Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2021 May 18;65(6):e00130-21. doi: 10.1128/AAC.00130-21

Molecular Epidemiology of Third-Generation-Cephalosporin-Resistant Enterobacteriaceae in Southeast Queensland, Australia

A G Stewart a,b, E P Price c,d, K Schabacker c,d, M Birikmen c,d, P N A Harris b,e, K Choong a, S Subedi a,f, D S Sarovich c,d,✉
PMCID: PMC8315908  PMID: 33781999

ABSTRACT

Third-generation cephalosporin-resistant (3GC-R) Enterobacteriaceae represent a major threat to human health. Here, we captured 288 3GC-R Enterobacteriaceae clinical isolates from 264 patients presenting at a regional Australian hospital over a 14-month period. In addition to routine mass spectrometry and antibiotic sensitivity testing, isolates were examined using rapid (∼40-min) real-time PCR assays targeting the most common extended-spectrum β-lactamases (ESBLs; blaCTX-M-1 and blaCTX-M-9 groups, plus blaTEM, blaSHV, and an internal 16S rRNA gene control). AmpC CMY β-lactamase (blaCMY) prevalence was also examined. Escherichia coli (80.2%) and Klebsiella pneumoniae (17.0%) were dominant, with Klebsiella oxytoca, Klebsiella aerogenes, and Enterobacter cloacae infrequently identified. Ceftriaxone and cefoxitin resistance were identified in 97.0% and 24.5% of E. coli and K. pneumoniae isolates, respectively. Consistent with global findings in Enterobacteriaceae, most (98.3%) isolates harbored at least one β-lactamase gene, with 144 (50%) harboring blaCTX-M-1 group, 92 (31.9%) harboring blaCTX-M-9 group, 48 (16.7%) harboring blaSHV, 133 (46.2%) harboring blaTEM, and 34 (11.8%) harboring blaCMY genes. A subset of isolates (n = 98) were subjected to whole-genome sequencing (WGS) to identify the presence of cryptic resistance determinants and to verify genotyping accuracy. WGS of β-lactamase-negative or carbapenem-resistant isolates identified uncommon ESBL and carbapenemase genes, including blaNDM and blaIMP, and confirmed all PCR-positive genotypes. We demonstrate that our PCR assays enable the rapid and cost-effective identification of ESBLs in the hospital setting, which has important infection control and therapeutic implications.

KEYWORDS: antibiotic, antimicrobial, resistance, cephalosporin, ESBL, whole-genome sequencing, real-time PCR, Enterobacteriaceae, diagnostics

INTRODUCTION

Third-generation cephalosporin-resistant (3GC-R) members of the Enterobacteriaceae represent a significant threat to human health due to their ability to rapidly transmit antimicrobial resistance (AMR) determinants within and among bacterial populations (1). Both infection and colonization with these globally disseminated organisms are associated with poor clinical outcomes and death (2). 3GC-R Enterobacteriaceae prevalence rates vary considerably among hospitals and countries, with particularly high rates in India, Asia, and the Middle East (3). Australia has historically observed a relatively low frequency of 3GC-R Enterobacteriaceae. However, this pattern may be changing, with an extended-spectrum β-lactamase (ESBL) phenotype detected in 13.3% of Escherichia coli isolates and 9.8% of Klebsiella pneumoniae isolates in blood culture in 2018 (4), up from 2013 rates of 7.6% and 6.3%, respectively. Moreover, ceftriaxone resistance was seen in 13.4% of E. coli isolates and 9.4% of K. pneumoniae isolates, with 86.3% and 82.6% containing CTX-M-type ESBL genes, respectively (4).

AMR in 3GC-R Enterobacteriaceae is generally conferred by the presence of an ESBL or the overexpression of a chromosomal or plasmid-borne AmpC β-lactamase gene (5). CTX-M-type ESBLs are currently the most common AMR determinants found in 3GC-R Enterobacteriaceae isolated in Australian hospitals, with blaCTX-M-1 and blaCTX-M-9 groups collectively comprising 86.2% of identified CTX-M-type enzymes (4). Detection of ESBL subtypes is not standard clinical practice; instead, their presence is typically inferred from antimicrobial susceptibility patterns and phenotypic confirmatory tests, which are laborious, costly (∼$AUD25/isolate), and time-consuming (>24 h) to perform (6). Use of molecular-based diagnostics for AMR determinant detection in the clinical setting would improve patient outcomes by enabling more rapid, directed, and personalized treatment strategies, thereby improving antibiotic stewardship measures and reducing AMR burden. Their utility has already been demonstrated in a number of clinical settings, including for bloodstream infections, pneumonia, and infection control screening (7–9).

In the current study, we prospectively collected all 3GC-R Enterobacteriaceae identified over a 14-month period at the Sunshine Coast University Hospital, Queensland, Australia, a 450-bed, regional teaching and tertiary hospital. Using large-scale comparative genomics, we developed a novel quadriplex and two singleplex real-time PCR assays to rapidly detect the most commonly identified β-lactamase (including ESBL) genes in 3GC-R Enterobacteriaceae. In association with whole-genome sequencing (WGS), we used our diagnostic real-time assays to determine the molecular epidemiology of the β-lactamase genes in our isolate set and compared their performance with both genotypic and phenotypic typing methods to validate assay accuracy, sensitivity, and specificity. Finally, we examined the population structure of our 3GC-R Enterobacteriaceae population to identify potential cases of nosocomial spread or outbreak clusters.

RESULTS AND DISCUSSION

ESBL enzymes have established themselves as major contributors of AMR in Gram-negative bacteria and are increasing in prevalence, particularly in the community setting. Over 14 months, we collected a total of 288 isolates from all diagnosed cases of 3GC-R Enterobacteriaceae in a regional hospital in Southeast Queensland, Australia. Our patient cohort was predominantly female (64.0%) and aged over 65 years (60.9%). Specimens from intensive care unit (ICU) patients comprised 54 (18.8%) of the total collection and were obtained from 48 ICU patients over a 12-month period. Five ICU patients had multiple isolates collected over the course of their stay in the ICU. Single species with identical AMR profiles were isolated from three patients, and multiple species were isolated from two patients, one with identical AMR profiles and one with differing profiles (see Table S1 in the supplemental material). E. coli and K. pneumoniae were dominant, comprising 80.2% and 17.0% 3GC-R strains, respectively (Table 1 and Table S1). The remaining isolates were identified as Enterobacter cloacae (1.4%; n = 4), Klebsiella oxytoca (1.0%; n = 3), and Klebsiella aerogenes (0.3%; n = 1). Resistance to ceftriaxone, ceftazidime, or cefepime was common and observed in 96.2%, 93.4%, and 86.8% of isolates, respectively. In contrast, cefoxitin resistance was noted in only 81 (28.1%) isolates (Table 1). Meropenem resistance was rare, with only six resistant strains (2.1%) identified. The double disc diffusion method for ESBL phenotypic testing was negative in 32 (11.1%) isolates, indicating a lack of β-lactamase inhibition in the presence of clavulanic acid. The remaining 256 (88.9%) isolates were positive for this phenotypic test.

TABLE 1.

Summary of antimicrobial resistance mechanisms among 288 clinical Enterobacteriaceae isolatesa

Resistance mechanism No. (%) of isolates
E. coli (n = 231) K. pneumoniae (n = 49) K. aerogenes (n = 1) K. oxytoca (n = 3) E. cloacae (n = 4)
Phenotypic antimicrobial resistanceb
    Ceftriaxone 223 (96.5) 46 (93.9) 1 (100) 3 (100) 4 (100)
    Ceftazidime 215 (93.1) 47 (95.9) 1 (100) 2 (66.7) 4 (100)
    Cefepime 201 (87.0) 43 (87.8) 1 (100) 2 (66.7) 3 (75.0)
    Cefoxitin 64 (27.7) 12 (24.5) 1 (100) 0 (0) 4 (100)
    Piperacillin-tazobactam 65 (28.1) 31 (63.3) 1 (100) 3 (100) 4 (100)
    Ticarcillin-clavulanate 186 (80.5) 46 (93. 9) 0 (0) 3 (100) 3 (75.0)
    Meropenem 3 (1.3) 2 (4.1) 0 (0) 0 (0) 3 (75.0)
ESBL phenotypic testc
    Positive 204 (88.3) 46 (93.9) 0 (0) 2 (66.7) 4 (100)
    Negative 27 (11.7) 3 (6.1) 1 (100) 1 (33.3) 0 (0)
ESBL and ampC gene prevalence
    blaCTX-M-1 104 (45.0) 36 (73.5) 0 (0) 2 (66.7) 2 (50.0)
    blaCTX-M-9 89 (38.5) 4 (8.2) 0 (0) 0 (0) 0 (0)
    blaSHV 9 (3.9) 38 (77.6) 0 (0) 0 (0) 1 (25.0)
    blaTEM 93 (40.3) 33 (67.3) 0 (0) 2 (66.7) 2 (50.0)
    blaCMY 30 (13.0) 3 (6.1) 0 (0) 0 (0) 1 (25.0)
    PCR negatived 7 (3.0) 1 (4) 1 (100) 1 (33.3) 1 (25.0)
a

Isolates were retrieved from 264 patients admitted to a Southeast Queensland hospital over a 14-month period.

b

Antimicrobial susceptibility testing was performed by an automated method (Vitek 2), and EUCAST breakpoints were applied.

c

ESBL phenotypic testing was performed by the disc diffusion method.

d

DNA integrity was confirmed by 16S rRNA gene PCR (23), which forms part of the quadriplex assay. Three PCR-negative E. coli strains carried blaDHA-1, one E. cloacae carried blaACT-17, one K. oxytoca carried blaOXY-2-1, a second K. oxytoca (included as a mixture with K. pneumoniae) carried blaOXY-2-4, and 5 of 11 isolates had no β-lactamase genes identified despite whole-genome sequencing.

Redesign of current ESBL PCR assays to improve specificity and detection rates.

We next set out to identify the abundance of 3GC-R AMR determinants in our isolate collection by using real-time PCR. The rapid expansion of WGS data in recent years has enabled improvements to be made upon assays designed in the pre-WGS era, which risk being either nonspecific or intolerant to sequence diversity within enzyme families. Given a sufficiently large and diverse data set, sequence diversity can result in a nontrivial proportion of false-negative calls, skewing epidemiological observations. Examination of previously published ESBL assays (10) identified several mismatches in primer/probe pairs, with the mismatches especially problematic for the CTX-M enzymes. To overcome probable issues with false-negative results using existing assays, we exploited the extensive volume of publicly available sequence data to identify conserved sequence regions suitable for assay design. Our redesigned assays target the genes encoding the most common ESBLs (CTX-M group 1, CTX-M group 9), along with SHV and TEM β-lactamases, which can evolve to become ESBLs through mutations in their active sites or contribute to clinically relevant AMR due to increased expression. Our redesigned assays thus represent a considerable improvement over the accuracy of existing ESBL assays by avoiding or accommodating sequence mismatches at primer- and probe-binding sites.

ESBL and β-lactamase assay performance.

Preliminary validation of our singleplex (blaTEM, blaCMY) and quadriplex (blaCTX-M-1 group, blaCTX-M-9 group, blaSHV, 16S rRNA gene) PCR assays was performed to determine their accuracy and specificity. Following in silico verification, assays were tested on 12 previously characterized control strains (Table S2) (11) that represented a range of Enterobacteriaceae containing the gene targets of interest. All expected targets were identified in this control data set; no false positives or false negatives were detected, although both the blaTEM and 16S rRNA gene assays yielded late (>30 cycles) amplification in no-template control wells (Fig. 1). This result was expected due to the presence of residual E. coli DNA in the recombinant SsoAdvanced Taq polymerase, which carries both blaTEM and 16S rRNA genes.

FIG 1.

FIG 1

Singleplex and quadriplex PCR performance on third-generation cephalosporin-resistant Enterobacteriaceae. 1, Enterobacter cloacae SCHI0016.S.104 containing CMY; 2, Escherichia coli SCHI0016.S.205 containing TEM; 3A, E. coli SCHI0016.S.187 positive for CTX-M group 1; 3B, E. coli SCHI0016.S.60 positive for both CTX-M groups 1 and 9; 3C, E. coli SCHI0046.S.46; 3D, E. coli with only 16s rRNA gene amplification with no CTX-M or SHV detected. Note that both 16S rRNA gene and TEM assays have late amplification in the no-template controls (NTC) due to low levels of recombinant E. coli DNA present in the SsoAdvanced Taq polymerase.

We found that all genotypes could be accurately determined for the control strains by directly inoculating PCR wells with a very small amount of bacterial culture, thereby obviating the need for DNA extraction and leading to a faster time to diagnosis. However, this technique requires skill to ensure that the PCR is not inhibited by excess DNA and cellular constituents and can lead to greater PCR failures if not performed correctly. In addition, we recommend using a 10-μl rather than a 5-μl total PCR volume, as, in our hands, the smaller reaction volume led to a greater failure rate. Inclusion of the 16S rRNA gene assay enables true negatives to be differentiated from PCR failures. This method provides an attractive option where rapid diagnosis is paramount or where DNA extraction is not feasible.

Next, we screened our PCR assays across a diversity panel of non-Enterobacteriaceae human pathogens or colonizers (n = 48 strains). Our assays showed 100% sensitivity and specificity for all targets, with no amplification detected in these isolates, except for the 16S target in bacterial strains; as with the control data set, the blaTEM PCR was inhibited by the presence of non-blaTEM-harboring DNA and therefore did not amplify in any diversity panel strains.

LoQ and LoD determination of the ESBL and β-lactamase assays.

Using serial dilutions of previously characterized DNA samples ranging from 40 ng to 0.4 fg, the limit of quantitation (LoQ) values for each assay were identified (Fig. 2) as follows: blaCMY, 400 fg (∼73 genome equivalents [GEs]); blaTEM, 400 fg (∼65 GEs); 16S rRNA gene, 40 fg (∼3 GEs); blaCTX-M-1 group, 4 pg (∼344 GEs); blaCTX-M-9 group, 4 pg (∼344 GEs); and blaSHV, 4 pg (∼344 GEs). Limit of detection (LoD) values for each assay were as follows: blaCMY, 4 fg (∼7 GEs); blaCTX-M-1 group, 4 pg (∼344 GEs); blaCTX-M-9 group, 400 fg (∼34 GEs); and blaSHV, 400 fg (∼34 GEs). Due to low levels of recombinant E. coli DNA present in the SsoAdvanced Taq polymerase, which results in late amplification in no-template control wells, LoD values for the blaTEM and 16S rRNA gene assays could not be determined. As expected, these results indicate inferior performance of the quadriplex assay in comparison with the singleplex assays. Although not examined in this study, increased LoQ and LoD values may be achieved for the blaCTX-M-1 group, blaCTX-M-9 group, and blaSHV assays by omitting the 16 rRNA gene assay or by running these assays in singleplex format. Although we have defined the limits of our assays by using pure bacterial templates, it remains to be determined what detection limits would be achieved from clinical specimens.

FIG 2.

FIG 2

Limits of detection (LoD) and quantitation (LoQ) for the extended-spectrum β-lactamase real-time PCR assays developed in this study. The blaCMY and blaTEM assays were examined as singleplex PCRs, whereas the 16S rRNA gene, blaCTX-M-1 group, blaCTX-M-9 group, and blaSHV assays were examined in quadriplex format. RFU, relative fluorescence units.

ESBL and β-lactamase prevalence in clinical 3GC-R Enterobacteriaceae isolates.

Following specificity confirmation, the PCR assays were tested across our clinical set (n = 288). All assays performed well, with 100% concordance between PCR genotypes and WGS of 98 isolates and with no false negatives identified (Table S3). Overall, a β-lactamase genotype was identified in 277 (96.2%) isolates. Consistent with previously reported rates (11), the blaCTX-M-1 group was most common, being identified in 144/288 (50%) isolates, including 105/231 (45.5%) E. coli and 36/49 (73.5%) K. pneumoniae isolates. The blaCTX-M-9 group was next most frequent, being found in 93/288 (32.3%) isolates, including 89/231 (38.5%) E. coli and 4/49 (8.2%) K. pneumoniae isolates. The presence of both blaCTX-M-1 group and blaCTX-M-9 group enzymes was identified in five (1.7%) E. coli isolates and one (2.0%) K. pneumoniae isolate. Of the eight isolates belonging to other species, blaCTX-M-1 and blaCTX-M-9 group genes were present in 4/8 (50%) and 0/8 (0%) of these isolates, respectively. The acquired ampC gene, blaCMY, was identified in 30/231 (13%) E. coli isolates, 3/49 (6.1%) K. pneumoniae isolates, and 1/8 (13%) isolates of other Enterobacteriaceae species. blaCMY and blaCTX-M-1 were both identified in seven isolates (five E. coli, one K. pneumoniae, and one E. cloacae isolate), and blaCMY and blaCTX-M-9 were present in two E. coli isolates only (Table 1).

Seven strains (five E. coli and two K. pneumoniae strains) had blaSHV only; nine E. coli strains had blaTEM only, and seven (five K. pneumoniae, one E. coli, and one E. cloacae strain) had both blaSHV and blaTEM. Although most SHV (e.g., blaSHV-1) and TEM (e.g., blaTEM-1, blaTEM-2) enzymes do not typically cause 3GC-R, their presence in strains that lack CTX-M-type ESBLs should be investigated, as these enzymes can occasionally confer 3GC-R through enzyme active-site mutation or gene overexpression (5). Of the 14 strains carrying blaSHV but not blaCTX-M-1 group, blaCTX-M-9 group, or blaCMY enzymes, five had accompanying WGS data, which permitted assessment of blaSHV ESBL status. In all cases, the blaSHV enzyme variant was an ESBL (two blaSHV-2, one blaSHV-64, one blaSHV-66, and one blaSHV-134) (12). In contrast, none of the four strains carrying blaTEM only were ESBLs, with all four strains carrying blaTEM-1. Three of these were negative by the double disc diffusion method, indicating probable chromosomal mutations underpinning this phenotype. The basis for the ESBL phenotype in the fourth strain could not be elucidated.

Correlation between blaCMY and cefoxitin resistance.

Of the 81 cefoxitin-resistant isolates, blaCMY was detected in only 31 (38.3%) cases. Although imperfect, cefoxitin resistance is often used as a marker for AmpC presence (13). Correlation is also dependent on the MIC, with higher MICs more reliably predicting AmpC presence (13). Our findings concur with this prior work, with 61.7% of cefoxitin-resistant isolates failing to amplify blaCMY. AmpC has previously been reported as an underappreciated mechanism of 3GC-R due to a lack of standardized testing (14). As such, molecular methods that can detect other common and emerging β-lactamase gene families (e.g., blaDHA, blaOXY, blaMIR) may prove useful for infection control management and treatment of multidrug-resistant infections. This is particularly true for piperacillin-tazobactam, which may not be effective against AmpC producers (11, 15).

WGS identifies uncommon ESBL genes.

Eleven (3.8%) PCR-negative isolates that otherwise successfully amplified their 16S rRNA gene internal control (seven E. coli, one K. pneumoniae, one K. oxytoca, one K. aerogenes, and one E. cloacae isolate) were subjected to WGS to determine the molecular basis of 3GC-R. Six were found to carry uncommon β-lactamase enzyme genes, with three E. coli isolates carrying blaDHA-1, one K. pneumoniae/K. oxytoca mixture harboring blaOXY-2-4, one K. oxytoca carrying blaOXY-2-1, and one E. cloacae carrying blaACT-17. The remaining five isolates had no discernible 3GC-R determinants, although misclassification via automated susceptibility testing or upregulation of chromosomal β-lactamases are both possible causes for this discrepancy.

Six isolates (three E. cloacae, two E. coli, and one K. pneumoniae) exhibiting meropenem resistance alongside 3GC-R were also subjected to WGS to determine the basis of resistance toward this carbapenem. As expected, meropenem resistance was mostly conferred by carbapenemases, with 4/6 (66.6%) isolates possessing one of these enzymes. blaNDM-1 or blaIMP-4 was identified in two E. cloacae isolates, blaNDM-5 was identified in an E. coli strain, and a gene encoding an OXA-48-like enzyme, blaOXA-232, was identified in a K. pneumoniae isolate. No carbapenemase gene could be identified in the remaining two isolates (one E. coli and one E. cloacae isolate). Although not investigated in this study, chromosomally encoded porin loss or efflux pump overexpression may form the basis of meropenem resistance in these strains.

Monitoring patient-to-patient spread in an ICU.

Fifty-four (18.8%) 3GC-R isolates obtained during this study originated from intensive care unit (ICU)-admitted patients. Due to their dominance, only E. coli and K. pneumoniae genomes were analyzed for potential transmission events. Among the E. coli population (Fig. 3), isolates SCHI0016.S.60 and SCHI0016.S.62 and isolates SCHI0016.S.265 and SCHI0016.S.46 were separated by 10 single nucleotide polymorphisms (SNPs) and 2 SNPs, respectively; however, both pairs came from individual patients, reflecting expected levels of within-host evolution of a single infecting strain. E. coli isolates SCHI0016.S.42 and SCHI0016.S.294 were very similar, being separated by 13 SNPs. Although both strains were isolated from ICU-admitted patients, SCHI0016.S.294 was isolated 306 days after SCHI0016.S.42, with no other linking epidemiology identified. Additionally, no similar strains were isolated from ICU patients over this time period, suggesting that these do not represent transmission. E. coli isolates SCHI0016.S.172 and SCHI0016.S.274 differed by ∼300 SNPs, with no epidemiological or temporal correlation. Approximately 300 SNPs separated SCHI0016.S.112 and SCHI0016.S.229, again with no demonstrable epidemiological link. Among K. pneumoniae isolates (Fig. 4), the closest isolates, SCHI0016.S.15 and SCHI0016.S.261, differed by 361 SNPs, with no epidemiological link. Additionally, no horizontal transfer of plasmids carrying ESBL determinants was observed. As standard practice, all ICU patients, and all patients in other wards infected or colonized with ESBL-producing E. coli and K. pneumoniae, have single rooms with an assigned nurse (1:1 ratio), with contact precautions exercised. In addition, hand hygiene rates in our hospital ICU are generally above 80% (16). Taken together, our results demonstrate no evidence of transmission in the ICU, suggesting that the implemented hygiene measures are effective.

FIG 3.

FIG 3

Whole-genome phylogeny of 79 third-generation cephalosporin-resistant Escherichia coli isolates and their β-lactamase gene complement. Sequence type 131 (ST131) is indicated by a gray-shaded box; strains isolated from ICU patients are highlighted in green.

FIG 4.

FIG 4

Whole-genome phylogeny and β-lactamase enzyme presence in Klebsiella pneumoniae. Green-shaded isolates were isolated from the ICU.

Population structure of E. coli and K. pneumoniae genomes.

We subjected an additional 36 strains to WGS (total n = 98) to capture a snapshot of genomic diversity and population structure (Fig. 3 and 4). In silico multilocus sequent typing (MLST) of the 79 E. coli strains found that ST131 was most common (n = 11; 13.9%). This finding is consistent with a recent study of the population structure of Australian, New Zealand, and Singaporean multidrug-resistant E. coli isolates (11). The highly successful ST131 clone has now spread worldwide, where it frequently causes urinary tract and bloodstream infections and accounts for 12 to 27% of all community-acquired E. coli infections (17, 18). Among our ST131 isolates, we found high frequencies of fluoroquinolone resistance-conferring variants (GyrAS83L, GyrAD87N, ParCS80I, and ParCE84V) alongside frequent carriage of plasmid-borne CTX-M-14 (CTX-M-9 group) and CTX-M-15 (CTX-M-1 group) ESBL genes. We also identified three strains belonging to the emerging multidrug-resistant pandemic clone ST1193. These isolates also possessed the same three fluoroquinolone-resistant SNPs as ST131. It has been proposed that ST1193 strains evolved fluoroquinolone resistance relatively recently through multiple recombination events with other E. coli strains (19).

Phylogenomic analysis of our 10 K. pneumoniae genomes identified several distinct lineages, which comprised two ST14 strains and one each of ST17, ST307, ST309, ST395, ST656, ST697, ST873, and ST969. Of note, the globally disseminated ST258 clone, which is responsible for a large number of hospital deaths (20), was not identified in our data set. However, we identified another globally disseminated clone, ST395, which has also been retrieved from clinical cases in Europe and Asia (21). Concerningly, this ST395 isolate, SCHI0016.S.137, carried both the ESBL genes blaSHV-11 and blaCTX-M-15 and the OXA-48-like carbapenemase gene blaOXA-232, the latter of which confers low-level meropenem resistance. Additionally, we observed one K. pneumoniae ST307, which is an emerging multidrug-resistant, globally disseminated clone postulated to have emerged in the mid-1990s (22). Although reports of this clone from Australian populations are uncommon, it has been previously observed (22).

This study had several recognized limitations. First, isolates were collected from a nosocomial setting; no community sources were sampled. It is well established that differences in AMR patterns and their associated molecular mechanisms exist between hospital and community settings. Second, the absence of certain high-risk populations within our hospital (e.g., solid organ or hematopoietic stem cell transplantation) limits the generalizability of our findings to other settings. Third, our PCR assays can identify only the presence or change in copy number of the most common ESBL and ampC genes. Although these loci make up the majority (>90%) of β-lactamase enzymes present in 3GC-R Enterobacteriaceae, they do not capture all potential ESBLs, leaving less common ESBL and ampC genes unidentified. In addition, our PCR assays for blaTEM or blaSHV cannot discriminate between ESBLs and non-ESBLs, with additional assays or concurrent WGS required to confirm ESBL status. Our assays also cannot detect chromosomal changes leading to AMR (e.g., porin mutations or efflux pump upregulation), making these assays less useful for 3GC-R bacteria that frequently encode these AMR determinants (e.g., Pseudomonas aeruginosa). Fourth, our PCR was unable to distinguish chromosomal versus low-copy-number plasmid-borne β-lactamase genes, which has implications for AMR transmissibility between and among bacterial populations. Finally, ∼40% of samples were obtained from rectal swabs, which have limitations for detection of multidrug-resistant organisms due to the high microbial burden coupled with difficulties in sample collection. It is therefore likely that we did not capture all 3GC-R isolates during our study period and thus may have missed potential transmission events.

Conclusions.

Taken together, our findings identified a predominance of CTX-M (and to a lesser extent, CMY) β-lactamases among 3GC-R Enterobacteriaceae in the Sunshine Coast region. These findings are consistent with global findings of Gram-negative bacterial AMR determinants, particularly among E. coli isolates. Our study demonstrates the likely absence of 3GC-R Enterobacteriaceae transmission in our ICU setting, indicating effective infection control processes. We show that rapid molecular assays, such as our multiplex PCR, can detect common β-lactamase genes from bacterial culture within 40 min. These early molecular results would permit more informed selection of antibiotic therapy up to 1 to 2 days prior to 3GC-R confirmation with traditional culture methodologies. Further research is required to determine whether these molecular assays can be used directly on clinical specimens and whether the implementation of molecular assays and more advanced technologies (e.g., WGS) is associated with improved patient outcomes in the hospital setting.

MATERIALS AND METHODS

Ethics.

This study was approved by The Prince Charles Hospital Human Resources Ethics Committee (HREC/18/QPCH/110). A waiver of informed consent was granted due to the low to negligible risk associated with this study.

Isolate collection.

Clinical specimens from 264 adult and pediatric patients (including ICU patients [n = 48]) that were culture positive for 3GC-R Enterobacteriaceae were collected prospectively from July 2017 through September 2018 at the Sunshine Coast University Hospital microbiology laboratory (n = 288). Multiple isolates were collected from 23 patients, due to either reinfection over the course of the study (n = 9) or multiple samples taken during initial admission (n = 11) or collected during the course of their hospital stay (n = 3). Samples were inoculated onto ChromID ESBL agar (bioMérieux) and ChromID Carba/OXA agar (bioMérieux) and examined for colored colonies at 18 to 24 h. An ESBL screening disc test was performed on isolates growing on ESBL agar. Species was determined by using the Vitek 2 matrix-assisted laser desorption ionization–time of flight mass spectrometer (MALDI-TOF MS) with the GN ID card (bioMérieux, Murrarie, QLD, Australia). Isolate information is detailed in Table S1 in the supplemental material.

Susceptibility testing.

Antibiotic susceptibility testing and MIC values were determined using Vitek 2 or Etest (bioMérieux) according to the manufacturer’s instructions. EUCAST criteria (v.10.0) were used for susceptibility and resistance interpretation.

Culture DNA preparation.

For PCR, crude DNA was extracted from all isolates using 5% Chelex-100 resin (Bio-Rad Laboratories, Gladesville, NSW, Australia). For a subset of samples (n = 50), a pinhead-sized amount of culture collected using a sterile 10-μl pipette tip was placed directly into 4 μl of PCR master mix to facilitate rapid turnaround time. For WGS, DNA was extracted using the Quick-DNA miniprep kit (Zymo Research, Irvine, CA, USA).

PCR development and β-lactamase detection.

A quadriplex real-time PCR assay was developed to detect the two major CTX-M ESBL groups (blaCTX-M-1 and blaCTX-M-9) and blaSHV (both ESBL and non-ESBL); a 16S rRNA gene probe-based assay (23) was included in this quadriplex assay to verify DNA integrity. Additionally, two singleplex assays were designed to amplify blaTEM (both ESBL and non-ESBL) and blaCMY β-lactamase genes (Fig. 1). Given the large number of mutations in blaTEM and blaSHV that can confer ESBL status, identification of blaTEM and blaSHV ESBL variants is impossible using a single real-time PCR assay. Therefore, our blaTEM and blaSHV assays were designed only to flag blaTEM- or blaSHV-harboring strains; secondary screening (e.g., WGS) is required for ESBL confirmation of blaTEM or blaSHV PCR-positive strains. To identify conserved regions for PCR assay design, all publicly available genetic sequences for blaCTX-M-1, blaCTX-M-9, blaCMY, blaSHV, and blaTEM were downloaded from the NCBI nucleotide database (as of March 2019) and aligned using Clustal Omega v1.2.2. Aligned sequences were visualized in Geneious v11.0.4. Candidate primers and probes were identified in Primer Express v3.0 (Applied Biosystems, Foster City, CA, USA) or Primer3 v0.4.0 (24), followed by primer dimer and heterodimer assessment using NetPrimer (Premier Biosoft, San Francisco, CA, USA).

Black hole quencher probes were used to enable multiplexing in a single PCR well and robust target identification. For the quadriplex assay, the following primers and probes (5′ to 3′) (Macrogen Inc., Geumcheon-gu, Seoul, Republic of Korea) were designed: blaCTX-M-1 (CTX1_F, CGAMACGTTCCGTCTCGAC; CTX1_R, CTTTCATCCAYGTCACCAGCTG; CTX1_P1, FAM-CGTGATACCACTTCACCTCGGG-BHQ1), blaCTX-M-9 (CTX9_F, CGTCSCGCTCATCGATACC; CTX9_R, CAGCTGCTTTTGCGTTTCACTC; CTX9_P1, HEX-CGCTTTCCAATGTGCAGTACC-BHQ1), and blaCTX-SHV (SHV_F, CCARCGTCTGAGCGCC; SHV_R, TATCGGCGATAAACCAGCCC; SHV_P1, Cy5-CAGCACGGAGCGGATCA-BHQ2). The previously described 16S assay (23) incorporated a different fluorophore on the probe (Texas Red-CACGAGCTGACGACARCCATGCA-BHQ2) to accommodate the quadriplex assay format. Two singleplex assays targeting blaTEM and blaCMY were also designed: TEM (TEM_F, TGTGGYGCGGTATTATCCCGT; TEM_R, TGCATAATTCTCTTACTGTCAWGCCA; TEM_P1, Cy5.5-CACCAGTCACAGAAAAGCATCT-BHQ2), CMY (CMY_F, TGGCGTATTGGYGATATGTA; CMY_R, TTATGCACCCATGAGGCTTT; CMY_Pr, FAM-TGGGAGATGCTGAACTGGCC-BHQ1). Coincidentally, the reverse primer sequence for our blaCMY assay was identical to one designed previously (25).

The quadriplex PCR was carried out using 0.1 μM 16S probe and primers, 0.2 μM blaCTX-M-1 and blaCTX-M-9 probes and primers, 0.3 μM blaSHV primers, and 0.4 μM blaSHV probe. For the blaTEM singleplex assay, 0.2 μM blaTEM primers and probe were used, and for the blaCMY singleplex assay, 0.2 μM primers and 0.4 μM probe were used. All reaction mixtures contained 1× SsoAdvanced universal probes supermix (Bio-Rad), primers, probe(s), 1 μl DNA template, and molecular grade H2O, to a 5-μl total volume. PCRs were performed on a CFX96 Touch real-time PCR detection system using white Hard Shell 96-well PCR plates and Microseal “C” adhesive seals (Bio-Rad) or 0.2-ml white 8-tube PCR strips and optical caps (Bio-Rad). For bacterial cultures, thermocycling conditions comprised an initial 2 min of denaturation at 95°C, followed by 45 cycles of 95°C for 1 s and 60°C for 3 s (total run time, 39 min).

LoD and LoQ determination.

Three previously characterized strains (26) that represent the PCR assays developed in this study, namely, MER85 (K. pneumoniae), MER110 (E. coli), and MER132 (E. coli), were subjected to total DNA extraction using the Gram-positive bacterial extraction protocol of the Qiagen DNeasy kit (Qiagen, Chadstone Centre, VIC, Australia). DNA quantities were measured on a Qubit 4 fluorimeter (Thermo Fisher Scientific, Seventeen Mile Rocks, QLD, Australia) using the Qubit double-stranded DNA (dsDNA) BR kit and normalized to 40 ng/μl in molecular grade H2O. LoD and LoQ values were determined across 1:10 serial dilutions (range, 40 ng to 0.4 fg) using MER85 (blaTEM singleplex), MER110 (blaCMY singleplex), and a 50:50 mix of MER85 (blaCTX-M-1 group, blaSHV) and MER132 (blaCTX-M-9 group) for the quadriplex assay. For PCR thermocycling, denaturation and annealing times were increased to 5 s and 10 s, respectively, to ensure assay robustness under very low DNA input conditions. Genome equivalents were calculated by assuming E. coli and K. pneumoniae genome sizes of 4.984 Mbp and 5.638 Mbp, respectively.

Assay specificity.

The quadriplex and singleplex assay amplicons were first assessed for specificity in silico by using the microbial nucleotide discontiguous BLAST tool and the complete genomes database (http://blast.ncbi.nlm.nih.gov/; performed March 2019). Next, assay specificity was examined by laboratory testing against a range of both pathogenic and nonpathogenic microbial species found in humans. This diversity panel comprised Achromobacter spp. (n = 4), Bordetella bronchiseptica (n = 1), Candida albicans (n = 1), Cupriavidus sp. (n = 2), Enterobacter aerogenes (n = 1), Enterobacter cloacae (n = 3), Enterococcus faecalis (n = 1), Klebsiella pneumoniae (n = 2), Klebsiella oxytoca (n = 1), Lactobacillus spp. (n = 2), Prevotella spp. (n = 6), Pseudomonas aeruginosa (n = 10), Staphylococcus aureus (n = 4), Staphylococcus epidermidis (n = 1), Stenotrophomonas maltophilia (n = 5), and Veillonella spp. (n = 4).

WGS.

Whole-genome sequencing (WGS) was performed at the Australian Centre of Ecogenomics (University of Queensland, St. Lucia, QLD, Australia) on a NextSeq 500 system (Illumina, San Diego, CA, USA) with Nextera DNA Flex libraries (Illumina).

Genomic analysis.

All genomic data were lightly quality filtered using Trimmomatic v0.39 (27) using parameters described elsewhere (28). WGS data were screened for multiple species by using Kraken 2 v2.0.8 (29). Single species were assembled using MGAP v1.1 (https://github.com/dsarov/MGAP---Microbial-Genome-Assembler-Pipeline), whereas WGS data containing multiple species were assembled with metaSPAdes (30). To determine plasmid copy number and identity, plasmids were assembled using the plasmid module of SPAdes (31), with plasmid homology determined using BLAST (32). Assemblies were binned with MaxBin v2.0 (33), and species determined with Kraken 2 v2.0.8 (29). Antibiotic resistance genes were identified using the Resistance Gene Identifier (34). Phylogenomic analysis was performed using SPANDx v3.2.1 (35). Samples identified as containing multiple strains according to the method described by Aziz and colleagues (36) were excluded from phylogenetic analysis (n = 7); samples able to be split into single species using MaxBin were included in phylogenetic analysis (n = 4). E. coli O157:H7 Sakai (NCBI Assembly ID ASM886v2) (37) or K. pneumoniae HS11286 (NCBI Assembly ID ASM24018v2) (38) were used as read mapping reference genomes for species-specific analyses. To achieve the highest possible resolution, error-corrected assemblies of strains with matching multilocus sequence types (STs) were used as reference genomes for transmission analyses. ST profiles were determined using SRST2 v0.2.0 (39). Phylogenetic trees were reconstructed using PAUP v4.4.7 (40) and visualized in iTOL v5.5 (41).

Data availability.

Raw sequence reads generated in this study are available in the NCBI Sequence Read Archive database under BioProject accession number PRJNA606985.

ACKNOWLEDGMENTS

This study was funded by the Wishlist Sunshine Coast Health Foundation (awarded to A.G.S., K.C., S.S., and D.S.S.). D.S.S. and E.P.P. were funded by Advance Queensland (grant no. AQRF13016-17RD2 and AQIRF0362018, respectively).

We thank Delaney Burnard (University of Queensland Centre for Clinical Research) and the Sunshine Coast University Hospital pathology laboratory for laboratory assistance and Rhys T. White (University of Queensland) for helpful feedback on the manuscript.

P.N.A.H. reports research grants from Shionogi, Sandoz, and MSD and speaker's fees from Pfizer, outside the submitted work. No conflicts are declared for remaining authors.

Footnotes

Supplemental material is available online only.

aac.00130-21-s000s1.xlsx (56.3KB, xlsx)

REFERENCES

  • 1.Gupta V, Ye G, Olesky M, Lawrence K, Murray J, Yu K. 2019. National prevalence estimates for resistant Enterobacteriaceae and Acinetobacter species in hospitalized patients in the United States. Int J Infect Dis 85:203–211. 10.1016/j.ijid.2019.06.017. [DOI] [PubMed] [Google Scholar]
  • 2.Biehl LM, Schmidt-Hieber M, Liss B, Cornely OA, Vehreschild MJ. 2016. Colonization and infection with extended spectrum beta-lactamase producing Enterobacteriaceae in high-risk patients—review of the literature from a clinical perspective. Crit Rev Microbiol 42:1–16. 10.3109/1040841X.2013.875515. [DOI] [PubMed] [Google Scholar]
  • 3.World Health Organization. 2014. Antimicrobial resistance—global report on surveillance 2014. https://apps.who.int/iris/bitstream/handle/10665/112642/9789241564748_eng.pdf;jsessionid=519244EE0EEF520027CE4098504150B4?sequence=1. Accessed 30 March 2020.
  • 4.Bell JM, Gottlieb T, Daley DA, Coombs GW. 2020. Australian group on antimicrobial resistance (AGAR) Australian Gram-negative sepsis outcome programme (GNSOP) annual report 2018. Commun Dis Intel (2018) 44. 10.33321/cdi.2020.44.79. [DOI] [PubMed] [Google Scholar]
  • 5.Paterson DL, Bonomo RA. 2005. Extended-spectrum beta-lactamases: a clinical update. Clin Microbiol Rev 18:657–686. 10.1128/CMR.18.4.657-686.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.National Institute for Health and Care Excellence. 2015. BD MAX enteric bacterial panel for identifying pathogens in contagious gastroenteritis. https://www.nice.org.uk/advice/mib32/chapter/Technology-overview. Accessed 14 February 2020.
  • 7.MacVane SH, Nolte FS. 2016. Benefits of adding a rapid PCR-based blood culture identification panel to an established antimicrobial stewardship program. J Clin Microbiol 54:2455–2463. 10.1128/JCM.00996-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Echavarria M, Marcone DN, Querci M, Seoane A, Ypas M, Videla C, O'Farrell C, Vidaurreta S, Ekstrom J, Carballal G. 2018. Clinical impact of rapid molecular detection of respiratory pathogens in patients with acute respiratory infection. J Clin Virol 108:90–95. 10.1016/j.jcv.2018.09.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Souverein D, Euser SM, van der Reijden WA, Herpers BL, Kluytmans J, Rossen JWA, Den Boer JW. 2017. Clinical sensitivity and specificity of the Check-Points Check-Direct ESBL Screen for BD MAX, a real-time PCR for direct ESBL detection from rectal swabs. J Antimicrob Chemother 72:2512–2518. 10.1093/jac/dkx189. [DOI] [PubMed] [Google Scholar]
  • 10.Birkett CI, Ludlam HA, Woodford N, Brown DFJ, Brown NM, Roberts MTM, Milner N, Curran MD. 2007. Real-time TaqMan PCR for rapid detection and typing of genes encoding CTX-M extended-spectrum beta-lactamases. J Med Microbiol 56:52–55. 10.1099/jmm.0.46909-0. [DOI] [PubMed] [Google Scholar]
  • 11.Harris PNA, Ben Zakour NL, Roberts LW, Wailan AM, Zowawi HM, Tambyah PA, Lye DC, Jureen R, Lee TH, Yin M, Izharuddin E, Looke D, Runnegar N, Rogers B, Bhally H, Crowe A, Schembri MA, Beatson SA, Paterson DL, Harris-Brown T, Lorenc P, McNamara J, Underwood N, Eisenmann J, Stewart J, Henderson A, Ali J, Chiang D, Hwa SS, Kang Y, Pei OS, Ying D, Holland U, Korman T,. MERINO Trial Investigators. 2018. Whole genome analysis of cephalosporin-resistant Escherichia coli from bloodstream infections in Australia, New Zealand and Singapore: high prevalence of CMY-2 producers and ST131 carrying blaCTX-M-15 and blaCTX-M-27. JAntimicrob Chemother 73:634–642. 10.1093/jac/dkx466. [DOI] [PubMed] [Google Scholar]
  • 12.Liakopoulos A, Mevius D, Ceccarelli D. 2016. A review of SHV extended-spectrum beta-lactamases: neglected yet ubiquitous. Front Microbiol 7:1374. 10.3389/fmicb.2016.01374. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Jacoby GA. 2009. AmpC beta-lactamases. Clin Microbiol Rev 22:161–182. 10.1128/CMR.00036-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Meini S, Tascini C, Cei M, Sozio E, Rossolini GM. 2019. AmpC beta-lactamase-producing Enterobacterales: what a clinician should know. Infection 47:363–375. 10.1007/s15010-019-01291-9. [DOI] [PubMed] [Google Scholar]
  • 15.Cheng L, Nelson BC, Mehta M, Seval N, Park S, Giddins MJ, Shi Q, Whittier S, Gomez-Simmonds A, Uhlemann AC. 2017. Piperacillin-tazobactam versus other antibacterial agents for treatment of bloodstream infections due to AmpC beta-lactamase-producing Enterobacteriaceae. Antimicrob Agents Chemother 61:e00276-17. 10.1128/AAC.00276-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Grayson ML, Stewardson AJ, Russo PL, Ryan KE, Olsen KL, Havers SM, Greig S, Cruickshank M, Hand Hygiene A,. the National Hand Hygiene I. 2018. Effects of the Australian National Hand Hygiene Initiative after 8 years on infection control practices, health-care worker education, and clinical outcomes: a longitudinal study. Lancet Infect Dis 18:1269–1277. 10.1016/S1473-3099(18)30491-2. [DOI] [PubMed] [Google Scholar]
  • 17.Giedraitienė A, Vitkauskienė A, Pavilonis A, Patamsytė V, Genel N, Decre D, Arlet G. 2017. Prevalence of O25b-ST131 clone among Escherichia coli strains producing CTX-M-15, CTX-M-14 and CTX-M-92 beta-lactamases. Infect Dis (Lond) 49:106–112. 10.1080/23744235.2016.1221531. [DOI] [PubMed] [Google Scholar]
  • 18.Nicolas-Chanoine MH, Bertrand X, Madec JY. 2014. Escherichia coli ST131, an intriguing clonal group. Clin Microbiol Rev 27:543–574. 10.1128/CMR.00125-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Tchesnokova V, Radey M, Chattopadhyay S, Larson L, Weaver JL, Kisiela D, Sokurenko EV. 2019. Pandemic fluoroquinolone resistant Escherichia coli clone ST1193 emerged via simultaneous homologous recombinations in 11 gene loci. Proc Natl Acad Sci U S A 116:14740–14748. 10.1073/pnas.1903002116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.David S, Reuter S, Harris SR, Glasner C, Feltwell T, Argimon S, Abudahab K, Goater R, Giani T, Errico G, Aspbury M, Sjunnebo S, Eu SWG, Group ES, Feil EJ, Rossolini GM, Aanensen DM, Grundmann H,. the EuSCAPE Working Group. 2019. Epidemic of carbapenem-resistant Klebsiella pneumoniae in Europe is driven by nosocomial spread. Nat Microbiol 4:1919–1929. 10.1038/s41564-019-0492-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lee CR, Lee JH, Park KS, Kim YB, Jeong BC, Lee SH. 2016. Global dissemination of carbapenemase-producing Klebsiella pneumoniae: epidemiology, genetic context, treatment options, and detection methods. Front Microbiol 7:895. 10.3389/fmicb.2016.00895. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Wyres KL, Hawkey J, Hetland MAK, Fostervold A, Wick RR, Judd LM, Hamidian M, Howden BP, Lohr IH, Holt KE. 2019. Emergence and rapid global dissemination of CTX-M-15-associated Klebsiella pneumoniae strain ST307. J Antimicrob Chemother 74:577–581. 10.1093/jac/dky492. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Yang S, Lin S, Kelen GD, Quinn TC, Dick JD, Gaydos CA, Rothman RE. 2002. Quantitative multiprobe PCR assay for simultaneous detection and identification to species level of bacterial pathogens. J Clin Microbiol 40:3449–3454. 10.1128/jcm.40.9.3449-3454.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. 2012. Primer3—new capabilities and interfaces. Nucleic Acids Res 40:e115. 10.1093/nar/gks596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Bae IK, Kang HK, Jang IH, Lee W, Kim K, Kim JO, Jeong SH, Lee K. 2015. Detection of carbapenemases in clinical Enterobacteriaceae isolates using the VITEK AST-N202 Card. Infect Chemother 47:167–174. 10.3947/ic.2015.47.3.167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Harris PNA, Tambyah PA, Lye DC, Mo Y, Lee TH, Yilmaz M, Alenazi TH, Arabi Y, Falcone M, Bassetti M, Righi E, Rogers BA, Kanj S, Bhally H, Iredell J, Mendelson M, Boyles TH, Looke D, Miyakis S, Walls G, Al Khamis M, Zikri A, Crowe A, Ingram P, Daneman N, Griffin P, Athan E, Lorenc P, Baker P, Roberts L, Beatson SA, Peleg AY, Harris-Brown T, Paterson DL,. MERINO Trial Investigators, Australasian Society for Infectious Disease Clinical Research Network (ASID-CRN). 2018. Effect of piperacillin-tazobactam vs meropenem on 30-day mortality for patients with E coli or Klebsiella pneumoniae bloodstream infection and ceftriaxone resistance: a randomized clinical trial. JAMA 320:984–994. 10.1001/jama.2018.12163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Bolger AM, Lohse M, Usadel B. 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30:2114–2120. 10.1093/bioinformatics/btu170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Price EP, Viberg LT, Kidd TJ, Bell SC, Currie BJ, Sarovich DS. 2018. Transcriptomic analysis of longitudinal Burkholderia pseudomallei infecting the cystic fibrosis lung. Microb Genom 4:e000194. 10.1099/mgen.0.000194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Wood DE, Lu J, Langmead B. 2019. Improved metagenomic analysis with Kraken 2. Genome Biol 20:257. 10.1186/s13059-019-1891-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Nurk S, Meleshko D, Korobeynikov A, Pevzner PA. 2017. metaSPAdes: a new versatile metagenomic assembler. Genome Res 27:824–834. 10.1101/gr.213959.116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Antipov D, Hartwick N, Shen M, Raiko M, Lapidus A, Pevzner PA. 2016. plasmidSPAdes: assembling plasmids from whole genome sequencing data. Bioinformatics 32:3380–3387. 10.1093/bioinformatics/btw493. [DOI] [PubMed] [Google Scholar]
  • 32.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. J Mol Biol 215:403–410. 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  • 33.Wu YW, Simmons BA, Singer SW. 2016. MaxBin 2.0: an automated binning algorithm to recover genomes from multiple metagenomic datasets. Bioinformatics 32:605–607. 10.1093/bioinformatics/btv638. [DOI] [PubMed] [Google Scholar]
  • 34.Jia B, Raphenya AR, Alcock B, Waglechner N, Guo P, Tsang KK, Lago BA, Dave BM, Pereira S, Sharma AN, Doshi S, Courtot M, Lo R, Williams LE, Frye JG, Elsayegh T, Sardar D, Westman EL, Pawlowski AC, Johnson TA, Brinkman FS, Wright GD, McArthur AG. 2017. CARD 2017: expansion and model-centric curation of the comprehensive antibiotic resistance database. Nucleic Acids Res 45:D566–D573. 10.1093/nar/gkw1004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sarovich DS, Price EP. 2014. SPANDx: a genomics pipeline for comparative analysis of large haploid whole genome re-sequencing datasets. BMC Res Notes 7:618. 10.1186/1756-0500-7-618. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Aziz A, Currie BJ, Mayo M, Sarovich DS, Price EP. 2020. Comparative genomics confirms a rare melioidosis human-to-human transmission event and reveals incorrect phylogenomic reconstruction due to polyclonality. Microb Genom 6:e000326. 10.1099/mgen.0.000326. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Hayashi T, Makino K, Ohnishi M, Kurokawa K, Ishii K, Yokoyama K, Han CG, Ohtsubo E, Nakayama K, Murata T, Tanaka M, Tobe T, Iida T, Takami H, Honda T, Sasakawa C, Ogasawara N, Yasunaga T, Kuhara S, Shiba T, Hattori M, Shinagawa H. 2001. Complete genome sequence of enterohemorrhagic Escherichia coli O157:H7 and genomic comparison with a laboratory strain K-12. DNA Res 8:11–22. 10.1093/dnares/8.1.11. [DOI] [PubMed] [Google Scholar]
  • 38.Liu P, Li P, Jiang X, Bi D, Xie Y, Tai C, Deng Z, Rajakumar K, Ou HY. 2012. Complete genome sequence of Klebsiella pneumoniae subsp. pneumoniae HS11286, a multidrug-resistant strain isolated from human sputum. J Bacteriol 194:1841–1842. 10.1128/JB.00043-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Inouye M, Dashnow H, Raven LA, Schultz MB, Pope BJ, Tomita T, Zobel J, Holt KE. 2014. SRST2: rapid genomic surveillance for public health and hospital microbiology labs. Genome Med 6:90. 10.1186/s13073-014-0090-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wilgenbusch JC, Swofford D. 2003. Inferring evolutionary trees with PAUP*. Curr Protoc Bioinformatics Chapter 6:Unit 6.4. 10.1002/0471250953.bi0604s00. [DOI] [PubMed] [Google Scholar]
  • 41.Letunic I, Bork P. 2019. Interactive Tree Of Life (iTOL) v4: recent updates and new developments. Nucleic Acids Res 47:W256–W259. 10.1093/nar/gkz239. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

Raw sequence reads generated in this study are available in the NCBI Sequence Read Archive database under BioProject accession number PRJNA606985.


Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES