ABSTRACT
Koi herpesvirus (KHV) is highly contagious and lethal to cyprinid fish, causing significant economic losses to the carp aquaculture industry, particularly to koi carp breeders. Vaccines delivered through intramuscular needle injection or gene gun are not suitable for mass vaccination of carp. So, the development of cost-effective oral vaccines that are easily applicable at a farm level is highly desirable. In this study, we utilized chitosan-alginate capsules as an oral delivery system for a live probiotic (Lactobacillus rhamnosus) vaccine, pYG-KHV-ORF81/LR CIQ249, expressing KHV ORF81 protein. The tolerance of the encapsulated recombinant Lactobacillus to various digestive environments and the ability of the probiotic strain to colonize the intestine of carp was tested. The immunogenicity and the protective efficacy of the encapsulated probiotic vaccine was evaluated by determining IgM levels, lymphocyte proliferation, expression of immune-related genes, and viral challenge to vaccinated fish. It was clear that the chitosan-alginate capsules protected the probiotic vaccine effectively against extreme digestive environments, and a significant level (P < 0.01) of antigen-specific IgM with KHV-neutralizing activity was detected, which provided a protection rate of ca. 85% for koi carp against KHV challenge. The strategy of using chitosan-alginate capsules to deliver probiotic vaccines is easily applicable for mass oral vaccination of fish.
IMPORTANCE An oral probiotic vaccine, pYG-KHV-ORF81/LR CIQ249, encapsulated by chitosan-alginate capsules as an oral delivery system was developed for koi carp against koi herpesvirus (KHV) infection. This encapsulated probiotic vaccine can be protected from various digestive environments and maintain effectively high viability, showing a good tolerance to digestive environments. This encapsulated probiotic vaccine has a good immunogenicity in koi carp via oral vaccination, and a significant level of antigen-specific IgM was effectively induced after oral vaccination, displaying effective KHV-neutralizing activity. This encapsulated probiotic vaccine can provide effective protection for koi carp against KHV challenge, which is handling-stress free for the fish, cost effective, and suitable for the mass oral vaccination of koi carp at a farm level, suggesting a promising vaccine strategy for fish.
KEYWORDS: koi herpesvirus (KHV), ORF81 protein, chitosan-alginate capsule, live probiotic vaccine, anti-KHV immune protection
INTRODUCTION
Koi herpesvirus (KHV), also known as cyprinid herpesvirus 3 (CyHV-3), is an emerging pathogenic agent of cyprinids (order Herpesvirales, family Alloherpesviridae, genus Cyprinivirus) (1–3). KHV has a linear, double-stranded DNA genome of approximately 295 kb, encoding 156 functional open reading frames (ORFs) (4), and causes fatal koi herpesvirus disease (KHVD) among members of the cyprinids, particularly, common carp and ornamental koi carp (Cyprinus carpio koi). Since the emergence of KHVD in the late 1990s (5), the disease has spread rapidly worldwide due to international fish trade (2, 5–12), resulting in enormous economic losses to the common carp and koi carp culture industry (5, 13–15).
Vaccination is generally considered to be the most effective method of protecting fish from viral infectious disease (16), and the development of different vaccine formulations against KHV infection has been rapid over the last few years. Among these vaccine candidates, inactivated KHV vaccines (17), live attenuated KHV vaccines (18–20), and live recombinant experimental vaccines (21–24) have all been reported to be efficient in providing anti-KHV immune protection under experimental conditions. Until now, the vaccine formulations mentioned above still exist in experimental stages. There has been no commercialized vaccine available for global use, mainly due to legislative restrictions concerning biosafety risks of reactivation or reversion to virulence (25, 26), while a live attenuated immersion vaccine is exceptive, which is commercialized and used exclusively in Israel (KV3; KoVax Ltd., Israel) (16, 18, 20). In recent years, DNA vaccines have been highlighted as being safe and effective inducers of protective immunity against KHV infection (26–30). However, for fish, vaccine administered by the intramuscular route is not practicable to the mass vaccination on a farm, due to the labor-intensive process, high costs, and handling stress that can provoke handling mortality in the vaccinated fish (31). Therefore, the development of cost-effective vaccines that are easily applicable at the farm level is an issue of growing importance.
Oral administration with natural and noninvasive factors is a conceptually simple approach to delivering vaccines in animals, particularly fish. Oral delivery can effectively mimic the natural feeding of the fish and can deliver the target antigens directly to the digestive tract (16). This can effectively induce antigen-specific mucosal immunity to prevent the virus from invading the mucosal tissues and can also induce antigen-specific immune responses in the systemic lymphoid tissues against virus when viral infections have gained entrance through the mucosa (32–35). The significant advantages of oral vaccination are stress-free handling, convenience, cost effectiveness, and easy application for mass vaccination (33, 35), making this the most desirable vaccination strategy for fish (33, 35–38). To this purpose, orally delivered antigens need to be protected from degradation as they pass through the stomach to the intestinal tract where immune responses are induced (32, 39). So, an effective delivery carrier is needed to deliver the antigen in an immunogenic and protected form to the targeted mucosa, where it triggers mucosal and systemic immune responses after oral administration.
Liposome has been used to deliver inactivated KHV to develop oral vaccine for the common carp. This provided a protective efficacy of 70% against KHV after oral vaccination (40). In recent years, the use of lactic acid bacteria as antigen delivery carriers represents a promising approach to the delivery of heterologous antigens for the development of oral vaccines, which has attracted much attention in the field (41–43), particularly, the use of probiotic Lactobacillus strains (44–54), which are well known for their beneficial effects on the health of humans and animals and can be used as safe carriers, with good tolerance to gastrointestinal conditions and the ability to colonize the intestinal tract (44, 47, 51). Several oral vaccines for fish that employ recombinant lactic acid bacteria against viral infections are in various experimental stages (33, 35, 55–57). However, although live probiotic vaccines show a certain tolerance to gastrointestinal conditions, considerable loss of viability during passage through the gastrointestinal tract inevitably reduces their efficacy. Many studies have reported that chitosan-alginate-based capsules can effectively offer bioactive molecules and probiotics good protection against various kinds of environmental stress (58–65), suggesting a potential solution for maintaining viability as high as possible (58, 64).
In this study, we explored the utilization of chitosan-alginate capsules as an oral delivery system for a live recombinant probiotic vaccine, pYG-KHV-ORF81/LR CIQ249, expressing KHV ORF81 protein by Lactobacillus rhamnosus, to develop a handling-stress free, cost-effective oral vaccine that is easily applicable to mass vaccination of fish against KHV at the farm level.
RESULTS AND DISCUSSION
Identification of fusion protein expressed by pYG-KHV-ORF81/LR CIQ249.
The genome of KHV is large; therefore, functional proteins that can be used as vaccine candidates should be identified. To date, immunogenicity has been functionally characterized for only a few KHV proteins. Of these, ORF81 protein is known to trigger the formation of neutralizing antibodies and provide effective protection for carp against KHV challenge (31, 33, 66). Therefore, the ORF81 protein was used to develop the anti-KHV probiotic vaccine. In this study, the gene encoding the ORF81 protein was amplified by PCR and subcloned into the expression plasmid pYG301, generating recombinant plasmid pYG-KHV-ORF81 (Fig. 1a). Next, pYG-KHV-ORF81 was electroporated into LR CIQ249 competent cells, generating the recombinant strain pYG-KHV-ORF81/LR CIQ249 (Fig. 1b). The protein of interest expressed by strain pYG-KHV-ORF81/LR CIQ249 was identified by Western blotting with anti-ORF81 and anti-anchor antibodies. As shown in Fig. 1c, the fusion protein (anchor-ORF81) expressed by the recombinant strain can be effectively recognized by the specific antiserum, while there was no specific immunoblotting band observed in LR CIQ249. In addition, we used an indirect immunofluorescence assay (IFA) to analyze the expression of the ORF81 protein, and significant green fluorescence was observed on the cell surface of the recombinant strain pYG-KHV-ORF81/LR CIQ249, but none was observed on the cell surface of pYG/LR CIQ249 (Fig. 1d). Our results clearly demonstrated that the ORF81 protein can be effectively expressed by the recombinant Lactobacillus pYG-KHV-ORF81/LR CIQ249 and displayed on its surface.
FIG 1.
(a) The gene encoding the KHV ORF81 protein was amplified by PCR and subcloned into the expression plasmid pYG301, generating the recombinant plasmid pYG-KHV-ORF81. (b) The recombinant plasmid pYG-KHV-ORF81 was electroporated into LR CIQ249 competent cells, generating the recombinant strain pYG-KHV-ORF81/LR CIQ249. (c) The expression of the protein of interest was identified by Western blotting with anti-anchor/anti-ORF81 antibodies, and the specific immunoblot band was observed in pYG-KHV-ORF81/LR CIQ249 but not in LR CIQ249. (d) The ORF81 protein was displayed on the cell surface of recombinant strain pYG-KHV-ORF81/LR CIQ249, detected by IFA.
Tolerance to digestive environments and colonization ability in the intestinal tract of koi carp of the encapsulated probiotic pYG-KHV-ORF81/LR CIQ249.
To promote fish feed intake, earthworm powder (smell attractant) and natural pigment red koji rice (color attractant) were used to prepare the chitosan-alginate capsule for probiotic vaccine (ca. 3.5 mm in diameter) containing an average of ∼5.2 × 1010 CFU/g of pYG-KHV-ORF81/LR CIQ249 (Fig. 2A). Live probiotic vaccines must be at an adequate viable dose to exert their effects after oral vaccination (64). In this study, we evaluated the tolerance of the encapsulated live probiotic vaccine to simulated digestive environments. Our results clearly demonstrate that the live probiotic vaccine entrapped by chitosan-alginate capsules is tolerant to harsh digestive environments, including a simulated gastric environment (pH 1.5) (Fig. 2B), simulated intestinal fluid environment (Fig. 2C), 0.5% bile salt (Fig. 2D), and a hypertonic environment (9% NaCl) (Fig. 2E). Although the viability of the live probiotic vaccine in the simulated gastric environment, in 0.5% bile salt, and in the hypertonic environment decreased from 10.2 log CFU/g to 8.3 log CFU/g, 9.8 log CFU/g to 7.2 log CFU/g, and 10.2 log CFU/g to 8.1 log CFU/g, respectively, an effectively high viability was maintained. This indicated that the limited impact of harsh digestive environments on the live probiotic vaccine pYG-KHV-ORF81/LR CIQ249 that was entrapped in chitosan-alginate capsules. Remarkably, the live probiotic vaccine pYG-KHV-ORF81/LR CIQ249 tended to grow well in simulated intestinal fluid.
FIG 2.
(A) Chitosan-alginate capsule probiotic vaccine, ca. 3.5 mm in diameter, containing ca. 5.2 × 1010 CFU/g of the live probiotic pYG-KHV-ORF81/LR CIQ249. The tolerance of the encapsulated live probiotic vaccine to the simulated digestive environments was evaluated, and results showed that the live probiotic vaccine pYG-KHV-ORF81/LR CIQ249 encapsulated by chitosan-alginate capsules displayed strong tolerance to the simulated gastric environment (pH 1.5) (B), intestinal fluid environment (C), 0.5% bile salt (D), and a hypertonic environment (9% NaCl) (E). (F) The colonization ability of cFDA-SE-labeled pYG-KHV-ORF81/LR CIQ249 in the intestinal tracts of koi carp was evaluated using flow cytometry.
The ability to colonize the intestinal tracts of animals is significantly important for live probiotic vaccines to exert their functions after oral vaccination (44, 51). We evaluated the colonization ability in the koi carp intestinal tracts of 5′-(and 6′)-carboxyfluorescein diacetate succinimidyl ester (cFDA-SE)-labeled pYG-KHV-ORF81/LR CIQ249 delivered by chitosan-alginate capsules by using flow cytometry. As shown in Fig. 2F, compared to the background fluorescence value (ca. 5%) of normal koi carp or koi carp administered chitosan-alginate capsules containing the unlabeled recombinant strain, the positive rate of the cFDA-SE-labeled recombinant Lactobacillus pYG-KHV-ORF81/LR CIQ249 (percentage of total population in 104) in the intestinal tracts of koi carp was ca. 85% on day 1 after oral administration. Some of the recombinant bacteria were lost, mainly due to harsh gastrointestinal environments and the digestion and metabolism of the fish. Although the occurrence of the cFDA-SE-labeled recombinant Lactobacillus showed a gradual decrease, the amount of labeled recombinant Lactobacillus that was detected by flow cytometry remained relatively high in the koi carp intestinal tracts on day 20 after oral administration, indicating good adhesion. To maintain high viability and increase the number of recombinant lactobacilli adhering to the koi carp intestinal tracts, an oral vaccination protocol was carried out three times per day, on three consecutive days.
Antigen-specific IgM levels in the vaccinated koi carp with the probiotic vaccine.
Until recently, three immunoglobulin classes in fish have been described, IgM, IgD, and IgT, in which IgM constitutes the main systemic immunoglobulin and was thought to be the only one responding to pathogens both in systemic and mucosal compartments (67–69). Therefore, as an oral probiotic vaccine for fish, it is expected to effectively induce specific IgM antibodies against viral infection. The vaccination and sampling protocol in this study is shown in Fig. 3A, and the antigen (ORF81)-specific IgM antibody levels in serum samples collected from the koi carp in each group were determined by enzyme-linked immunosorbent assay (ELISA) on days 0, 14, 28, 42, and 56 after the primary oral vaccination. The results showed that significant levels (P < 0.01) of the anti-ORF81 specific IgM antibody were induced in the koi carp vaccinated with the encapsulated probiotic vaccine from day 14 after the primary oral vaccination compared to that in koi carp given chitosan-alginate capsules containing just pYG/LR CIQ249 or phosphate-buffered saline (PBS) (Fig. 3B), indicating good immunogenicity of pYG-KHV-ORF81/LR CIQ249, which can effectively deliver the KHV ORF81 protein to induce anti-ORF81 immune responses in fish. However, there was no difference (P > 0.05) in the levels of antigen-specific IgM antibodies between control groups, before and after oral administration. This is the first proof of the protective efficacy of encapsulating the live probiotic vaccine for koi carp against KHV infection. We further tested the KHV-inhibiting ability of the antiserum obtained from the koi carp in each group on day 42 after the primary oral vaccination. As shown in Fig. 3C, the effective inhibition of the antiserum collected from the koi carp orally vaccinated with the encapsulated probiotic vaccine was at a 1:32 dilution, while the serum obtained from the pYG/LR CIQ249 group showed a small degree (<1:2) of inhibition, and no inhibition ability was detected in the PBS group. The KHV-neutralizing antibody titer of the serum obtained from the vaccinated koi carp with the encapsulated probiotic vaccine on day 42 after primary oral vaccination was 1:22 determined by the Reed-Muench method. Significantly, antigen-specific IgM with KHV-neutralizing activity would contribute to the host’s immune defense by inhibiting viral spread via systemic circulation.
FIG 3.
(A) Koi carp were used as an animal model to evaluate the immunogenicity of the encapsulated live probiotic vaccine, and the oral vaccination protocol and sampling times are shown in the panel. (B) Antigen (ORF81)-specific IgM levels in the serum of koi carp (n = 10) in each group detected by ELISA on days 0, 14, 28, 42, and 56 after the primary oral vaccination. Data are given as means ± standard errors [SEMs]. **, P < 0.01; ***, P < 0.001. (C) Inhibition of viral plaque formation by sera with 2-fold serial dilutions obtained from koi carp in each group on day 42 after primary oral vaccination. Data are given as means ± standard deviations (SDs) (n = 10).
Determination of lymphocyte proliferation.
In this work, in order to further determine lymphocyte proliferation in vitro, the splenocytes of koi carp collected from each group on day 42 after the primary vaccination were restimulated with the purified KHV ORF81 protein followed by detection using the thiazolyl blue tetrazolium bromide (MTT) assay. Results showed that the stimulation index (SI) values of the splenocytes stimulated by the ORF81 protein with a dose-dependent response in the pYG-KHV-ORF81/LR CIQ249 group were significantly higher than those in control groups, and there was lymphocyte proliferation observed in the pYG/LR CIQ249 group and PBS group, but no significant difference (P < 0.05) between them (Fig. 4A), indicating that when the antigen (ORF81)-sensitized splenocytes of koi carp orally vaccinated with the probiotic vaccine were restimulated with the purified KHV ORF81 protein again, the cells proliferated rapidly. Having confirmed a systemic antigen-specific IgM response was induced in vaccinated koi carp with the probiotic vaccine, we determined the number of total IgM-secreting cells and antigen-specific IgM-secreting cells in koi carp spleens using an enzyme-linked immunosorbent spot assay (ELISPOT) assay. The spleens of koi carp collected from each group on day 42 after the primary oral vaccination were used in this experiment. As shown in Fig. 4B, the number of total IgM-secreting cells in the probiotic vaccine group was significantly higher than that of the pYG/LR CIQ249 group (P < 0.05) or PBS group (P < 0.01), and the level of total IgM-secreting cells in the pYG/LR CIQ249 group was significantly higher than that in the PBS group (P < 0.05). Moreover, the level of antigen (ORF81)-specific IgM-secreting cells in the probiotic vaccine group was significantly higher than that in the control groups (P < 0.01) (Fig. 4C), while no difference (P > 0.05) was observed between the pYG/LR CIQ249 group and the PBS group. Additionally, we also used a fluorescence immunohistochemistry assay (FIA) to detect the proliferation of total and antigen-specific IgM-secreting B cells in the spleens of koi carp after oral vaccination. In this case, significantly higher numbers of total and antigen-specific IgM-secreting B cells were observed in the probiotic vaccine group than in control groups (Fig. 4D), which is consistent with the ELISPOT result. Based on the above-described results, our data clearly demonstrate that pYG-KHV-ORF81/LR CIQ249 can effectively promote the differentiation and proliferation of antigen-specific IgM-secreting cells, and strain LR CIQ249 used in this study can effectively promote the proliferation of nonspecific IgM-secreting cells, indicating good immunomodulatory activity. Many studies have also reported that Lactobacillus rhamnosus strains have good immunomodulatory effects (70–72). Thus, LR CIQ249 used in this study can serve as a promising candidate for use as an antigen delivery carrier to develop oral vaccines.
FIG 4.
(A) Lymphoproliferation response of splenocytes obtained from koi carp in each group after restimulation with the recombinant ORF81 protein detected by the MTT assay. Data are given as means ± SDs (n = 10). The numbers of total IgM-secreting cells (B) and antigen-specific IgM-secreting cells (C) in the spleens of vaccinated koi carp in each group were analyzed by the ELISPOT assay. Data are given as means ± SDs (n = 10). (D) A fluorescence immunohistochemistry assay was used to detect the proliferation of total and antigen-specific IgM-secreting B cells in the spleens of koi carp after oral vaccination. The lowercase letters (a versus b, and b versus c) indicate significant difference of P < 0.05; a versus c indicates a significant difference of P < 0.01.
Transcriptional response of immune-related genes in immunized koi carp.
The immune-related genes encoding tumor necrosis factor alpha (TNF-α), interleukin 1 beta (IL-1β), IL-6a, gamma interferon (IFN-γ), type I interferon (I-IFN), CD4, CD8α, major histocompatibility complex class II alpha (MHCIIα), and IgM in fish are mainly involved in host-nonspecific and -specific immunity against pathogenic microbial infections (26, 73). In this study, we analyzed the transcription levels of these genes in the spleens of koi carp from each group after oral vaccination. Our results showed that the expression levels of immune-related genes in the spleens of fish from the pYG-KHV-ORF81/LR CIQ249 group and the pYG/LR CIQ249 group displayed significant difference (P < 0.05 or P < 0.01) from those determined in the PBS group (Fig. 5). Of these, the levels of IL-1β, IFN-γ, CD4, CD8α, MHCIIα, and IgM genes in the fish of the encapsulated live probiotic vaccine group were significantly higher (P < 0.05) than those in the pYG/LR CIQ249 group. On the other hand, our data also indicate that strain LR CIQ249 used in this study has a potent immunomodulatory effect, which can effectively induce host-nonspecific immune responses.
FIG 5.
Transcriptional response of immune-related genes in the spleens of the koi carp in each group after oral vaccination. Total RNA was extracted from the spleens of the vaccinated koi carp obtained on day 42 after the primary oral vaccination, and the transcription levels of immune-related genes (encoding TNF-α, IL-1β, IL-6a, IFN-γ, I-IFN, CD4, CD8α, MHCIIα, and IgM) were determined by SYBR green I-based qRT-PCR using the β-actin gene as endogenous control. Data are given as means ± SDs (n = 10). The lowercase letters (a versus b, and b versus c) indicate significant difference of P < 0.05; a versus c indicates significant difference of P < 0.01.
Effects on serum biochemical parameters.
In fish, innate immunity is considered an important means to identify and remove foreign invaders from the body, in which lysozyme activity, superoxide dismutase (SOD) activity, and serum myeloperoxidase activity are important indexes to evaluate host-nonspecific immunity status (73). In this study, the changes in activity of serum myeloperoxidase, serum lysozyme, and SOD were determined to evaluate the effects of the encapsulated live probiotic vaccine on these three important innate immune parameters. Our results showed that serum lysozyme activity (Fig. 6A), SOD activity (Fig. 6B), and serum myeloperoxidase activity (Fig. 6C) in the pYG-KHV-ORF81/LR CIQ249 group and the pYG/LR CIQ249 group increased significantly (P < 0.05 or P < 0.01) compared to the activity of these enzymes detected in the PBS group, suggesting that the increased activity of these three important enzymes showed a higher immunological status of fish. However, there was no significant difference in levels (P > 0.05) of these three enzymes between the pYG-KHV-ORF81/LR CIQ249 group and the pYG/LR CIQ249 group. Based on the results, we can see that the KHV ORF81 protein had no effect on the activity of lysozyme, SOD, and serum myeloperoxidase, while strain LR CIQ249 itself promoted the activity of these important enzymes, further indicating that strain LR CIQ249 has a potent immunomodulatory function and can effectively promote host innate immunity. In addition, our data also further demonstrate that strain LR CIQ249 with good probiotic properties would be a promising candidate as an antigen delivery carrier to develop oral vaccines.
FIG 6.
Effects of the encapsulated live probiotic vaccine on nonspecific immune parameters: (A) serum lysozyme activity, (B) SOD activity, and (C) serum myeloperoxidase activity, determined after oral vaccination. Data are given as means ± SDs (n = 10). The lowercase letters (a versus b) indicate significant difference of P < 0.05; a versus c indicates significant difference of P < 0.01.
Anti-KHV protection for koi carp orally vaccinated with the encapsulated probiotic vaccine.
The breeding of koi carp as ornamental fish has become a popular hobby and exhibited competitively worldwide. However, KHV has become a major threat to the koi carp industry, resulting in enormous economic losses (5, 7, 9, 10, 15). Among the strategies to control the disease, vaccination is considered an effective way to prevent KHV infection. In particular, oral vaccine is the most desirable vaccination strategy for aquaculture (38). In this study, an encapsulated probiotic vaccine containing recombinant Lactobacillus pYG-KHV-ORF81/LR CIQ249 was developed and its immune protection for koi carp against KHV challenge was evaluated by recording the cumulative mortality during a 20-day monitoring period. Our data showed that the survival rate of koi carp orally vaccinated with the encapsulated live probiotic vaccine was approximately 85%, which was significantly higher (P < 0.01) than that of fish in the control groups (Fig. 7), suggesting that effective protection against KHV infection can be provided by the probiotic vaccine. After the 20-day monitoring period, kidney samples of all koi carp (dead and live) in each group were collected, and the viral load in kidney was determined using quantitative real-time PCR. Our results showed that the viral loads in surviving koi carp significantly decreased and that high levels were maintained in koi carp that died, particularly, in the pYG/LR CIQ249 group and the PBS group (Fig. 8).
FIG 7.

Survival rates of the vaccinated koi carp in each group after KHV challenge.
FIG 8.

Viral loads in kidney of each koi carp from each group determined by qPCR after challenge test. (A) CT values. (B) Log10 of copies of KHV DNA in kidney.
In conclusion, in order to effectively control KHV infection in koi carp, an oral probiotic vaccine, pYG-KHV-ORF81/LR CIQ249, encapsulated by chitosan-alginate capsules as an oral delivery system was developed in this study, and its immunogenicity and protective efficacy for koi carp against KHV challenge were evaluated. Our study clearly demonstrates that the chitosan-alginate capsules offer effective protection to the live probiotic vaccine in harsh digestive environments. A significant level of antigen-specific IgM antibody with KHV-neutralizing activity was induced by oral vaccination in this manner, providing effective anti-KHV protection for koi carp. This method is handling-stress free for the fish, cost effective, and suitable for the mass vaccination of koi carp, suggesting a promising anti-KHV vaccine strategy. A global overview of the immune protection of the encapsulated probiotic vaccine for koi carp against KHV infection via oral vaccination is given in Fig. 9. Moreover, in order to control KHVD, efficient disease management strategies are essential, including increased virus surveillance, biosecurity, and improved farm management. Our study also provides a reference for the development of oral vaccines against other fish diseases.
FIG 9.
Global overview of the immune protection of the encapsulated probiotic vaccine for koi carp against KHV infection via oral vaccination.
MATERIALS AND METHODS
Virus, lactic acid bacteria, plasmid, primers, and fish.
Koi herpesvirus (KHV) isolate CX729 was propagated in koi fin-1 (KF-1) cells at 20°C with 5% CO2, in minimum essential medium (MEM; BasalMedia, China) supplemented with 10% fetal bovine serum (FBS; Everygreen, China), and 1% l-glutamine (33). Lactobacillus rhamnosus strain CIQ249 (LR CIQ249) kept in our laboratory was cultured in de Man, Rogosa, and Sharpe (MRS) broth (Qingdao Hope Bio-Technology Co., Ltd., China) at 37°C. A surface-displayed expression plasmid system, pYG301, was used to construct a recombinant probiotic vaccine which harbors the major elements of a transcriptional enhancer, secretion signal peptide, cell wall anchor peptide, repA and repC replication, chloromycetin resistance (Cmr) determinant, and multiclonal insertion sites (33). Koi carp (Cyprinus carpio) (KHV free, ∼50 g each) obtained from local commercial ornamental fish markets were maintained in concrete ponds with recirculating fresh water at 25 ± 1°C. The koi carp were fed twice a day with a commercial particle diet. All animal experiments described comply with the National Guidelines for the Care and Use of Laboratory Animals (CNAS-CL06:2018) and were approved by the Committee on the Ethics of Animal Experiments of Northeast Agricultural University, China (2017NEAU07223). Details of the primers used in this study are listed in Table 1.
TABLE 1.
Primers used in this study
| Primer | Sequence (5′→3′) | Reference or accession no. |
|---|---|---|
| ORF81-F | CTCGAGATGGCAGTCACCAAAGCTCAa | 33 |
| ORF81-R | GGATCCGGTACCTCACCACATCTTGCb | |
| β-actin-F | ACCGAGAGAGGCTACAGCTTCAC | M24113.1 |
| β-actin-R | GAGGAGGAGGAGGCAGCAGTG | |
| CD4-F | CACGGTGGAGGTTCTGAAGGTTTC | DQ400124.1 |
| CD4-R | CGAGGTCGGAGCTATGTTGATGTC | |
| CD8α-F | CTGGTCGGAGGTTGTGGACTTTTC | NM_001040049.1 |
| CD8α-R | AGTGGCTGGTGGGCATTTTCG | |
| IgM-F | CCCAGAGCACAAAGAGGGTGAAAC | HM452128.1 |
| IgM-R | TCACAGGTTCATCATCAGCAAGCC | |
| IFN-γ-F | CACTTGTCAGGCGCTGTTGC | FJ695520.1 |
| IFN-γ-R | TTCTCCCTTCTTTATGCTCAGACTTCA | |
| IL-1β-F | CAACCTGTGTGCCTGGGAATCTC | AM932525.1 |
| IL-1β-R | TCAAGAGCAGTTTGGGCAAGGAAG | |
| IL-6a-F | ACGGTGCATTCGATCCTGTTCAAC | KC858890.1 |
| IL-6a-R | AGTCTGCGGGTCTCTTCGTGTC | |
| MHCII-α-F | AAGATGATGTGGTGCTGGGTGTTC | HQ380379.1 |
| MHCII-α-R | TCTGCGGTACTGGCTTAGACTCAC | |
| TNF-α-F | AGGTGATGGTGTCGAGGAGGAAG | AJ311800.2 |
| TNF-α-R | AGACTTGTTGAGCGTGAAGCAGAC | |
| I-IFN-F | CTAAGGTGGAGGACCAGGTGAGG | GQ168344.1 |
| I-IFN-R | TCCACTGTCGTTAGGTTCCATTGC | |
| qORF81-F | CGCTGAGCGATTCAAGATACTCG | 33 |
| qORF81-R | CCCCGATCAGGAAGAGGAAGATG |
XhoI site is underlined.
BamHI site is underlined.
Construction of recombinant strain pYG-KHV-ORF81/LR CIQ249.
KHV genomic DNA was obtained from KF-1 cell cultures, using the MiniBEST universal genomic DNA extraction kit (TaKaRa, China) according to the manufacturer’s instructions. Next, using the KHV DNA as a template, the gene encoding KHV ORF81 protein was amplified by PCR with the primers ORF81-F (containing a XhoI site) and ORF81-R (containing a BamHI site) (Table 1) and was then subcloned as an XhoI/BamHI fragment into the plasmid pYG301, generating pYG-KHV-ORF81. Subsequently, the recombinant plasmid pYG-KHV-ORF81 was electroporated into LR CIQ249 competent cells according to a previously described method (54, 74), generating the recombinant strain pYG-KHV-ORF81/LR CIQ249. Briefly, the strain LR CIQ249 (optical density at 600 nm [OD600] ≈ 0.3) was washed four times with ice-cold sucrose-magnesium chloride buffer to prepare competent cells. Then, a mixture of 50 ng recombinant plasmid pYG-KHV-ORF81 and 200 μl LR CIQ249 competent cells was transferred into a 0.2-cm precooled Gene Pulser cuvette, followed by a single electric pulse (2,500 V/cm; 25 μF) provided by a Gene Pulser (Bio-Rad, USA). After that, 900 μl of recovery medium (MRS broth plus 0.3 M sucrose) was added immediately to the mixture and incubated at 37°C for 3 h, followed by screening positive recombinant strain pYG-KHV-ORF81/LR CIQ249 on MRS agar medium containing chloromycetin (10 μg/ml).
Expression of ORF81 protein.
The strain pYG-KHV-ORF81/LR CIQ249 was grown in MRS broth supplemented with 2% xylose at 37°C for 16 h, followed by centrifugation. The cell pellets were lysed with 2× sodium dodecyl sulfate (SDS) and boiled for 10 min. After centrifugation, proteins in the lysates were separated by 12% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto a polyvinylidene fluoride (PVDF) membrane, followed by incubation with mouse anti-KHV-ORF81 serum (33) or anti-anchor serum (diluted at 1:500) as the primary antibody and horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (diluted at 1:2,000) (Abcam, USA) as the secondary antibody. After that, the immunoblot band was visualized using chemiluminescent substrate reagent (Thermo Fisher Scientific, USA). In addition, an indirect immunofluorescence assay (IFA) was carried out to identify the expression of the ORF81 protein from pYG-KHV-ORF81/LR CIQ249. Briefly, the strain was induced by xylose and washed three times with PBS, centrifuged, and incubated with mouse anti-KHV-ORF81 serum (1:500) and fluorescein isothiocyanate (FITC)-labeled goat anti-mouse IgG antibody (1:1,000) (Abcam, USA). After washing, the fluorescence signals on the surfaces of pYG-KHV-ORF81/LR CIQ249 cells were observed by laser confocal microscopy. The strain pYG/LR CIQ249 was used as a negative control.
Preparation of chitosan-alginate capsule probiotic vaccine.
Sodium alginate solution at 2.49% (wt/vol) was obtained by dissolving and passing the solution through a 0.22-μm membrane filter, and then chitosan was added to the sodium alginate solution to a final concentration of 0.96% (wt/vol). The recombinant strain pYG-KHV-ORF81/LR CIQ249 was cultured in MRS broth containing 2% xylose at 37°C for 16 h and then centrifuged and finely dispersed in the chitosan-alginate solution supplemented with earthworm powder and the natural pigment from red koji rice to a final concentration of ∼1011 CFU/ml. Next, the chitosan-alginate solution containing the recombinant strain pYG-KHV-ORF81/LR CIQ249 was added dropwise (2 drops per s) to a CaCl2 solution of 6.67% (wt/vol) to coagulate for 45 min. After rinsing with PBS buffer, the chitosan-alginate capsules containing the probiotic vaccine were dried and stored at 4°C until use. The live probiotic population (CFU/g) encapsulated by the chitosan-alginate capsules was quantified by the plate counting method following resuspension and homogenization in capsule-breaking solution.
Tolerance of the live encapsulated probiotic vaccine to digestive environments.
To test the protective efficacy of chitosan-alginate capsules for the live probiotic vaccine against various digestive environments, 1 g of the encapsulated probiotic vaccine sample was treated with methods previously described (44) as follows: (i) to test the tolerance to gastric juice, the sample was incubated in 10 ml of simulated gastric juice with pH 1.5, 2.5, 3.5, or 4.5 at 37°C for 2.5 h; (ii) to test the tolerance to intestinal fluids, the sample was incubated in 10 ml of simulated intestinal fluids at 37°C for 12 h; (iii) to test the tolerance to bile, the sample was incubated in 10 ml of MRS broth containing 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, or 0.5% bile (wt/vol) at 37°C for 5 h; (iv) to test the tolerance to a hypertonic environment, the sample was incubated in 10 ml of MRS broth containing 4%, 5%, 6%, 7%, 8%, or 9% NaCl (wt/vol) at 37°C for 5 h. In parallel, unencapsulated, live recombinant strain pYG-KHV-ORF81/LR CIQ249 was used as a control. Each test was performed three times, and the number of live bacteria was counted using the plate method.
Colonization of live pYG-KHV-ORF81/LR CIQ249 in the intestinal tracts of koi carp.
The ability of strain pYG-KHV-ORF81/LR CIQ249 to colonize the intestinal tracts of koi carp was tested as previously described (44), with some modifications. Briefly, the recombinant strain pYG-KHV-ORF81/LR CIQ249, at a final concentration of ∼1011 CFU/ml, was labeled with molecular probe 5′-(and 6′)-carboxyfluorescein diacetate succinimidyl ester (cFDA-SE; Sigma, USA), followed by preparation of the live encapsulated probiotic vaccine as described above. Routine feeding of fish was stopped for 1 day, and then koi carp (n = 40) were bait fed with the encapsulated probiotic vaccine labeled with cFDA-SE. After that, koi carp (n = 5) were randomly selected and sacrificed on days 1, 4, 7, 11, 15, 20, 25, and 30 after feeding. The intestinal tract of each koi carp was extracted and cut longitudinally, followed by rinsing with PBS to remove particular materials. Next, all microbes were dislodged from the intestinal mucosa with PBS, fixed with 0.75% formaldehyde (vol/vol), and analyzed by flow cytometry. In parallel, koi carp that were bait fed with chitosan-alginate capsules containing unlabeled probiotics or PBS (40 koi for each group) were used as negative controls.
Oral vaccination of the encapsulated live probiotic vaccine for koi carp.
To evaluate the immunogenicity in koi carp of the encapsulated live probiotic vaccine, oral vaccination for koi carp was carried out. Briefly, the koi carp vaccine group (n = 50) was bait fed with the encapsulated probiotic vaccine containing the recombinant pYG-KHV-ORF81/LR CIQ249; others (n = 50 each group) bait fed with the capsules containing pYG/LR CIQ249 or PBS were used as the control. The vaccination protocol was as follows: the first oral vaccination was performed on days 1, 2, and 3 (three times per day); oral booster vaccinations were performed on days 14 to 16 and 28 to 30. Before oral vaccination, routine feeding for koi carp was stopped on days 0, 13, and 27.
Determination of antigen-specific IgM levels induced by the encapsulated live probiotic vaccine in koi and its KHV-neutralizing ability.
On days 0, 14, 28, 42, and 56 after the primary oral vaccination, koi carp (n = 10) were randomly selected from each group to prepare serum samples, followed by determination of the antigen-specific IgM levels in the sera using ELISA. Briefly, a 96-well polystyrene plate was coated with KHV strain CX729 at 4°C for 12 h. After washing three times with PBS-0.1% Tween 20 (PBST), the ELISA plate was blocked with 5% skim milk (wt/vol) at 37°C for 2 h, followed by rewashing with PBST. Next, the serum samples (diluted at 1:10) as the primary antibody were added to the polystyrene plate and incubated at 37°C for 2 h. After washing with PBST, HRP-conjugated anti-koi carp IgM antibody diluted at 1:1,000 (Aquatic Diagnostics Ltd., England) was added to the plate as the secondary antibody and incubated at 37°C for 2 h, followed by washing with PBST. After that, using tetramethylbenzidine (Qiagen, Germany) as a colorimetric substrate, color was developed, followed by measurement of the absorbance at 490 nm. In addition, the KHV-neutralizing ability of antisera was determined as previously described (33), with some modifications. Briefly, 50 μl of serum obtained from each koi carp (n = 10 per group) was subjected to 2-fold serial dilution in a 96-cell plate (8 replicates per dilution), and 50 μl of KHV strain CX729 (200× 50% tissue culture infective dose [TCID50]) was added to each well of the plate, mixed fully, and incubated at 20°C for 2 h. After that, the serum-virus mixture (100 μl per well) was transferred to another 96-well plate containing a confluent monolayer of KF-1 cells and incubated in a 5% CO2 incubator at 20°C for a further 2 h. After discarding the liquid in the plate, rinsing the cell monolayer, and adding 200 μl of MEM-10% FBS into each well, the plate was incubated in 5% CO2 at 20°C for 4 days. After discarding the overlay medium and washing the wells three times with PBS, the cells in each well were stained with 1% crystal violet solution, followed by observation of plaque formation. Differences in the number of plaques formed between treatments were examined for the level of significance by Student’s t test after analysis of variance. Moreover, the neutralizing antibody titer of koi serum samples obtained from each group was determined using the Reed-Muench method.
Lymphocyte proliferation.
The thiazolyl blue tetrazolium bromide (MTT) assay was used to determine the lymphocyte proliferation in each group of koi carp after oral vaccination, according to a method previously described (51), with some modifications. Briefly, the spleen of each koi carp (n = 10 per group) obtained on day 42 after the primary oral vaccination was used to separate splenocytes to a final concentration of 5 × 106 cells/ml. After that, 100 μl of cell suspension was added to a 96-well plate containing RPMI 1640 medium-10% FBS (8 replicates per sample) and incubated in 5% CO2 at 37°C for 2 h, followed by restimulation for 72 h with 1.0 μg/ml and 10 μg/ml of purified recombinant ORF81 protein solubly expressed in the prokaryotic system. Next, MTT (Sigma, USA) was added to each well (10 μl per well) and incubated at 37°C for 4 h, and then the CellTiter 96 AQueous non-radioactive cell proliferation assay (Promega, Fitchburg, WI, USA) was used for evaluation, followed by measuring the absorbance of each well at 570 nm. In parallel, 5 μg/ml of concanavalin A (ConA; Sigma, USA) was used as a positive control, and RPMI 1640 medium was used as a negative control. The stimulation index (SI) was calculated as follows: SI = OD570 (sample)/OD570 (negative control).
An ELISPOT assay was used to determine the number of total and antigen-specific IgM-secreting B cells in the spleens of koi carp from each group after oral vaccination according to a previously described method (75), with some modifications. Briefly, a 96-well PVDF ELISPOT plate (Millipore, USA) was treated with 35% ethanol for 2 min. After washing five times with sterile deionized H2O, the 96-well plate was coated overnight at 4°C with 5 μg/ml of an anti-koi carp IgM antibody (Aquatic Diagnostics Ltd., England) or with 10 μg/ml of purified recombinant KHV ORF81 protein, followed by blocking nonspecific binding sites with 5% bovine serum albumin (BSA) at 37°C for 1 h. Next, the splenocytes of each koi carp (n = 10) from each group were added to the ELISPOT plate (in triplicates, 3 × 105 cells/well) and were incubated in 5% CO2 at 20°C for 24 h. After washing five times with sterile PBS and blocking with 5% BSA, 100 μl of biotinylated anti-koi carp IgM antibody (1 μg/ml) was added to each well and incubated at 37°C for 1 h. After washing, 100 μl of streptavidin-HRP (100 ng/ml) (Sigma, USA) was added to each well and incubated at 37°C for 1 h, followed by washing and incubating with 3-amino 9-ethylcarbazole (AEC; Sigma, USA) in the dark at 37°C for 30 min. After washing again, the number of spots in each well was determined using an AID ELISPOT reader (Autoimmun Diagnostika GMBH).
Moreover, a fluorescence immunohistochemistry assay (FIA) was used to detect the proliferation of total IgM-secreting B cells and antigen-specific IgM-secreting B cells in the spleens of koi carp from each group after oral vaccination. Spleens obtained from the immunized koi carp in each group were fixed in 10% paraformaldehyde, followed by routine immunohistological procedures. To detect the proliferation of total IgM-secreting B cells in the spleen, rabbit anti-koi carp IgM antibody was used as the primary antibody, and FITC-labeled goat anti-rabbit IgG antibody (Abcam, USA) was used as the secondary antibody. To detect the proliferation of antigen-specific IgM-secreting B cells in the spleens of vaccinated koi carp, FITC-labeled recombinant ORF81 protein was used. Cell nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) dye (Abcam, USA), and images were acquired using an inverted fluorescence microscope (Zeiss, Germany).
Quantitative RT-PCR analysis of immune-related gene expression.
Total RNA of the spleen of each koi carp (n = 5) obtained from each experimental group on day 42 after the primary oral vaccination was extracted using the TRIzol total RNA isolation kit (Invitrogen, USA), and then first-strand cDNA was synthesized using the QuantiTect reverse transcription kit (Qiagen, Germany). Subsequently, using the cDNA as a template, SYBR green I-based quantitative reverse transcription-PCR (qRT-PCR) was carried out to analyze the expression of immune-related genes, including those encoding TNF-α, IL-1β, IL-6a, IFN-γ, type I IFN (I-IFN), CD4, CD8α, MHCIIα, and IgM (3 replicate tests), with the primers listed in Table 1. All data were analyzed using the comparative threshold cycle (2−ΔΔCT) method.
Analysis of serum biochemical parameters.
After oral vaccination, serum myeloperoxidase activity, serum lysozyme activity, and superoxide dismutase (SOD) activity of koi carp (n = 10) from each group were analyzed according to methods previously described (73), with some modifications. To determine the serum myeloperoxidase activity, 25 μl of serum from each koi carp was added to a 96-well plate containing 75 μl of Hanks’ balanced salt solution (3 replicates per sample), followed by the addition of 50 μl tetramethylbenzidine (20 mM) (Qiagen, Germany) and 50 μl of H2O2 (5 mM) to each well and incubation at 35°C for 2 min. After that, 50 μl of termination solution (4 M H2SO4) was added to each well to stop color development, followed by measurement of absorbance at 450 nm. To determine the serum lysozyme activity, 180 μl of lyophilized Micrococcus lysodeikticus (Sangon Biotech Co., Ltd., China) dissolved in sterile PBS (pH 5.5) was added to a 96-well plate, in triplicates, followed by addition of 20 μl serum and incubation at room temperature for 0 and 30 min before the measurement of absorbance at 450 nm. The SOD activity of serum was determined using a SOD assay kit (Abcam, USA), according to the manufacturer’s instructions.
Virus challenge experiment.
A challenge test was carried out to evaluate the protective efficacy of the encapsulated live probiotic vaccine for koi carp against KHV infection. Briefly, koi carp were divided into three groups (n = 100 per group), and the koi carp vaccine group was bait fed with the encapsulated live probiotic vaccine; and control groups of koi carp were bait fed with capsules containing pYG/LR CIQ249 or PBS. The vaccination protocol was performed as described above. Koi carp in each group were challenged on day 15 after the second booster by placing them in a bath for a 4-h exposure to 106 TCID50 of KHV, and the cumulative mortality of koi carp in each group was recorded every day for 20 days. The challenge test was performed three times. After challenge, the viral load in kidney samples obtained from the koi carp in each group was determined by a quantitative real-time PCR with the primers qORF81-F and qORF81-R (Table 1). Briefly, the total RNA of each kidney sample was extracted using the TRIzol total RNA isolation kit (Invitrogen, USA), followed by the synthesis of the first-strand cDNA using the QuantiTect reverse transcription kit (Qiagen, Germany). The qPCR system was 5×Golden EvaGreen qPCR mix (4 μl), ROX reference DyeII (0.4 μl), cDNA (3 μl), 10 μM primer mix (1 μl), and deionized H2O to a final volume of 20 μl. The thermal cycling conditions were 95°C for 3 min followed by 40 cycles of 95°C for 30 s and 60°C for 45 s.
Statistical analysis.
Data are presented as means ± standard deviations (SDs). Tukey’s multiple-comparison tests and one-way analysis of variance (ANOVA) were used to analyze the differences among groups using GraphPad Prism V7.0 software.
ACKNOWLEDGMENTS
This work was funded by the Academic Backbone Project of Northeast Agricultural University Scholar Program (grant number 18XG24) and the National Natural Science Foundation of China (grant number 31672591).
Conceptualization, Yigang Xu and Ronghui Pan; Data curation, Ronghui Pan; Formal analysis, Yingying Ma and Yixin Wang; Funding acquisition, Yigang Xu and Ronghui Pan; Methodology, Xinning Huang, Yingying Ma, Yixin Wang, Shuo Jia, and Xueting Guan; Project administration, Yigang Xu and Ronghui Pan; Resources, Ronghui Pan, Zhongmei Liu, and Xueting Guan; Software, Chao Niu, Xin Yao, and Xiaoxia Jiang; Supervision, Yigang Xu, Ronghui Pan, and Zhongmei Liu; Validation, Ronghui Pan, Zhongmei Liu, and Dandan Li; Writing – original draft, Xinning Huang and Yigang Xu; Writing – review & editing, Yigang Xu and Li Wang.
We declare no conflict of interest.
Contributor Information
Li Wang, Email: wanglicau@163.com.
Yigang Xu, Email: yigangxu@neau.edu.cn.
Jae U. Jung, Lerner Research Institute, Cleveland Clinic
REFERENCES
- 1.Davison AJ, Eberle R, Ehlers B, Hayward GS, McGeoch DJ, Minson AC, Pellett PE, Roizman B, Studdert MJ, Thiry E. 2009. The order Herpesvirales. Arch Virol 154:171–177. 10.1007/s00705-008-0278-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Gotesman M, Kattlun J, Bergmann SM, El-Matbouli M. 2013. CyHV-3: the third cyprinid herpesvirus. Dis Aquat Organ 105:163–174. 10.3354/dao02614. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Waltzek TB, Kelley GO, Alfaro ME, Kurobe T, Davison AJ, Hedrick RP. 2009. Phylogenetic relationships in the family Alloherpesviridae. Dis Aquat Organ 84:179–194. 10.3354/dao02023. [DOI] [PubMed] [Google Scholar]
- 4.Aoki T, Hirono I, Kurokawa K, Fukuda H, Nahary R, Eldar A, Davison AJ, Waltzek TB, Bercovier H, Hedrick RP. 2007. Genome sequences of three koi herpesvirus isolates representing the expanding distribution of an emerging disease threatening koi and common carp worldwide. J Virol 81:5058–5065. 10.1128/JVI.00146-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Michel B, Fournier G, Lieffrig F, Costes B, Vanderplasschen A. 2010. Cyprinid herpesvirus 3. Emerg Infect Dis 16:1835–1843. 10.3201/eid1612.100593. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Hedrick RP, Gilad O, Yun S, Spangenberg J, Marty R, Nordhausen M, Kebus MJ, Bercovier H, Eldar A. 2000. A herpesvirus associated with mass mortality of juvenile and adult koi, a strain of common carp. J Aquat Anim Health 12:44–57. 10.1577/1548-8667(2000)012<0044:AHAWMM>2.0.CO;2. [DOI] [PubMed] [Google Scholar]
- 7.Rathore G, Kumar G, Swaminathan TR, Swain P. 2012. Koi herpes virus: a review and risk assessment of Indian aquaculture. Indian J Virol 23:124–133. 10.1007/s13337-012-0101-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Haenen O, Way K, Gorgoglione B, Ito T, Paley R, Bigarre L, Waltzek T. 2016. Novel viral infections threatening Cyprinid fish. Bull Eur Assoc Fish Pathol 36:11. [Google Scholar]
- 9.Padhi SK, Tolo I, McEachran M, Primus A, Mor SK, Phelps NBD. 2019. Koi herpesvirus and carp oedema virus: infections and coinfections during mortality events of wild common carp in the United States. J Fish Dis 42:1609–1621. 10.1111/jfd.13082. [DOI] [PubMed] [Google Scholar]
- 10.Jin Y, Adamkowska N, Kiełpińska J, Bergmann SM. 2020. Detection of koi herpesvirus (KHV) and carp oedema virus (CEV) in invasive round goby, Neogobius melanostomus Pallas, 1814, from Poland and Germany. J Vet Res 64:247–251. 10.2478/jvetres-2020-0037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Colorio S, Toffan A, Lewisch E, Pozza MD, Stifter E, Pircher A, Meraner A, Bettini A, Tavella A. 2020. Koi herpesvirus disease outbreak: input for the implementation of a surveillance program in South Tyrol-Italy. Prev Vet Med 181:105089. 10.1016/j.prevetmed.2020.105089. [DOI] [PubMed] [Google Scholar]
- 12.Zrnčić S, Oraić D, Zupičić IG, Pavlinec Ž, Brnić D, Rogić ŽA, Sučec I, Steinhagen D, Adamek M. 2020. Koi herpesvirus and carp edema virus threaten common carp aquaculture in Croatia. J Fish Dis 43:673–685. 10.1111/jfd.13163. [DOI] [PubMed] [Google Scholar]
- 13.Bergmann SM, Jin Y, Franzke K, Grunow B, Wang Q, Klafack S. 2020. Koi herpesvirus (KHV) and KHV disease (KHVD) – a recently updated overview. J Appl Microbiol 129:98–103. 10.1111/jam.14616. [DOI] [PubMed] [Google Scholar]
- 14.Haenen OLM, Way K, Bergmann SM, Ariel E. 2004. The emergence of koi herpesvirus and its significance to European aquaculture. Bull Eur Assoc Fish Pathol 24:293–307. [Google Scholar]
- 15.Steinhagen D, Jung-Schroers V, Adamek M. 2016. Impact of cyprinid herpesvirus 3 (koi herpesvirus) on wild and cultured fish. Perspect Agric Vet Sci Nutr Nat Resour 11:1–10. [Google Scholar]
- 16.Dhar AK, Manna SK, Allnutt FCT. 2014. Viral vaccines for farmed finfish. Virus Dis 25:1–17. 10.1007/s13337-013-0186-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Schmid T, Gaede L, Böttcher K, Bräuer G, Fichtner D, Beckmann R, Speck S, Becker F, Truyen U. 2016. Efficacy assessment of three inactivated koi herpes virus antigen preparations against experimental challenge virus infection in common carp. J Fish Dis 39:1007–1013. 10.1111/jfd.12428. [DOI] [PubMed] [Google Scholar]
- 18.Perelberg A, Ronen A, Hutoran M, Smith Y, Kotler M. 2005. Protection of cultured Cyprinus carpio against a lethal viral disease by an attenuated virus vaccine. Vaccine 23:3396–3403. 10.1016/j.vaccine.2005.01.096. [DOI] [PubMed] [Google Scholar]
- 19.Weber EPS, Malm KV, Yun SC, Campbell LA, Kass PH, Marty GD, Salonius K, Dishon A. 2014. Efficacy and safety of a modified-live cyprinid herpesvirus 3 vaccine in koi (Cyprinus carpio koi) for prevention of koi herpesvirus disease. Am J Vet Res 75:899–904. 10.2460/ajvr.75.10.899. [DOI] [PubMed] [Google Scholar]
- 20.Ronen A, Perelberg A, Abramowitz J, Hutoran M, Tinman S, Bejerano I, Steinitz M, Kotler M. 2003. Efficient vaccine against the virus causing a lethal disease in cultured Cyprinus carpio. Vaccine 21:4677–4684. 10.1016/s0264-410x(03)00523-1. [DOI] [PubMed] [Google Scholar]
- 21.Fuchs W, Fichtner D, Bergmann SM, Mettenleiter TC. 2011. Generation and characterization of koi herpesvirus recombinants lacking viral enzymes of nucleotide metabolism. Arch Virol 156:1059–1063. 10.1007/s00705-011-0953-8. [DOI] [PubMed] [Google Scholar]
- 22.Boutier M, Ronsmans M, Ouyang P, Fournier G, Reschner A, Rakus K, Wilkie GS, Farnir FF, Bayrou C, Lieffrig FF, Li H, Desmecht D, Davison AJ, Vanderplasschen A. 2015. Rational development of an attenuated recombinant cyprinid herpesvirus 3 vaccine using prokaryotic mutagenesis and in vivo bioluminescent imaging. PLoS Pathog 11:e1004690. 10.1371/journal.ppat.1004690. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Schröder L, Klafack S, Bergmann SM, Fichtner D, Jin Y, Lee PY, Höper D, Mettenleiter TC, Fuchs W. 2019. Generation of a potential koi herpesvirus live vaccine by simultaneous deletion of the viral thymidine kinase and dUTPase genes. J Gen Virol 100:642–655. 10.1099/jgv.0.001148. [DOI] [PubMed] [Google Scholar]
- 24.Schröder L, Klafack S, Bergmann SM, Lee PYA, Franzke K, Höper D, Mettenleiter TC, Fuchs W. 2019. Characterization of gene deletion mutants of Cyprinid herpesvirus 3 (koi herpesvirus) lacking the immunogenic envelope glycoproteins pORF25, pORF65, pORF148 and pORF149. Virus Res 261:21–30. 10.1016/j.virusres.2018.12.004. [DOI] [PubMed] [Google Scholar]
- 25.St-Hilaire S, Beevers N, Way K, Deuff RL, Martin P, Joiner C. 2005. Reactivation of koi herpesvirus infections in common carp Cyprinus carpio. Dis Aquat Organ 67:15–23. 10.3354/dao067015. [DOI] [PubMed] [Google Scholar]
- 26.Embregts CWE, Tadmor-Levi R, Veselý T, Pokorová D, David L, Wiegertjes GF, Forlenza M. 2019. Intra-muscular and oral vaccination using a koi herpesvirus ORF25 DNA vaccine does not confer protection in common carp (Cyprinus carpio L.). Fish Shellfish Immunol 85:90–98. 10.1016/j.fsi.2018.03.037. [DOI] [PubMed] [Google Scholar]
- 27.Hu F, Li Y, Wang Q, Wang G, Zhu B, Wang Y, Zeng W, Yin J, Liu C, Bergmann SM, Shi C. 2020. Carbon nanotube-based DNA vaccine against koi herpesvirus given by intramuscular injection. Fish Shellfish Immunol 98:810–818. 10.1016/j.fsi.2019.11.035. [DOI] [PubMed] [Google Scholar]
- 28.Liu L, Gao S, Luan W, Zhou J, Wang H. 2018. Generation and functional evaluation of a DNA vaccine co-expressing Cyprinid herpesvirus-3 envelope protein and carp interleukin-1 beta. Fish Shellfish Immunol 80:223–231. 10.1016/j.fsi.2018.05.046. [DOI] [PubMed] [Google Scholar]
- 29.Zhou JX, Wang H, Li XW, Zhu X, Lu WL, Zhang DM. 2014. Construction of KHV-CJ ORF25 DNA vaccine and immune challenge test. J Fish Dis 37:319–325. 10.1111/jfd.12105. [DOI] [PubMed] [Google Scholar]
- 30.Zhou JX, Xue J, Wang Q, Zhu X, Li X, Lv W, Zhang D. 2014. Vaccination of plasmid DNA encoding ORF81 gene of CJ strains of KHV provides protection to immunized carp. In Vitro Cell Dev Biol Anim 50:489–495. 10.1007/s11626-014-9737-2. [DOI] [PubMed] [Google Scholar]
- 31.Plant KP, Lapatra SE. 2011. Advances in fish vaccine delivery. Dev Comp Immunol 35:1256–1262. 10.1016/j.dci.2011.03.007. [DOI] [PubMed] [Google Scholar]
- 32.Chen H. 2000. Recent advances in mucosal vaccine development. J Control Release 67:117–128. 10.1016/S0168-3659(00)00199-1. [DOI] [PubMed] [Google Scholar]
- 33.Cui LC, Guan XT, Liu ZM, Tian CY, Xu YG. 2015. Recombinant Lactobacillus expressing G protein of spring viremia of carp virus (SVCV) combined with ORF81 protein of koi herpesvirus (KHV): a promising way to induce protective immunity against SVCV and KHV infection in cyprinid fish via oral vaccination. Vaccine 33:3092–3099. 10.1016/j.vaccine.2015.05.002. [DOI] [PubMed] [Google Scholar]
- 34.Gomez D, Sunyer JO, Salinas I. 2013. The mucosal immune system of fish: the evolution of tolerating commensals while fighting pathogens. Fish Shellfish Immunol 35:1729–1739. 10.1016/j.fsi.2013.09.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Jia S, Zhou K, Pan R, Wei J, Liu Z, Xu Y. 2020. Oral immunization of carps with chitosan–alginate microcapsule containing probiotic expressing spring viremia of carp virus (SVCV) G protein provides effective protection against SVCV infection. Fish Shellfish Immunol 105:327–329. 10.1016/j.fsi.2020.07.052. [DOI] [PubMed] [Google Scholar]
- 36.Dhar AK, Allnutt F. 2011. Challenges and opportunities in developing oral vaccines against viral diseases of fish. J Mar Sci Res Dev S1:e003. [Google Scholar]
- 37.Embregts CW, Forlenza M. 2016. Oral vaccination of fish: lessons from humans and veterinary species. Dev Comp Immunol 64:118–137. 10.1016/j.dci.2016.03.024. [DOI] [PubMed] [Google Scholar]
- 38.Mutoloki S, Munang'andu HM, Evensen Ø. 2015. Oral vaccination of fish–antigen preparations, uptake, and immune induction. Front Immunol 6:519. 10.3389/fimmu.2015.00519. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Rombout JH, Abelli L, Picchietti S, Scapigliati G, Kiron V. 2011. Teleost intestinal immunology. Fish Shellfish Immunol 31:616–626. 10.1016/j.fsi.2010.09.001. [DOI] [PubMed] [Google Scholar]
- 40.Yasumoto S, Kuzuya Y, Yasuda M, Yoshimura T, Miyazaki T. 2006. Oral immunization of common carp with a liposome vaccine fusing koi herpesvirus antigen. Fish Pathol 41:141–145. 10.3147/jsfp.41.141. [DOI] [Google Scholar]
- 41.Szatraj K, Szczepankowska AK, Chmielewska-Jeznach M. 2017. Lactic acid bacteria promising vaccine vectors: possibilities, limitations, doubts. J Appl Microbiol 123:325–339. 10.1111/jam.13446. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Ding CC, Ma JF, Dong QL, Liu Q. 2018. Live bacterial vaccine vector and delivery strategies of heterologous antigen: a review. Immunol Lett 197:70–77. 10.1016/j.imlet.2018.03.006. [DOI] [PubMed] [Google Scholar]
- 43.Takahashi K, Orito N, Tokunoh N, Inoue N. 2019. Current issues regarding the application of recombinant lactic acid bacteria to mucosal vaccine carriers. Appl Microbiol Biotechnol 103:5947–5955. 10.1007/s00253-019-09912-x. [DOI] [PubMed] [Google Scholar]
- 44.Bai J, Qiao XY, Ma YY, Han MJ, Jia S, Huang XN, Han B, Wang L, Li YJ, Xu YG. 2020. Protection efficacy of oral bait probiotic vaccine constitutively expressing tetravalent toxoids against Clostridium perfringens exotoxins in livestock (rabbits. Vaccines 8:17. 10.3390/vaccines8010017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Gao X, Ma Y, Wang Z, Bai J, Jia S, Feng B, Jiang Y, Cui W, Tang L, Li Y, Wang L, Xu Y. 2019. Oral immunization of mice with a probiotic Lactobacillus casei constitutively expressing the alpha-toxoid induces protective immunity against Clostridium perfringens alpha-toxin. Virulence 10:166–179. 10.1080/21505594.2019.1582975. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Jiang YP, Jia S, Zheng DZ, Li FS, Wang SW, Wang L, Qiao XY, Cui W, Tang LJ, Xu YG, Xia XZ, Li YJ. 2019. Protective immunity against canine distemper virus in dogs induced by intranasal immunization with a recombinant probiotic expressing the viral H protein. Vaccines 7:213. 10.3390/vaccines7040213. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Ma ST, Ding GJ, Huang XW, Wang ZW, Wang L, Yu ML, Shi W, Jiang YP, Tang LJ, Xu YG, Li YJ. 2018. Immunogenicity in chickens with orally administered recombinant chicken-borne Lactobacillus saerimneri expressing FimA and OmpC antigen of O78 avian pathogenic Escherichia coli. J Med Microbiol 67:441–451. 10.1099/jmm.0.000679. [DOI] [PubMed] [Google Scholar]
- 48.Ma ST, Wang L, Huang XW, Wang XN, Chen S, Shi W, Qiao XY, Jiang YP, Tang LJ, Xu YG, Li YJ. 2018. Oral recombinant Lactobacillus vaccine targeting the intestinal microfold cells and dendritic cells for delivering the core neutralizing epitope of porcine epidemic diarrhea virus. Microb Cell Fact 17:20. 10.1186/s12934-018-0861-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Wang XN, Wang L, Huang XW, Ma ST, Yu ML, Shi W, Qiao XY, Tang LJ, Xu YG, Li YJ. 2017. Oral delivery of probiotics expressing dendritic cell-targeting peptide fused with porcine epidemic diarrhea virus COE antigen: a promising vaccine strategy against PEDV. Viruses 9:312. 10.3390/v9110312. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Wang XN, Wang L, Zheng DZ, Chen S, Shi W, Qiao XY, Jiang YP, Tang LJ, Xu YG, Li YJ. 2018. Oral immunization with a Lactobacillus casei-based anti-porcine epidemic diarrhoea virus (PEDV) vaccine expressing microfold cell-targeting peptide Co1 fused with the COE antigen of PEDV. J Appl Microbiol 124:368–378. 10.1111/jam.13652. [DOI] [PubMed] [Google Scholar]
- 51.Wang YX, Feng BH, Niu C, Jia S, Sun C, Wang Z, Jiang YP, Cui W, Wang L, Xu YG. 2019. Dendritic cell targeting of bovine viral diarrhea virus E2 protein expressed by Lactobacillus casei effectively induces antigen-specific immune responses via oral vaccination. Viruses 11:575. 10.3390/v11060575. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Xu YG, Guan XT, Liu ZM, Tian CY, Cui LC. 2015. Immunogenicity in swine of orally administered recombinant Lactobacillus plantarum expressing classical swine fever virus E2 protein in conjunction with thymosin α-1 as an adjuvant. Appl Environ Microbiol 81:3745–3752. 10.1128/AEM.00127-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Yu M, Qi R, Chen C, Yin J, Ma S, Shi W, Wu Y, Ge J, Jiang Y, Tang L, Xu Y, Li Y. 2017. Immunogenicity of recombinant Lactobacillus casei expressing F4 (K88) fimbrial adhesin FaeG in conjunction with a heat-labile enterotoxin A (LTAK63) and heat-labile enterotoxin B (LTB) of enterotoxigenic Escherichia coli as an oral adjuvant in mice. J Appl Microbiol 122:506–515. 10.1111/jam.13352. [DOI] [PubMed] [Google Scholar]
- 54.Yu M, Wang L, Ma S, Wang X, Wang Y, Xiao Y, Jiang Y, Qiao X, Tang L, Xu Y, Li Y. 2017. Immunogenicity of eGFP-marked recombinant Lactobacillus casei against transmissible gastroenteritis virus and porcine epidemic diarrhea virus. Viruses 9:274. 10.3390/v9100274. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Chen Y, Hua X, Ren X, Duan K, Gao S, Sun J, Feng Y, Zhou Y, Guan X, Li D, Wang N, Li J, Yang J, Xia D, Shi W, Liu M. 2020. Oral immunization with recombinant Lactobacillus casei displayed AHA1-CK6 and VP2 induces protection against infectious pancreatic necrosis in rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol 100:18–26. 10.1016/j.fsi.2020.03.001. [DOI] [PubMed] [Google Scholar]
- 56.Zhao LL, Liu M, Ge JW, Qiao XY, Li YJ, Liu DQ. 2012. Expression of infectious pancreatic necrosis virus (IPNV) VP2-VP3 fusion protein in Lactobacillus casei and immunogenicity in rainbow trouts. Vaccine 30:1823–1829. 10.1016/j.vaccine.2011.12.132. [DOI] [PubMed] [Google Scholar]
- 57.Zhang C, Guo S, Zhao Z, Guo ZR, Ma R, Wang GX, Zhu B. 2020. Surface display of spring viremia of carp virus glycoprotein on Lactococcus lactis and its protection efficacy in common carp (Cyprinus carpio L.). Fish Shellfish Immunol 104:262–268. 10.1016/j.fsi.2020.06.021. [DOI] [PubMed] [Google Scholar]
- 58.Anal AK, Singh H. 2007. Recent advance in microencapsulation of probiotics for industrial applications and targeted delivery. Trends Food Sci Tech 18:240–251. 10.1016/j.tifs.2007.01.004. [DOI] [Google Scholar]
- 59.Cheow WS, Kiew TY, Hadinoto K. 2014. Controlled release of Lactobacillus rhamnosus biofilm probiotics from alginate-locust bean gum microcapsules. Carbohydr Polym 103:587–595. 10.1016/j.carbpol.2014.01.036. [DOI] [PubMed] [Google Scholar]
- 60.Hosseini SM, Hosseini H, Mohammadifar MA, German JB, Mortazavian AM, Mohammadi A, Khosravi-Darani K, Shojaee-Aliabadi S, Khaksar R. 2014. Preparation and characterization of alginate and alginate-resistant starch microparticles containing nisin. Carbohydr Polym 103:573–580. 10.1016/j.carbpol.2013.12.078. [DOI] [PubMed] [Google Scholar]
- 61.Li S, Wang X, Zhang X, Yang R, Zhang H, Zhu L, Hou X. 2002. Studies on alginate–chitosan microcapsules and renal arterial embolization in rabbits. J Control Release 84:87–98. 10.1016/S0168-3659(02)00214-6. [DOI] [PubMed] [Google Scholar]
- 62.Liu LS, Liu SQ, Ng SY, Froix M, Ohno T, Heller H. 1997. Controlled release of interleukin-2 for tumour immunotherapy using alginate/chitosan porous microspheres. J Control Release 43:65–74. 10.1016/S0168-3659(96)01471-X. [DOI] [Google Scholar]
- 63.Lucinda-Silva RM, Salgado HRN, Evangelista RC. 2010. Alginate-chitosan systems: in vitro controlled release of triamcinolone and in vivo gastrointestinal transit. Carbohydr Polym 81:260–268. 10.1016/j.carbpol.2010.02.016. [DOI] [Google Scholar]
- 64.Song H, Yu W, Liu X, Ma X. 2014. Improved probiotic viability in stress environments with post-culture of alginate–chitosan microencapsulated low density cells. Carbohydr Polym 108:10–16. 10.1016/j.carbpol.2014.02.084. [DOI] [PubMed] [Google Scholar]
- 65.Yang D, Guo S, Qiao J, Nie J. 2011. Investigation on the preparation and application of chitosan-alginate microcapsules. J Control Release 152:e71–e72. 10.1016/j.jconrel.2011.08.130. [DOI] [PubMed] [Google Scholar]
- 66.Rosenkranz D, Klupp BG, Teifke JP, Granzow H, Fichtner D, Mettenleiter TC, Fuchs W. 2008. Identification of envelope protein pORF81 of koi herpesvirus. J Gen Virol 89:896–900. 10.1099/vir.0.83565-0. [DOI] [PubMed] [Google Scholar]
- 67.Salinas I, Zhang YA, Sunyer JO. 2011. Mucosal immunoglobulins and B cells of teleost fish. Dev Comp Immunol 35:1346–1365. 10.1016/j.dci.2011.11.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Mashoof S, Criscitiello MF. 2016. Fish immunoglobulins. Biology 5:45. 10.3390/biology5040045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Magadan S, Sunyer OJ, Boudinot P. 2015. Unique features of fish immune repertoires: particularities of adaptive immunity within the largest group of vertebrates. Results Probl Cell Differ 57:235–264. 10.1007/978-3-319-20819-0_10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Lee YN, Youn HN, Kwon JH, Lee DH, Park JK, Yuk SS, Erdene-Ochir TO, Kim KT, Lee JB, Park SY, Choi IS, Song CS. 2013. Sublingual administration of Lactobacillus rhamnosus affects respiratory immune responses and facilitates protection against influenza virus infection in mice. Antiviral Res 98:284–290. 10.1016/j.antiviral.2013.03.013. [DOI] [PubMed] [Google Scholar]
- 71.Fong FLY, Kirjavainen PV, El-Nezami H. 2016. Immunomodulation of Lactobacillus rhamnosus GG (LGG)-derived soluble factors on antigen presenting cells of healthy blood donors. Sci Rep 6:22845. 10.1038/srep22845. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Cai S, Kandasamy M, Rahmat JN, Tham SM, Bay BH, Lee YK, Mahendran R. 2016. Lactobacillus rhamnosus GG activation of dendritic cells and neutrophils depends on the dose and time of exposure. J Immunol Res 2016:7402760. 10.1155/2016/7402760. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73.Hasan MT, Jang WJ, Lee BJ, Kim KW, Hur SW, Lim SG, Bai SC, Kong IS. 2019. Heat-killed Bacillus sp. SJ-10 probiotic acts as a growth and humoral innate immunity response enhancer in olive flounder (Paralichthys olivaceus). Fish Shellfish Immunol 88:424–431. 10.1016/j.fsi.2019.03.018. [DOI] [PubMed] [Google Scholar]
- 74.Xu Y, Li Y. 2008. Construction of recombinant Lactobacillus casei efficiently surface displayed and secreted porcine parvovirus VP2 protein and comparison of the immune responses induced by oral immunization. Immunology 124:68–75. 10.1111/j.1365-2567.2007.02738.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Martín-Martín A, Simón R, Abós B, Díaz-Rosales P, Tafalla C. 2020. Rainbow trout mount a robust specific immune response upon anal administration of thymus-independent antigens. Dev Comp Immunol 109:103715. 10.1016/j.dci.2020.103715. [DOI] [PMC free article] [PubMed] [Google Scholar]







