Effect of sugar metabolite methylglyoxal on equine lamellar explants: An ex vivo model of laminitis

Cristina Vercelli; Massimiliano Tursi; Silvia Miretti; Gessica Giusto; Marco Gandini; Giovanni Re; Emanuela Valle

doi:10.1371/journal.pone.0253840

. 2021 Jul 27;16(7):e0253840. doi: 10.1371/journal.pone.0253840

Effect of sugar metabolite methylglyoxal on equine lamellar explants: An ex vivo model of laminitis

Cristina Vercelli ^1,^*,^#, Massimiliano Tursi ^1,^#, Silvia Miretti ^1,^#, Gessica Giusto ^1,^#, Marco Gandini ^1,^#, Giovanni Re ^1,^#, Emanuela Valle ^1,^#

Editor: Kanhaiya Singh²

PMCID: PMC8315528 PMID: 34314429

Abstract

Laminitis is one of the most devastating diseases in equine medicine, and although several etiopathogenetic mechanisms have been proposed, few clear answers have been identified to date. Several lines of evidence point towards its underlying pathology as being metabolism-related. In the carbonyl stress pathway, sugars are converted to methylglyoxal (MG)—a highly reactive α-oxoaldehyde, mainly derived during glycolysis in eukaryotic cells from the triose phosphates: D-glyceraldehyde-3-phosphate and dihydroxyacetone phosphate. One common hypothesis is that MG could be synthesized during the digestive process in horses, and excessive levels absorbed into peripheral blood could be delivered to the foot and lead to alterations in the hoof lamellar structure. In the present study, employing an ex vivo experimental design, different concentrations of MG were applied to hoof explants (HE), which were then incubated and maintained in a specific medium for 24 and 48 h. Macroscopic and histological analyses and a separation force test were performed at 24 and 48 h post-MG application. Gene expression levels of matrix metalloproteinase (MMP)-2 and -14 and tissue inhibitor of metalloproteinase (TIMP)-2 were also measured at each time point for all experimental conditions. High concentrations of MG induced macroscopic and histological changes mimicking laminitis. The separation force test revealed that hoof tissue samples incubated for 24 h in a high concentration of MG, or with lower doses but for a longer period (48 h), demonstrated significant weaknesses, and samples were easily separated. All results support that high levels of MG could induce irreversible damage in HEs, mimicking laminitis in an ex vivo model.

Introduction

Laminitis is one of the most painful and debilitating diseases in equine medicine, with significant implications in terms of horse welfare. It is characterized by deterioration of the lamellar tissue that connects the hoof wall to the underlying third phalanx in the equine hoof, with associated inflammation, heat, digital pulses, pain and lameness, and, in some cases, dorsopalmar rotation of the third phalanx [1]. It can be classified as either acute or chronic, and it is not usually readily reversible. Laminitis can lead to permanent disability or even death [1]. The most common etiology of laminitis cases involves gastrointestinal or metabolic disease [2]. For a number of reasons, laminitis is considered a metabolism-related pathology, resembling the human diabetic foot, since hormonal influences, weight and pressure are involved [3–5]. Evidence suggests that diabetic microvascular complications, including neuropathy, are caused by the activation of mechanisms related to the polyol pathway: advanced glycation end-product (AGE) formation with subsequent activation of the receptor for AGEs (RAGE), and lead to the activation of other factors such as nuclear factor kB, protein kinase C (PKC) isoforms, and the hexosamine pathway as a result of the overproduction of superoxide by mitochondria [6].

Gastrointestinal disturbances resulting from ingestion of excess carbohydrates play a pivotal role in sepsis-related laminitis [7, 8]. Feeds rich in starch are used as highly digestible energy sources in horses. During digestion in the small bowel, starch is primarily broken down by amylase enzymes, leading to glucose liberation. Extremely large quantities of starch in the diet can result in starch overload; which means that undigested starch passes from the small to the large intestine, which can lead to a decrease in colon and caecal pH, often followed by colic laminitis [9].

In this scenario, release of toxins from the hindgut is suspected to occur, which in theory induces degradation of the lamellar basement membrane and a loss in epithelial cell adhesion, with the subsequent activation of matrix metalloproteinases (MMPs) and leukocyte infiltration into the lamellae [4]. According to some authors, AGEs accumulate in significant amounts in the hoof lamellar tissue in the acute phase of experimentally induced laminitis using the hyperinsulinemic model [10]. Moreover, Valle et al. [11] revealed increased plasma levels of pentosidine, a glycoxidative marker, in ponies with clinical equine metabolic syndrome. Methylglyoxal (MG) causes the formations of AGEs, leading to carbonyl stress [12]. AGES derived from glucose and intermediates like MG maybe the major source of intracellular and plasma AGEs [13]. Since MG is a highly reactive intermediate, it is converted into D-lactate, to prevent the formation of AGEs.

Specifically, starch overload in the gut can lead to rapid, devastating changes that result in the elaboration of toxins and other substances: Gram-negative and -positive bacteria undergo carbonyl stress, leading to methylglyoxal biosynthesis—a highly reactive α-oxoaldehyde, mainly derived from the triose phosphates D-glyceraldehyde-3-phosphate and dihydroxyacetone phosphate, which would be detoxified into D-lactate under healthy physiological conditions [14]. In equines, feeding large amounts of fermentable carbohydrates with subsequent acidosis increases the plasma levels of D- lactate up to 25 mMol/L [13]. According to this mechanism, D-lactate can be considered a clinical marker of the development of laminitis, because it is more specific than its L-isoform and more stable than methylglyoxal [9, 15].

Matrix metalloproteinases (MMPs) have been long investigated for their role in the cleavage of the extracellular matrix, which precedes and enables remodeling of tissues and the selective degradation of membrane proteins and collagen IV and VII [16, 17].

Previous studies using ex vivo hoof explant models have shown that under specific conditions, basal epidermal cells can separate from their basement membrane as occurs in vivo, making them an attractive model for the study of laminitis. In these investigations, silymarin or LPS were used to stimulate a tissue reaction analogous to laminitis in hoof explants [18, 19].

The aim of the present study was to investigate the effects of MG on equine lamellar explants in an ex vivo model by evaluating macroscopic and histological structures, tissue integrity by means of the separation force test, and by quantifying MMP expression at different exposure time points.

Materials and methods

Animals

Nine male draft horses (Breton horses), reared for meat production, with an age ranging between 18 and 24 months, were enrolled in the study. No animals were specifically killed for the purposes of this study. Horses were slaughtered in a commercial abattoir in Volpiano (Turin, Italy), and front limbs were collected with the slaughterhouse owner’s consent under the control of a supervisor from the Italian National Health Service.

Sample collection

A complete physical examination of all animals was performed, with particular attention to symptoms and signs of laminitis (i.e.: lameness, typical stance, increased digital pulse, and increased hoof capsular warmth). Following slaughter, the right fore distal limb was disarticulated at the carpal joint, and the limbs were transferred onto ice within 45 minutes and brought to the dissection room of the Department of Veterinary Sciences of the University of Turin (Italy).

Hoof explant preparation

Hoof explant (HE) collection and treatment procedures are summarized in Fig 1.

Hooves were carefully cleaned using a hoof-knife and scrubbed with brushes and chlorhexidine solution (4%). All instruments were cleaned with chlorhexidine and sterile saline. Ice was used to keep all instruments and samples cool.

Explants were collected according to the method reported in Mungall and Pollitt [16] with slight modifications. Hooves were trimmed, removing the lateral and medial walls and cutting the digits into 4–5 sagittal slices. In this way, it was possible to obtain hoof wall strips measuring 0.8x1.5 cm in thickness containing 10–12 lamellae, consisting of the inner part of the hoof wall epidermal lamellae, dermal lamellae and the bone. Prior to incubation, HEs were washed three times with Phosphate Buffered Saline (PBS) under sterile conditions.

Ex vivo tissue survival conditions–preliminary assay

Before the execution of the present project, a preliminary assay was performed to identify the best culture medium for preserving HEs: the tests were run to evaluate the use of Dulbecco’s Modified Eagle Medium (DMEM) alone (with 4.5mg/L glucose, but without L-glutamine) vs DMEM plus 2% of antibiotic/antimycotic solution, 2% of L-glutamine, and 10% Fetal Bovine Serum (FBS) (DMEM+). All reagents were purchased by Sigma Aldrich (Milan, Italy).

The HEs were incubated in 5 mL of their assigned medium in 6 well-plates. Plates were incubated at 37°C (5% CO₂ and 95% O₂ atmosphere) for 24 or 48 hours. The medium in the plates assigned to the 48 hour incubation condition was changed after 24 hours.

Ex vivo tissue survival conditions

Sample survival was evaluated considering macroscopic features (changing of colour, smell, and disruption) with histology as confirmation. In accordance with the results obtained from the preliminary assay (see details in “Results” section), the DMEM+ medium was used for the rest of the study.

Experimental design

HEs collected from nine different horses were incubated in triplicate with DMEM+ medium in six-well plates. MG was added to the HEs at the following concentrations: 50, 100, 150 and 200 mM, and incubated at 37°C (5% CO₂ and 95% O₂ atmosphere) for 24 and 48 hours. HEs cultured in the absence of MG were used as controls (K). In order to allow the execution of the entire experimental design, 45 samples were incubated.

Separation force test

The separation force test was used to evaluate structural integrity of the samples. All tests were performed in a blinded manner. All HEs were evaluated using a strain gauge (Fig 2) as follows: one end of the HE was fixed to a tong and the other was attached to a force transducer and exposed to a maximum force of 4000 x g. Separation force was averaged over nine experiments for each time point (24 and 48 h) by the same operator. Only HEs that separated at the level of epidermal lamellae or dermal lamellae were considered as valid measurements. The HEs that were not broken at these points were considered virtually impossible to separate. The procedure was coordinated in order to immediately proceed with RNA extraction (details in section “RNA extraction and cDNA synthesis”).

Fig 2 — The image depicts the equipment used to perform the separation force test.

Histology

One sample from each time point and from each MG concentration was fixed in 4% buffered formalin. These samples were then embedded in paraffin, and 3-μm slices were mounted on silanized glass slides. Samples were air-dried and stained histochemically with haematoxylin and eosin (H&E) and periodic acid-Schiff (PAS) (Dako, Milan, Italy).

Slides were examined using a Nikon microscope, and images captured and stored with Image pro-plus software (Media Cybernetics, MD, USA). The same expert operator performed all evaluations, blinded to treatment group. The laminitic lesions were scored using the histopathological grading system proposed by Pollitt [20]. Briefly, lesions of epidermal lamellae attributable to laminitis induced by the experimental design were graded using the following evaluation method: normal (grade N), mild (Grade 1), moderate (Grade 2), severe or extensive (Grade 3). The grading system was based on the degree of change observed in the lamellar basement membrane. Samples were then evaluated for lesions of the secondary epidermal lamellae [20].

RNA extraction and cDNA synthesis

Immediately after the separation force test, hoof explants (HEs) were placed in tubes containing RNAlater solution (Ambion), and the stratum lamellatum was disrupted using a TissueLyser II (Qiagen) with stainless steel beads in 1 mL TRI Reagent (Sigma Aldrich). Total RNA from tissue samples was extracted and purified from any residual genomic DNA using a DNAse I Recombinant RNAse free kit (Roche, Mannheim, Germany). RNA concentration was measured using spectrophotometry (BioPhotometer, Eppendorf, Germany). The ratio of the optical densities measured at 260 and 280 nm was greater than 1.9 in all RNA samples. cDNA was synthesized from 1 μg of total RNA using a RT high Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s protocol. The cDNA was subsequently diluted in nuclease-free water and stored at -20°C.

Quantitative assessment of MMP gene expression

Sufficient cDNA was prepared in a single run to perform the real-time quantitative PCR (q-PCR) experiments for all the selected genes. To determine the relative amount of specific MMP-2, MMP-14, and TIMP-2 transcripts, qPCR was performed using the CFX Connect Real-time System (Bio-Rad, Hercules, CA, USA). Primers for target and reference genes were designed for Equus caballus GenBank mRNA sequences using Primer 3 Software (version 4.0). In order to minimize the amplification of contaminant genomic DNA, oligonucleotides were designed using exon/exon boundaries analyzed using the IDT tool (available at http://www.idtdna.com/scitools/scitools.aspx) for hairpin structure and dimer formation. Primer specificity was verified using BLAST analysis, comparing results against the genomic NCBI database. Table 1 reports primer sequences, gene accession numbers, and amplicon sizes. To establish primer efficiency, we used the dilution method: CFX Manager software (version 3.0, Bio-Rad, Milan, Italy) was used to calculate primer efficiency using the linear regression slope of the dilution series. Each primer set efficiency was between 95% and 100% [21]. Multiple housekeeping genes were selected as potential internal control mRNAs: ß-2 microglobulin (B2M), ß-actin (ACTB), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Based on the stable cycles quantification (Cq) values among the different experimental conditions, GAPDH was selected as the most suitable internal control. The q-PCR parameters were as follows: 95°C for 3 min, 95°C for 15 sec, and 60°C for 30 sec, for a total of 44 cycles. To evaluate mRNA expression, data obtained as Cq values of technical replicates were averaged and used to determine ΔCq values (ΔCq = Cq of the target gene–Cq of the reference gene). The ΔΔCq method was used to analyze the data, and results were expressed as fold changes compared with control samples [22]. Assays were run in triplicate, and template control was included using water instead of cDNA.

Table 1. Genes subjected to quantitative PCR (q-PCR) analysis.

Gene name	Sequence 5’-3’	Amplicon size (bp)	Gene bank accession number
MMP-2	`TTCTTCTTCAAGGACCGGTTCA`	93	XM_001493281
MMP-2	`GAGCTCAGGCCAGAATGTGG`	93	XM_001493281
MMP-14	`CCTGATAAGCCCAAAAACC`	209	XM_005603265
MMP-14	`CTTCCTCTCATAGGCAGTGTT`	209	XM_005603265
TIMP-2	`TCTACGGCAACCCCATCAAG`	101	XM_005597879
TIMP-2	`GGAGGGAGCCGTGTAGATGA`	101	XM_005597879
GAPDH	`TGTCAGCAATGCCTCCT`	191	NM_001163856
GAPDH	`AAGCAGGGATGATGTT`	191	NM_001163856
β-ACTIN	`CATCCGTAAGGACCTGT`	189	NM_001081838
β-ACTIN	`GTGGACAATGAGGCCA`	189	NM_001081838
β-2 MICROGLOBULIN	`ACCCAGCAGAGAATGGAAAGC`	93	NM_001082502
β-2 MICROGLOBULIN	`CATCTTCTCTCCATTCTTTAG`	93	NM_001082502

Open in a new tab

Primer sequences for q-PCR were designed for Equus Caballus GenBank messenger RNA sequences. Primer sequences, gene accession numbers and amplicon sizes are shown.

Statistical analysis

Results were organized using Excel software (Microsoft Corporation, CA, USA) and data were analyzed with Prism 9.0 software (Graph Pad, CA, USA).

The results of the separation force test and qPCR were analyzed using one-way Anova and Tukey’s multiple comparison test.

Histology score data were recorded, and their distributions were analyzed using two-way Anova, setting time and concentration as variables.

The normality of q-PCR data was checked using D’Agostino and Pearson’s omnibus normality test.

Results are presented as means ± standard deviation (SD). Statistical significance was accepted at p values ≤ 0.05.

Results

Preliminary assay

Samples maintained in DMEM underwent a change of colour (from a white-light pink colour to green) and smell, indicating that autolytic processes were underway. Histological examination was performed for all samples in order to confirm the macroscopic evaluation. The separation force test was only performed in a few samples because the majority of samples already showed clear visual evidence of disrupted lamellae. On the contrary, samples maintained in DMEM+ medium showed no macroscopical changes, and histological evaluation confirmed the integrity of all structures; all samples were considered eligible for the separation force test. These details are shown in Fig 3.

Fig 3 — A-C, histology of the *stratum lamellatum*, DMEM+. Primary epidermal lamellae and primary dermal lamellae have well-recognizable structure and cellular characteristics. Hematoxylin and eosin (H&E) stain. A: 10 X. B: 20 X. C: 40X. D-F, histology of the *stratum lamellatum*, DMEM. Primary epidermal lamellae and primary dermal lamellae have identifiable but less accurate morphological characteristics than DMEM+ cases. The morphological characteristics of cells and their relationship to contiguous structures are completely compromised (F). H&E stain. D: 10 X. E: 20 X. F: 40 X.

Macroscopic evaluation

Considering the results obtained in the preliminary assay, samples were kept in DMEM+ for all subsequent experiments. During the incubation period, all the samples were checked daily. No alterations in colour or other macroscopic changes were detected.

Separation force test

The separation force test was performed for all samples incubated with the different concentrations of MG at predetermined time points.

The data reported in Table 2 show that after 24 h of incubation in the presence of varying concentrations of MG, separation of the HE lamellar structures could be provoked in 55% of samples (25/45). After 48 h, the percentage increased to 77% (35/45). The representation in Fig 4 shows the averaged weights (kg ± SD) required to provoke separation. No statistically significant effect was observed according to the different MG concentrations, probably due to the high variability of samples. Statistically significant difference can be observed comparing the two time points (24h and 48h). Moreover, a trend for reduced tissue integrity in samples treated with 50, 100 and 150 mM MG for 48 h can be observed.

Table 2. Results of separation force test.

Number of explants
	Separated/Total	Separated/Total	Separated/Total
MG concentration (nM)	T0	T24 h	T48 h
K	0/9	5/9	5/9
50	-	4/9	8/9
100	-	4/9	8/9
150	-	4/9	8/9
200	-	8/9	6/9
Total	0/9	25/45	35/45

Open in a new tab

The table summarizes the results of the separation force test performed on hoof explants (HEs) following 0, 24 and 48 h incubation in different concentrations of MG (total number of samples = 45).

Fig 4 — The image represents the distribution of values obtained in the separation force test prior to (T0) and after (T24 h and T48 h) incubation in different concentrations of methylglyoxal (0, 50, 100, 150 and 200 mM) (N = 45 per time point).

Histology

Histological analysis permitted the ranking of samples according to a scoring system, as described above in the Materials and Methods section; the distributions of scores per experimental condition are shown in Fig 5. Hoof sections incubated for 48 h in the presence of high concentrations of MG scored the highest due to the alteration of all layers and were statistically different from samples incubated for 24h. In these samples (classified as laminitic stage 2), the following histological changes were observed under low magnification: wavy primary epidermal lamellae; the absence of connective tissue between secondary epidermal lamellae; and rounded basal nuclei. Under high magnification, the round shape of the nuclei was confirmed; basal cells showed a pale, cloudy and vacuolated cytoplasm; and the normal organization of palmar anatomy was no longer recognizable: the definition near the tip of the secondary epidermal lamellae was lost.

Fig 5 — The graph represents the distribution of histological scores after the incubation of HE in different concentrations of MG (ranging from 0 to 200 mM) for 24 and 48 hours.

Expression of MMP-2, MMP-14 and TIMP-2 mRNA in digital lamellar specimens

The expression of genes encoding MMPs associated with inflammation, such as MMP-2 and MMP-14, was not substantially increased in digital lamellar samples following 24 h incubation with MG compared with control samples. Concerning MMP-2, higher levels of expression were observed in samples incubated for 48 h compared with controls, with differences also evident for the different MG concentrations. Nevertheless, these differences did not reach the level of statistical significance. This suggests that MG may have a concentration-dependent effect following 48 h incubation. That said, no significant differences between samples, or between the two experimental time points, were detected. Significant differences in TIMP2 expression levels were detected between the MG-treated samples and controls at 24 h at any concentration. At the 48 h time point, the expression levels of TIMP2 were inversely related to MMP-2 and MMP-14 levels. Results are presented in Figs 6–8.

Fig 6 — MMP-2 gene expression levels following 24 and 48 h incubation in the presence of increasing concentrations of MG (50, 100, 150 and 200 mM). Control samples (K) were incubated in the absence of MG. Total N = 45 for each time point (24 and 48 h).

Fig 8 — TIMP-2 gene expression levels following 24 and 48 h incubation in the presence of increasing concentrations of MG (50, 100, 150 and 200 mM). Control samples (K) were incubated in the absence of MG. Total N = 45 for each time point (24 and 48 h).

Fig 7 — MMP-14 gene expression levels following 24 and 48 h incubation in the presence of increasing concentrations of MG (50, 100, 150 and 200 mM). Control samples (K) were incubated in the absence of MG. Total N = 45 for each time point (24 and 48 h).

Discussion

Regarding the primary aim of this study, our results support the use of ex vivo equine lamellar hoof wall and dermis explants cultured in DMEM with the appropriate addition of FBS, antibiotic and antimycotic solution, and L-glutamine as a suitable methodology for obtaining a suitable viable model system for investigating the pathological mechanisms of laminitis.

Here, we focused on the possible role of MG in laminitis. To this end, macroscopic and histological evaluations, the separation force test, and MMP-2, MMP-14 and TIMP-2 gene expression level assessments were performed.

The preliminary assay was a milestone for the entire experiment: glucose supply was shown to be essential for the maintenance of an integral hoof structure in the explant model, corroborating the results of previous studies that evaluated the integrity of explants in the presence or absence of glucose [23, 24]. In accordance with the method published by Reisinger et al. [25], all explants were cultivated in medium containing high glucose concentrations (4.5 g/L) and antibiotics, but in accordance with our results, FBS and L-glutamine are necessary for tissue preservation. The macroscopic evaluation of explants cultivated in DMEM+ showed the absence of any colour or smell changes throughout the entire experimental period, supporting the viability of the samples for further investigations into the pathogenesis of laminitis. Other papers have evaluated the possibility of using hoof explant samples but focus their attention on different metabolic goals (eg.: the role of insulin) or with the final aim to obtain cell culture. To the authors knowledge this is the first paper focusing specifically on the role of MG [25, 26].

The results obtained in the separation force test support the hypothesis that MG can lead to modification of the hoof lamellae, rendering them less robust and unable to resist separation following the application of a load that untreated samples are able to bear and remain intact. This evaluation confirmed that higher concentrations of MG and a longer incubation period (48 h) can cause irreversible damage that weakens hoof tissues. These results were confirmed by histological examination of HEs, which revealed major alterations in the basal lamella, the severity of which correlated with increasing concentrations of MG.

The results of gene expression of MMPs and TIMP-2 in HEs are in accordance with those obtained by other groups [23, 27]. Increased levels of MMPs seem to be correlated to increasing degrees of extracellular matrix remodeling, more severe histological features, and resulting in structural weakness as assessed by the separation force test. On the contrary, it was expected that TIMP2 levels would decrease in a proportional way as previously shown [16, 28, 29]. MMPs are important for maintaining the integrity of healthy hoof tissue [16, 28]. Virtually the entire lamellar region is non proliferative [30], and remodeling of the various cells of the secondary and primary lamellae occurs via controlled MMP activity [23]. The results of the present work seem to be aligned with those obtained by de Laat et al. [31], who showed MMP-2 to be secreted by basal cells and to be present in the lamellar tissue of healthy horses; however, the study by de Laat and colleagues did not show any increase in MMP gene expression, protein concentration, or activation in lamellar tissue taken from horses with insulin-induced laminitis, suggesting that it does not play a significant role in the development of this form of the disease. However, in the case of laminitis induced by starch overload or other causes, increases in MMP-2 have been detected and may be accompanied by the activation of other MMPS, such as MMP-9 [32].

MMP-14 may also play a key role in the maintenance of lamellar homeostasis under physiological conditions. One possibility is that MMP-14 and MMP-2 act simultaneously to remodel the non-proliferative basal cells of the inner hoof wall [30, 31]. MMP-14 has been shown to be regulated in breast cancer, where it is reported to activate MMP2 that is, in turn, associated with increased risk of malignancy and metastasis [33]. We cannot exclude the possibility that a similar mechanism occurs during laminitis, where MMP-14 activation may cause the subsequent activation of MMP-2 and thereby trigger the entire laminitic process.

The triggering factors able to induce laminitis have yet to be clearly identified. Although cellular and molecular events have been studied in the past, yielding important contributions to our current knowledge, much remains unknown about the early events of the disease process. One of the main known risk factors entails a metabolism-related pathology [4]. The accumulation of triosephosphate intermediates induced by an increase in reactive carbonyl species is caused by an enhanced metabolic flux [34]. Methylglyoxal belongs to a class of reactive carbonyl species known as the alpha-oxoaldehydes or dicarbonyls. It is derived from the spontaneous degradation of triosephosphate intermediates and acts as a highly potent glycating agent [34]. Dicarbonyls, such as methylglyoxal, can modify DNA and react with the amino groups of intracellular and extracellular proteins to form AGEs. Increased levels of AGEs induce alterations in physiological cell cycles, leading to extreme stress conditions and even cell death. The interaction of AGE-modified proteins through cell surface receptors, such as RAGE, can lead to increased cellular activation and sustained inflammatory responses [35]. Significantly higher levels of the aforementioned factors have been clinically demonstrated in various pathologies; for example, erythrocytes from diabetic subjects show higher levels of triosephosphate intermediates and methylglyoxal compared with those of healthy subjects [6, 34].

In addition to the metabolic causes of laminitis, many other theories have been proposed, of which the production of bacterial exotoxins seems to be one of the most important. Indeed, a great deal of research has been conducted in the attempt to elucidate a possible bacterial role. However, a study by Reisinger et al. [19] demonstrated that lipopolysaccharide (LPS) extracted from bacteria Escherichia coli alone is not sufficient to induce laminitis in vitro. The majority of horses in the study by Tóth et al. [36] developed laminitis after the administration of a low dose of oligofructose in the presence of endotoxins: this strongly suggests that endotoxins are unlikely to induce laminitis on their own, more likely contributing to the disease’s development and progression.

One drawback of ex vivo studies is that tissues are isolated from the whole organism, thus the complex processes occurring on the systemic level are missing. For example, in the case of hoof explants, the lack of cytokines might explain why in some experiments that used LPS, high concentrations were necessary to induce lamellar separation [25].

Moreover, the diffusion of nutrients and oxygen can vary throughout the explant and could depend on the explant dimensions (i.e., an excessive thickness could limit the permeability of the nutrients contained in the medium). To minimize all these effects, the present study employed a complex approach with several evaluations. In addition, in this study we have used male draft horses (Breton horses) that were relatively young; it would be interesting to apply the same ex vivo model for laminitis to even older horses of different breeds, such as pony breeds, to assess any differences in the studied parameters.

Conclusions

The results of the present study provide evidence showing that it is possible to maintain HEs for at least 48 h following their harvest, and that sections could be used for ex vivo studies. The results of histological examination and the separation force test showed that increasing concentrations of MG lead to the deterioration of HE tissue integrity. Moreover, the effect of MG seems to be time -dependent because samples incubated for 48 h showed higher levels of deterioration compared with samples incubated for 24 h. RNA quantification of MMP-2 and -14 and TIMP-2 expression supported the occurrence of extracellular matrix remodeling induced by MG in all samples. Further studies are needed to advance our understanding of the role of glucose metabolism in pathogenesis of laminitis.

Supporting information

S1 Dataset. Datasets of the different experimental assays.

(ZIP)

Click here for additional data file.^{(69.3KB, zip)}

S1 Fig. Step-by-step procedure.

A: Hooves obtained from a commercial abattoir were transported in ice to the lab, immediately cleaned using a hoof knife and brush and scrubbed. B: Hooves were trimmed using an electric table saw on the medial and lateral aspects to facilitate further cutting. Sagittal cuts were made to create 4–5 slices of the digit, measuring 0.8x1.5 cm in thickness containing 10–12 lamellae. C: Slices were trimmed using saw and scalpel blade to obtain 0.7cm X 0.5 cm blocks of tissue. Each block consists of inner hoof wall (a), epidermal lamellae (b), dermal lamellae (c), and distal phalanx (d). Explants were rinsed and placed in a sterile saline solution. D: The lamellar explants were in Dulbecco’s Modified Eagles Medium (DMEM) supplemented with % of antibiotic/antimycotic solution, 2% of L-glutamine, and 10% of Fetal Bovine Serum (FBS) (defined as DMEM+) at 37°C and 5% CO₂.

(TIF)

Click here for additional data file.^{(422.1KB, tif)}

Acknowledgments

The preliminary study results were presented in the Equine Colic Research Symposium of 2014 (Dublin, Ireland) and in Sisvet Congress 2017 (Naples, Italy).

Data Availability

All relevant data are within the manuscript and its Supporting Information files.

Funding Statement

This study was supported by Ministero dell’Istruzione, dell’Università e della Ricerca (MIUR) under the programme "Dipartimento di Eccellenza ex L.232/2016" to the Department of Veterinary Science, University of Turin (to authors EV, MG, and GG); and by the ex 60% fund of the University of Turin. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

1.Steelman SM, Johnson D, Wagner B, Stokes Ashley M, Chowdhary BP. Cellular and humoral immunity in chronic equine laminitis. Veterinary Immunology and Immunopathology. 2013. Jun;153(3–4):217–26. doi: 10.1016/j.vetimm.2013.03.001 [DOI] [PubMed] [Google Scholar]
2.Lameness & Laminitis in U.S. Horses. United States Department of Agriculture Report #N318.0400. 2000; 1–40. [Google Scholar]
3.Medina-Torres CE, Mason SL, Floyd RV, Harris PA, Mobasheri A. Hypoxia and a hypoxia mimetic up-regulate matrix metalloproteinase 2 and 9 in equine laminar keratinocytes. The Veterinary Journal. 2011. Nov;190(2):e54–9. doi: 10.1016/j.tvjl.2011.02.026 [DOI] [PubMed] [Google Scholar]
4.Katz LM, Bailey SR. A review of recent advances and current hypotheses on the pathogenesis of acute laminitis: The pathogenesis of equine acute laminitis. Equine Vet J. 2012. Nov;44(6):752–61. doi: 10.1111/j.2042-3306.2012.00664.x [DOI] [PubMed] [Google Scholar]
5.Wells-Smith L. Laminitis in the 21st century. Veterinary Record. 2015. Jan;176(3):70–1. doi: 10.1136/vr.h53 [DOI] [PubMed] [Google Scholar]
6.Ziegler D, Schleicher E, Strom A, Knebel B, Fleming T, Nawroth P, et al. Association of transketolase polymorphisms with measures of polyneuropathy in patients with recently diagnosed diabetes: Transketolase Polymorphisms and Neuropathy. Diabetes Metab Res Rev. 2017. May;33(4):e2811. [DOI] [PubMed] [Google Scholar]
7.Milinovich GJ, Burrell PC, Pollitt CC, Klieve AV, Blackall LL, Ouwerkerk D, et al. Microbial ecology of the equine hindgut during oligofructose-induced laminitis. ISME J. 2008. Nov;2(11):1089–100. doi: 10.1038/ismej.2008.67 [DOI] [PubMed] [Google Scholar]
8.Pollitt CC, Visser MB. Carbohydrate Alimentary Overload Laminitis. Veterinary Clinics of North America: Equine Practice. 2010. Apr;26(1):65–78. [DOI] [PubMed] [Google Scholar]
9.Hoffman RM. Carbohydrate metabolism and metabolic disorders in horses. R Bras Zootec. 2009. Jul;38(spe):270–6. [Google Scholar]
10.de Laat MA, Kyaw-Tanner MT, Sillence MN, McGowan CM, Pollitt CC. Advanced glycation endproducts in horses with insulin-induced laminitis. Veterinary Immunology and Immunopathology. 2012. Jan;145(1–2):395–401. doi: 10.1016/j.vetimm.2011.12.016 [DOI] [PubMed] [Google Scholar]
11.Valle E, Storace D, Sanguineti R, Carter R, Odetti P, Geor R, et al. Association of the glycoxidative stress marker pentosidine with equine laminitis. The Veterinary Journal. 2013. Jun;196(3):445–50. doi: 10.1016/j.tvjl.2012.10.030 [DOI] [PubMed] [Google Scholar]
12.Valle E, Prola L, Vergnano D, Borghi R, Monacelli F, Traverso N, et al. Investigation of hallmarks of carbonyl stress and formation of end products in feline chronic kidney disease as markers of uraemic toxins. Journal of Feline Medicine and Surgery. 2019. Jun;21(6):465–74. doi: 10.1177/1098612X18783858 [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Teodorowicz M, Hendriks WH, Wichers HJ, Savelkoul HFJ. Immunomodulation by Processed Animal Feed: The Role of Maillard Reaction Products and Advanced Glycation End-Products (AGEs). Front Immunol. 2018. Sep 13;9:2088. doi: 10.3389/fimmu.2018.02088 [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Kosmachevskaya OV, Shumaev KB, Topunov AF. Carbonyl Stress in Bacteria: Causes and Consequences. Biochemistry Moscow. 2015. Dec;80(13):1655–71. doi: 10.1134/S0006297915130039 [DOI] [PubMed] [Google Scholar]
15.Ewaschuk JB, Zello GA, Naylor JM, Brocks DR. Metabolic acidosis: separation methods and biological relevance of organic acids and lactic acid enantiomers. Journal of Chromatography B. 2002. Dec;781(1–2):39–56. doi: 10.1016/s1570-0232(02)00500-7 [DOI] [PubMed] [Google Scholar]
16.Mungall BA, Pollitt CC. Thermolysin Activates Equine Lamellar Hoof Matrix Metalloproteinases. Journal of Comparative Pathology. 2002. Jan;126(1):9–16. doi: 10.1053/jcpa.2001.0515 [DOI] [PubMed] [Google Scholar]
17.Wang L, Pawlak EA, Johnson PJ, Belknap JK, Alfandari D, Black SJ. Expression and Activity of Collagenases in the Digital Laminae of Horses with Carbohydrate Overload‐Induced Acute Laminitis. J Vet Intern Med. 2014. Jan;28(1):215–22. doi: 10.1111/jvim.12252 [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Pass MA, Pollitt S, Pollitt CC. Decreased glucose metabolism causes separation of hoof lamellae in vitro: a trigger for laminitis? Equine Veterinary Journal. 2010. Jun 10;30(S26):133–8. [DOI] [PubMed] [Google Scholar]
19.Reisinger N, Schaumberger S, Nagl V, Hessenberger S, Schatzmayr G. Milk Thistle Extract and Silymarin Inhibit Lipopolysaccharide Induced Lamellar Separation of Hoof Explants in Vitro. Toxins. 2014. Oct 6;6(10):2962–74. doi: 10.3390/toxins6102962 [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Pollitt CC. Basement membrane pathology: a feature of acute equine laminitis. Equine Vet J. 1996; 28(1):38–46. doi: 10.1111/j.2042-3306.1996.tb01588.x [DOI] [PubMed] [Google Scholar]
21.Miretti S, Volpe MG, Martignani E, Accornero P, Baratta M. Temporal correlation between differentiation factor expression and microRNAs in Holstein bovine skeletal muscle. Animal. 2017;11(2):227–35. doi: 10.1017/S1751731116001488 [DOI] [PubMed] [Google Scholar]
22.Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 2001. Dec;25(4):402–8. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
23.French KR, Pollitt CC. Equine laminitis: glucose deprivation and MMP activation induce dermo-epidermal separation in vitro. Equine Veterinary Journal. 2010. Jan 5;36(3):261–6. [DOI] [PubMed] [Google Scholar]
24.Pass MA, Pollitt S, Pollitt CC. Decreased glucose metabolism causes separation of hoof lamellae in vitro: a trigger for laminitis? Equine Vet J Suppl. 1998; 26, 133–8. doi: 10.1111/j.2042-3306.1998.tb05132.x [DOI] [PubMed] [Google Scholar]
25.Reisinger N, Schaumberger S, Nagl V, Hessenberger S, Schatzmayr G. Concentration Dependent Influence of Lipopolysaccharides on Separation of Hoof Explants and Supernatant Lactic Acid Concentration in an Ex Vivo/In Vitro Laminitis Model. Haziot A, editor. PLoS ONE. 2015. Nov 24;10(11):e0143754. doi: 10.1371/journal.pone.0143754 [DOI] [PMC free article] [PubMed] [Google Scholar]
26.Sandow C, Fugler LA, Leise B, Riggs L, Monroe WT, Totaro N, et al. Ex vivo effects of insulin on the structural integrity of equine digital lamellae. Equine Vet J. 2019. Jan;51(1):131–5. doi: 10.1111/evj.12964 [DOI] [PubMed] [Google Scholar]
27.Visser MB, Pollitt CC. The timeline of metalloprotease events during oligofructose induced equine laminitis development: Temporal protease events during laminitis development. Equine Veterinary Journal. 2012. Jan;44(1):88–93. doi: 10.1111/j.2042-3306.2011.00393.x [DOI] [PubMed] [Google Scholar]
28.Pollitt CC, Pass MA, Pollitt S. Batimastat (BB-94) inhibits matrix metalloproteinases of equine laminitis. Equine Veterinary Journal. 2010. Jun 10;30(S26):119–24. [DOI] [PubMed] [Google Scholar]
29.Kyaw-Tanner MT, Wattle O, Eps AW, Pollitt CC. Equine laminitis: Membrane type matrix metalloproteinase-1 (MMP-14) is involved in acute phase onset. Equine Veterinary Journal. 2008. Jul;40(5):482–7. doi: 10.2746/042516408X270353 [DOI] [PubMed] [Google Scholar]
30.Daradka M, Pollitt CC. Epidermal cell proliferation in the equine hoof wall. Equine Veterinary Journal. 2010. Jan 5;36(3):236–41. [DOI] [PubMed] [Google Scholar]
31.de Laat MA, Kyaw-Tanner MT, Nourian AR, McGowan CM, Sillence MN, Pollitt CC. The developmental and acute phases of insulin-induced laminitis involve minimal metalloproteinase activity. Vet Immunol Immunopathol. 2011; 140(3–4):275–81 doi: 10.1016/j.vetimm.2011.01.013 [DOI] [PubMed] [Google Scholar]
32.Johnson PJ, Tyagi SC, Katwa LC, Ganjam VK, Moore LA, Kreeger JM, et al. Activation of extracellular matrix metalloproteinases in equine laminitis. Veterinary Record. 1998. Apr;142(15):392–6. doi: 10.1136/vr.142.15.392 [DOI] [PubMed] [Google Scholar]
33.Jiang WG, Davies G, Martin TA, Parr C, Watkins G, Mason MD, et al. Expression of membrane type‐1 matrix metalloproteinase, MT1‐MMP in human breast cancer and its impact on invasiveness of breast cancer cells. Int. J. Mol. Med. 2006; 17, 583–90. [PubMed] [Google Scholar]
34.Fleming T, Cuny J, Nawroth G, Djuric Z, Humpert PM, Zeier M, et al. Is diabetes an acquired disorder of reactive glucose metabolites and their intermediates? Diabetologia. 2012. Apr;55(4):1151–5. doi: 10.1007/s00125-012-2452-1 [DOI] [PubMed] [Google Scholar]
35.Hidmark A, Fleming T, Vittas S, Mendler M, Deshpande D, Groener J, et al. A New Paradigm to Understand and Treat Diabetic Neuropathy. Exp Clin Endocrinol Diabetes. 2014. Mar 12;122(04):201–7. doi: 10.1055/s-0034-1367023 [DOI] [PubMed] [Google Scholar]
36.Tóth F, Frank N, Chameroy KA, Bostont RC. Effects of endotoxaemia and carbohydrate overload on glucose and insulin dynamics and the development of laminitis in horses. Equine Vet. J. 2009; 41(9):852–8. doi: 10.2746/042516409x479027 [DOI] [PubMed] [Google Scholar]

PLoS One. doi: 10.1371/journal.pone.0253840.r001

Decision Letter 0

Jamie Males

9 Apr 2021

PONE-D-20-06143

Effect of sugar metabolite methylglyoxal on horse keratinocytes: an ex vivo model for laminitis

PLOS ONE

Dear Dr. Vercelli,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Reviewer 1 has identified a number of questions that need to be addressed regarding aspects of the methods and analyses included in your study. Please ensure that you provide detailed responses to each of these questions and concerns, as well as addressing the presentational issues raised.

Please submit your revised manuscript by May 21 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: http://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Jamie Males

Senior Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

Thank you for stating in your Funding Statement:

The present study was funded with ex 60% fund of the University of Turin.

Please provide an amended statement that declares *all* the funding or sources of support (whether external or internal to your organization) received during this study, as detailed online in our guide for authors at http://journals.plos.org/plosone/s/submit-now. Please also include the statement “There was no additional external funding received for this study.” in your updated Funding Statement.

Please include your amended Funding Statement within your cover letter. We will change the online submission form on your behalf.

3. We noticed you have some minor occurrence of overlapping text with the following previous publications, which needs to be addressed:

- https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3605361/

- https://onlinelibrary.wiley.com/doi/full/10.1002/dmrr.2811

- https://beva.onlinelibrary.wiley.com/doi/abs/10.2746/042516406778400565

- https://www.sciencedirect.com/science/article/abs/pii/S0165242711000201?via%3Dihub

The text that needs to be addressed involves:

- Lines 297-302

- Lines 303-310

- Lines 315-326

In your revision ensure you cite all your sources (including your own works), and quote or rephrase any duplicated text outside the methods section. Further consideration is dependent on these concerns being addressed.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: Yes

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have submitted a manuscript describing an ex vivo model of laminitis that they have created using a glucose metabolite (methylglyoxal) applied to lamellar explants. Such a model, if it could be validated, would be extremely useful for research in this area and has, in fact, been sought for some years now by researchers in the field. This could be a valuable contribution to those efforts - I have some questions and comments for the authors about their work, listed below (by line number in the manuscript):

Line 1 - 'Effect of the sugar metabolite...'; ex vivo should be italicized

Abstract:

Line 15 - '...synthesized during the digestion process in horses...'

Line 16 - '...excessive levels could lead to alterations in the hoof lamellar structure.'

Line 18 - '...were applied to hoof explants (HE), which...'

Line 19 - 'Microscopic'

Line 20 - '..post-MG application.'

Line 21 - '...(MMP)-2 and -14, and tissue inhibitor of metalloproteinases (TIMP)-2'

Line 22 - '...at each time point for all...'

Line 23 - '...mimicking laminitis. The separation force test revealed...'

Line 26 - '...significant weakness, and samples...'; 'In the same samples, high levels of MMP-2 and -14 and low levels of TIMP-2 were present.

Line 27 - 'All results support that high levels of MG could induce irreversible...'

Introduction:

Line 33 - 'It is characterized by damage/deterioration of the lamellar tissue...'

Line 37 - '...acute or chronic, and it is not usually readily reversible.'

Lines 38 - 39 - 'The most common etiology of laminitis cases involves gastrointestinal or metabolic disease.'

Line 41 - '...hormonal influences and weight/pressure are both involved..'

Line 46 - would add comma after 'isoforms'

Line 48 - '...disturbances resulting from ingestion...'

Line 49 - '...role in sepsis-related laminitis...'

Line 50 - '...used as highly digestible...'

Line 52 - '...glucose liberation...'

Line 54 - '...followed by colic and laminitis.' (founder is redundant here, I believe)

Line 56 - 'In this scenario, release of toxins from the hindgut is suspected to occur, which in theory induces degradation of the lamellar basement membrane...'

Line 58 - '...infiltration into the lamellae.'

Line 59 - '...can lead to rapid, devastating changes that result in the elaboration of toxins and other substances:...'

Line 60 - 'Gram-negative and -positive...'

Line 61 - '...stress, leading to ...'; has this substance been shown to appear in equine serum/plasma following induction of a carbohydrate overload model of laminitis? That would seem to be central to the premise here, given the proposed route of exposure of the lamellae to this substance in vivo.

Lines 64-65 - Would include some context-specific criteria where lactate may serve as a biomarker of laminitis risk (not laminitis itself) - certain situations are associated with hyperlactatemia but not laminitis risk (such as intense aerobic exercise), so would restrict this in some way to situations in which this is more likely to be the case (e.g., sepsis).

Line 67 - '...which precedes and enables remodeling...'

Line 70 - '...have shown that under specific...'

Line 72 - '...making them an attractive model for the...'

Line 77 - '...different exposure time points.'

Materials and Methods:

Line 81 - the authors might comment in the discussion about how widely these data might be extrapolated to other breeds/types of horses

Line 82 - '...were enrolled in the study.'

Line 84 - would add a comma after 'Italy)'; would remove the commas after 'collected' and 'consent'

Line 88 - would remove 'symptoms and' from this sentence; what signs of laminitis, specifically, were evaluated (would list them)? Also, would specify whether the limb was a front or hind limb.

Line 89 - would add a comma after 'joint'; '...within 45 minutes of slaughter and..'

Line 101 - would use 'lamellae' instead of 'laminae' consistently throughout

Line 114 - '48 hour incubation'

Lines 116-117 - would include how survival was evaluated here (not just in the Results section)

Line 117 - '...used for the rest of the study.'

Line 125 - '...integrity of the samples.'

Line 130 - '...lamellar site were considered valid measurements.'

Lines 130-131 - I'm not sure what the authors are trying to say here, it's a bit unclear; consider rewording this sentence.

Line 136 - '...then embedded in paraffin, and 3-um slices were mounted...'

Line 142 - 'epidermal'

Line 144 - '...or severe and extensive (Grade...'

Lines 146 - 147 - This sentence is unclear - what particular characteristic of the SEL was evaluated?

Line 149 - how long after the force testing did RNA extraction occur? Was RNA extracted from any samples that were not subjected to force testing? Can the authors comment on the likely influence of this testing on the mRNA concentrations of some of their target genes in the sample tissue (i.e., are they known to be influenced by stretch, if sufficient time had elapsed between force testing and RNA extraction)?

Line 157 - can remove the comma after 'USA)'

Line 162 - '...MMP-14, and TIMP-2 transcripts...'

Line 164 - 'Equus caballus'

Line 169 - '...gene accession numbers, and...'

Line 174 - '...(ACTB), and...'

Line 175 - how was this determined?

Line 177 - '...triplicate, and template...'

Line 179 - can remove comma after 'averaged'

Line 187 - 'All the data were analyzed with a commercially available software program...'

Lines 190-193 - 'The separation force test and q-PCR data were analyzed using one-way ANOVA and Tukey's...'

Line 192 - How were the distributions of the histology score data analyzed?

Line 196 - '...was accepted at values...'

Results:

Lines 200-201 - Were any more sensitive/quantifiable measures of autolysis used to evaluate this tissue? This seems like a very subjective assessment.

Line 202 - Can the authors include a figure displaying representative histologic sections?

Line 203 - '...in a few samples...'

Line 204 - 'lamellae'

Line 205 - '...changes, and histological...'

Line 206 - 'structures; all samples...'

Lines 208-209 - '...in the preliminary assay, samples were kept in DMEM+ for all subsequent experiments.'

Line 212 - '...on all samples...'

Line 213 - '...at predetermined time points.'

Line 215 - '...separation of the HE lamellar structures could be...

Line 221 - '...can be observed.'

Line 222 - 'However, these differences did not reach the level of statistical significance.'

Line 225 - 'methylglyoxal'; '(N=45 per time point)'

Line 235 - '...due to alteration of...'

Lines 237, 238, 241 - do the authors mean 'epidermal' instead of 'epithelial' in these instances?

Lines 251-252 - 'Nevertheless, these differences did not reach the level of statistical significance.'

Line 256 - would avoid commenting on trends, if possible

Line 266, 270 - 'MG' is missing in the last line of the legend for Figure 6 and Figure 7

Line 267 - 'Tissue inhibitor of metalloproteinases-2 (TIMP-2) gene...'

Discussion:

Line 274 - would add a comma after 'solution'; can the authors discuss any other papers that have attempted to characterize/use a lamellar explant model of laminitis, for the purposes of comparing their model to others? (I believe there are at least a few out there currently.)

Line 284 - '...but according to our results, FBS and L-glutamine are necessary for tissue preservation.'

Line 290 - '...hoof lamellae, rendering them less robust and unable...'

Line 291 - '...untreated samples are instead able to bear and remain intact.'

Line 301 - would add a comma after 'features'

Line 311 - would add a comma after 'concentration'

Line 315 - would remove comma after 'detected'

Line 320 - '...has been shown to be regulated in breast cancer, where...'

Line 321 - '...with increased risk of malignancy...'

Line 326 - '...in the past, yielding important...'

Line 333 - would remove comma after 'intermediates'

Line 341 - '...subjects show higher levels...'

Line 342 - '...compared with those of healthy subjects.'

Line 347 - 'Escherichia coli' - should be italicized

Line 348 - 'induce the laminitis process...'

Line 350 - '...suggests that endotoxins are unlikely to induce laminitis...'

Line 351 - 'more likely merely contribute to the...'

Lines 358-359 - can the authors clarify here how their approach and evaluations mitigated the effects of variable diffusion of nutrients and oxygen in explants?

Line 362 - '...following their harvest, and that sections could be used for ex vivo studies.'

Line 367 - would list specific MMP's here

Lines 367-368 - I don't think that MMP mRNA expression necessarily correlates well with enzymatic activity, so would probably refine this statement a bit.

Line 367-368 - 'Further studies are needed to advance our understanding...'

Figure 1 - 'Sample preparation'; 'Histology/histology'

Figure 2 - 'Outer'; 'Lamellae'

Figure 4 - 'Histological score'

Figures 5, 6, and 7 - 'Concentration of Methylglyoxal (mM)'

Reviewer #2: Congratulations for this important research work. It is not easy to culture hoof explants of horses mainly by secondary bacteria contamination. I only suggest you to replace the figure 1 by another one more explicative and less tedious. I also suggest to add a set of photographs showing the method for explant procurement in a sequential fashion (step by step). This technique is very important and useful for equine laminitis researchers around the world.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

PLoS One. 2021 Jul 27;16(7):e0253840. doi: 10.1371/journal.pone.0253840.r002

Author response to Decision Letter 0

3 May 2021

Response letter manuscript PONE-D-20-06143

Journal requirements:

• The manuscript has been formatted according to Journal’s style

• The specification about funding has been added and the previous funding statement has been corrected

• The overlapping texts have been corrected according to the suggestions.

o https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3605361/ � this reference (Miretti et al., 2017) has been added along the text and in reference list. Thank You for the suggestion because we forgot to cite a paper of one of the co-authors.

o https://onlinelibrary.wiley.com/doi/full/10.1002/dmrr.2811 � this paper was already present in the reference list and we added a new reference along the text.

o https://beva.onlinelibrary.wiley.com/doi/abs/10.2746/042516406778400565 � we are really sorry but we can not add this reference because we did not consult it to write the paper. We don’t know why there’s an overlapping.

o https://www.sciencedirect.com/science/article/abs/pii/S0165242711000201?via%3Dihub � this paper was already present in the reference list and we added a new reference along the text.

Reviewer 1

Dear Reviewer, on behalf of all Authors, I would like to thank You for the time that you have spent to revise our manuscript. We appreciate Your efforts to improve our manuscript. We accepted all Your suggestions, and we provided the best answers that we could to the questions and comments that You addressed.

Here I provide a point-to-point response. When rephrasing was suggested, I have just stated “fixed”. When a longer answer was needed, I provided an explanation.

Line 1: fixed

Abstract

• Line 15: fixed

• Line 16: fixed

• Line 18: fixed

• Line 19: fixed

• Line 20: fixed

• Line 21: fixed

• Line 22: fixed

• Line 23: fixed

• Line 26: fixed

• Line 27: fixed

Introduction

• Line 33: fixed

• Line 37: fixed

• Line 38-39: fixed

• Line 41: fixed

• Line 46: fixed

• Line 48: fixed

• Line 49: fixed

• Line 50: fixed

• Line 52: fixed

• Line 54: fixed

• Line 56: fixed

• Line 58: fixed

• Line 59: fixed

• Line 60: fixed

• Line 61: fixed. To answer to the Reviewer’s question “ has this substance been shown to appear in equine serum/plasma following induction of a carbohydrate overload model of laminitis? That would seem to be central to the premise here, given the proposed route of exposure of the lamellae to this substance in vivo” some sentences were added in order to clarify (L61-69 in the revised version).

• Line 64-65: To answer to the Reviewer’s question “Would include some context-specific criteria where lactate may serve as a biomarker of laminitis risk (not laminitis itself) - certain situations are associated with hyperlactatemia but not laminitis risk (such as intense aerobic exercise), so would restrict this in some way to situations in which this is more likely to be the case (e.g., sepsis)” some sentences were added (L75-80 in the revised version).

• Line 67: fixed

• Line 70: fixed

• Line 72: fixed

• Line 77: fixed

Material and methods

• Line 81: According to Reviewer’s comment: “the authors might comment in the discussion about how widely these data might be extrapolated to other breeds/types of horses”, Authors provided a short explanation in discussion session (L 389-391 in the revised version).

• Line 82: fixed

• Line 84: fixed

• Line 88: To answer to the Reviewer’s questions: “hind limb or front limb? List signs of laminitis that were excluded?” Authors added that front limbs were collected (L 99 in the revised version) and wrote the evaluated signs and symptoms (L 103-104 in the revised version).

• Line 89: fixed

• Line 101: fixed in this line and along the text

• Line 114: fixed

• Lines 116-117: According to Reviewer’s comment: “would include how survival was evaluated here (not just in the Results section)” a short sentence was added (L 131-132 in the revised version).

• Line 117: fixed

• Line 130: fixed

• Lines 130-131: According to Reviewer’s comment: “I'm not sure what the authors are trying to say here, it's a bit unclear; consider rewording this sentence”, Authors rephrased (L 147-149 in the revised version).

• Line 136: fixed

• Line142: fixed

• Line 144: fixed

• Lines 146-147: According to Reviewer’s comment: ”how long after the force testing did RNA extraction occur? Was RNA extracted from any samples that were not subjected to force testing? Can the authors comment on the likely influence of this testing on the mRNA concentrations of some of their target genes in the sample tissue (i.e., are they known to be influenced by stretch, if sufficient time had elapsed between force testing and RNA extraction)?” Authors added some short sentences in lines 147-150 and 169-171 in order to explain that samples were immediately treated after the separation force test. According with reviewer's comment could be interesting evaluate changing in gene expression after the force test, but when the samples are maintained in culture condition for additional time after the test as reported by other studies (REF: Wu JH et al, Bone Joint Res. 2017 Mar;6(3):179-185; Qin TW, Sun YL, Thoreson AR, et al.. Effect of mechanical stimulation on bone marrow stromal cell-seeded tendon slice constructs: a potential engineered tendon patch for rotator cuff repair. Biomaterials 2015;51:43-50.The revitalisation of flexor tendon allografts with bone marrow stromal cells and mechanical stimulation: An ex vivo model revitalising flexor tendon allografts). In our case, we consider negligible the influence of the force test on the gene expression due to the closed timing between the test and RNA extraction.

• Line 157: fixed

• Line162: fixed

• Line 164: fixed

• Line 169: fixed

• Line 174: fixed

• Line 175: According to Reviewer’s question “how was this determined?” Authors answer that GAPDH was selected as housekeeping gene for the stable Cq values among the different experimental conditions. The correction is provided in lines 194-197 of the revised version.

• Line 177: fixed

• Line 179: fixed

• Line 187: Authors tried to provide the suggested correction. We hope to have interpreted well the comments.

• Line 190-193: fixed

• Line 192: According to Reviewer’s question: “How were the distributions of the histology score data analyzed?” the test’s name (L210-211 in the revised version) and a short explanation (L 269-270 in the revised version) were added.

• Line 196: fixed

Results

• Lines 200-201: According to Reviewer’s comment: “Were any more sensitive/quantifiable measures of autolysis used to evaluate this tissue? This seems like a very subjective assessment.”, Authors tried to rephrase and explain better (L 221 in the revised version).

• Line 202: According to Reviewer’s question “Can the authors include a figure displaying representative histologic sections?”, Authors provided pictures to show the differences between well preserved hoof explant samples (using DMEM+) and other samples that were considered autholitic and not eligible for the further experiments. Pictures are presented as Figure 3 (L 232-238 in the revised version). The other pictures have been renumbered as consequence.

• Line 203: fixed

• Line 204: fixed

• Line 205: fixed

• Line 206: fixed

• Lines 208-209: fixed

• Line 212: fixed

• Line 213: fixed

• Line 215: fixed

• Line 221: fixed

• Line 222: Authors tried to provide the suggested correction. We hope to have correctly interpreted the comments.

• Line 225: fixed

• Lines 237, 238, 241: According to Reviewer’s question: “do the authors mean 'epidermal' instead of 'epithelial' in these instances?” the answer is: Yes. Authors provided a correction along the text (Lines 255, 256 and 259 in the revised version).

• Lines 251-252: fixed

• Line 256: According to Reviewer’s comment: “would avoid commenting on trends, if possible”, only statistically significances were considered.

• Line 266-270: fixed

• Line 267: fixed

Discussion

• Line 274: fixed. According to Reviewer’s comment: “can the authors discuss any other papers that have attempted to characterize/use a lamellar explant model of laminitis, for the purposes of comparing their model to others? (I believe there are at least a few out there currently.)”, short sentences were added (L325-329 in the revised version).

• Line 284: fixed

• Line 290: fixed

• Line 291: fixed

• Line 301: fixed

• Line 311: fixed

• Line 315: fixed

• Line 320: fixed

• Line 321: fixed

• Line 326: fixed

• Line 333: fixed

• Line 341: fixed

• Line 342: fixed

• Line 347: fixed

• Line 348: fixed

• Line 350: fixed

• Line 351: fixed

• Line 358-359: According to Reviewer’s question “can the authors clarify here how their approach and evaluations mitigated the effects of variable diffusion of nutrients and oxygen in explants?” Authors added a short sentence to clarify (L380-381 in the revised version).

• Line 362: fixed

• Line 367: fixed

• Lines 367-368: According to Reviewer’s comment: “I don't think that MMP mRNA expression necessarily correlates well with enzymatic activity, so would probably refine this statement a bit”, the sentence has been refined.

• Lines 367-368: fixed

Reviewer 1 also requested the following modifications on Figures:

• Figure 1 - 'Sample preparation'; 'Histology/histology’: Figure 1 has been changed and designed according to the Reviewer 2 comment, considering also the corrections proposed by Reviewer 1.

• Figure 2 - 'Outer'; 'Lamellae’: Figure has been corrected according to the Reviewer’s comment

• Figure 4 - 'Histological score: Figure has been corrected according to the Reviewer’s comment

• Figures 5, 6, and 7 - 'Concentration of Methylglyoxal (mM)': all the Figures have been corrected according to Reviewer suggestion.

Reviewer 2:

Reviewer 2 wrote: “Congratulations for this important research work. It is not easy to culture hoof explants of horses mainly by secondary bacteria contamination. I only suggest you to replace the figure 1 by another one more explicative and less tedious. I also suggest to add a set of photographs showing the method for explant procurement in a sequential fashion (step by step). This technique is very important and useful for equine laminitis researchers around the world”.

Dear Reviewer, we are glad that our paper seems interesting for You. On behalf of all Authors, I would like to thank You for the time that you have spent to revise our manuscript. We accepted all Your suggestions, and here I provide the answers to Your comments.

• According to Reviewer suggestion, Figure 1 was changes. Authors hope that this new design is easier to read and more attractive for readers.

• Pictures: a panel of 4 pictures has been added as supplementary material ("Other") in order to show the different passages of the procedure.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(26.3KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0253840.r003

Decision Letter 1

Kanhaiya Singh

26 May 2021

PONE-D-20-06143R1

Effect of sugar metabolite methylglyoxal on horse keratinocytes: an ex vivo model for laminitis

PLOS ONE

Dear Dr. Vercelli,

Please submit your revised manuscript by Jul 10 2021 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.
A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.
An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

We look forward to receiving your revised manuscript.

Kind regards,

Kanhaiya Singh, Ph.D

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments (if provided):

Please address the suggestions made by Reviewers 2 and 3.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #1: (No Response)

Reviewer #2: All comments have been addressed

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

Reviewer #1: Yes

Reviewer #2: Yes

Reviewer #3: Yes

**********

6. Review Comments to the Author

Reviewer #1: The author have addressed the majority of the questions and comments that I had included in a review of the previous version of this manuscript, and I believe that it is improved. I have a few additional questions, by line, below:

Title - 'Effect of the sugar metabolite...'; would use 'equine lamellar explants' instead of 'horse keratinocytes' in the title, to more accurately describe the tissue that was used; '... model of laminitis'

Abstract:

Line 18 - '...and excessive levels absorbed into peripheral blood could be delivered to the foot and lead to...'

Line 23 - can remove the comma after '14'

Line 25 - can remove 'a' after 'mimicking'

Line 27-28 - this sentence (the one that begins with 'In the same...') is incomplete and should be reworded

Introduction:

Line 41 - '...resembling the human diabetic...'

Line 49 - please add a space between 'from' and 'ingestion'

Line 55 - '...caecal pH, often followed by colic and laminitis...'

Line 59 - '...AGEs accumulate in significant amounts in the hoof lamellar tissue in the acute...'

Line 61 - 'using the hyperinsulinemic model...'

Line 63 - '...MG) causes the formation of AGEs, leading...'

Line 66 - '...intermediate, it is converted...'

Line 72 - 'In equines, feeding large amounts of fermentable carbohydrates with subsequent acidosis increases the level of plasma D-lactate...'

Line 75 - '...D-lactate can be considered a...'

Line 84 - '...making them an attractive model...'

Line 87 - '...of MG on equine lamellar explants in an ex vivo...'

Materials and Methods:

Line 99 - '...typical stance, increased digital pulse, and increased hoof capsular warmth).'

Line 100 - '...the right fore distal limb...'

Line 112 - '...dermal lamellae, and the bone.'

Line 120 - can remove 'of' in front of 'Fetal'

Line 126 - 'Sample'

Line 142 - would use 'lamellae' instead of 'laminae' throughout the manuscript

Line 143 - 'broken at'

Line 149 - 'One sample from each time point and from each MG concentration...'

Line 150 - would add a comma after 'paraffin'; '...slices were mounted...'

Line 153 - '...microscope, and images were captured...'

Line 160 - '...evaluated for lesions of the secondary...'

Line 164 - 'RNA-Later solution (Ambion), and the stratum lamellatum was disrupted using...'

Line 177 - '...MMP-14, and TIMP-2 transcripts, qPCR...'

Line 179 - 'designed from Equus caballus...'

Line 200 - '...were designed from Equus caballus...'

Line 205 - 'one-way ANOVA and Tukey's multiple...

Line 207 - '...their distributions were analyzed using two-way ANOVA...'

Results and discussion:

Line 221 - '...all structures; all samples were...'

Line 225 - 'characteristics'

Line 236 - 'predetermined'

Line 245 - '...for 48 h can be observed.'

Line 258 - '...of all layers and were statistically...'

Line 267 - 'concentrations'

Line 280 - can remove the comma after 'concentration'

Line 296 - '...as a suitable viable model system for investigating...'

Line 307 - 'with our results, FBS and...'

Line 309 - '...period, supporting the viability of the samples...'

Line 310 - 'Other papers have evaluated the possibility of using hoof explant samples but focus their attention on different metabolic goals (e.g.,...'

Line 312 - 'To the authors' knowledge, this is the first paper focusing specifically on the role of MG (...'

Line 315 - 'to modification of the hoof lamellae...'

Line 316 - '...that untreated samples are able to bear...'

Line 317 - '...confirmed that higher concentrations of MG and a longer...'

Line 319 - '...were confirmed by histological...'

Line 322 - 'The results of gene expression of MMPs...'

Line 325 - '...matrix remodeling, more severe histological features, and...'

Line 337 - '...starch overload or other causes, increases...'

Line 346 - can remove the comma after 'MMP2' here

Line 349 - 'yielding'

Line 363 - '...various pathologies; for example,...'

Line 370 - '...not sufficient to induce laminitis in vitro.'

Line 373-374 - '...more likely contributing to the disease's...'

Line 383-385 - '...(Breton horses) that were relatively young; it would be interesting to apply the same ex vivo model of laminitis to even older horses of different breeds, such as pony breeds, to assess any differences...'

Line 388 - '...could be used for ex vivo studies.'

Line 393 - would use 'supported' instead of 'confirmed' here

Supplemental data:

Line 519 - would use 'lamellar' instead of 'laminar' here

Reviewer #2: Congratulations. This is an important research work. In general, you addressed the concerns raised during the review process.

Reviewer #3: In this paper, the authors are examining the effects of excessive methylglyoxal on the hoof lamellar structure with an aim to identify the mechanism behind the Laminitis disease. They use an ex vivo experimental design and perform various types of analysis - macroscopic analysis, histological analysis, separation force test and gene expression. They identify that high levels of methylglyoxal could induce irreversible damage in the hooves which mimicks laminitis in an ex vivo model.

Overall, the findings of the manuscript are well-supported by the data and the methods used are appropriate. The authors have also addressed the reviewers comments adequately. However, there are some points to consider that I have outlined below:

1. In the revised manuscript, the authors have renamed the ‘Results’ section as ‘Results and Discussion’, however, the discussion has not been incorporated with the results. It is still presented as a separate section (minus the heading). The layout of this section will have to be changed significantly if the authors want to keep the ‘Results and Discussion’ heading. If not, I would recommend adding the ‘Discussion’ heading and keeping ‘Results’ separate.

Minor concerns:

1. In the abstract, the authors mention ‘Microscopical and histological analysis’, however, in the rest of the manuscript, there is ‘Macroscopical analysis’. Please correct accordingly.

2. In the abstract, the second last line starting with ‘In the same samples…’ (Line 29), does not make sense, it seems incomplete. Please edit.

3. Line 45, ‘…influences and weight/ pressures…’ needs to be edited for coherence.

4. Lines 48-51, need to be changed to make sense. Right now, it seems like a collection of terms.

5. Line 57, ‘this means’ should be ‘which means’.

6. Line 64, ‘hoof lamellar tissue level’, the word ‘level’ can be removed.

7. Line 70, ‘highly reactive intermediate is’, should be ‘highly reactive intermediate, it is’.

8. Line 78, ‘sequent acidosis’, do the authors mean ‘subsequent acidosis’?

9. Line 79, ‘increase the level of plasma levels’, should be ‘increase the plasma levels of’.

10. Line 81, ‘also because’ is redundant. Use either also, or because.

11. Line 89, ‘attracting model’ should be ‘attractive model’.

12. Line 100, ‘for this study purpose’ can be rephrased to, ‘for the purposes of this study’.

13. Line 105, ‘typical pain position and digital pulse and hot hoof’, one ‘and’ can be removed.

14. Line 107, ‘within 45 minutes of slaughter’ should be ‘within 45 minutes’, since the sentence is starting with ‘following slaughter’.

15. Line 114, Mungall and Pollitt is missing an in-text citation.

16. Line 131, should be ‘Fig S1’ to make it consistent with the rest of the manuscript.

17. Line 133, do the authors mean ‘Sample survival’?

18. Line 141, for ‘controls (K)’, reference the figure number.

19. Line 144, ‘the’ before structural integrity should be removed.

20. Line 150, do the authors mean ‘broken’, instead of ‘brocken’?

21. Line 172, change RNA later to RNAlater (as per manufacturers label).

22. Line 198 and Line 202, move Cq definition from line 202 to line 198.

23. Line 207, table 1 is not in line with the text.

24. Line 211-214, do not make sense. Which softwares? Which companies? Please edit. Line 211, remove ‘a’ before ‘commercially’ if you are referring to more than 1 software.

25. Line 216, ‘Turkey’s’ should be ‘Tukey’s’.

26. Line 222, define SD.

27. Line 228, should be ‘performed for all samples’.

28. Line 232-233, separate the sentences. ‘All samples’ should be a different sentence.

29. Line 248, should be ‘predetermined’.

30. Line 254-255 is very confusing. Please clarify.

31. Line 271-272, ‘and resulted statistically different’, please clarify.

32. Line 277, what do you mean by definition?

33. Line 280, should be ‘concentrations’.

34. Fig 6-8 legend, the gene descriptions should be in the text and not in the figure legends.

35. Line 328-329, please rephrase for coherence.

36. Line 330, should be ‘In our knowledge’.

37. Line 340, please edit for coherence.

38. Line 344, edit spelling to ‘correlated’.

39. Line 345, should be ‘resulting in structural weakness’.

40. Line 367, please define the ‘entire process’ so as to make the sentence complete.

41. Line 369, edit spelling to ‘yielding’.

42. Line 378, the acronym AGEs does not need to be defined again.

43. Line 391, the word ‘bacteria’ should be before E.coli and not after.

44. Line 395, rephrase for coherence.

45. Line 403-406, rephrase for coherence.

46. Line 410, remove ‘an’ before ex vivo.

47. Line 412, time-dependent would be more appropriate than ‘time-related’.

48. Figure 1, The authors can consider changing ‘force test’ to ‘separation force test’. It would then be consistent throughout the manuscript.

49. Figure 4, table headings are missing.

50. Figure 4,6,7,8, the legend for time needs to be consistent throughout. Either 24h, 48h or T24h, T48h.

51. Figure 6-8, the Y-axis should be Cq instead of Ct, for consistency between figures and text.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

Reviewer #3: No

PLoS One. 2021 Jul 27;16(7):e0253840. doi: 10.1371/journal.pone.0253840.r004

Author response to Decision Letter 1

7 Jun 2021

Response to Reviewers

Journal requirements

Dear Editor,

As required in your email, the following items are under submission:

• Response to Reviewers

• Revised Manuscript with Track Changes

• Manuscript

• Cover letter

An updated and more precise financial disclosure statement is presented in our cover letter.

All Figures have been checked using PAGE online system and are submitted according to PAGE system revision.

Tables have been formatted according to https://journals.plos.org/plosone/s/tables

References have been numbered along the text in order at first citation and reference list has been updated consequently. Two references have been delated from the reference list (Bierhaus et al., 2012 and Kyaw-Tanner et al., 2012) because they were not present in-text. The in-text citation of “Visser 2008” (L199) has been removed because it does not exist. References have been organized and formatted in Vancouver style using Zotero software.

Reviewer comments

Reviewer 1

Authors would like to thank R1 for all the efforts made to improve our paper. Authors accepted all suggestions that have been addressed and corrections have been provided along the text.

Reading once again the revised manuscript, we correct some minor issue that are listed at the end of this letter.

Here we copied R1 comments (italics) and we provide the answers.

Abstract:

• Line 18 - '...and excessive levels absorbed into peripheral blood could be delivered to the foot and lead to...' � correction has been provided according to Reviewer’s comment.

• Line 23 - can remove the comma after '14'�correction has been provided according to Reviewer’s comment.

• Line 25 - can remove 'a' after 'mimicking'� correction has been provided according to reviewer’s comment.

• Line 27-28 - this sentence (the one that begins with 'In the same...') is incomplete and should be reworded �according to reviewer’s comment the sentence has been erased. R3 suggested the same.

Introduction:

• Line 41 - '...resembling the human diabetic...'. � correction has been provided according to reviewer’s comment.

• Line 49 - please add a space between 'from' and 'ingestion' �Correction has been provided according to reviewer’s comment.

• Line 55 - '...caecal pH, often followed by colic and laminitis...'. � Correction has been provided according to reviewer’s comment.

• Line 59 - '...AGEs accumulate in significant amounts in the hoof lamellar tissue in the acute...'. � Correction has been provided according to reviewer’s comment.

• Line 61 - 'using the hyperinsulinemic model...'� Correction has been provided according to reviewer’s comment.

• Line 63 - '...MG) causes the formation of AGEs, leading...' � Correction has been provided according to reviewer’s comment.

• Line 66 - '...intermediate, it is converted...': � Correction has been provided according to reviewer’s comment.

• Line 72 - 'In equines, feeding large amounts of fermentable carbohydrates with subsequent acidosis increases the level of plasma D-lactate...'. � Correction has been provided according to reviewer’s comment.

• Line 75 - '...D-lactate can be considered a...'. � Correction has been provided according to reviewer’s comment.

• Line 84 - '...making them an attractive model...’ �Correction has been provided according to reviewer’s comment.

• Line 87 - '...of MG on equine lamellar explants in an ex vivo...'. � Correction has been provided according to reviewer’s comment.

Materials and Methods:

• Line 99 - '...typical stance, increased digital pulse, and increased hoof capsular warmth).' � Correction has been provided according to reviewer’s comment.

• Line 100 - '...the right fore distal limb...’ � Correction has been provided according to reviewer’s comment.

• Line 112 - '...dermal lamellae, and the bone. � Correction has been provided according to reviewer’s comment.

• Line 120 - can remove 'of' in front of 'Fetal'. � Correction has been provided according to reviewer’s comment.

• Line 126 - 'Sample'. � Correction has been provided according to reviewer’s comment

• Line 142 - would use 'lamellae' instead of 'laminae' throughout the manuscript �Correction has been provided according to reviewer’s comment in this line and along the text and captions.

• Line 143 - 'broken at'. � Correction has been provided according to reviewer’s comment. Also, R3 suggested the same correction.

• Line 149 - 'One sample from each time point and from each MG concentration...'. � Correction has been provided according to reviewer’s comment.

• Line 150 - would add a comma after 'paraffin'; '...slices were mounted...'. � Correction has been provided according to reviewer’s comment.

• Line 153 - '...microscope, and images were captured...'. � Correction has been provided according to reviewer’s comment.

• Line 160 - '...evaluated for lesions of the secondary...'. � Correction has been provided according to reviewer’s comment.

• Line 164 - 'RNA-Later solution (Ambion), and the stratum lamellatum was disrupted using...' � Correction has been provided according to reviewer’s comment. R3 suggested ‘RNAlater’ instead of 'RNA-Later’. We checked the manufactured label, and we wrote ‘RNAlater’.

• Line 177 - '...MMP-14, and TIMP-2 transcripts, qPCR...'. � Correction has been provided according to reviewer’s comment.

• Line 179 - 'designed from Equus caballus...'. �Correction has been provided according to reviewer’s comment.

• Line 200 - '...were designed from Equus caballus...'. � Correction has been provided according to reviewer’s comment.

• Line 205 - 'one-way ANOVA and Tukey's multiple.... �. Correction has been provided according to reviewer’s comment.

• Line 207 - '...their distributions were analyzed using two-way ANOVA...'. � Correction has been provided according to reviewer’s comment.

Results and discussion:

• Line 221 - '...all structures; all samples were...'. � Correction has been provided according to reviewer’s comment.

• Line 225 - 'characteristics'. � Correction has been provided according to reviewer’s comment.

• Line 236 - 'predetermined'. � Correction has been provided according to reviewer’s comment.

• Line 245 - '...for 48 h can be observed. � Correction has been provided according to reviewer’s comment.

• Line 258 - '...of all layers and were statistically...' �Correction has been provided according to reviewer’s comment.

• Line 267 - 'concentrations'. � Correction has been provided according to reviewer’s comment.

• Line 280 - can remove the comma after 'concentration'. � Correction has been provided according to reviewer’s comment.

• Line 296 - '...as a suitable viable model system for investigating...’ � Correction has been provided according to reviewer’s comment.

• Line 307 - 'with our results, FBS and...' �Correction has been provided according to reviewer’s comment.

• Line 309 - '...period, supporting the viability of the samples...' � Correction has been provided according to reviewer’s comment.

• Line 310 - 'Other papers have evaluated the possibility of using hoof explant samples but focus their attention on different metabolic goals (e.g.,...'. � Correction has been provided according to reviewer’s comment.

• Line 312 - 'To the authors' knowledge, this is the first paper focusing specifically on the role of MG (...' � Correction has been provided according to reviewer’s comment.

• Line 315 - 'to modification of the hoof lamellae...’ � Correction has been provided according to reviewer’s comment.

• Line 316 - '...that untreated samples are able to bear...'. � Correction has been provided according to reviewer’s comment.

• Line 317 - '...confirmed that higher concentrations of MG and a longer...' � Correction has been provided according to reviewer’s comment.

• Line 319 - '...were confirmed by histological...'. �. Correction has been provided according to reviewer’s comment.

• Line 322 - 'The results of gene expression of MMPs...' � Correction has been provided according to reviewer’s comment.

• Line 325 - '...matrix remodeling, more severe histological features, and...' � Correction has been provided according to reviewer’s comment.

• Line 337 - '...starch overload or other causes, increases...' � Correction has been provided according to reviewer’s comment.

• Line 346 - can remove the comma after 'MMP2' here. Correction has been provided according to reviewer’s comment.

• Line 349 - 'yielding' �Correction has been provided according to reviewer’s comment.

• Line 363 - '...various pathologies; for example,...' � Correction has been provided according to reviewer’s comment

• Line 370 - '...not sufficient to induce laminitis in vitro.' �. Correction has been provided according to reviewer’s comment.

• Line 373-374 - '...more likely contributing to the disease's...' � Correction has been provided according to reviewer’s comment.

• Line 383-385 - '...(Breton horses) that were relatively young; it would be interesting to apply the same ex vivo model of laminitis to even older horses of different breeds, such as pony breeds, to assess any differences...'. � Corrections have been provided according to reviewer’s comment.

• Line 388 - '...could be used for ex vivo studies.' � Correction has been provided according to reviewer’s comment.

• Line 393 - would use 'supported' instead of 'confirmed' here. � Correction has been provided according to reviewer’s comment.

Supplemental data:

• Line 519 - would use 'lamellar' instead of 'laminar' here. �The correction has been provided according to the comment in L519 and in Fig S1.

Reviewer 2

Reviewer #2: Congratulations. This is an important research work. In general, you addressed the concerns raised during the review process.

Author would like to sincerely thank R2 for all the efforts made to improve our paper. We are pleased to hear that R2 is satisfied about the corrections that have been provided in the first revision round.

Reading once again the revised manuscript, we correct some minor issue that are listed at the end of this letter.

Reviewer 3

Authors would like to thank R3 for all the efforts made to improve our paper. Authors accepted all suggestions that have been addressed and corrections have been provided along the text.

Reading once again the revised manuscript, we correct some minor issue that are listed at the end of this letter.

Here we copied R3 comments (italics) and we provide the answers.

Minor concerns:

1. In the abstract, the authors mention ‘Microscopical and histological analysis’, however, in the rest of the manuscript, there is ‘Macroscopical analysis’. Please correct accordingly � According to reviewer’s comment, correction has been provided.

2. In the abstract, the second last line starting with ‘In the same samples…’ (Line 29), does not make sense, it seems incomplete. Please edit. � the sentence has been edited.

3. Line 45, ‘…influences and weight/ pressures…’ needs to be edited for coherence. � The sentence has been edited according to reviewer’s comment.

4. Lines 48-51, need to be changed to make sense. Right now, it seems like a collection of terms. � sentence has been rephrased in order to be clearer

5. Line 57, ‘this means’ should be ‘which means’. � Correction has been provided according to reviewer’s comment.

6. Line 64, ‘hoof lamellar tissue level’, the word ‘level’ can be removed. � ‘Level ‘has been removed, also according to R1 suggestion.

7. Line 70, ‘highly reactive intermediate is’, should be ‘highly reactive intermediate, it is’. � The same correction was proposed also by R1. Correction has been provided.

8. Line 78, ‘sequent acidosis’, do the authors mean ‘subsequent acidosis’? � yes, thank you for your comment, Correction has been provided.

9. Line 79, ‘increase the level of plasma levels’, should be ‘increase the plasma levels of’.�Correction has been provided according to reviewer’s comment.

10. Line 81, ‘also because’ is redundant. Use either also, or because. � Correction has been provided according to reviewer’s comment.

11. Line 89, ‘attracting model’ should be ‘attractive model’. �The same correction was proposed also by R1. Correction has been provided.

12. Line 100, ‘for this study purpose’ can be rephrased to, ‘for the purposes of this study’. � The sentence has been rephrased according to the comment of R3.

13. Line 105, ‘typical pain position and digital pulse and hot hoof’, one ‘and’ can be removed. � R1 asked to rephrase the sentence. We hope that R3 agrees with this version.

14. Line 107, ‘within 45 minutes of slaughter’ should be ‘within 45 minutes’, since the sentence is starting with ‘following slaughter’. � thank you for your comment, Correction has been provided.

15. Line 114, Mungall and Pollitt is missing an in-text citation. � All the in-text citations have been formatted according to the journal requirements and the reference list has been updated. According to this, also the comment about L114 has been fixed.

16. Line 131, should be ‘Fig S1’ to make it consistent with the rest of the manuscript. � correction has been provided. Thank you for the suggestion.

17. Line 133, do the authors mean ‘Sample survival’? � The same correction was proposed also by R1. Correction has been provided.

18. Line 141, for ‘controls (K)’, reference the figure number. � reference to figures has been added

19. Line 144, ‘the’ before structural integrity should be removed. � ‘the’ has been removed

20. Line 150, do the authors mean ‘broken’, instead of ‘brocken’?--> yes, thank you for your suggestion.

21. Line 172, change RNA later to RNAlater (as per manufacturers label). � R1 proposed a different correction (‘RNA-Later’) but we checked the manufacturer label and we accepted your suggestion.

22. Line 198 and Line 202, move Cq definition from line 202 to line 198. � The Cq definition has been moved and the sentences have been rephrased in order to be clearer.

23. Line 207, table 1 is not in line with the text. � all tables have been formatted according to the journal style. We hope that table 1 now is in line with the text.

24. Line 211-214, do not make sense. Which softwares? Which companies? Please edit. Line 211, remove ‘a’ before ‘commercially’ if you are referring to more than 1 software. � thank you for your suggestion. The sentence has been edited and corrections have been provided.

25. Line 216, ‘Turkey’s’ should be ‘Tukey’s’. � Correction has been provided.

26. Line 222, define SD. � SD has been defined.

27. Line 228, should be ‘performed for all samples’. � thank you for your suggestion. Correction has been provided.

28. Line 232-233, separate the sentences. ‘All samples’ should be a different sentence. � R1 asked to change ‘,’ with ‘;’ to separate the sentences. We hope that R3 agrees with R1.

29. Line 248, should be ‘predetermined’. � The same correction was proposed also by R1. Correction has been provided.

30. Line 254-255 is very confusing. Please clarify. � these two lines have been modified according to the comments provided by reviewers in the fist round. Nevertheless, Authors checked the first manuscript that was submitted and tried to rephrase the sentences in order to be clearer and more related to the original meaning.

31. Line 271-272, ‘and resulted statistically different’, please clarify. � sentence has been rephrased according to R1 comment. We hope that R3 agrees with R1.

32. Line 277, what do you mean by definition? � no, in this case, we mean the definition of the histological image.

33. Line 280, should be ‘concentrations’. � ‘s’ has been added according to R1 and R3comments.

34. Fig 6-8 legend, the gene descriptions should be in the text and not in the figure legends. � the definitions have been removed from figure captions.

35. Line 328-329, please rephrase for coherence. � some corrections have been provided according to the R1 comments. We hope that R3 agrees with R1.

36. Line 330, should be ‘In our knowledge’. ��some corrections have been provided according to the R1 comments. We hope that R3 agrees with R1.

37. Line 340, please edit for coherence. � some corrections have been provided according to the R1 comments. We hope that R3 agrees with R1.

38. Line 344, edit spelling to ‘correlated’. � thank you. Correction has been provided.

39. Line 345, should be ‘resulting in structural weakness’. �thank you for your comment. Correction has been provided.

40. Line 367, please define the ‘entire process’ so as to make the sentence complete. � we add ‘laminitic’

41. Line 369, edit spelling to ‘yielding’. � also R1 suggested this correction. Correction has been provided.

42. Line 378, the acronym AGEs does not need to be defined again. � definition has been removed.

43. Line 391, the word ‘bacteria’ should be before E.coli and not after.--> Thank you for your comment. This correction has been fixed.

44. Line 395, rephrase for coherence. � also R1 suggested a rephrasing here. We hope that R3 agrees with R1.

45. Line 403-406, rephrase for coherence. � also R1 suggested a rephrasing here. We hope that R3 agrees with R1.

46. Line 410, remove ‘an’ before ex vivo. � ‘an’ as been delated according to R1 and R3 suggestions.

47. Line 412, time-dependent would be more appropriate than ‘time-related’. � the word has been changed according to R3 suggestion.

48. Figure 1, The authors can consider changing ‘force test’ to ‘separation force test’. It would then be consistent throughout the manuscript. � Figure 1 has been changed according to R3 suggestion.

49. Figure 4, table headings are missing. � the complete table has been inserted.

50. Figure 4,6,7,8, the legend for time needs to be consistent throughout. Either 24h, 48h or T24h, T48h. � Fig. 4,6-8 are now consistent and the same wording (T24 h and T 48 h) has been used along the text.

51. Figure 6-8, the Y-axis should be Cq instead of Ct, for consistency between figures and text. � Y axis label has been corrected according to R3 comment.

Authors comments

• Reading once again the manuscript, we have found some typos and double-spaced words: we have fixed everything.

• Some references have been delated. An explanation is provided at the beginning of this letter and in the cover letter.

• L292: Fig 9 does not exist. Thus a correction has been provided.

• L305: ‘/maintaing’ has been removed.

• L356: ‘ alpha oxoaldehydes’ instead of ‘alphaoxoaldehydes’

• In the whole document, MMP-2, MMP-14 and TIMP-2 (using ‘-‘) instead of MMP2, MMP14 and TIMP2 have been written. This was done in order to be coherent along the text, tables and figures using the same wording and according to a suggestion of the first round of revision.

• Table 2: the title was missing. We added it.

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(29.1KB, docx)}

PLoS One. doi: 10.1371/journal.pone.0253840.r005

Decision Letter 2

Kanhaiya Singh

15 Jun 2021

Effect of sugar metabolite methylglyoxal on equine lamellar explants: an ex vivo model of laminitis

PONE-D-20-06143R2

Dear Dr. Vercelli,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice for payment will follow shortly after the formal acceptance. To ensure an efficient process, please log into Editorial Manager at http://www.editorialmanager.com/pone/, click the 'Update My Information' link at the top of the page, and double check that your user information is up-to-date. If you have any billing related questions, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Kanhaiya Singh, Ph.D

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Reviewers' comments:

PLoS One. doi: 10.1371/journal.pone.0253840.r006

Acceptance letter

Kanhaiya Singh

19 Jul 2021

PONE-D-20-06143R2

Effect of sugar metabolite methylglyoxal on equine lamellar explants: an ex vivo model of laminitis

Dear Dr. Vercelli:

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now with our production department.

If your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information please contact onepress@plos.org.

If we can help with anything else, please email us at plosone@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Kanhaiya Singh

Academic Editor

PLOS ONE

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Dataset. Datasets of the different experimental assays.

(ZIP)

Click here for additional data file.^{(69.3KB, zip)}

S1 Fig. Step-by-step procedure.

(TIF)

Click here for additional data file.^{(422.1KB, tif)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(26.3KB, docx)}

Attachment

Submitted filename: Response to Reviewers.docx

Click here for additional data file.^{(29.1KB, docx)}

Data Availability Statement

All relevant data are within the manuscript and its Supporting Information files.

[pone.0253840.ref001] 1.Steelman SM, Johnson D, Wagner B, Stokes Ashley M, Chowdhary BP. Cellular and humoral immunity in chronic equine laminitis. Veterinary Immunology and Immunopathology. 2013. Jun;153(3–4):217–26. doi: 10.1016/j.vetimm.2013.03.001 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref002] 2.Lameness & Laminitis in U.S. Horses. United States Department of Agriculture Report #N318.0400. 2000; 1–40. [Google Scholar]

[pone.0253840.ref003] 3.Medina-Torres CE, Mason SL, Floyd RV, Harris PA, Mobasheri A. Hypoxia and a hypoxia mimetic up-regulate matrix metalloproteinase 2 and 9 in equine laminar keratinocytes. The Veterinary Journal. 2011. Nov;190(2):e54–9. doi: 10.1016/j.tvjl.2011.02.026 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref004] 4.Katz LM, Bailey SR. A review of recent advances and current hypotheses on the pathogenesis of acute laminitis: The pathogenesis of equine acute laminitis. Equine Vet J. 2012. Nov;44(6):752–61. doi: 10.1111/j.2042-3306.2012.00664.x [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref005] 5.Wells-Smith L. Laminitis in the 21st century. Veterinary Record. 2015. Jan;176(3):70–1. doi: 10.1136/vr.h53 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref006] 6.Ziegler D, Schleicher E, Strom A, Knebel B, Fleming T, Nawroth P, et al. Association of transketolase polymorphisms with measures of polyneuropathy in patients with recently diagnosed diabetes: Transketolase Polymorphisms and Neuropathy. Diabetes Metab Res Rev. 2017. May;33(4):e2811. [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref007] 7.Milinovich GJ, Burrell PC, Pollitt CC, Klieve AV, Blackall LL, Ouwerkerk D, et al. Microbial ecology of the equine hindgut during oligofructose-induced laminitis. ISME J. 2008. Nov;2(11):1089–100. doi: 10.1038/ismej.2008.67 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref008] 8.Pollitt CC, Visser MB. Carbohydrate Alimentary Overload Laminitis. Veterinary Clinics of North America: Equine Practice. 2010. Apr;26(1):65–78. [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref009] 9.Hoffman RM. Carbohydrate metabolism and metabolic disorders in horses. R Bras Zootec. 2009. Jul;38(spe):270–6. [Google Scholar]

[pone.0253840.ref010] 10.de Laat MA, Kyaw-Tanner MT, Sillence MN, McGowan CM, Pollitt CC. Advanced glycation endproducts in horses with insulin-induced laminitis. Veterinary Immunology and Immunopathology. 2012. Jan;145(1–2):395–401. doi: 10.1016/j.vetimm.2011.12.016 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref011] 11.Valle E, Storace D, Sanguineti R, Carter R, Odetti P, Geor R, et al. Association of the glycoxidative stress marker pentosidine with equine laminitis. The Veterinary Journal. 2013. Jun;196(3):445–50. doi: 10.1016/j.tvjl.2012.10.030 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref012] 12.Valle E, Prola L, Vergnano D, Borghi R, Monacelli F, Traverso N, et al. Investigation of hallmarks of carbonyl stress and formation of end products in feline chronic kidney disease as markers of uraemic toxins. Journal of Feline Medicine and Surgery. 2019. Jun;21(6):465–74. doi: 10.1177/1098612X18783858 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0253840.ref013] 13.Teodorowicz M, Hendriks WH, Wichers HJ, Savelkoul HFJ. Immunomodulation by Processed Animal Feed: The Role of Maillard Reaction Products and Advanced Glycation End-Products (AGEs). Front Immunol. 2018. Sep 13;9:2088. doi: 10.3389/fimmu.2018.02088 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0253840.ref014] 14.Kosmachevskaya OV, Shumaev KB, Topunov AF. Carbonyl Stress in Bacteria: Causes and Consequences. Biochemistry Moscow. 2015. Dec;80(13):1655–71. doi: 10.1134/S0006297915130039 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref015] 15.Ewaschuk JB, Zello GA, Naylor JM, Brocks DR. Metabolic acidosis: separation methods and biological relevance of organic acids and lactic acid enantiomers. Journal of Chromatography B. 2002. Dec;781(1–2):39–56. doi: 10.1016/s1570-0232(02)00500-7 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref016] 16.Mungall BA, Pollitt CC. Thermolysin Activates Equine Lamellar Hoof Matrix Metalloproteinases. Journal of Comparative Pathology. 2002. Jan;126(1):9–16. doi: 10.1053/jcpa.2001.0515 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref017] 17.Wang L, Pawlak EA, Johnson PJ, Belknap JK, Alfandari D, Black SJ. Expression and Activity of Collagenases in the Digital Laminae of Horses with Carbohydrate Overload‐Induced Acute Laminitis. J Vet Intern Med. 2014. Jan;28(1):215–22. doi: 10.1111/jvim.12252 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0253840.ref018] 18.Pass MA, Pollitt S, Pollitt CC. Decreased glucose metabolism causes separation of hoof lamellae in vitro: a trigger for laminitis? Equine Veterinary Journal. 2010. Jun 10;30(S26):133–8. [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref019] 19.Reisinger N, Schaumberger S, Nagl V, Hessenberger S, Schatzmayr G. Milk Thistle Extract and Silymarin Inhibit Lipopolysaccharide Induced Lamellar Separation of Hoof Explants in Vitro. Toxins. 2014. Oct 6;6(10):2962–74. doi: 10.3390/toxins6102962 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0253840.ref020] 20.Pollitt CC. Basement membrane pathology: a feature of acute equine laminitis. Equine Vet J. 1996; 28(1):38–46. doi: 10.1111/j.2042-3306.1996.tb01588.x [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref021] 21.Miretti S, Volpe MG, Martignani E, Accornero P, Baratta M. Temporal correlation between differentiation factor expression and microRNAs in Holstein bovine skeletal muscle. Animal. 2017;11(2):227–35. doi: 10.1017/S1751731116001488 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref022] 22.Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 2001. Dec;25(4):402–8. doi: 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref023] 23.French KR, Pollitt CC. Equine laminitis: glucose deprivation and MMP activation induce dermo-epidermal separation in vitro. Equine Veterinary Journal. 2010. Jan 5;36(3):261–6. [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref024] 24.Pass MA, Pollitt S, Pollitt CC. Decreased glucose metabolism causes separation of hoof lamellae in vitro: a trigger for laminitis? Equine Vet J Suppl. 1998; 26, 133–8. doi: 10.1111/j.2042-3306.1998.tb05132.x [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref025] 25.Reisinger N, Schaumberger S, Nagl V, Hessenberger S, Schatzmayr G. Concentration Dependent Influence of Lipopolysaccharides on Separation of Hoof Explants and Supernatant Lactic Acid Concentration in an Ex Vivo/In Vitro Laminitis Model. Haziot A, editor. PLoS ONE. 2015. Nov 24;10(11):e0143754. doi: 10.1371/journal.pone.0143754 [DOI] [PMC free article] [PubMed] [Google Scholar]

[pone.0253840.ref026] 26.Sandow C, Fugler LA, Leise B, Riggs L, Monroe WT, Totaro N, et al. Ex vivo effects of insulin on the structural integrity of equine digital lamellae. Equine Vet J. 2019. Jan;51(1):131–5. doi: 10.1111/evj.12964 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref027] 27.Visser MB, Pollitt CC. The timeline of metalloprotease events during oligofructose induced equine laminitis development: Temporal protease events during laminitis development. Equine Veterinary Journal. 2012. Jan;44(1):88–93. doi: 10.1111/j.2042-3306.2011.00393.x [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref028] 28.Pollitt CC, Pass MA, Pollitt S. Batimastat (BB-94) inhibits matrix metalloproteinases of equine laminitis. Equine Veterinary Journal. 2010. Jun 10;30(S26):119–24. [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref029] 29.Kyaw-Tanner MT, Wattle O, Eps AW, Pollitt CC. Equine laminitis: Membrane type matrix metalloproteinase-1 (MMP-14) is involved in acute phase onset. Equine Veterinary Journal. 2008. Jul;40(5):482–7. doi: 10.2746/042516408X270353 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref030] 30.Daradka M, Pollitt CC. Epidermal cell proliferation in the equine hoof wall. Equine Veterinary Journal. 2010. Jan 5;36(3):236–41. [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref031] 31.de Laat MA, Kyaw-Tanner MT, Nourian AR, McGowan CM, Sillence MN, Pollitt CC. The developmental and acute phases of insulin-induced laminitis involve minimal metalloproteinase activity. Vet Immunol Immunopathol. 2011; 140(3–4):275–81 doi: 10.1016/j.vetimm.2011.01.013 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref032] 32.Johnson PJ, Tyagi SC, Katwa LC, Ganjam VK, Moore LA, Kreeger JM, et al. Activation of extracellular matrix metalloproteinases in equine laminitis. Veterinary Record. 1998. Apr;142(15):392–6. doi: 10.1136/vr.142.15.392 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref033] 33.Jiang WG, Davies G, Martin TA, Parr C, Watkins G, Mason MD, et al. Expression of membrane type‐1 matrix metalloproteinase, MT1‐MMP in human breast cancer and its impact on invasiveness of breast cancer cells. Int. J. Mol. Med. 2006; 17, 583–90. [PubMed] [Google Scholar]

[pone.0253840.ref034] 34.Fleming T, Cuny J, Nawroth G, Djuric Z, Humpert PM, Zeier M, et al. Is diabetes an acquired disorder of reactive glucose metabolites and their intermediates? Diabetologia. 2012. Apr;55(4):1151–5. doi: 10.1007/s00125-012-2452-1 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref035] 35.Hidmark A, Fleming T, Vittas S, Mendler M, Deshpande D, Groener J, et al. A New Paradigm to Understand and Treat Diabetic Neuropathy. Exp Clin Endocrinol Diabetes. 2014. Mar 12;122(04):201–7. doi: 10.1055/s-0034-1367023 [DOI] [PubMed] [Google Scholar]

[pone.0253840.ref036] 36.Tóth F, Frank N, Chameroy KA, Bostont RC. Effects of endotoxaemia and carbohydrate overload on glucose and insulin dynamics and the development of laminitis in horses. Equine Vet. J. 2009; 41(9):852–8. doi: 10.2746/042516409x479027 [DOI] [PubMed] [Google Scholar]

PERMALINK

Effect of sugar metabolite methylglyoxal on equine lamellar explants: An ex vivo model of laminitis

Cristina Vercelli

Massimiliano Tursi

Silvia Miretti

Gessica Giusto

Marco Gandini

Giovanni Re

Emanuela Valle

Roles

Abstract

Introduction

Materials and methods

Animals

Sample collection

Hoof explant preparation

Fig 1. Timeline.

Ex vivo tissue survival conditions–preliminary assay

Ex vivo tissue survival conditions

Experimental design

Separation force test

Fig 2. Separation force test.

Histology

RNA extraction and cDNA synthesis

Quantitative assessment of MMP gene expression

Table 1. Genes subjected to quantitative PCR (q-PCR) analysis.

Statistical analysis

Results

Preliminary assay

Fig 3.

Macroscopic evaluation

Separation force test

Table 2. Results of separation force test.

Fig 4. Distribution of the separation force data.

Histology

Fig 5. Distribution of the histological score data.

Expression of MMP-2, MMP-14 and TIMP-2 mRNA in digital lamellar specimens

Fig 6. Effect of MG treatment upon MMP-2 gene expression.

Fig 8. Effect of MG treatment upon TIMP-2 gene expression.

Fig 7. Effect of MG treatment upon MMP-14 gene expression.

Discussion

Conclusions

Supporting information

Acknowledgments

Data Availability

Funding Statement

References

Decision Letter 0

Jamie Males

Roles

Author response to Decision Letter 0

Decision Letter 1

Kanhaiya Singh

Roles

Author response to Decision Letter 1

Decision Letter 2

Kanhaiya Singh

Roles

Acceptance letter

Kanhaiya Singh

Roles

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases