. The authors have formulated the diet containing 0.75% Ca in the starter and 0.52% in the finisher, while the available phosphorus is 0.3% in the starter and 0.23% in the finisher. There is a typo: it should be available phosphorus and not dig. If the authors provide correct information in the draft and state the reason for this inclusion level then it would be ok otherwise it would be understood as a mistake in their feed formulation.

Response: We highly appreciate the reviewer’s meticulous review and pointing out about the feed formulation (following the recent commercial standard). Yes, we agree with the reviewer’s point that we have used lower amount of the calcium and phosphorus than that is recommended for the commercial requirements. We have added this information in our revised manuscript. (Line 94-95). The objective of this study is focused on mitigating heat stress using nutritional supplementation (Alpha lipoic acid). So, our focus was on meeting the energy and protein requirement following the NRC (1994) guidelines and examining at the variables related to heat stress. We agree with the reviewer that we should have formulate diets based on commercial requirement, which we believe is a valuable input for executing our future projects. In this study, however, we believe that lower Ca and P level will not affect the tested variable. So, the finding of the study still holds scientific merits as it provides valuable information on mitigation of heat stress.

Corrections:

• Birds were fed the corn-soybean meal-based diets in two phase, starter (1-21d) and finisher (22-42d). The energy and protein requirements of the diet was met following the NRC (1994); however, Ca and P level was used at lower level than the commercial requirements (Line 94-95).

• We have corrected “dig-P” to “available phosphorous” (in the Table-1, Line 102)

Again, thank you so much for your critical review for the refinement of this manuscript, and we will follow the recent NRC guidelines in our future study as per reviewer’s recommendation.

2. Also, authors should have removed 'standard curve method' from line 146 if they calculated gene expression by the comparative CT method. Figure 2 does not show any fold change (as stated in line 147) as none of the treatment has a normalized value of 1. So, it would be better to remove the fold change from the materials and methods. Besides, the authors should mention the treatment (may be the control group) that was used to calculate the ΔΔ CT.

Response: Standard curve has been removed from the method section, and was modified

In line 147-150: The expression level of target genes was determined using the cycle threshold (Ct) values and changes in the gene expression were calculated by the 2-ΔΔCt method compared to the control group. The relative mRNA expression was normalized to the endogenous reference gene B-actin.

Attachment

Submitted filename: Response to Reviewer_PONE-D-21-05713R2.docx

Decision Letter 2

Arda Yildirim

7 Jul 2021

Dietary Supplementation of Alpha-lipoic Acid Mitigates the Negative Effects of Heat Stress in Broilers

PONE-D-21-05713R2

Dear Dr. Mishra,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Arda Yildirim, Ph.D.

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Thanks for reviewing and accepting all the comments and suggestions.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: All comments have been addressed

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The comments have been addressed. Congratulations to the authors for their hard work and acceptable draft for publication.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Acceptance letter

Arda Yildirim

16 Jul 2021

PONE-D-21-05713R2

Dietary Supplementation of Alpha-lipoic Acid Mitigates the Negative Effects of Heat Stress in Broilers

Dear Dr. Mishra:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Prof. Dr. Arda Yildirim

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Data

    (XLSX)

    Attachment

    Submitted filename: Plos One review.docx

    Attachment

    Submitted filename: Reviewers response_PONE-D-21-05713R1.pdf

    Attachment

    Submitted filename: Reviewer report revision 1.docx

    Attachment

    Submitted filename: Response to Reviewer_PONE-D-21-05713R2.docx

    Data Availability Statement

    Additional supplemental files having the minimal data set is submitted along with this manuscript.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES