Skip to main content
PLOS One logoLink to PLOS One
. 2021 Jul 27;16(7):e0255007. doi: 10.1371/journal.pone.0255007

Incidence of malignant transformation in the oviductal fimbria in laying hens, a preclinical model of spontaneous ovarian cancer

Elizabeth A Paris 1, Janice M Bahr 2, Pincas Bitterman 3,4, Sanjib Basu 5, Jacques S Abramowicz 6, Animesh Barua 1,3,4,*
Editor: Yihong Wang7
PMCID: PMC8315513  PMID: 34314463

Abstract

Ovarian high grade serous carcinoma (HGSC) is a lethal form of ovarian cancer (OVCA). In most cases it is detected at late stages as the symptoms are non-specific during early stages. Emerging information suggests that the oviductal fimbria is a site of origin of ovarian HGSC. Currently available tests cannot detect ovarian HGSC at early stage. The lack of a preclinical model with oviductal fimbria that develops spontaneous ovarian HGSC is a significant barrier to developing an early detection test for this disease. The goal of this study was to examine if the oviductal fimbria in hens is a site of origin of HGSC and whether it expresses several putative markers expressed in ovarian HGSC in patients. A total of 135 laying hens (4 years old) were selected from a flock using transvaginal ultrasound (TVUS) imaging, followed by euthanasia and gross examination for the presence of solid masses and ascites. Histological types of carcinomas were determined by hematoxylin and eosin staining. Expression of WT-1, mutant p53, CA-125, PAX2 and Ki67 in normal or malignant fimbriae or ovaries were examined using immunohistochemistry, immunoblotting and gene expression assays. This study detected tumors in oviductal fimbriae in hens and routine staining revealed ovarian HGSC-like microscopic features in these tumors. These tumors showed similarities to ovarian HGSC in patients in expressing several markers. Compared with normal fimbriae, intensities of expression of WT-1, mutant p53, CA-125, and Ki67 were significantly (P<0.05) higher in fimbrial tumors. In contrast, expression of PAX2 decreased gradually as the tumor progressed to late stages. The patterns of expression of these markers were similar to those in ovarian HGSC patients. Thus, tumors of the oviductal fimbria in hens may offer a preclinical model to study different aspects of spontaneous ovarian HGSC in women including its early detection.

Introduction

Due to the non-specificity of symptoms at early stages, aggressive rates of growth, and the lack of an effective early detection test, high-grade serous carcinoma (HGSC) of the ovary, a fatal form of epithelial ovarian cancer (OVCA), in most cases is detected at late stages [1]. The 5-year survival rates of OVCA patients decrease to less than 30% when the disease is detected at late stages as opposed to more than 90% when detected at early stages [2]. Moreover, tumors recur frequently as they develop resistance against currently available therapeutics [3]. Thus, early detection of ovarian HGSC remains critical for improving the rates of survival of patients. Until recently, the ovarian surface epithelium was predicted to be the only site of origin of ovarian HGSC. Emerging information suggests that OVCA is a disease with heterogeneous origin and the fimbria of the fallopian tube has also shown as a site of origin of ovarian HGSC [4]. Unfortunately, difficulty in identifying patients at early stages of ovarian HGSC and access to fimbrial tissues are significant barriers to the study and development of an effective early detection test for ovarian HGSC.

Animal models have long been used to understand the pathophysiology of human diseases, as well as for development of tests for their detection and interventional strategies which are difficult to study in humans [5, 6]. For ovarian HGSC, rodent models have been used extensively to generate information despite not being a spontaneous model [7]. Several rodent models of induced OVCA have been developed either chemically, including hormonal or non-hormonal, genetically, including knockout or transgenic, or with xenograft or syngeneic methods [6, 8]. The genetically engineered mouse models (GEMMs) of HGSC have reported to develop HGSC with histopathologic features seen in many human HGSCs [9, 10]. Ovariectomized mice have been reported to develop HGSC while removal of fallopian tube prevented its incidence [11]. In addition, mice genetically engineered to harbor Dicer 1 and Pten inactivation and mutant p53 showed the fallopian tube as a site of ovarian HGSC [12].

Unfortunately, these models have some inherent limitations. Following detachment, tubal epithelial cells are implanted in the ovary and the bursa covering the mouse ovary is a physical barrier to such implantation [7]. Endosalpingiosis has been suggested as a precursor for developing OVCA, however, no such extra-ovarian (tubal) precursor is present in these mouse models [7]. Moreover, endometriosis and polycystic ovarian syndrome (PCOS) have also been reported as risk factors for OVCA development [13, 14]. Unfortunately, rodents do not develop these conditions. Although large animals, including bovines, develop OVCA spontaneously, their long generation intervals, low rates of incidence, and the managerial requirements of these animals make them unsuitable to be a preclinical model for the study of fimbria and its malignant transformation leading to ovarian HGSC [7]. Thus, additional animal model(s) which develop OVCA spontaneously and are feasible for the study of fimbrial malignant transformation need to be explored.

Laying hens have been reported to develop OVCA spontaneously with remarkable similarities to OVCA in women, including its dissemination (with the formation of ascites), histological types of tumors, and expression of several key markers [15–17]. In addition, similarities in gene expression between ovarian tumors and normal oviduct have been reported in laying hens [18], suggesting a possibility of oviductal contribution to a portion of ovarian cancer as proposed for women. Moreover, similarities exist between hens and women with regard to the normal endocrine regulation of ovarian functions, such as follicular growth and ovulation [19]. The theory of incessant ovulation as a predisposing factor for the development of OVCA has been supported by the laying hen, model as they are frequent ovulators [19, 20]. Therefore, hens have the potential to be a biologically and clinically relevant model of spontaneous OVCA to examine the etiology, pathophysiology, and progression of OVCA and to develop diagnostics and therapeutic interventions. Furthermore, the reproductive tract of hens also consists of fimbriae and, as is observed in the fallopian tube of women, the ovulated egg is received by the fimbria of the oviduct in hens following ovulation. Through this process, fimbrial tissues in women and in hens are both exposed to various biomolecules and inflammatory agents present in the follicular fluid [21]. Thus, laying hens may represent a suitable animal model for the study of fimbrial malignant transformation leading to spontaneous ovarian HGSC development if they express markers reported in ovarian HGSC in patients.

WT-1 (Wilms Tumor 1) is a transcription factor and plays an essential role in the normal development of the urogenital system and 93% of ovarian serous carcinomas showed to express nuclear staining for WT-1 [22]. Tumor protein p53, a master regulator and a tumor suppressor protein, also known as guardian of the genome, has been shown to be mutated in more than 96% of cases in ovarian cancer [23]. CA-125 (cancer antigen 125) is a member of the mucin family of glycoproteins [24] and has been shown to play a role in advancing tumorigenesis and tumor proliferation by several different mechanisms. Serum level of CA-125 is used to monitor the progression and/or efficacy of therapies against ovarian cancer [25]. The PAX (paired box) gene PAX2 is a lineage-specific transcription factor that is involved in epithelial development of the fallopian tube but not the ovary [26, 27]. PAX2 has been reported to be expressed in prostate cancer [28] and in both high- and low-grade ovarian tumors in women [29, 30]. As in women, PAX2 expression has also been reported in oviduct of normal hens as well as in ovarian tumors [18]. The goal of this exploratory study was to examine the incidence of malignant transformation in oviductal fimbriae in hens and to determine whether fimbrial tumors in hens also express markers commonly expressed in ovarian HGSC in women including WT-1, p53, CA125, and PAX2.

Methods & materials

Hen specimens

Commercial strains of White Leghorn laying hens (approx. 4 years old, n = 135) were randomly selected from a flock and scanned using transvaginal ultrasound (TVUS) imaging as reported earlier [31, 32]. Hens were reared at the University of Illinois at Urbana-Champaign (UIUC) Poultry Research Farm in individual cages under a 17-hour light/ 7-hour dark schedule with feed and water provided ad libitum. Appropriate hygienic conditions were maintained throughout the environment and egg-laying rates were monitored. Distress and suffering were minimized in all practices. Blood from all hens was collected from the brachial vein (wing vein) and serum was separated and stored in -80°C for future use. All hens were euthanized via cervical dislocation or inhalation of carbon dioxide, consistent with humane recommendations of the American Veterinary Medical Association, and examined for the presence of any abnormality, including solid tissue mass in the ovary, oviductal fimbria and other parts of the oviduct, as well as any other organs and tissues as reported earlier [15]. Extent of malignancy when present was recorded during gross examination following euthanasia as reported earlier [15]. Fimbriae and/or ovaries with solid mass as well as fimbrial and ovarian tissues from healthy hens were collected. All selected tissues were processed for either paraffin, frozen sections, proteomic or genomic studies. All procedures for animal use were performed according to the protocol (Protocol Number: 19091) approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Illinois at Urbana-Champaign (UIUC).

Clinical specimens

Archived clinical specimens, including normal ovarian (n = 5, 60-65years old) tissues were collected from the Department of Pathology at Rush University Medical Center (RUMC). These subjects underwent prophylactic surgery due to risk of OVCA development. Specimens from patients with ovarian HGSC (n = 5, n = 60–70 years old) were also used. Clinical specimens served as the reference to study the resemblance in the expression of markers among hen fimbrial and ovarian tumors to human ovarian HGSC. All clinical specimens were full anonymized prior to this study and used as per the protocols approved by the Institutional Review Board (IRB) of Rush University Medical Center.

Histopathological examination of specimens

Presence or absence of malignancy in hen fimbrial and/or ovarian tissues and their histological subtypes were determined by routine hematoxylin and eosin staining using paraffin-embedded sections as reported earlier [15]. Diagnosis for clinical specimens including normal tissues or histological types of tumors and their stages were obtained from the final reports from the Department of Pathology at Rush University Medical Center, Chicago, IL.

Immunohistochemistry (IHC)

Expression of markers in normal or malignant tissues was determined by immunohistochemistry using paraffin sections as reported earlier [33, 34]. Briefly, sections were deparaffinized with xylene and rehydrated using a graded series of ethanol and rinsing in deionized (DI) water. Antigens on the sections were retrieved by heating using citrate solution (pH 6.0), followed by quenching of endogenous peroxidase by incubating with 0.3% H2O2 in methanol. Non-specific binding of antibodies was blocked by incubating the sections with normal horse serum (Vector Laboratories, Burlingame, CA). Sections were then incubated overnight with primary antibodies, including anti-WT-1, anti-p53 or anti-Ki67 (Millipore Sigma, St. Louis, MO) or anti-CA-125 (Invitrogen, Thermo Fisher Scientific, Waltham, MA) or anti-PAX2 (R&D Systems, Inc., Minneapolis, MN) at a 1:100 dilution. Additional information for each antibody is available in (S1 Table). After incubation, sections were washed with phosphate buffered saline (PBS, 3X5min) and incubated with respective biotinylated secondary antibodies for 1 hour. After washing with PBS (3X5min), sections were incubated with peroxidases conjugated with avidin for 1 hour. Sections were then washed with PBS (3X5min) and immunoreactions on the sections were visualized with 3, 3’Diaminobenzidine (DAB) containing H2O2 substrate by observing under a light microscope. Once the reaction was complete, sections were washed in DI water, counter-stained with hematoxylin, dehydrated with a graded series of ethanol and xylene, and mounted with organic mounting media and covered with a cover slip and oven dried. Sections were then examined under a light microscope attached to a computer-assisted software program for imaging (MicroSuiteTM version 5, Olympus American, Inc., Center Valley, PA). Images from 3–5 areas at a 40X magnification in a section containing the highest immunoreactive cells or with strong staining were taken and archived. Specificity of immunostaining for each antibody was confirmed by control staining of sections in which primary antibodies were omitted. No staining was observed in these sections.

Counting of immunostaining

Archived images were examined to determine the intensity of immunostaining for each marker, including WT-1 or PAX2. Staining intensities were determined using a computer-assisted software program (MicroSuiteTM version 5, Olympus American, Inc., Center Valley, PA). The mean intensity for each marker in a section was determined as the arbitrary values from the 3–5 areas at 40X magnification. Values were converted to be expressed as intensities in 20,000 μm2 area of tissue. Two sections were used for each marker from each tissue from each hen in a group. The average of the intensities of all hens in a group were considered as the mean intensity of each marker in each group (normal fimbria, tumor fimbria, and ovarian tumors). Similarly, frequencies of p53, CA-125, and Ki67 expressing cells among different groups of hens were determined.

Western blotting

Immunohistochemical expression of WT-1, p53, CA-125, PAX2 and Ki67 were confirmed by immunoblotting of homogenates collected from representative specimens of normal fimbriae, fimbriae with tumors, and ovaries with tumors in hens using the primary antibodies at a 1:1000 dilution for each marker mentioned above as reported previously at [35]. Appropriate horse-radish peroxidase conjugated secondary antibodies were used and immunoreactions on the membranes were detected as chemiluminescence products and imaged by ChemiDoc XRS (Bio-Rad Laboratories, Hercules, CA). Images were archived for later use.

Gene expression studies

Expression of WT-1, p53, CA-125, PAX2, and Ki67 genes in normal fimbriae, fimbriae with tumors, and ovaries with tumor were examined by reverse-transcriptase polymerase chain reaction (RT-PCR) and quantitative RT-PCR (qRT-PCR) assays using β-actin as a control.

Extraction of mRNA

Prior to extraction, work surfaces, gloves, and instruments were treated with RNase-Zap and RNase-free water. Archived tissue was thawed on ice and then homogenized using TRIzol reagent followed by the addition of chloroform. Samples were mixed vigorously and centrifuged at 12,000g for 15 minutes at 4°C. Supernatant was collected and washed with isopropyl alcohol and then centrifuged at 10,000g for 10 minutes at 4°C. Supernatant was discarded and the remaining pellet was washed with 70% ethanol. Samples were centrifuged at 7500g for 5 minutes at 4°C, the supernatant was discarded, and the pellet was re-suspended in RNase-free molecular grade water. Nucleic acid was quantified immediately using a NanoDrop. Samples were stored at -80°C for later use.

Synthesis of cDNA library

Samples (DNase-treated RNA containing a cDNA master mix) were heated for 10 minutes at 25°C followed by 120 minutes at 37°C and finally 85°C for one minute to terminate the reaction to complete the synthesis of cDNA.

Gene expression assays

Expression of WT-1, p53, CA-125, PAX2, and Ki67 genes in normal fimbriae, fimbriae with tumors, and ovaries with tumor were examined by reverse-transcriptase polymerase chain reaction (RT-PCR) and quantitative RT-PCR (qRT-PCR) assays using β-actin as a control. Synthesized cDNA was added to a RT-PCR master mix and placed in a thermocycler. Samples were heated for 10 minutes at 94°C. This was followed by a cycling between denaturation (30 seconds at 95°C), annealing (1 minute at 60°C), and elongation (72°C for 1 minute) for 25–35 cycles. The reaction was terminated after 10 minutes at 72°C and samples were kept at 4°C for later use. Agarose gel electrophoresis was performed at 100V for ~40 minutes. The gel was stained with an ethidium bromide solution, washed with deionized water, and imaged. Images were archived for later use. The Applied Biosystems ViiA7 Real-Time PCR system and associated computer software were utilized for qRT-PCR analysis (Thermo Fisher Scientific, Waltham, MA). Previously synthesized cDNA were plated in a 96-well reaction plate using SYBR ® Green supermix and the appropriate primers, listed below. Amplification during the RT-PCR stage cycled 40 times between 10 seconds at 95°C followed by 30 seconds at 60°C. The melt curve stage immediately followed where samples were heated at 95°C for 15 seconds, 60°C for 1 minute, and finally 95°C for 15 seconds to terminate the reaction. Results were subjected to statistical analyses.

Following primers were used for hen tissues (Gallus gallus) (5’ → 3’):

  • WT-1 F: CTGAAACGGCACCAAAGACG, R: ACCTGTATGAGTCGTGGTATGA;

  • p53 F: GCCGTGGCCGTCTATAAGAAA, R: CGGAAGTTCTCCTCCTCGATC;

  • CA-125 F: GGACCAGCCTCTACGTCAAC, R: TGCAGATGCTGTCTACTGCTG;

  • PAX2 F: GGCAGCAGGAAGCGACTATT, R: TCGCCCTTGATGTGGAACTG;

  • Ki67 F: CAGCAGATGTCTTAGCACCCA, R: TGCCTCCTCCATCAAGTTCTTC;

  • β-actin F: TGGCAATGAGAGGTTCAGGT, R: ATGCCAGGGTACATTGTGGT.

Statistical analysis

Significant differences in the intensity of immunohistochemical expression of markers (WT-1, p53, CA-125, PAX2, Ki67) or gene expression among different groups were determined by ANOVA and independent sample t-test using GraphPad Prism version 6.0 (GraphPad Software Inc., La Jolla, CA). Differences were considered significant when P<0.05.

Results

Gross presentation

During gross examination following euthanasia, hens were grouped as: (1) healthy without any abnormality, (2) hens with solid masses in the fimbria and/or other parts of the infundibulum of the oviduct as well as in a part of the ovary, (3) solid mass only in the ovary without the involvement of the fimbria of the oviduct, or (4) solid masses in the ovary, fimbria and metastasized to other distant organs. A normal fully functional ovary in a regularly laying hen contains a hierarchy of 5 to 6 large pre-ovulatory follicles protruding from the ovarian surface (F1, F2 so on, Fig 1A). A normally laying hen lays an egg/day consecutively for 5 to 6 days and after taking one day rest, it resumes laying. In contrast, ovaries and oviducts in hens with ceased egg laying were regressed in size and showed no preovulatory follicles. Functionally, these hens resemble postmenopausal women (Fig 1B). Solid masses in all hens were accompanied with varying degrees of ascites, including little, moderate, or profuse amount, depending on the degree of the tumor metastasis. Based on the gross examination, hens with solid mass or masses in groups 2 and 3 were categorized as early stage OVCA and hens in group 4 were considered late stage OVCA (Fig 1C and 1D) (S2 Table). Of the total 135 hens examined, solid masses were detected in 27 hens. Of the 27 hens with tumors, solid masses in the fimbria and/or other parts of the infundibulum of the oviduct as well as in a part of the ovary in 7 hens (categorized as group 2) while solid masses in 8 hens were limited to the hen ovary (categorized as group 3) and in the remaining 12 hens, solid masses were detected in ovaries and/or fimbriae as well as in other distal organs (categorized as group 4).

Fig 1. Gross presentation of normal ovaries and ovaries with tumors in laying hens.

Fig 1

A) A normal fully functional ovary in a healthy laying hen showing a hierarchy of preovulatory follicles (F1-F5). B) A normal ovary in an older hen with ceased laying activity. The ovary is regressed, no preovulatory follicle is seen in the ovary and no abnormalities are observed at gross. Functionally, this ovary resembles a postmenopausal ovary in a woman. C) Tumor in ovary involving the fimbria of the infundibulum of the oviduct. The tumor is at early stage and is accompanied with moderate ascites. D) Ovarian cancer (OVCA) at late stage in a hen. Compared with early stage, the tumor in late stage showed extensive metastasis with solid masses formed in distant organs. ASC = Ascites, F1 to F5 = Hierarchical follicles: F1 = The largest follicle destined to ovulate soon followed by F2, F3, so on, FIM = Fimbria, FT = Tumor in fimbria, INT = Intestine, OD = Oviduct, OV = Ovary, OT = Ovarian tumor, Tu = Tumor.

The oviduct in a laying hen consists of five grossly and physiologically distinct parts including (1) infundibulum, (2) ampulla or magnum, (3) isthmus, (4) uterus or shell gland, and (5) vagina. The fimbria is the innermost part of the infundibulum located close to the ovary. Similar to women, fimbriae in hens appear like long, slender, finger-like projections known as the funnel of the infundibulum (Fig 2A). The fimbria and the remaining parts of infundibulum were studied separately. For fimbria, the cranial part of the infundibulum (approximately 2mm from the tip/edge of the fimbrial lip) were excised as reported by other investigators [36]. Solid masses were localized in the fimbria and adjacent areas in the infundibulum (Fig 2C).

Fig 2. Spontaneous malignant transformation of chicken oviductal fimbria.

Fig 2

A) Gross presentation of the reproductive system in a hen showing the ovary and different parts of the oviduct including oviductal fimbria (FIM), infundibulum (IN), magnum (MG), isthmus (IS), uterus (UT), vagina (VA). B) Microscopic presentation of chicken normal fimbria showing morphological similarities with that of human. C) Gross presentation of fimbrial tumor at early stage accompanied with ascites (ASC). D) Section of a microscopic tumor in fimbria showing papillary-like structure (P). E) Section of a fully formed tumor in fimbria. Ci = Cilia, CL = Cloaca, E = Surface epithelial layer, F1 to F5 = Hierarchical follicles, INT = Intestine, L = Lumen, M = Mucosa in fimbria, OV = Ovary, OD = Oviduct, S = Stroma, Tu = Tumor. Scale bar = 20μm.

Microscopic features

As observed in healthy subjects (S1 Fig), the fimbria in healthy hens consists of two surface epithelial layers (visceral and parietal), a muscular layer and the lumen (Fig 2). The surface epithelial layer consists of ciliated and taller columnar cells. Non-ciliated secretory goblet cells were seen to be intermingled with ciliated cells. The mucosal layer formed radial ridges and folds.

Histologically, the tumors were classified as serous, endometrioid, mucinous and mixed adenocarcinoma based on microscopic examination as reported earlier. Tumors in fimbriae showed papillary structures and marked nuclear atypia (Fig 2D and 2E) as seen in ovarian HGSC in humans (S1 Fig). The architecture was characterized by a lace-like papillary folding composed of cells with large pleomorphic nuclei containing mitotic bodies (red arrows indicate examples). These tumors were classified as serous-like carcinoma at early stage (7 hens in group 2). Of the 8 tumors limited to the ovary only (group 3), 6 showed confluent back-to-back glands surrounded by a single layer of malignant cells and were classified as endometrioid carcinoma. Tumor in one hen in this group showed malignant glands lined by columnar and goblet cells containing mucinous material in their lumen and was classified as mucinous carcinoma while the remaining one was a mixed sero-mucinous carcinoma. Of the 12 hens in group 4 with late-stage tumor, 5 were serous, 5 were endometrioid, one was mucinous, and one was poorly differentiated carcinoma, probably serous.

Expression of WT-1

WT-1 expression in the surface epithelial cells of fimbria or ovary in healthy hens was either occasional or very weak (Fig 3A). No staining for WT-1 was observed in the stromal area of tumor tissues. In contrast, intense expression for WT-1 by the nuclei of malignant cells was detected in hens with fimbrial tumor and hens with tumors metastasized to distant organs (late stage OVCA) (Fig 3B and 3C). Similar patterns of WT-1 staining were detected in ovarian HGSC in patients (used as reference specimen) (S1 Fig).

Fig 3. Changes in WT-1 expression during malignant transformation and tumor development in oviductal fimbriae in hens.

Fig 3

A) Normal fimbria in a healthy hen showing very weak or occasional staining for WT-1 by the apical surface epithelial cells (red arrows are examples). B and C) Fimbria with tumor at early and late stages. In contrast to normal fimbria, malignant cells in fimbriae with tumors showed intense staining for WT-1. D) Intensity of immunohistochemical expression of WT-1. Compared with normal fimbria, the intensity of WT-1 was significantly higher in fimbria with tumor at early stage and increased further in late stages (P<0.001). E) Immunoblotting showed a band of 65kDa for WT-1. The signal for WT-1 expression was very weak in normal fimbria while it was stronger in fimbria with tumor at early stage and strongest in late stage tumor. F and G) semi-quantitative (F) and quantitative (G) gene expression assays showed similar patterns of changes in WT-1 gene expression as observed in immunohistochemistry and immunoblotting. Bars with different letters are significantly different. Intensity or fold change values in (D) and (G), respectively, are arbitrary values presented as mean ± SEM. Bp = Base pair, Ci = Cilia, E = Early, L = Late, N = Normal, S = Stroma, Tu = Tumor. Scale bar = 20μm.

Compared to the normal fimbria (1.08x104 ± 1.6x103, mean ± SE in 20,000 μm2 area of the tissue), the intensity of WT-1 expression was significantly higher in fimbriae with tumors (1.58x104 ± 2.5x103, mean ± SE) in 20,000 μm2 area of the tumor (P < 0.05) (Fig 3D). The intensity of WT-1 expression increased further to 3.04x104 ± 3.1x103 (mean ± SE) in 20,000 μm2 area of the tumor in late stage OVCA (P < 0.01).

Immunoblotting detected an immunoreactive band of approximately ~65kDa for WT-1. The pattern of intensity of WT-1 protein expression was similar as observed in immunohistochemical study including high expression in fimbrial tumor which increased further in hens with late stage OVCA (Fig 3E). Fimbrial and ovarian tissues from healthy hens showed faint expression for WT-1. Gene expression study also showed increase in WT-1 expression in association with malignant development in the oviductal fimbria in hens. Semi-quantitative RT-PCR assays showed a band for the WT-1 gene with high intensity in specimens from tumor-containing fimbriae as compared with the fimbriae of healthy hens (Fig 3F). Similarly, compared with normal fimbriae, significant (P<0.01) increase in WT-1 gene expression was observed in qRT-PCR in fimbriae with tumors and in late stage OVCA (Fig 3G). These results confirm the changes in the expression of WT-1 during tumor development in the fimbria as detected by immunoreactivity.

Expression of p53

Expression of p53 in all specimens including normal fimbriae from healthy hens, WT-1-expressing fimbrial tumors, hens with tumors metastasized to other organs (late stage), as well as ovarian HGSC from patients (as reference specimens) was examined using an anti-p53 antibody (Millipore Sigma, St. Louis, MO) developed to detect expression of mutant p53 gene in humans. No staining for p53 was observed in normal fimbriae from healthy hens (Fig 4A). In contrast, abnormal staining for p53 was detected in the nuclei of malignant cells in all tumor sections, including those limited to the fimbria (early stage) and those at late stage showed abnormal staining for p53 (Fig 4B and 4C). The patterns of abnormal staining of p53 expression in these tumors was similar to the mutant p53 expression in ovarian HGSC in patients (used as reference specimens) (S1 Fig).

Fig 4. Detection of abnormality in p53 protein and gene expression in fimbriae with tumor in hens.

Fig 4

A) Section of a normal fimbria in a hen. No staining for p53 is seen in normal fimbria. B and C) Section of a fimbria with tumor at early stage (B) and late stage (C) showing abnormal staining for p53. D) and E) Expression of p53 gene in normal fimbria and fimbria with tumor as detected by semi-quantitative (D) and quantitative (E) PCR (RT-PCR and qRT-PCR, respectively). Gene expression assays detected abnormal expression of p53 gene during malignant transformation which increased further as the tumor progressed to late stages (P<0.001). Fold change values are arbitrary values presented as mean ± SEM. Bars with different letters are significantly different. S = Stroma, Tu = Tumor. Scale bar = 20μm.

Quantitative and semi quantitative PCR assays were performed for expression of p53 gene using WT-1-expressing tumors limited to fimbriae (early stage) and hens with tumors metastasized to other organs (late stage) (Fig 4E and 4F). Quantitative PCR assays showed abnormal expression of p53 gene in tumor limited to the fimbria (early stage) which was stronger in late-stage tumors (P< 0.0001). Similar patterns of abnormal expression of p53 gene (396 base pair) was observed in semi-quantitative PCR.

Expression of CA-125

Strong staining for CA-125 was observed in tumors limited to the fimbria and tumors metastasized to distant organs (early and late stages, respectively). However, no staining for CA-125 was observed in the stroma of tumors. Strong immunoreactive band of approximately 70 kDa was seen for CA-125 in tumors limited to the fimbria (early stage) and tumor at late stages while it was weaker for fimbriae from healthy hens (Fig 5A). Quantitative gene expression assays (qRT-PCR) showed the difference in expression of CA-125 gene in fimbriae with tumors (early stage) and in ovarian tumors at late stage is not significant (P = 0.075) (Fig 5B). Similar patterns of expression for CA-125 were seen in ovarian HGSC from patients (used as reference).

Fig 5. Changes in CA-125 expression during the development and progression of tumor in oviductal fimbriae in hens.

Fig 5

A) Immunoblotting showed weak expression of CA-125 in normal fimbria. Compared with normal fimbria, strong signal for CA-125 was detected in fimbria with tumor at early stage and the signal was stronger in late-stage tumor. B) Quantitative gene expression (qRT-PCR) assays did not show significant increase in CA-125 levels with the progression of the disease to the late stages (P = 0.075). Fold change values are arbitrary values presented as mean ± SEM.

Expression of PAX2

Strong expression for PAX2 was observed in normal fimbriae from healthy hens (Fig 6). In contrast, the expression of PAX2 was remarkably reduced in the nucleus in malignant cells in tumors limited to the fimbria (early stage) and in tumors metastasized to distant organs (late stage) (Fig 6A–6C). The intensity of immunohistochemical expression of PAX2 in normal fimbriae was 1.64x104 ± 0.13x104 in 20,000 μm2 area of tissue and decreased significantly in tumor limited to the fimbria (early stage) (P<0.0001) and in tumors metastasized to distant organs (late stage) (P < 0.0001) to 5.50x103 ± 0.87x103 and 1.26x103 ± 0.24 x103, respectively, in 20,000 μm2 area of tissue in (Fig 6D).

Fig 6. Changes in PAX2 expression during tumor development in oviductal fimbriae in hens.

Fig 6

A) Section of a normal fimbria in a healthy hen showing strong staining for PAX2 by the surface epithelial cells. (B and C) Sections of fimbriae with tumor at early (B) and late (C) stages. In contrast to normal fimbria, malignant cells in fimbriae with tumors showed weaker staining for PAX2. (D) Intensity of immunohistochemical expression of PAX2. Compared with normal fimbria, the intensity of PAX2 was significantly lower in fimbriae with tumor at early stage and decreased further in late stage (P<0.0001). (E and F) semi-quantitative (E) and quantitative (F) gene expression assays showed significant decrease in PAX2 expression during tumor development and progression (P<0.001). Bars with different letters are significantly different. Intensity or fold change values in (D) and (F), respectively, are arbitrary values presented as mean ± SEM. Ci = Cilia. S = Stroma, Tu = Tumor. Scale bar = 20μm.

Quantitative and semi-quantitative PCR assays showed strong signal for expression of PAX2 in normal fimbriae from healthy hens. However, PAX2 expression declined gradually in association with malignant transformation (fimbriae with tumors) and was lost in late stage OVCA (Fig 6E and 6F).

Expression of Ki67

Immunopositive Ki67 cells were localized both in normal fimbria and fimbria with tumors (S2 Fig). However, approximately 27% cells of normal fimbrial epithelium were found positive for Ki67 expression. In contrast, more than 90% malignant cells showed strong staining for Ki67 in tumors limited to the fimbria (early stage) and tumors metastasized to distant organs (late stage). Semi-quantitative PCR assays also showed similar patterns of gene expression for Ki67 in normal fimbriae and in specimens with tumors limited to the fimbria or tumors metastasized to distant organs (S2 Fig).

Discussion

This is the first study reporting malignant transformation of the oviductal fimbria in laying hens, a preclinical model of spontaneous OVCA. Fallopian tube (Oviduct) fimbria in women has recently been suggested to be the most common site of origin of ovarian high grade serous carcinoma (HGSC), the highly lethal form of OVCA. Difficulty in accessing the fimbrial tissues in women to study the pathophysiology of ovarian HGSC necessitates the exploration of a preclinical model with oviductal fimbria that develops spontaneous OVCA. The current study was undertaken to examine the incidence of malignant transformation in the oviductal fimbria in laying hens. This study revealed that oviductal fimbriae in hens develop malignant tumors which histologically resemble ovarian HGSC-like features in patients. These tumors expressed several markers including WT-1, p53, CA-125, PAX2 and Ki67 similarly observed in ovarian HGSC. Thus, the fimbria of the laying hen offers a potential model to study spontaneous malignant transformation leading to ovarian HGSC and to develop an early detection test and interventions against it.

In this study, routine staining with hematoxylin and eosin showed malignant cells with large pleomorphic nuclei containing mitotic bodies arranged in a papillary-like structure in some tumors limited to fimbriae (early stage). Other tumors showed masses like a compact sheet of malignant large and pleomorphic cells. Back-to-back tumor glands separated by fibromuscular tissue were seen to be arranged in the tumor stroma. Similar microscopic features have been reported in hens with OVCA and ovarian HGSC in patients earlier [15].

The Wilms Tumor 1 (WT-1) gene encodes a transcription factor that is involved in the regulation of cellular development and survival including in the urogenital system [37]. WT-1 is necessary for the development of critical organs, including the kidneys, and also plays a role as a tumor suppressor against the formation of Wilms’ tumor, a cancer of the kidneys [38]. Enhanced expression of WT-1 has been reported in colorectal, breast, and epithelial ovarian cancers [39]. In this study, intense expression of WT-1 by the nucleus of malignant cells was detected in tumors limited to the fimbriae. However, no staining was observed in normal fimbriae from healthy hens, suggesting an association of WT-1 expression with malignant transformation. Similar patterns of intense expression of WT-1 by the nucleus of the malignant cells were also observed in ovarian HGSC in women. The expression of WT-1 increased further in specimens with tumors at late stage. Enhancement in WT-1 expression was also observed in immunoblotting and genomic studies. In this study, a band of approximately 65 kDa was detected for WT-1 in tumor specimens. WT-1 has been reported to be expressed at multiple band sizes, ranging from 36–65 kDa in chicken [40] and human [41, 42]. Thus, these results suggest that fimbrial tissues in hens may be a site of ovarian HGSC-like malignant development.

Wildtype TP53 is a well-known tumor suppressor that effectively prevents the development of many cancers. A major role of p53 in preventing tumor development is to prevent DNA damage and cellular stress [43]. In contrast, mutant TP53 favors oncogenic pathways and promotes tumor growth by dysregulation of DNA repair mechanisms and resisting apoptosis or cellular senescence [44]. TCGA data reported mutation in TP53 gene in over 96% of ovarian HGSC cases [45]. This study showed abnormal expression of p53 by the malignant cells in tumors limited to the fimbria in hens (early stage) while no expression for p53 was recorded in normal fimbrial tissues from healthy hens. These observations were supported by the immunoblotting and gene expression assays for p53. Similarities in the patterns of abnormal expression of p53 in tumors limited to the fimbriae in hens and expression of mutant p53 in ovarian HGSC in patients suggest the suitability of fimbrial tissues in chickens as a model to study ovarian HGSC.

Serum CA-125 level is a currently used marker for the detection of OVCA [46]. CA-125 levels are also commonly elevated in endometriosis, infection, and benign tumors. As a biomarker CA-125 has high specificity but low sensitivity for OVCA, especially in detecting early stage OVCA [47]. The exact biological role of CA-125 has yet to be elucidated, but it has been proposed that this antigen interacts with different aspects of the immune system, like NK cells, and may potentially be involved in the immune evasion of tumors in OVCA progression [48]. The association of CA-125 and OVCA is well-reported and the specificity of CA-125 makes it a suitable choice for demonstrating the histological similarities in HGSC of the oviductal fimbria in hens and ovarian HGSC in women. This study showed strong expression of CA-125 in hens with tumor limited to the fimbria (early stage) and tumor at late stage as observed in ovarian HGSC in patients. Thus, enhanced expression of CA-125 during malignant transformation and similarities in the expression patterns to ovarian HGSC in patients further supports the suitability of oviductal fimbria in hens as a model to study ovarian HGSC.

This study showed compared with normal fimbria, expression of PAX2 protein as well as PAX2 gene was lower in fimbria with tumor limited to the fimbria and the expression was lowest in late stage tumors [49]. PAX2 has been shown to be expressed in normal adult female reproductive tissues [50], be absent in ~85% of HGSC, and be expressed in clear cell and mucinous tumors [30, 49]. Thus, this result supports the previous report [18] that a portion of epithelial ovarian tumors in hens also express PAX2, an oviductal protein, and its expression decreases with the progress of the OVCA.

Ki67 is a marker of proliferation and growth of cells and can be specifically used as a marker of tumor growth since it is only detected in dividing cells [51]. While it is not specific to ovarian HGSC, it is indicative of malignancy because of the rapid growth rate observed during malignant transformation. Thus, high prevalence of intense Ki67 expression supports the incidence of malignant change. It has been suggested by other studies that Ki67 may also serve as a marker of metastasis in cancer, further promoting its role as a prognostic marker in a variety of cancers [52]. The intense immunohistochemical staining for Ki67 observed in fimbrial tumors in hens as well as the results of genomic assays support the notion of malignant-associated cellular growth in the fimbria, as seen in ovarian HGSC in patients.

Taken together, the results of the present study suggest that the oviductal fimbria in hens is a site of malignant transformation. The histological features of fimbrial tumors in hens closely resemble the microscopic features of ovarian HGSC in patients and show similarities in expression of several putative molecular markers. Therefore, the oviductal fimbria in laying hens offers a potential preclinical model to establish an early detection test for ovarian HGSC and to develop targeted therapeutics, including immunotherapeutics, as well as prevention strategies. Fimbrial tumors in hens may also be a preclinical model to develop a targeted ultrasound imaging method, as reported earlier [53], to detect malignant-associated changes relative to ovarian HGSC.

Small sample size may be a limitation of this study. Moreover, a lack of information on serum levels of the markers may also be a significant limitation of the study. However, the results presented here including the histological features and expression of markers as detected in immunohistochemical, immunoblotting and gene expression assays will serve as a foundation for serum assays and early detection of the disease.

Conclusion

In conclusion, this study showed that oviductal fimbrial epithelium in laying hens may become malignant and develop tumor masses. These tumors showed similarities in their microscopic features and in the expression of molecular markers including WT-1, p53, CA-125, PAX2, and Ki67 to those observed in ovarian HGSC in women. Thus, the fimbrial tumors in hens may be a potential model to study to generate information on different aspects of ovarian HGSC.

Supporting information

S1 Fig. Sections of ovarian high grade serous carcinoma (HGSC) stained for expression of several markers used as positive control to study similarities in staining patterns between patients and hens.

(A) Section of a normal fimbria from a subject. Histological features are similar with the fimbria in hens shown in Fig 2. (B) Section of an ovarian HGSC showing papillary-like feature of the tumor surrounded by stroma. Such features were also seen in fimbria with tumor in hens (Fig 2). (C-F) Sections of ovarian HGSC stained for expression of WT-1, mutated p53, PAX2 and Ki67 staining, respectively. Similar patterns of staining for these markers were also observed in fimbriae with tumor in hens (presented in Figs 3–5). E = Ovarian surface epithelial cells, S = Stroma, Tu = Tumor. Scale bar = 20μm.

(TIF)

S2 Fig. Expression of Ki67 in normal oviductal fimbria and fimbriae with tumors at early and late stages in hens.

(A) Surface epithelial cells in normal fimbria (FSE) showed variable staining including strong staining by apical cells while basal cells showed weak staining for Ki67 expression. (B and C) In contrast to normal fimbria, intense staining for Ki67 staining was observed in fimbriae with tumor at early stage (B) and late stage (C). D) RT-PCR showing gene expression of Ki67 and keratin 8 was used as control. As in immunohistochemistry, strong signal for Ki67 in fimbriae with tumor was also observed in gene expression assay. Ci = Cilia, M = Mucosa of the fimbria, S = Stroma, Tu = Tumor. Scale bar = 20μm.

(TIF)

S1 Table. Information on primary antibodies used in this study.

(DOCX)

S2 Table. Distribution of hens with or without ovarian tumors based on their gross presentation.

(DOCX)

S1 Raw images. Original blot/gel image data used in this study.

(PDF)

Acknowledgments

The staffs of the Poultry Research Farm of the University of Illinois at Urbana-Champaign (UIUC), Urbana, Illinois and the assistance of Bill W. Hanafin, Laboratory Assistant, Bahr’s Lab, Department of Animal Sciences, UIUC, Urbana, Illinois are acknowledged.

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This study was supported by NIH R01 CA210370 (AB). The funders had no role in study design, data collection and analysis, preparation of manuscript and decision to publish.

References

  • 1.Prat J., D’Angelo E., and Espinosa I., Ovarian carcinomas: at least five different diseases with distinct histological features and molecular genetics. Hum Pathol, 2018. 80: p. 11–27. doi: 10.1016/j.humpath.2018.06.018 [DOI] [PubMed] [Google Scholar]
  • 2.Capriglione S., et al., Ovarian cancer recurrence and early detection: may HE4 play a key role in this open challenge? A systematic review of literature. Med Oncol, 2017. 34(9): p. 164. doi: 10.1007/s12032-017-1026-y [DOI] [PubMed] [Google Scholar]
  • 3.Ottevanger P.B., Ovarian cancer stem cells more questions than answers. Semin Cancer Biol, 2017. 44: p. 67–71. doi: 10.1016/j.semcancer.2017.04.009 [DOI] [PubMed] [Google Scholar]
  • 4.Diniz P.M., et al., Fallopian tube origin of supposed ovarian high-grade serous carcinomas. Clinics (Sao Paulo), 2011. 66(1): p. 73–6. doi: 10.1590/s1807-59322011000100013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Simmon D., The use of animal models in studying genetic disease: transgenesis and induced mutation. Nature Education (2008) 1(1): p. 70. [Google Scholar]
  • 6.Stakleff K.D. and Von Gruenigen V.E., Rodent models for ovarian cancer research. Int J Gynecol Cancer, 2003. 13(4): p. 405–12. doi: 10.1046/j.1525-1438.2003.13317.x [DOI] [PubMed] [Google Scholar]
  • 7.Karnezis A.N. and Cho K.R., Preclinical Models of Ovarian Cancer: Pathogenesis, Problems, and Implications for Prevention. Clin Obstet Gynecol, 2017. 60(4): p. 789–800. doi: 10.1097/GRF.0000000000000312 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Morin P.J. and Weeraratna A.T., Genetically-defined ovarian cancer mouse models. J Pathol, 2016. 238(2): p. 180–4. doi: 10.1002/path.4663 [DOI] [PubMed] [Google Scholar]
  • 9.Perets R., et al., Transformation of the fallopian tube secretory epithelium leads to high-grade serous ovarian cancer in Brca;Tp53;Pten models. Cancer Cell, 2013. 24(6): p. 751–65. doi: 10.1016/j.ccr.2013.10.013 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Zhai YL, W.R., Hu TC, et al, Development and characterization of an oviduct-specific model of high-grade serous carcinoma. 10th Biennial Ovarian Cancer Research Symposium. Seattle, WA. 2014.
  • 11.Kim J., et al., High-grade serous ovarian cancer arises from fallopian tube in a mouse model. Proc Natl Acad Sci U S A, 2012. 109(10): p. 3921–6. doi: 10.1073/pnas.1117135109 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Kim O., et al., In vivo modeling of metastatic human high-grade serous ovarian cancer in mice. PLoS Genet, 2020. 16(6): p. e1008808. doi: 10.1371/journal.pgen.1008808 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Schildkraut J.M., et al., Epithelial ovarian cancer risk among women with polycystic ovary syndrome. Obstet Gynecol, 1996. 88(4 Pt 1): p. 554–9. doi: 10.1016/0029-7844(96)00226-8 [DOI] [PubMed] [Google Scholar]
  • 14.Gadducci A., et al., Polycystic ovary syndrome and gynecological cancers: is there a link? Gynecol Endocrinol, 2005. 20(4): p. 200–8. doi: 10.1080/09513590400021201 [DOI] [PubMed] [Google Scholar]
  • 15.Barua A., et al., Histopathology of ovarian tumors in laying hens: a preclinical model of human ovarian cancer. Int J Gynecol Cancer, 2009. 19(4): p. 531–9. doi: 10.1111/IGC.0b013e3181a41613 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Hakim A.A., et al., Ovarian adenocarcinomas in the laying hen and women share similar alterations in p53, ras, and HER-2/neu. Cancer Prev Res (Phila), 2009. 2(2): p. 114–21. [DOI] [PubMed] [Google Scholar]
  • 17.Johnson P.A. and Giles J.R., The hen as a model of ovarian cancer. Nat Rev Cancer, 2013. 13(6): p. 432–6. doi: 10.1038/nrc3535 [DOI] [PubMed] [Google Scholar]
  • 18.Trevino L.S., et al., Gene expression profiling reveals differentially expressed genes in ovarian cancer of the hen: support for oviductal origin? Horm Cancer, 2010. 1(4): p. 177–86. doi: 10.1007/s12672-010-0024-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Fredrickson T.N., Ovarian tumors of the hen. Environ Health Perspect, 1987. 73: p. 35–51. doi: 10.1289/ehp.877335 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hawkridge A.M., The chicken model of spontaneous ovarian cancer. Proteomics Clin Appl, 2014. 8(9–10): p. 689–99. doi: 10.1002/prca.201300135 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Yoshimura Y and B. A., Female Reproductive System and Immunology. Avian Reproduction. Advances in Experimental Medicine and Biology, 2017. In: Sasanami T. (eds), Singapore. 10.1007/978-981-10-3975-1_3. 1001.: p. 33–57. [DOI] [PubMed]
  • 22.Leong AS, C.K., Leong FJ Manual of Diagnostic Cytology (2 ed.). Greenwich Medical Media, Ltd. pp. 447–448. ISBN 978-1-84110-100-2. 2003.
  • 23.Aloni-Grinstein R., et al., p53: the barrier to cancer stem cell formation. FEBS Lett, 2014. 588(16): p. 2580–9. doi: 10.1016/j.febslet.2014.02.011 [DOI] [PubMed] [Google Scholar]
  • 24.Duraisamy S., et al., Distinct evolution of the human carcinoma-associated transmembrane mucins, MUC1, MUC4 AND MUC16. Gene, 2006. 373: p. 28–34. doi: 10.1016/j.gene.2005.12.021 [DOI] [PubMed] [Google Scholar]
  • 25.Society, T.A.C., Can Ovarian Cancer Be Found Early? https://www.cancer.org/cancer/ovarian-cancer/detection-diagnosis-staging/detection.html. 2020.
  • 26.Robson E.J., He S.J., and Eccles M.R., A PANorama of PAX genes in cancer and development. Nat Rev Cancer, 2006. 6(1): p. 52–62. doi: 10.1038/nrc1778 [DOI] [PubMed] [Google Scholar]
  • 27.Li C.G. and Eccles M.R., PAX Genes in Cancer; Friends or Foes? Front Genet, 2012. 3: p. 6. doi: 10.3389/fgene.2012.00006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Ueda T., et al., PAX2 promoted prostate cancer cell invasion through transcriptional regulation of HGF in an in vitro model. Biochim Biophys Acta, 2015. 1852(11): p. 2467–73. doi: 10.1016/j.bbadis.2015.08.008 [DOI] [PubMed] [Google Scholar]
  • 29.Tong G.X., et al., Expression of PAX2 in papillary serous carcinoma of the ovary: immunohistochemical evidence of fallopian tube or secondary Mullerian system origin? Mod Pathol, 2007. 20(8): p. 856–63. doi: 10.1038/modpathol.3800827 [DOI] [PubMed] [Google Scholar]
  • 30.Tung C.S., et al., PAX2 expression in low malignant potential ovarian tumors and low-grade ovarian serous carcinomas. Mod Pathol, 2009. 22(9): p. 1243–50. doi: 10.1038/modpathol.2009.92 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Barua A., et al., Detection of ovarian tumors in chicken by sonography: a step toward early diagnosis in humans? J Ultrasound Med, 2007. 26(7): p. 909–19. doi: 10.7863/jum.2007.26.7.909 [DOI] [PubMed] [Google Scholar]
  • 32.Barua A., et al., Detection of tumor-associated neoangiogenesis by Doppler ultrasonography during early-stage ovarian cancer in laying hens: a preclinical model of human spontaneous ovarian cancer. J Ultrasound Med, 2010. 29(2): p. 173–82. doi: 10.7863/jum.2010.29.2.173 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Yellapa A., et al., Interleukin 16 expression changes in association with ovarian malignant transformation. Am J Obstet Gynecol, 2014. 210(3): p. 272 e1-10. doi: 10.1016/j.ajog.2013.12.041 [DOI] [PubMed] [Google Scholar]
  • 34.Barua A., et al., Expression of death receptor 6 by ovarian tumors in laying hens, a preclinical model of spontaneous ovarian cancer. Transl Oncol, 2012. 5(4): p. 260–8. doi: 10.1593/tlo.12184 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Lee H.J., et al., Polycystic Ovarian Condition May Be a Risk Factor for Ovarian Tumor Development in the Laying Hen Model of Spontaneous Ovarian Cancer. J Immunol Res, 2018. 2018: p. 2590910. doi: 10.1155/2018/2590910 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Fujii S., et al., The regional morphology of the infundibulum of rge Hen’s Oviduct with special reference to the mechanism of engulfing of the ovulated ovum. Journal of Faculty of Applied Biological Science. Hiroshima University, 1981. 20: p. 12. [Google Scholar]
  • 37.Hwang H., et al., Wilms tumor gene product: sensitive and contextually specific marker of serous carcinomas of ovarian surface epithelial origin. Appl Immunohistochem Mol Morphol, 2004. 12(2): p. 122–6. doi: 10.1097/00129039-200406000-00004 [DOI] [PubMed] [Google Scholar]
  • 38.Hartkamp J. and Roberts S.G., The role of the Wilms’ tumour-suppressor protein WT1 in apoptosis. Biochem Soc Trans, 2008. 36(Pt 4): p. 629–31. doi: 10.1042/BST0360629 [DOI] [PubMed] [Google Scholar]
  • 39.Taube E.T., et al., Wilms tumor protein 1 (WT1)—not only a diagnostic but also a prognostic marker in high-grade serous ovarian carcinoma. Gynecol Oncol, 2016. 140(3): p. 494–502. doi: 10.1016/j.ygyno.2015.12.018 [DOI] [PubMed] [Google Scholar]
  • 40.Carmona R., et al., Localization of the Wilm’s tumour protein WT1 in avian embryos. Cell Tissue Res, 2001. 303(2): p. 173–86. doi: 10.1007/s004410000307 [DOI] [PubMed] [Google Scholar]
  • 41.Scharnhorst V., et al., Internal translation initiation generates novel WT1 protein isoforms with distinct biological properties. J Biol Chem, 1999. 274(33): p. 23456–62. doi: 10.1074/jbc.274.33.23456 [DOI] [PubMed] [Google Scholar]
  • 42.Maugeri G., et al., Expression profile of Wilms Tumor 1 (WT1) isoforms in undifferentiated and all-trans retinoic acid differentiated neuroblastoma cells. Genes Cancer, 2016. 7(1–2): p. 47–58. doi: 10.18632/genesandcancer.94 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Kastan M.B., Wild-type p53: tumors can’t stand it. Cell, 2007. 128(5): p. 837–40. doi: 10.1016/j.cell.2007.02.022 [DOI] [PubMed] [Google Scholar]
  • 44.Freed-Pastor W.A. and Prives C., Mutant p53: one name, many proteins. Genes Dev, 2012. 26(12): p. 1268–86. doi: 10.1101/gad.190678.112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Jayson G.C., et al., Ovarian cancer. Lancet, 2014. 384(9951): p. 1376–88. doi: 10.1016/S0140-6736(13)62146-7 [DOI] [PubMed] [Google Scholar]
  • 46.Henderson J.T., Webber E.M., and Sawaya G.F., Screening for Ovarian Cancer: Updated Evidence Report and Systematic Review for the US Preventive Services Task Force. JAMA, 2018. 319(6): p. 595–606. doi: 10.1001/jama.2017.21421 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Dochez V., et al., Biomarkers and algorithms for diagnosis of ovarian cancer: CA125, HE4, RMI and ROMA, a review. J Ovarian Res, 2019. 12(1): p. 28. doi: 10.1186/s13048-019-0503-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Weiland F., et al., Deciphering the molecular nature of ovarian cancer biomarker CA125. Int J Mol Sci, 2012. 13(8): p. 10568–82. doi: 10.3390/ijms130810568 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Hardy L.R., Salvi A., and Burdette J.E., UnPAXing the Divergent Roles of PAX2 and PAX8 in High-Grade Serous Ovarian Cancer. Cancers (Basel), 2018. 10(8). doi: 10.3390/cancers10080262 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Zhai Q.J., et al., PAX-2 expression in non-neoplastic, primary neoplastic, and metastatic neoplastic tissue: A comprehensive immunohistochemical study. Appl Immunohistochem Mol Morphol, 2010. 18(4): p. 323–32. doi: 10.1097/PAI.0b013e3181d712ef [DOI] [PubMed] [Google Scholar]
  • 51.Li L.T., et al., Ki67 is a promising molecular target in the diagnosis of cancer (review). Mol Med Rep, 2015. 11(3): p. 1566–72. doi: 10.3892/mmr.2014.2914 [DOI] [PubMed] [Google Scholar]
  • 52.Yang C., et al., Ki67 targeted strategies for cancer therapy. Clin Transl Oncol, 2018. 20(5): p. 570–575. doi: 10.1007/s12094-017-1774-3 [DOI] [PubMed] [Google Scholar]
  • 53.Barua A., et al., VEGFR2-Targeted Ultrasound Imaging Agent Enhances the Detection of Ovarian Tumors at Early Stage in Laying Hens, a Preclinical Model of Spontaneous Ovarian Cancer. Ultrason Imaging, 2015. 37(3): p. 224–37. doi: 10.1177/0161734614553603 [DOI] [PubMed] [Google Scholar]

Decision Letter 0

Yihong Wang

11 May 2021

PONE-D-21-12611

Incidence of malignant transformation in the oviductal fimbria in laying hens, a preclinical model of spontaneous ovarian cancer

PLOS ONE

Dear Dr. Barua,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Jun 25 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

  • A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

  • A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

  • An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Yihong Wang

Academic Editor

PLOS ONE

Additional Editor Comments:

Based on the advice received, we felt that your manuscript could be accepted for publication should you be prepared to incorporate the reviewer’s questions/comments in the revision.

As the Academic Editor, I have a couple of general suggestions. First, please respect the reviewers by taking their suggestions seriously because they took the time and effort to provide their reviews. If you decide to revise and resubmit the manuscript, please include a sheet indicating: (1) how you followed the suggestions and (2) why you did not follow the suggestions. Please include specific citations to justify your responses if you disagree with suggestions from the reviewers.

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Please provide the product number and any lot numbers of the antibodies purchased for your study.

3.  At this time, we request that you  please report additional details in your Methods section regarding animal care, as per our editorial guidelines:

(1) Please state the source of hens used in the study

(2) Please provide details of animal welfare (e.g., shelter, food, water, environmental enrichment), and any steps taken to minimize animal suffering and distress

(3) Please include the method of euthanasia

Thank you for your attention to these requests.

4. In your ethics statement in the manuscript and in the online submission form, please ensure that you have discussed whether all data/samples were fully anonymized before you accessed them and/or whether the IRB or ethics committee waived the requirement for informed consent. If patients provided informed written consent to have data/samples from their medical records used in research, please include this information.

5. Thank you for including your ethics statement:  "Animals were used in this study as per the approved protocol of the IACUC, University of Illinois at Urbana-Champaign (UIUC). The approved number is 19091. ".   

Please amend your current ethics statement to confirm that your named institutional review board or ethics committee specifically approved this study

Once you have amended this/these statement(s) in the Methods section of the manuscript, please add the same text to the “Ethics Statement” field of the submission form (via “Edit Submission”).

For additional information about PLOS ONE ethical requirements for human subjects research, please refer to http://journals.plos.org/plosone/s/submission-guidelines#loc-human-subjects-research.

6. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: This manuscript communicates the very interesting occurrence of tumors located on the fimbriae of the laying hen. This is significant in that high grade serous cancer in women is thought to arise from a primary lesion in the fimbria, characterized by a p53 signature in the secretory cells. Other groups have identified commonalities in gene expression between hen ovarian tumors and normal oviduct (see Trevino, LS, Giles, JR Wang, W, Urick ME Johnson PA. Gene Expression Profiling Reveals Differentially Expressed Genes in Ovarian Cancer of the Hen: Support for Oviductal Origin? Hormones and Cancer. August 2010; 1(4):177-86 DOI: 10.1007/s12672-010-0024-8) and mutations in p53 have been identified by sequencing cDNA from ovarian tumors (reference 16, Hakim, et al). These observations are relevant to this manuscript but have been glossed over in the introduction (lines 94-96).

Until the authors are able to demonstrate that the p53 gene is mutated, they should refrain from referring to it as mutant and instead describe it as abnormal staining. The assumption that human p53 staining in tumors is the result of a mutation has been backed up innumerable times by sequencing the gene or transcript. Furthermore, the PAX family (2, 5 and 8) has been shown to inhibit p53 transcription, so the increase in p53 transcript may simply reflect loss of PAX2 protein expression (ref. Stuart ET, Haffner R, Oren M, Gruss P. Loss of p53 function through PAX-mediated transcriptional repression. EMBO J. 1995 Nov 15; 14(22):5638-45. PMID: 8521821; PMCID: PMC394679.)

Additionally, the Pax 8 gene is not present in avian species including chickens (ref Paixao-Cortes VR, Salzano FM, Bortolini MC (2013) Evolutionary History of Chordate PAX Genes: Dynamics of Change in a Complex Gene Family. PLoS ONE 8(9): e73560. doi:10.1371/journal.pone.0073560). Therefore it is recommended that the authors remove of all mention of PAX8.

The data on PAX8 protein raises the question of how all of the antibodies used were validated for use in the chicken. For example, the western blot of WT-1 in figure 3E shows the molecular weight to be 65 kDa whereas other references show chicken embryo WT-1 to have a molecular weight of 42 kDa (Cell Tissue Res (2001) 303:173–186 DOI 10.1007/s004410000307 R. Carmona · M. González-Iriarte J.M. Pérez-Pomares · R. Muñoz-Chápuli Localization of the Wilms’ tumour protein WT1 in avian embryos).

Additionally, the antibodies that were used in this manuscript should be identified by catalog number or clone.

The intensity of Ki67 expression in figure S2 seems relatively comparable between normal fimbria and the tumor cells, although normal fimbriae are described to have “few” Ki67 positive cells (page 18, line382). In fact, it is difficult to determine if any of the normal fimbrial epithelial cells are negative for Ki67. It would be more accurate to report the number of positive cells relative to the total number of epithelial cells in several fields. It is misleading to use actin as a normalization protein in the western blot as there are varying amounts of non-Ki67 positive tissues (actin-containing stroma) in the samples. An epithelial specific marker would more accurately reflect the Ki67 quantity in the epithelial compartments.

A table should be added that shows the number of hens in each category as described on page 10 in Gross Presentation. Hens categorized in group 4 had masses in ovaries and/or fimbriae (line 226 page 11) these should be separated into ovary, fimbria and both (three subcategories of group 4). It is not clear if all hens in group 2 had ovarian tumors, or also oviductal tumors. The use of and/or (page 10 line 211 and page 11 line 226) renders these categorizations very murky

If the study was undertaken to examine the incidence, (page 5, line 119 and page 18 line 394), what is the incidence of malignant transformation in the fimbriae? The answer might be more obvious by the inclusion of the table, if not explicitly stated.

Were patient specimens from BRCA1 mutated fimbrial tissue used in this manuscript? If not, should they be included in the description of clinical specimens (page 6 line 138)?

Figure 1 C is described as a tumor in the ovary involving the fimbria. An arrow pointing to this involvement would be useful. A suggestion for future photographs would be to remove the tumors and reproductive tract from the animal for clearer viewing.

Page 5 line 111. Should read Tumor protein p53, not tissue.

Reviewer #2: The aim of this study was to examine if the oviductal fimbria in hens is a site of origin of Ovarian high grade serous carcinoma (HGSC) and whether it expresses several putative markers expressed in ovarian HGSC in patients. Authors showed that, compared with normal fimbriae, intensities of expression of WT-1, mutant p53, CA-125, PAX8, PAX2 and Ki67 were higher in fimbrial tumors, however, the expression of PAX2 decreased gradually as the tumor progressed to late stages. The patterns of expression of these markers were similar to those in ovarian HGSC patients. Thus, authors suggest that tumors of the oviductal fimbria in hens may offer a preclinical model to study different aspects of spontaneous ovarian HGSC in women.

This study is designed with unique idea to use a chicken model that enables to investigate the factors responsible for the ovarian and infundibular cancer. The results show interesting and novel findings that expression profiles of specific markers were similar to those in ovarian HGSC patients, and thus tumors of the oviductal fimbria in hens may offer a preclinical model to study the spontaneous ovarian HGSC.

Major comments

1. Authors describe the examined tissue only as the infundibulum. However, the hen infundibulum has a unique structure; namely, at the edge of the fimbria (approximately 2 mm), mucosal surface on the inner side extends even on the outer side before the epithelium transit to serosa. Thus, both inner and outer surface of this part of the fimbria are surrounded serosa by mucosal epithelium. Furthermore, lymohocyst-like structures may appear occasionally in that outer mucosal epithelium. Authors show the micrographs for the immunohistochemistry; they should make it clear which parts of the infundibulum were examined, cephalic, middle, caudal, inner side or outer side.

The following paper may help the authors to understand the comments of this reviewer.

Fujii S et al. (!981) The regional morphology of the infundibulum of the hen's oviduct with special reference to the mechanism of the engulfing of the ovulated ovum. J. Fac. Appl. Biol. Sci. Hiroshima Univ. 20: 87-98. ( https://ir.lib.hiroshima-u.ac.jp/files/public/2/23426/20141016143413572892/24-2126.pdf )

2. In the Results section, Figure legends are presented. It makes difficult to read the manuscript, and thus the figure legends should be put on separate pages.

3. Quality of Fig. 2A is not acceptable. Authors should prepare a new photograph to replace with the current one.

Specific comments

L134: Give the name of the institute that approved the animal experiment.

L154: What is D2O? Add full spelling at the place where the abbreviation appears first.

L155: What is neutralization? You may mean the endogenous peroxidase was quenched.

L159-160: Add the name of animals used to raise the antibodies.

L172: Add how to confirm the specificity of the immunostaining. Although western blotting was performed, IHC specificity is also required.

L174-183: Is the word of “intensity of the staining” correct? This reviewer assumes it may the positive area in 20,000 μm2.

L193: Procedure for the total RNA extraction, revers transcription for CDNA synthesis, and qRT-PCR condition should be added.

L202: Actin should be β-actin.

L241: Delete cloaca, cloaca is not a part of oviduct.

L260: Crypts in the funnel part may not be the secretory glands, although the chalaza is secreted in the tubular region of the infundibulum.

L265: Specify the pleomorphic nuclei containing mitotic bodies by arrows on the micrographs.

L284: Specify the intense staining for WT-1 by arrows on the micrographs.

L344: Although authors describe the expression is significant, P=0.075 does not show significance.

L355: Specify the intense staining for PAX8 by arrows on the micrographs.

L459-450: This sentence is difficult to follow.

Figures: Magnification should be shown by scale bars. “X40” is not a correct magnification.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Jul 27;16(7):e0255007. doi: 10.1371/journal.pone.0255007.r002

Author response to Decision Letter 0


25 Jun 2021

Responses to the Academic Editor:

We are thankful for your review of our manuscript and the specific recommendations provided to align with PLOS ONE’s requirements. The manuscript has been revised (specific changes listed below).

1. PLOS ONE’s style requirements were reviewed and met.

2. Information on antibodies in the study is included in S1 Table.

3. The source of hens used in the study, details of animal welfare, and methods of euthanasia are included in lines 132-138 in the revised version.

4. Samples were fully anonymized prior to our access and prior to the start of this study. This information was included in lines 153-154 in the revised version. This statement will be uploaded to the online submission form.

5. Methods section was revised to state that protocol number 19091 was specifically approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Illinois at Urbana-Champaign (UIUC) in lines 144-146. This statement will be uploaded to the Ethics Statement during submission.

6. Original blot/gel image data are provided as supplementary information.

Responses to the comments of Reviewer 1:

We are very thankful for your time to review our manuscript and appreciate your comments and suggestions on our manuscript. We have revised the manuscript in line with your comments and suggestions. Specific responses are mentioned below:

Query #1 (Q#1): This manuscript communicates the very interesting occurrence of tumors located on the fimbriae of the laying hen. This is significant in that high grade serous cancer in women is thought to arise from a primary lesion in the fimbria, characterized by a p53 signature in the secretory cells. Other groups have identified commonalities in gene expression between hen ovarian tumors and normal oviduct (see Trevino, LS, Giles, JR Wang, W, Urick ME Johnson PA. Gene Expression Profiling Reveals Differentially Expressed Genes in Ovarian Cancer of the Hen: Support for Oviductal Origin? Hormones and Cancer. August 2010; 1(4):177-86 DOI: 10.1007/s12672-010-0024-8) and mutations in p53 have been identified by sequencing cDNA from ovarian tumors (reference 16, Hakim, et al). These observations are relevant to this manuscript but have been glossed over in the introduction (lines 94-96).

Response #1 (R#1): We agree with the reviewer that Trevino et al., (PMID: 21761365) has reported very important information that gene expression between ovarian tumors and normal oviduct in laying hens are similar. We have included this information in lines 95-98 of the revised version.

Q#2A: Until the authors are able to demonstrate that the p53 gene is mutated, they should refrain from referring to it as mutant and instead describe it as abnormal staining. The assumption that human p53 staining in tumors is the result of a mutation has been backed up innumerable times by sequencing the gene or transcript. Furthermore, the PAX family (2, 5 and 8) has been shown to inhibit p53 transcription, so the increase in p53 transcript may simply reflect loss of PAX2 protein expression (ref. Stuart ET, Haffner R, Oren M, Gruss P. Loss of p53 function through PAX-mediated transcriptional repression. EMBO J. 1995 Nov 15; 14(22):5638-45. PMID: 8521821; PMCID: PMC394679.)

R#2A: As suggested, we have changed the statement “mutation in p53” to “abnormal staining of p53” throughout the text. Furthermore, additional relevant information on the anti-p53 antibodies is also included in lines 363-366 of the revised version.

Q#2B: Additionally, the Pax 8 gene is not present in avian species including chickens (ref Paixao-Cortes VR, Salzano FM, Bortolini MC (2013) Evolutionary History of Chordate PAX Genes: Dynamics of Change in a Complex Gene Family. PLoS ONE 8(9): e73560. doi:10.1371/journal.pone.0073560). Therefore it is recommended that the authors remove of all mention of PAX8.

R#2B: As suggested, all mention of PAX8 has been removed. However, we felt it would be highly relevant to include additional information on PAX2. Thus, in the revised version, data from additional experimentation on PAX2 is added. Results = lines 404-427, Discussion = 495-501

Q#3: The data on PAX8 protein raises the question of how all of the antibodies used were validated for use in the chicken. For example, the western blot of WT-1 in figure 3E shows the molecular weight to be 65 kDa whereas other references show chicken embryo WT-1 to have a molecular weight of 42 kDa (Cell Tissue Res (2001) 303:173–186 DOI 10.1007/s004410000307 R. Carmona · M. González-Iriarte J.M. Pérez-Pomares · R. Muñoz-Chápuli Localization of the Wilms’ tumour protein WT1 in avian embryos).

R#3: WT-1 has been shown to exist in multiple isoforms ranging from 36-65 kDa and this has been stated in lines 467-469 of the revised version.

In addition, validation of antibodies used is stated in lines 184-186 of the revised version.

Furthermore, the antibodies that were used in this manuscript are identified by catalog number or clone in S1 Table.

Q#4: The intensity of Ki67 expression in figure S2 seems relatively comparable between normal fimbria and the tumor cells, although normal fimbriae are described to have “few” Ki67 positive cells (page 18, line382). In fact, it is difficult to determine if any of the normal fimbrial epithelial cells are negative for Ki67. It would be more accurate to report the number of positive cells relative to the total number of epithelial cells in several fields. It is misleading to use actin as a normalization protein in the western blot as there are varying amounts of non-Ki67 positive tissues (actin-containing stroma) in the samples. An epithelial specific marker would more accurately reflect the Ki67 quantity in the epithelial compartments.

R#4: As suggested, the number of Ki67-positive cells was counted and reported in lines 430-432 of the revised version. In addition, the micrograph of normal fimbria in S2 Fig A has been replaced to better represent the observed Ki67 expression.

The RT-PCR (mistaken as a western blot in this comment) was re-done using keratin 8 as the control for each sample. Keratin 8 is an epithelial marker and thus serves as a positive control for Ki67 gene expression. This is found in S2 Fig D.

Q#5: A table should be added that shows the number of hens in each category as described on page 10 in Gross Presentation. Hens categorized in group 4 had masses in ovaries and/or fimbriae (line 226 page 11) these should be separated into ovary, fimbria and both (three subcategories of group 4). It is not clear if all hens in group 2 had ovarian tumors, or also oviductal tumors. The use of and/or (page 10 line 211 and page 11 line 226) renders these categorizations very murky. If the study was undertaken to examine the incidence, (page 5, line 119 and page 18 line 394), what is the incidence of malignant transformation in the fimbriae? The answer might be more obvious by the inclusion of the table, if not explicitly stated.

R#5: As suggested, a table showing the number of hens in each category as described in gross presentation is resented in S2 Table and mentioned in line 269.

Q#6: Were patient specimens from BRCA1 mutated fimbrial tissue used in this manuscript? If not, should they be included in the description of clinical specimens (page 6 line 138)?

R#6: Removed from the revised version.

Q#7: Figure 1 C is described as a tumor in the ovary involving the fimbria. An arrow pointing to this involvement would be useful. A suggestion for future photographs would be to remove the tumors and reproductive tract from the animal for clearer viewing.

R#7: An arrow has been added to Fig 1C in the revised version.

Q#8: Page 5 line 111. Should read Tumor protein p53, not tissue.

R#8: Corrected in line 113 of the revised version.

Responses to the comments of Reviewer 2:

We are very grateful for your time to review our manuscript and appreciate your suggestions. We have revised the manuscript according to your comments and suggestions. Specific responses are mentioned below:

Major comments

Q#1: Authors describe the examined tissue only as the infundibulum. However, the hen infundibulum has a unique structure; namely, at the edge of the fimbria (approximately 2 mm), mucosal surface on the inner side extends even on the outer side before the epithelium transit to serosa. Thus, both inner and outer surface of this part of the fimbria are surrounded serosa by mucosal epithelium. Furthermore, lymohocyst-like structures may appear occasionally in that outer mucosal epithelium. Authors show the micrographs for the immunohistochemistry; they should make it clear which parts of the infundibulum were examined, cephalic, middle, caudal, inner side or outer side.

The following paper may help the authors to understand the comments of this reviewer.

Fujii S et al. (!981) The regional morphology of the infundibulum of the hen's oviduct with special reference to the mechanism of the engulfing of the ovulated ovum. J. Fac. Appl. Biol. Sci. Hiroshima Univ. 20: 87-98. (https://ir.lib.hiroshima-u.ac.jp/files/public/2/23426/20141016143413572892/24-2126.pdf )

R#1: More information on the fimbria of the infundibulum used in this study (cranial part) is included in lines 290-292 of the revised version.

Q#2. In the Results section, Figure legends are presented. It makes difficult to read the manuscript, and thus the figure legends should be put on separate pages.

R#2: This is a format-related requirement of the journal – no change is added in the revised version.

Q#3. Quality of Fig. 2A is not acceptable. Authors should prepare a new photograph to replace with the current one.

R#3: As suggested, part of Fig 2A has been modified in the revised version.

Specific comments:

L134: Give the name of the institute that approved the animal experiment.

Listed in line 145-146 of the revised version.

L154: What is D2O? Add full spelling at the place where the abbreviation appears first.

Defined in line 165 of the revised version.

L155: What is neutralization? You may mean the endogenous peroxidase was quenched.

Wording was modified to the suggested “quenching” in line 167 of the revised version

L159-160: Add the name of animals used to raise the antibodies.

Animals used to raise antibodies included in S1 Table

L172: Add how to confirm the specificity of the immunostaining. Although western blotting was performed, IHC specificity is also required.

Confirmation of immunostaining specificity described in lines 184-186 of the revised version.

L174-183: Is the word of “intensity of the staining” correct? This reviewer assumes it may the positive area in 20,000 μm2.

The phrase “intensity of the staining” is correct for the purposes of our analyses. No changes have been made.

L193: Procedure for the total RNA extraction, revers transcription for CDNA synthesis, and qRT-PCR condition should be added.

Details of RNA extraction, reverse-transcription for cDNA synthesis, and conditions for (q)RT-PCR have been described in lines 210-241 of the revised version.

L202: Actin should be β-actin.

Correction to β-actin completed in line 248 of the revised version.

L241: Delete cloaca, cloaca is not a part of oviduct.

Cloaca has been removed.

L260: Crypts in the funnel part may not be the secretory glands, although the chalaza is secreted in the tubular region of the infundibulum.

Part of that line has been removed of the revised version (lines 308-309).

L265: Specify the pleomorphic nuclei containing mitotic bodies by arrows on the micrographs.

Arrows have been added to S1Fig and mentioned in line 314 of the revised version.

L284: Specify the intense staining for WT-1 by arrows on the micrographs.

Arrows have been added to Fig 3.

L344: Although authors describe the expression is significant, P=0.075 does not show significance.

Expression was mistakenly listed as significant. Lines 395 and 401 were corrected accordingly in the revised version.

L355: Specify the intense staining for PAX8 by arrows on the micrographs.

PAX8 has been removed from the manuscript. Arrows have been added to Fig6 of the revised version to indicate intense PAX2 staining.

L459-460: This sentence is difficult to follow.

This sentence has been re-written in lines 505-506 of the revised version.

Figures: Magnification should be shown by scale bars. “X40” is not a correct magnification.

Figures contain scale bars when appropriate and figure legends include size of scale bar.

Decision Letter 1

Yihong Wang

8 Jul 2021

Incidence of malignant transformation in the oviductal fimbria in laying hens, a preclinical model of spontaneous ovarian cancer

PONE-D-21-12611R1

Dear Dr. Barua,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Yihong Wang

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

All the questions and comments have been addressed.

Reviewers' comments:

Acceptance letter

Yihong Wang

12 Jul 2021

PONE-D-21-12611R1

Incidence of malignant transformation in the oviductal fimbria in laying hens, a preclinical model of spontaneous ovarian cancer

Dear Dr. Barua:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Yihong Wang

Academic Editor

PLOS ONE

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    S1 Fig. Sections of ovarian high grade serous carcinoma (HGSC) stained for expression of several markers used as positive control to study similarities in staining patterns between patients and hens.

    (A) Section of a normal fimbria from a subject. Histological features are similar with the fimbria in hens shown in Fig 2. (B) Section of an ovarian HGSC showing papillary-like feature of the tumor surrounded by stroma. Such features were also seen in fimbria with tumor in hens (Fig 2). (C-F) Sections of ovarian HGSC stained for expression of WT-1, mutated p53, PAX2 and Ki67 staining, respectively. Similar patterns of staining for these markers were also observed in fimbriae with tumor in hens (presented in Figs 3–5). E = Ovarian surface epithelial cells, S = Stroma, Tu = Tumor. Scale bar = 20μm.

    (TIF)

    S2 Fig. Expression of Ki67 in normal oviductal fimbria and fimbriae with tumors at early and late stages in hens.

    (A) Surface epithelial cells in normal fimbria (FSE) showed variable staining including strong staining by apical cells while basal cells showed weak staining for Ki67 expression. (B and C) In contrast to normal fimbria, intense staining for Ki67 staining was observed in fimbriae with tumor at early stage (B) and late stage (C). D) RT-PCR showing gene expression of Ki67 and keratin 8 was used as control. As in immunohistochemistry, strong signal for Ki67 in fimbriae with tumor was also observed in gene expression assay. Ci = Cilia, M = Mucosa of the fimbria, S = Stroma, Tu = Tumor. Scale bar = 20μm.

    (TIF)

    S1 Table. Information on primary antibodies used in this study.

    (DOCX)

    S2 Table. Distribution of hens with or without ovarian tumors based on their gross presentation.

    (DOCX)

    S1 Raw images. Original blot/gel image data used in this study.

    (PDF)

    Data Availability Statement

    All relevant data are within the manuscript and its Supporting Information files.


    Articles from PLoS ONE are provided here courtesy of PLOS

    RESOURCES