ABSTRACT
Clarifying the molecular mechanisms by which bacteria acquire virulence traits is important for understanding the bacterial virulence system. In the present study, we utilized a bacterial evolution method in a silkworm infection model and revealed that deletion of the opgGH operon, encoding synthases for osmoregulated periplasmic glucan (OPG), increased the virulence of a nonpathogenic laboratory strain of Escherichia coli against silkworms. The opgGH knockout mutant exhibited resistance to host antimicrobial peptides and antibiotics. Compared with the parent strain, the opgGH knockout mutant produced greater amounts of colanic acid, which is involved in E. coli resistance to antibiotics. RNA sequence analysis revealed that the opgGH knockout altered the expression of various genes, including the evgS/evgA two-component system that functions in antibiotic resistance. In both a colanic acid-negative background and an evgS-null background, the opgGH knockout increased E. coli resistance to antibiotics and increased the silkworm-killing activity of E. coli. In the null background of the envZ/ompR two-component system, which genetically interacts with opgGH, the opgGH knockout increased antibiotic resistance and virulence in silkworms. These findings suggest that the absence of OPG confers antimicrobial resistance and virulence in E. coli in a colanic acid-, evgS/evgA-, and envZ/ompR-independent manner.
IMPORTANCE The gene mutation types that increase the bacterial virulence of Escherichia coli remain unclear, in part due to the limited number of methods available for isolating bacterial mutants with increased virulence. We utilized a bacterial evolution method in the silkworm infection model, in which silkworms were infected with mutagenized bacteria and highly virulent bacterial mutants were isolated from dead silkworms. We revealed that knockout of OPG synthases increased E. coli virulence against silkworms. The OPG knockout mutants were resistant to host antimicrobial peptides as well as antibiotics. Our findings not only suggest a novel mechanism for virulence acquisition in E. coli but also support the usefulness of the bacterial experimental evolution method in the silkworm infection model.
KEYWORDS: experimental evolution, osmoregulated periplasmic glucan, silkworm infection model, virulence
INTRODUCTION
Osmoregulated periplasmic glucan (OPG) is a glucose oligosaccharide present in the periplasmic space of various Gram-negative bacteria. OPG production is induced under low-osmolarity conditions in many bacterial species, and it is considered to function as an osmoprotectant (1, 2). Disruption of OPG synthases results in pleiotropic bacterial phenotypes, such as growth defects under low-osmolarity conditions, sensitivity to antibiotics and detergents, decreased biofilm formation, and motility defects (3). In Escherichia coli, disruption of the opgGH operon encoding OPG synthases sensitizes E. coli against a detergent (SDS), decreases E. coli motility by downregulating flagellum expression, and decreases the expression of OmpF, a membrane porin involved in antibiotic resistance (4–6). In addition, disruption of OPG synthases decreases bacterial virulence in animal pathogens, including Brucella abortus (7), Yersinia enterocolitica (8), Pseudomonas aeruginosa (9), and Salmonella enterica serovar Typhimurium (10), as well as in plant pathogens, including Pseudomonas syringae (11), Dickeya dadantii (12), Agrobacterium tumefaciens (13), and Xanthomonas campestris (14). In contrast, disruption of OPG synthases does not affect the host cell-invading ability of Shigella flexneri (15) and the virulence in mice of Yersinia pseudotuberculosis (16). The role of OPG in E. coli virulence properties, however, is not known.
The pleiotropic phenotypes of OPG mutants can be attributed to the multiple functions of OPG (1), in osmoprotection (2), in a structural role (17, 18), in cell division (19), and in cell signaling (5, 20). OPG is proposed to be involved in two signaling systems, namely, EnvZ-OmpR and RcsCDB. EnvZ-OmpR is a two-component system involved in osmotic stress responses to regulate the outer membrane porins OmpF and OmpC (21). Mutation of envZ or ompR suppressed the motility defect of an opgH mutant in E. coli (5, 22), and the envZ/ompR system was not active in an opgG mutant of D. dadantii (23), indicating the relationship between OPG and EnvZ-OmpR. The RcsCDB phosphorelay system is a regulator of colanic acid synthesis in E. coli (24). Colanic acid is an extracellular polysaccharide comprising glucose, galactose, fucose, and glucuronic acid (25) and is involved in E. coli resistance to host complement and antibiotics (26, 27). Disruption of opgH activates the promoter activity of the colanic acid synthesis operon, which is composed of 20 genes, including wza, via the RcsCDB phosphorelay system (28).
We previously investigated how E. coli acquires virulence by evaluating the experimental evolution of the bacteria in a silkworm infection model (29). In the present study, utilizing the bacterial experimental evolution method, we found that opgGH knockout increased E. coli virulence against silkworms. We investigated the roles of colanic acid, envZ/ompR, and evgS/evgA in the increased virulence of an opgGH knockout mutant.
RESULTS
Knockout of the opgGH operon increases E. coli virulence against silkworms.
To identify gene mutations that increase E. coli virulence, we mutagenized an E. coli nonpathogenic laboratory strain (KP7600) with ethyl methanesulfonate, infected silkworms with the mutagenized E. coli cells, and isolated E. coli cells from dead silkworms (Fig. 1A). We obtained 16 E. coli strains with increased killing activity against silkworms and determined the nucleotide sequences of the lptD and lptE genes, whose mutation can increase E. coli virulence (29). Six of these mutant strains carried gene mutations of LptD (G348D), LptD (S350N), LptE (T95I), or LptE (E139K) (29), but the other 10 strains did not carry mutations in the lptD and lptE genes. Then, we performed whole-genome sequencing of 10 E. coli mutant strains with increased killing activity against silkworms (Fig. 1B). The mutant strains had many gene mutations (see Table S1 in the supplemental material), although all of the mutant strains carried opgGH mutations; 2 strains had opgG mutations, and 8 strains had opgH mutations (Fig. 1B). Because the 2 opgG mutations and 4 of the 8 opgH mutations were stop codon mutations (Fig. 1B), we speculated that functional loss of OpgG or OpgH, and not functional alterations of OpgG or OpgH, increased E. coli virulence; therefore, we examined the effect of opgGH knockout on E. coli virulence. A transposon insertion mutant of opgG (strain JD22094, referred to as opgG::Tn) and an opgGH deletion mutant (ΔopgGH) killed silkworms faster than the parent strain (Fig. 1C and D). The increased killing activities of the opgG::Tn mutant and the ΔopgGH mutant were cancelled by introducing the intact opgGH operon (Fig. 1D). To address which gene in the opgGH operon is responsible for the increased killing activity, we examined the killing activities of opgG and opgH deletion mutants (ΔopgG and ΔopgH) in the silkworm model (Fig. 1C). Both of the ΔopgG and ΔopgH mutants increased E. coli killing activity against silkworms, and the increased killing activity was cancelled by introducing the respective intact gene (Fig. 1E). These findings suggest that knockout of either opgG or opgH, as well as knockout of both genes, increases E. coli virulence activity against silkworms.
FIG 1.
Knockout of opgG or opgH increases E. coli virulence against silkworms. (A) Schematic representation of the experimental evolution experiment with E. coli using the silkworm infection model. The illustration was slightly modified from our previous study (29). The bacterial strains isolated from dead silkworms were distinguished by their colony morphologies, and their virulence levels were evaluated in the silkworm model. (B) Ten E. coli mutant strains were injected into silkworms (n = 10) (8.8 × 107 CFU/larva), and surviving silkworms were counted 2 days after the injection. OpgG or OpgH mutations in the 10 E. coli mutant strains, which were identified by whole-genome sequencing, are listed. Mutations other than those in OpgG and OpgH are listed in Table S1 in the supplemental material. (C) Schematic representation of the opgGH knockout mutations used in this study. Dotted lines indicate the deleted genomic region. The ΔopgG and ΔopgH mutants were constructed by markerless gene deletion. In the opgG::Tn mutant, the mini-Tn10 is located 278 bp from the A of the initiation codon of opgG. (D) The silkworm killing activity of the parent strain transformed with an empty vector (Parent/pMW118), the opgG transposon insertion mutant transformed with an empty vector (opgG::Tn/pMW118), the opgG transposon insertion mutant transformed with popgGH, harboring intact opgGH (opgG::Tn/popgGH), the opgGH deletion mutant transformed with an empty vector (ΔopgGH/pMW118), or the opgGH deletion mutant transformed with popgGH, harboring intact opgGH (ΔopgGH/popgGH), was examined. Silkworms were injected with bacterial cells (1.9 × 108 CFU), and survival was monitored. The experiment was performed twice, and the data were pooled (n = 20). Asterisks indicate that the log rank test P value is <0.05. (E) The silkworm killing activity of the parent strain transformed with an empty vector (Parent/pMW118), the opgG deletion mutant transformed with an empty vector (ΔopgG/pMW118), the opgG deletion mutant transformed with popgG, harboring intact opgG (ΔopgG/popgG), the opgH deletion mutant transformed with an empty vector (ΔopgH/pMW118), or the opgH deletion mutant transformed with popgH, harboring intact opgH (ΔopgH/popgH), was examined. Silkworms were injected with bacterial cells (1.9 × 108 CFU), and survival was monitored. The experiment was performed three times, and the data were pooled (n = 30). Asterisks indicate that the log rank test P value is <0.05.
Knockout of the opgGH operon increases E. coli resistance to antimicrobial peptides and antibiotics.
To investigate the molecular mechanism by which opgGH knockout increases E. coli virulence, we examined whether the opgGH knockout mutants exhibited resistance to cecropin A, a silkworm antimicrobial peptide. When cecropin A was added to liquid medium, the opgG::Tn, ΔopgGH, ΔopgG, and ΔopgH mutants showed slightly greater growth than the parent strain (Fig. 2A and B). The growth capabilities of the opgG::Tn, ΔopgGH, ΔopgG, and ΔopgH mutants in the presence of cecropin A were diminished by introducing the intact opgGH operon, opgG gene, or opgH gene (Fig. 2A and B). In contrast, the growth of the opgG::Tn, ΔopgGH, ΔopgG, and ΔopgH mutants was indistinguishable from that of the parent strain in liquid medium without cecropin A (Fig. 2A and B). These findings suggest that knockout of either opgG or opgH, as well as knockout of both genes, increases E. coli resistance to the silkworm antimicrobial peptide.
FIG 2.
The opgG and opgH knockout mutants show resistance to silkworm antimicrobial peptides and antibiotics. (A and B) E. coli strains (A, Parent/pMW118, opgG::Tn/pMW118, opgG::Tn/popgGH, ΔopgGH/pMW118, and ΔopgGH/popgGH; B, Parent/pMW118, ΔopgG/pMW118, ΔopgG/popgG, ΔopgH/pMW118, and ΔopgH/popgH) were aerobically cultured in LB medium, cecropin A (final 0.4 μM) was added to the bacterial culture, and the OD600 value of the bacterial culture was measured after 2 h. Means ± standard errors from two independent experiments with duplicate samples are presented. Asterisks indicate P values of <0.05. (C) E. coli overnight cultures were serially diluted 10-fold, spotted onto LB agar plates without or supplemented with vancomycin, levofloxacin, or tetracycline, and incubated at 37°C. The experiment was performed twice, and one of two data sets is presented in Fig. S1 in the supplemental material.
We reported previously that E. coli lptD and lptE mutants with high killing activity against silkworms were resistant to several antibiotics, such as vancomycin, levofloxacin, and tetracycline (29). We then examined whether the opgGH knockout increases E. coli resistance to these antibiotics in addition to the silkworm antimicrobial peptide. The opgG::Tn, ΔopgGH, ΔopgG, and ΔopgH mutants exhibited better growth than the parent strain in the presence of vancomycin or levofloxacin and had slightly better growth than the parent strain in the presence of tetracycline (Fig. 2C). The growth capabilities of the opgG::Tn, ΔopgGH, ΔopgG, and ΔopgH mutants in the presence of these antibiotics were decreased by introducing the intact opgGH operon, opgG gene, or opgH gene (Fig. 2C). These findings suggest that knockout of either opgG or opgH, as well as knockout of both genes, increases E. coli resistance to vancomycin, levofloxacin, and tetracycline.
In the subsequent analyses to determine the molecular function of the opgGH operon, we used the opgG::Tn mutant and the ΔopgGH mutant. RNA sequence analysis revealed that the opgG::Tn mutant decreased the expression of opgG as well as opgH (Table 1), indicating that both opgG and opgH genes are expressed at a low level in the opgG::Tn mutant. The ΔopgGH mutant was used when we needed a different antibiotic marker, compared to that of the opgG::Tn mutant, to construct double gene deletion mutants.
TABLE 1.
Differentially expressed genes in the opgG::Tn mutant
| Gene | Protein accession no.a | Product | Fold change (opgG::Tn/parent) |
|---|---|---|---|
| evgA | WP_000991370.1 | Acid-sensing system DNA-binding response regulator EvgA | 10.1 |
| evgS | WP_001326970.1 | Acid-sensing system histidine kinase EvgS | 7.94 |
| bdm | WP_000495771.1 | Biofilm-dependent modulation protein | 3.43 |
| ymgG | WP_001304448.1 | Glycine zipper family protein | 3.34 |
| ymgD | WP_000979977.1 | YmgD family protein | 3.29 |
| slp | WP_001350553.1 | Outer membrane lipoprotein Slp | 2.66 |
| hdeD | WP_000965672.1 | Acid resistance protein HdeD | 2.41 |
| melB | WP_000028111.1 | Melibiose-sodium transporter MelB | 2.40 |
| gadB | WP_000358930.1 | Glutamate decarboxylase | 2.40 |
| hdeB | WP_001298717.1 | Acid-activated periplasmic chaperone HdeB | 2.30 |
| ygdI | WP_000750398.1 | YgdI/YgdR family lipoprotein | 2.28 |
| melA | WP_000986601.1 | α-Galactosidase | 2.27 |
| csiR | WP_000156811.1 | DNA-binding transcriptional regulator CsiR | 2.25 |
| yjbJ | WP_001030593.1 | CsbD family protein | 2.25 |
| ygiW | WP_000712658.1 | OB fold stress tolerance protein YgiW | 2.25 |
| hdeA | WP_000756550.1 | Acid-activated periplasmic chaperone HdeA | 2.23 |
| patD | WP_001163872.1 | Aminobutyraldehyde dehydrogenase | 2.22 |
| ivy | WP_000532698.1 | C-type lysozyme inhibitor | 2.19 |
| ytjA | WP_000490275.1 | DUF1328 domain-containing protein | 2.16 |
| osmY | WP_001295748.1 | Molecular chaperone OsmY | 2.13 |
| osmE | WP_001039044.1 | Osmotically inducible lipoprotein OsmE | 2.11 |
| ydcI | WP_000414567.1 | LysR family transcriptional regulator | 0.463 |
| rseA | WP_001168459.1 | Anti-sigma-E factor RseA | 0.460 |
| glcC | WP_001297764.1 | Transcriptional regulator GlcC | 0.454 |
| fadD | WP_000758422.1 | Long-chain-fatty-acid–coenzyme A ligase FadD | 0.432 |
| ygiM | WP_001125331.1 | SH3 domain-containing protein | 0.418 |
| opgG | WP_001343212.1 | Glucan biosynthesis protein MdoG | 0.295 |
| opgH | WP_001295445.1 | Glucan biosynthesis glucosyltransferase MdoH | 0.0124 |
Protein accession numbers are for the NCBI protein database.
Knockout of the opgGH operon increases E. coli virulence in a colanic acid-negative background.
A previous report revealed that an opgH knockout mutant increases the promoter activity of the cps operon, which encodes colanic acid synthases, via the Rcs phosphorelay system and results in a mucoid phenotype in E. coli (28). Colanic acid affects the activation of the Rcs phosphorelay system in D. dadantii (20). The Rcs phosphorelay system and colanic acid have roles in conferring E. coli resistance to antibiotics and host complement (26, 27). Based on these reports, we hypothesized that the increased amount of colanic acid is involved in the increased virulence of the opgGH knockout mutants, and we examined the effect of the opgG::Tn mutation in colanic acid-negative backgrounds in which the wza or rcsB gene was deleted. The wza gene in the cps operon encodes a colanic acid synthase (30). The rcsB gene encodes a transcription factor of the RcsCDB phosphorelay system (31). First, to confirm that the opgG::Tn mutation increases the expression of colanic acid, we measured the amount of colanic acid in the opgG::Tn mutant. The opgG::Tn mutant had greater amounts of colanic acid than the parent strain (Fig. 3A). The increased amount of colanic acid in the opgG::Tn mutant was decreased by introducing the intact opgGH operon (Fig. 3A). In the wza- and rcsB-null backgrounds, the opgG::Tn mutation did not increase the amount of colanic acid (Fig. 3B). Thus, the opgGH knockout increases the amount of colanic acid via the RcsCDB phosphorelay system. The wza and rcsB deletions did not alter E. coli resistance to vancomycin (Fig. 4A) and the killing activity against silkworms (Fig. 5A and B). In both the wza- and rcsB-null backgrounds, the opgG::Tn mutation increased E. coli growth in the presence of vancomycin (Fig. 4B) and increased the killing activity of E. coli against silkworms (Fig. 5A and B). The increased vancomycin resistance and the increased silkworm killing activity in the Δwza/opgG::Tn double mutant or the ΔrcsB/opgG::Tn double mutant were cancelled by introducing the intact opgGH operon (Fig. 4B and 5A and B). These findings suggest that the opgGH knockout causes E. coli resistance to vancomycin and increases E. coli virulence against silkworms in a colanic acid-independent manner and that the increased production of colanic acid in the opgGH knockout strain has little role in these E. coli phenotypes.
FIG 3.
The opgGH knockout increases the amount of colanic acid. (A) The amount of colanic acid in the Parent/pMW118, opgG::Tn/pMW118, or opgG::Tn/popgGH strain was measured. Means ± standard errors from three experiments are shown. Asterisks indicate P values of <0.05. (B) The amount of colanic acid in the parent, opgG::Tn, Δwza, Δwza/opgG::Tn, ΔrcsB, or ΔrcsB/opgG::Tn E. coli strain was measured. Means ± standard errors from three experiments are shown. The asterisk indicates a P value of <0.05.
FIG 4.
The opgGH knockout increases E. coli resistance to vancomycin in the colanic acid-negative, envZ/ompR-null, and evgS-null backgrounds. E. coli overnight cultures were serially diluted 10-fold, spotted onto LB agar plates without or supplemented with vancomycin, and incubated at 37°C. The experiments were performed twice, and one of two data sets is presented in Fig. S2 in the supplemental material.
FIG 5.
The opgGH knockout increases E. coli killing activity against silkworms in the colanic acid-negative, envZ/ompR-null, and evgS-null backgrounds. The silkworm killing activity of E. coli strains was examined. Silkworms were injected with E. coli cells (1.9 × 108 CFU), and silkworm survival was monitored. The experiment was performed twice, and the data were pooled (n = 20). The data for the parent and opgG::Tn strains are identical in panels A and B and the data for the parent and ΔopgGH strains are identical in panels C and E, because these experiments were performed at the same time. Asterisks indicate that the log rank test P value is <0.05.
Knockout of opgGH increases E. coli virulence in an envZ/ompR-null background.
A previous report revealed that a mutation in the envZ/ompR locus, which encodes a two-component system involved in responses to osmotic stress, suppressed the motility defects of the opgGH mutants (5). The envZ/ompR locus regulates the expression of OmpF and OmpC, which are membrane porins important for antibiotic resistance (21). Recently, Caby et al. reported that the envZ/ompR system needs OPG for its proper activation in D. dadantii (23). Therefore, we hypothesized that the absence of OPG affects the envZ/ompR activation to increase antibiotic resistance, and we examined whether the knockout of envZ/ompR suppresses the antimicrobial resistance and virulence in the opgGH knockout strain. The transposon insertion mutants of the envZ and ompR genes (envZ::Tn and ompR::Tn) were sensitive to vancomycin, compared to the parent strain (Fig. 4A and C). In the envZ- and ompR-disrupted backgrounds, the opgGH deletion did not show clear effects in the presence of 360 μg/ml vancomycin but increased E. coli growth in the presence of 180 μg/ml vancomycin (Fig. 4C). The opgGH deletion increased the killing activity of E. coli against silkworms in the envZ- and ompR-disrupted backgrounds (Fig. 5C and D). The increased vancomycin resistance and the increased silkworm killing activity in the envZ::Tn/ΔopgGH mutant and the ompR::Tn/ΔopgGH mutant were cancelled by introducing the intact opgGH operon. These findings suggest that the increased vancomycin resistance and virulence in the opgGH knockout strain are not due to activation of the envZ/ompR system.
Knockout of opgGH increases expression of the two-component system evgS/evgA.
To investigate the molecular mechanism by which opgGH knockout increases E. coli resistance to antimicrobial substances, as well as E. coli virulence, we performed RNA sequence analysis to identify gene expression changes caused by opgGH dysfunction. In the opgG::Tn mutant, a number of gene transcripts were changed, including increased expression of the two-component system evgS/evgA, which functions in E. coli resistance to acids and antibiotics (32, 33) (Table 1). In addition, expression of hdeA, hdeB, hdeD, and gadB, which is positively regulated by evgS/evgA (33), was increased in the opgG::Tn mutant (Table 1). Gene ontology (GO) analysis categorized the functions of genes whose expression was changed in the opgG::Tn mutant (Table S2). One-third of the genes were related to GO categories for the membrane and plasma membrane (Table S2), suggesting that the opgG::Tn mutation altered the expression of membrane-related genes. To determine whether evgS/evgA is required for the effect of opgGH knockout on the E. coli phenotype, we examined the effect of the opgGH deletion in the evgS-null background. The evgS deletion did not have much effect on the E. coli growth in the presence of vancomycin (Fig. 4A) but slightly decreased the killing activity of E. coli against silkworms (Fig. 5E). In the evgS-null background, the opgGH deletion increased bacterial growth in the presence of vancomycin (Fig. 4C) and increased E. coli killing activity against silkworms (Fig. 5E). The increased vancomycin resistance and the increased silkworm killing activity in the ΔevgS/ΔopgGH mutant were canceled by introducing the intact opgGH operon (Fig. 4C and 5E). These findings suggest that the increased vancomycin resistance and virulence in the opgGH knockout strain are not due to activation of the evgS/evgA system.
DISCUSSION
In this study, we applied a bacterial experimental evolution method in a silkworm infection model and revealed that knockout of OPG synthases increased E. coli virulence against silkworms. We also found that knockout of OPG synthases increased E. coli resistance to silkworm antimicrobial peptides, vancomycin, and levofloxacin. Our findings provide evidence of a novel mechanism in which the absence of OPG increases bacterial antimicrobial resistance and causes high bacterial virulence.
OPG synthases are required for the virulence of many bacterial species. Several molecular mechanisms are proposed for the attenuated virulence of OPG synthase knockout mutants, including a motility defect in S. enterica serovar Typhimurium, a biofilm formation defect in P. aeruginosa (34), reduced secretion of enzymes in D. dadantii (12), decreased bacterial adhesion to host cells in A. tumefaciens (13), and decreased bacterial invasion of host cells in B. abortus (7). In these bacterial species, the resistance of the OPG mutants to some antimicrobial substances was not reported. Rather, the OPG mutant of D. dadantii was sensitive to bile acids (12), and the OPG mutant of P. aeruginosa was sensitive to antibiotics (34). Because the OPG mutant of E. coli is resistant to antimicrobial peptides and antibiotics and has high killing activity against silkworms, the role of OPG is clearly distinct between E. coli and the aforementioned bacterial species. In contrast, Yersinia pestis, a well-known human pathogen causing Black Death, does not carry opgGH; therefore, the absence of OPG has been hypothesized to underlie the virulence of Y. pestis (16). Transforming the Y. pestis strain with opgGH, however, does not attenuate the virulence activity, compared with the original Y. pestis strain (16), which does not support a relationship between the absence of OPG and bacterial virulence. The distinct roles of OPG among bacterial species suggest that OPG is involved in the virulence system specific to each bacterial species. Further studies are needed to investigate the developmental mechanism of the distinct roles of OPG among bacterial species.
We examined the involvement of colanic acid, envZ/ompR, and evgS in the increased virulence of the opgGH knockout mutant. By evaluating double gene deletion mutants, we found that opgGH knockout increases E. coli virulence through unidentified mechanisms other than colanic acid, envZ/ompR, and evgS (Fig. 6). The rate of increase in the vancomycin resistance and the silkworm killing activity caused by the opgGH knockout was not affected by the negative backgrounds for colanic acid, envZ/ompR, and evgS. Thus, we assume that most of the effects of the opgGH knockout cannot be explained by these factors (Fig. 6). A number of gene expression changes other than evgS/evgA that were observed in the opgG::Tn mutant may explain the increased virulence caused by the absence of OPG and should be investigated in future studies. It is also possible that, rather than gene expression changes, physical changes caused by the absence of OPG cause E. coli antimicrobial resistance, as follows. (i) OPG might function as a stabilizer for antimicrobial substances. OPG is modified with phosphoglycerol, succinyl, and phosphoethanolamine and thus has a negative electric charge (1, 35). Because silkworm antimicrobial peptides, vancomycin, and phage lysis proteins have a positive charge, a negatively charged surface of OPG may absorb and accumulate these antimicrobial substances in the periplasmic space. Hydrophobic antibiotics such as levofloxacin and tetracycline may bind to the hydrophobic part of OPG. Such hydrophobic interactions have not been reported for E. coli OPG, which is a β-1,6-linked glucan containing 5 to 12 glucose units, but several other bacterial OPGs, i.e., β-1,2-linked cyclic glucan containing 17 to 25 glucose units, can form a complex with hydrophobic molecules (36, 37). (ii) Structural changes in the bacterial cell surface might be involved in the antimicrobial resistance of the opgGH knockout mutant. Höltje et al. reported that an opgGH mutant was resistant to lysis proteins from phages MS2 and X174 (38), which is similar to our finding that the opgGH knockout mutant is resistant to antimicrobial peptides. Those authors used electron microscopy to analyze the opgGH mutant after exposure to plasmolytic conditions and found that the periplasmic space of the opgGH mutant was larger than that of the parent strain (38). Based on this observation, they proposed that a correct arrangement of the inner and outer membranes caused E. coli resistance to phage lysis proteins (38). Such alteration of the inner and outer membranes may disturb the access of antimicrobial peptides and antibiotics to the inner membrane. Further studies are needed to investigate the molecular mechanisms by which the absence of OPG increases E. coli resistance to antimicrobial substances.
FIG 6.
Model for the virulence upregulation triggered by the absence of OPG. Knockout of opgGH leads to E. coli resistance to antibiotics (vancomycin and levofloxacin) and antimicrobial peptides and the killing activity against silkworms via a colanic acid-, EvgS-, and EnvZ/OmpR-independent manner. The question mark indicates unidentified mechanisms through which the knockout of opgGH increases E. coli virulence. Knockout of opgGH increases the amount of colanic acid and activates EvgS-EvgA. Knockout of opgGH affects the activation of EnvZ-OmpR in D. dadantii (23).
Bacterial evolution experiments in the silkworm infection model have so far identified two gene mutations causing high levels of E. coli virulence, i.e., amino acid substitutions of the lipopolysaccharide transporter (29) and an absence of OPG. Identification of other gene mutations causing high levels of virulence in bacterial evolution experiments will further our understanding of how bacteria acquire virulence properties.
MATERIALS AND METHODS
Bacterial strains and culture conditions.
E. coli strains were aerobically cultured in lysogeny broth (LB) medium at 37°C. The E. coli mutant strains carrying mini-Tn10 or the chloramphenicol resistance gene from pKD3 were grown on LB agar plates containing kanamycin (50 μg/ml) or chloramphenicol (25 μg/ml) when required. E. coli strains transformed with pKD46, pCP20, or pMW118 were cultured in LB medium containing ampicillin (100 μg/ml). The bacterial strains and plasmids used in this study are listed in Table 2.
TABLE 2.
Bacterial strains and plasmids used
| Strain or plasmid | Genotypes or characteristicsa | Source or referenceb |
|---|---|---|
| Strains | ||
| KP7600 | W3110 type A; F− lacIq lacZΔM15 λ− galK2 galT22 IN(rrnD-rrnE)1 | NBRP |
| HVA10 | Highly virulent mutant from KP7600 carrying opgH Trp30stop | This study |
| HVA13 | Highly virulent mutant from KP7600 carrying opgH Gly360Glu | This study |
| HVA23 | Highly virulent mutant from KP7600 carrying opgH Glu464Lys | This study |
| HVK4a | Highly virulent mutant from KP7600 carrying opgH His407Tyr | This study |
| HVK7b | Highly virulent mutant from KP7600 carrying opgG Gln239stop | This study |
| HVK7a | Highly virulent mutant from KP7600 carrying opgH Gly316Ser | This study |
| HVA17 | Highly virulent mutant from KP7600 carrying opgH Gln398stop | This study |
| HVK6a | Highly virulent mutant from KP7600 carrying opgH Trp673stop | This study |
| HVA22 | Highly virulent mutant from KP7600 carrying opgG Gln67stop | This study |
| HVK5a | Highly virulent mutant from KP7600 carrying opgH Trp806stop | This study |
| JD22094 | KP7600 opgG::mini-Tn10 (inserted 178 bp from initial codon) Kanr | NBRP |
| JD25108 | KP7600 envZ::mini-Tn10 Kanr | NBRP |
| JD25110 | KP7600 ompR::mini-Tn10 Kanr | NBRP |
| JW1035 | BW25113 opgG::kan Kanr | NBRP |
| JW2367 | BW25113 evgS::kan Kanr | NBRP |
| K0900 | KP7600 ΔopgG::markerless (transduced from Keio Collection JW1035) | This study |
| K0901 | KP7600 ΔopgH::markerless | This study |
| K1000 | KP7600 opgGH::cat Cmr | This study |
| K1001 | KP7600 rcsB::cat Cmr | This study |
| K1002 | KP7600 wza::cat Cmr | This study |
| K1003 | KP7600 evgS::kan Kanr (transduced from Keio Collection JW2367) | This study |
| K1004 | KP7600 rcsB::cat Cmr opgG::mini-Tn10 Kanr | This study |
| K1006 | KP7600 wza::cat Cmr opgG::mini-Tn10 Kanr | This study |
| K1008 | KP7600 evgS::kan Kanr opgGH::cat Cmr | This study |
| K1009 | KP7600 envZ::mini-Tn10 Kanr opgGH::cat Cmr | This study |
| K1010 | KP7600 ompR::mini-Tn10 Kanr opgGH::cat Cmr | This study |
| Plasmids | ||
| pMW118 | Low-copy-number plasmid; Ampr | Nippon Gene |
| popgG | pMW118 with opgG; Ampr | This study |
| popgH | pMW118 with opgH; Ampr | This study |
| popgGH | pMW118 with opgGH operon; Ampr | This study |
| pKD46 | λRed recombinase expression; temperature sensitive, Ampr | 42 |
| pKD3 | flp-cat-flp Cmr Ampr | 42 |
| pCP20 | FLP recombinase; Ampr | 42 |
Kanr, kanamycin resistance; Cmr, chloramphenicol resistance; Ampr, ampicillin resistance.
NBRP, National BioResource Project.
Silkworms.
Third-instar silkworms (Fu/Yo × Tsukuba/Ne) were purchased from Ehime Sansyu (Ehime, Japan) and fed an artificial diet (Silkmate 2S; Nihon Nosan Kogyo Co., Kanagawa, Japan) at 27°C (39). Fifth-instar silkworms were fed an antibiotic-free artificial diet (Sysmex Co., Hyogo, Japan) for 1 day and used for the infection experiments.
Experimental evolution in the silkworm infection model.
The details of the bacterial experimental evolution method were described in our previous report (29). In brief, an overnight culture of E. coli laboratory strain KP7600 was inoculated into a 100-fold greater amount of fresh LB liquid medium containing 0.2% ethyl methanesulfonate and was aerobically cultured overnight. The overnight culture was inoculated into a 100-fold greater amount of LB liquid medium without ethyl methanesulfonate and was aerobically cultured overnight. We prepared 32 bacterial cultures, which were independently treated with ethyl methanesulfonate. Silkworms (n = 2) were injected in the hemolymph with 0.05 ml of the bacterial culture and were maintained at 37°C. Two days after the injection, dead silkworms were dissected, and the hemolymph was spread on tryptic soy broth agar plates. Single colonies that showed different morphologies were restreaked on tryptic soy broth agar plates to isolate single colonies. Single colonies were cultured in LB liquid medium to which glycerol had been added at a 40% final concentration, and they were stored at −80°C. Single colonies were also tested for killing activity against silkworms as described below.
Silkworm infection experiments.
Overnight cultures of an E. coli strain were centrifuged at 4,050 × g for 10 min, and the bacterial pellet was suspended in 0.9% NaCl. Silkworms were injected in the hemolymph with 0.05 ml of the bacterial solution using a 1-ml syringe equipped with a 27-gauge needle (40, 41), and they were maintained at 37°C. The numbers of living silkworms were counted every 12 h after the injection. The optical density at 600 nm (OD600) of the overnight cultures was measured to confirm that the bacterial numbers did not differ among E. coli strains.
Whole-genome sequencing analysis.
E. coli genomic DNA was extracted using a QIAamp DNA blood minikit (Qiagen). A DNA library carrying 300-bp genomic DNA fragments was prepared and sequenced using a HiSeq 2500 system (Illumina). At least 400 million base sequences of 100-bp paired-end reads were generated per sample. The data were analyzed using the CLC Genomics Workbench software (version 11.0). The reads were mapped to a reference genome of the E. coli W3110 strain, and the single-nucleotide polymorphisms causing amino acid substitutions were identified using the basic variant detection program in the CLC software.
Examination of E. coli resistance to antimicrobial substances.
To examine E. coli resistance to cecropin A, an overnight culture of E. coli (30 μl) was inoculated into 3 ml of liquid LB medium and aerobically cultured. At 60 min after the inoculation, cecropin A (Anygen Co., Ltd., Gwangju, South Korea) was added to 300 μl of the bacterial culture. The OD600 was measured 2 h after the addition of cecropin A.
To evaluate E. coli resistance to antibiotics, an overnight culture of E. coli was serially diluted 10-fold in a 96-well plate, spotted onto LB agar plates containing vancomycin, levofloxacin, or tetracycline, and incubated at 37°C.
Measurement of colanic acid.
Colanic acid was extracted according to the previous method (30) with minor modifications. Each E. coli strain was aerobically cultured in 5 ml of M9 medium overnight at 30°C, and the culture was boiled for 15 min. The sample was centrifuged at 12,000 × g for 10 min, and the supernatant was mixed with a 3-fold greater amount of ice-cold ethanol and stored at 4°C overnight. The sample was centrifuged at 10,000 × g for 10 min, and the precipitate was dried. The dried precipitate was suspended in 2.5 ml water, mixed with a 5-fold greater volume of tetraborate-sulfuric acid solution (0.475 mg/liter), and boiled for 5 min. Hydroxydiphenyl solution (0.15% 3-phenylphenol, 0.5% NaOH; 10 μl) was added to 1.2 ml of the sample, and the OD526 was measured.
Genetic manipulation.
The wza, rcsB, opgH, and opgGH deletion mutants were constructed using the method described by Datsenko and Wanner (42). Briefly, DNA fragments for gene targeting were amplified by PCR using primer pairs with homology to target genes (Table 3) from pKD3 or pKD4 as a template and then were electroporated into the KP7600 strain carrying pKD46. From the colonies that appeared on plates containing chloramphenicol or kanamycin, gene deletion mutants were screened by PCR. To make opgG and evgS mutants, the deletions of opgG and evgS in the Keio Collection library (43) were transferred to KP7600 by transduction using phage P1vir (44). To construct a double deletion mutant, a gene deletion was transferred to another gene deletion mutant by transduction using phage P1vir (44). To construct markerless deletion mutants of opgG and opgH, the opgG and opgH mutants were transformed with pCP20 expressing the FLP recombinase (42). After confirmation of the loss of the kan cassette, the mutants were cultured at 43°C to remove pCP20.
TABLE 3.
Primers used in this study
| Primer | Sequence |
|---|---|
| Primers to amplify opgGH operon | |
| opgGH_F2_BamHI | GGAGGATCCACGGGTGGTGAACCAGATAG |
| opgGH_R3_HindIII | AAGAAGCTTATACGGGCCATGATGAATGT |
| Primers to construct popgG and popgH | |
| opgH-Del-F2 | ATATTCTTCATGGGTGAGTTATTACGAAGGGATA |
| opgH-Del-R | GCATTGCGTCAATGTACTCAGTTGTCTTATTCAT |
| opgG-Del-F | ACTGAAATGCGTGCTGCGCTGGTGAATGCCGATCA |
| opgG-Del-R | ACTGCAGCACTCAACCAACGCATTTTCATCAT |
| Targeting primers to delete genes | |
| opgG-H1-P1 | AAGGGGGAAGTGCTTACTAATTATGAAACATAAACTACAAGTGTAGGCTGGAGCTGCTTC |
| opgH-H2-P2 | TGTAGGCCTGATAAGCGTAGCGCATCAGGCAACTACGTTTCATATGAATATCCTCCTTAG |
| opgH-H1-P1 | ATGAATAAGACAACTGAGTACATTGACGCAATGCCCATCGGTGTAGGCTGGAGCTGCTTC |
| rcsB-H1-P1 | AGTTATGTCAAGAGCTTGCTGTAGCAAGGTAGCCTATTACGTGTAGGCTGGAGCTGCTTC |
| rcsB-H2-P2 | CAGATAAGACACTAACGCGTCTTATCTGGCCTACAGGTGACATATGAATATCCTCCTTAG |
| wza-H1-P1 | GTGCACAGGATAATTACTCTGCCAAAGTGATAAATAAACAGTGTAGGCTGGAGCTGCTTC |
| wza-H2-P2 | TTGCCGACACAGACAACTAAGATGTTGTTAAACATGACGACATATGAATATCCTCCTTAG |
To construct popgGH, carrying the intact opgGH operon, a DNA fragment containing the opgGH operon was amplified by PCR using primer pairs (Table 3) and genomic DNA of KP7600 as a template. The amplified DNA fragment was inserted into the BamHI and HindIII sites of pMW118, resulting in popgGH. To construct popgG or popgH, carrying the intact opgG or opgH gene, respectively, a DNA fragment containing the opgG or opgH gene with pMW118 was amplified by PCR using primer pairs (Table 3) from popgGH as a template. The amplified DNA fragment was self-ligated, resulting in popgG and popgH.
RNA sequence analysis.
Total RNA of E. coli was extracted according to a previously described method (45) with minor modifications. Fifty microliters of an overnight culture of the KP7600 or JD22094 strain was inoculated into 5 ml LB medium and aerobically cultured at 37°C. When the OD600 of the culture reached 0.7, 1.8 ml of culture was vortex-mixed with 200 μl of 5% phenol in ethanol, chilled in ice water for 5 min, and centrifuged at 21,500 × g for 2 min. The bacterial precipitate was frozen in liquid nitrogen and stored at −80°C for 2 h. The precipitate was dissolved in 200 μl lysis buffer (TE buffer, 1% lysozyme, 1% SDS) and incubated at 65°C for 2 min. The sample was subjected to RNA extraction using an RNeasy minikit (Qiagen) according to the manufacturer’s protocol. rRNA was removed from the total RNA using a NEBNext rRNA depletion kit (NEB), and RNA was converted to a DNA library using a TruSeq stranded total RNA kit (Illumina). RNA sequencing was performed using a NovaSeq 6000 system (Illumina), and at least 4 billion base sequences of 100-base paired-end reads were generated per sample. The data were analyzed using the CLC Genomics Workbench software (version 11.0). The reads were mapped to a reference genome of the E. coli W3110 strain (NCBI reference sequence NC_007779.1), and the reads per kilobase of transcript per million mapped reads (RPKM) values were compared between the KP7600 and JD22094 strains. The experiment was independently performed three times to identify the genes for which the mean values differed by >2-fold between KP7600 and JD22094 and the false discovery rate P value was <0.05. GO analysis was performed using software developed by the European Molecular Biology Laboratory (https://www.ebi.ac.uk/QuickGO).
Statistical analysis.
Differences in the amounts of colanic acid were assessed using Student's t test in Microsoft Excel for the Mac 2011 (version 14.0.0). Statistics on the survival curves were performed using the log rank test with GraphPad PRISM software (version 5.0c). Differences in gene expression were analyzed using the Empirical analysis of DGE in CLC Genomics Workbench (version 11.0).
Data availability.
The whole-genome sequencing reads of 10 highly virulent E. coli mutants were deposited in the DDBJ (accession numbers DRA010694, SAMD00241774 [HVA10], SAMD00241775 [HVA13], SAMD00241780 [HVA17], SAMD00241782 [HVA22], SAMD00241776 [HVA23], SAMD00241777 [HVK4a], SAMD00241783 [HVK5a], SAMD00241781 [HVK6a], SAMD00241779 [HVK7a], and SAMD00241778 [HVK7b]). The RNA sequencing reads for KP7600 and JD22094 were deposited in DDBJ (accession numbers DRA010695, SAMD00241787 [JD22094-1], SAMD00241789 [JD22094-2], SAMD00241791 [JD22094-3], SAMD00241786 [KP7600-1], SAMD00241788 [KP7600-2], and SAMD00241790 [KP7600-3]).
ACKNOWLEDGMENTS
This study was supported by JSPS Grants-in-Aid for Scientific Research (grants 19H03466 and 19K22523), the Takeda Science Foundation, the Ichiro Kanehara Foundation, and the Ryobi Teien Memory Foundation.
We thank the National BioResource Project-E. coli (National Institute of Genetics, Japan) for providing the KP7600 strain, the mini-Tn10 library, and the Keio Collection.
Footnotes
Supplemental material is available online only.
jb.00515-20-s0001.pdf (4.5MB, pdf)
Contributor Information
Chikara Kaito, Email: ckaito@okayama-u.ac.jp.
Laurie E. Comstock, Brigham and Women's Hospital/Harvard Medical School
REFERENCES
- 1.Bontemps-Gallo S, Bohin JP, Lacroix JM. 2017. Osmoregulated periplasmic glucans. EcoSal Plus 7:0001-2017. 10.1128/ecosalplus.ESP-0001-2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Kennedy EP. 1982. Osmotic regulation and the biosynthesis of membrane-derived oligosaccharides in Escherichia coli. Proc Natl Acad Sci U S A 79:1092–1095. 10.1073/pnas.79.4.1092. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Bontemps-Gallo S, Lacroix JM. 2015. New insights into the biological role of the osmoregulated periplasmic glucans in pathogenic and symbiotic bacteria. Environ Microbiol Rep 7:690–697. 10.1111/1758-2229.12325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Rajagopal S, Eis N, Bhattacharya M, Nickerson KW. 2003. Membrane-derived oligosaccharides (MDOs) are essential for sodium dodecyl sulfate resistance in Escherichia coli. FEMS Microbiol Lett 223:25–31. 10.1016/S0378-1097(03)00323-9. [DOI] [PubMed] [Google Scholar]
- 5.Fiedler W, Rotering H. 1988. Properties of Escherichia coli mutants lacking membrane-derived oligosaccharides. J Biol Chem 263:14684–14689. 10.1016/S0021-9258(18)68091-3. [DOI] [PubMed] [Google Scholar]
- 6.Weissborn AC, Rumley MK, Kennedy EP. 1992. Isolation and characterization of Escherichia coli mutants blocked in production of membrane-derived oligosaccharides. J Bacteriol 174:4856–4859. 10.1128/jb.174.14.4856-4859.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Briones G, Inon de Iannino N, Roset M, Vigliocco A, Paulo PS, Ugalde RA. 2001. Brucella abortus cyclic β-1,2-glucan mutants have reduced virulence in mice and are defective in intracellular replication in HeLa cells. Infect Immun 69:4528–4535. 10.1128/IAI.69.7.4528-4535.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Young GM, Miller VL. 1997. Identification of novel chromosomal loci affecting Yersinia enterocolitica pathogenesis. Mol Microbiol 25:319–328. 10.1046/j.1365-2958.1997.4661829.x. [DOI] [PubMed] [Google Scholar]
- 9.Mahajan-Miklos S, Tan MW, Rahme LG, Ausubel FM. 1999. Molecular mechanisms of bacterial virulence elucidated using a Pseudomonas aeruginosa-Caenorhabditis elegans pathogenesis model. Cell 96:47–56. 10.1016/s0092-8674(00)80958-7. [DOI] [PubMed] [Google Scholar]
- 10.Bhagwat AA, Jun W, Liu L, Kannan P, Dharne M, Pheh B, Tall BD, Kothary MH, Gross KC, Angle S, Meng J, Smith A. 2009. Osmoregulated periplasmic glucans of Salmonella enterica serovar Typhimurium are required for optimal virulence in mice. Microbiology (Reading) 155:229–237. 10.1099/mic.0.023747-0. [DOI] [PubMed] [Google Scholar]
- 11.Loubens I, Debarbieux L, Bohin A, Lacroix JM, Bohin JP. 1993. Homology between a genetic locus (mdoA) involved in the osmoregulated biosynthesis of periplasmic glucans in Escherichia coli and a genetic locus (hrpM) controlling pathogenicity of Pseudomonas syringae. Mol Microbiol 10:329–340. 10.1111/j.1365-2958.1993.tb01959.x. [DOI] [PubMed] [Google Scholar]
- 12.Page F, Altabe S, Hugouvieux-Cotte-Pattat N, Lacroix JM, Robert-Baudouy J, Bohin JP. 2001. Osmoregulated periplasmic glucan synthesis is required for Erwinia chrysanthemi pathogenicity. J Bacteriol 183:3134–3141. 10.1128/JB.183.10.3134-3141.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Puvanesarajah V, Schell FM, Stacey G, Douglas CJ, Nester EW. 1985. Role for 2-linked-β-d-glucan in the virulence of Agrobacterium tumefaciens. J Bacteriol 164:102–106. 10.1128/JB.164.1.102-106.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Minsavage GV, Mudgett MB, Stall RE, Jones JB. 2004. Importance of opgHXcv of Xanthomonas campestris pv. vesicatoria in host-parasite interactions. Mol Plant Microbe Interact 17:152–161. 10.1094/MPMI.2004.17.2.152. [DOI] [PubMed] [Google Scholar]
- 15.Liu L, Dharne M, Kannan P, Smith A, Meng J, Fan M, Boren TL, Ranallo RT, Bhagwat AA. 2010. Osmoregulated periplasmic glucans synthesis gene family of Shigella flexneri. Arch Microbiol 192:167–174. 10.1007/s00203-009-0538-z. [DOI] [PubMed] [Google Scholar]
- 16.Quintard K, Dewitte A, Reboul A, Madec E, Bontemps-Gallo S, Dondeyne J, Marceau M, Simonet M, Lacroix JM, Sebbane F. 2015. Evaluation of the role of the opgGH operon in Yersinia pseudotuberculosis and Its deletion during the emergence of Yersinia pestis. Infect Immun 83:3638–3647. 10.1128/IAI.00482-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Santini CL, Bernadac A, Zhang M, Chanal A, Ize B, Blanco C, Wu LF. 2001. Translocation of jellyfish green fluorescent protein via the Tat system of Escherichia coli and change of its periplasmic localization in response to osmotic up-shock. J Biol Chem 276:8159–8164. 10.1074/jbc.C000833200. [DOI] [PubMed] [Google Scholar]
- 18.Wieruszeski JM, Bohin A, Bohin JP, Lippens G. 2001. In vivo detection of the cyclic osmoregulated periplasmic glucan of Ralstonia solanacearum by high-resolution magic angle spinning NMR. J Magn Reson 151:118–123. 10.1006/jmre.2001.2348. [DOI] [PubMed] [Google Scholar]
- 19.Hill NS, Buske PJ, Shi Y, Levin PA. 2013. A moonlighting enzyme links Escherichia coli cell size with central metabolism. PLoS Genet 9:e1003663. 10.1371/journal.pgen.1003663. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Bontemps-Gallo S, Madec E, Dondeyne J, Delrue B, Robbe-Masselot C, Vidal O, Prouvost AF, Boussemart G, Bohin JP, Lacroix JM. 2013. Concentration of osmoregulated periplasmic glucans (OPGs) modulates the activation level of the RcsCD RcsB phosphorelay in the phytopathogen bacteria Dickeya dadantii. Environ Microbiol 15:881–894. 10.1111/1462-2920.12054. [DOI] [PubMed] [Google Scholar]
- 21.Forst S, Delgado J, Inouye M. 1989. Phosphorylation of OmpR by the osmosensor EnvZ modulates expression of the ompF and ompC genes in Escherichia coli. Proc Natl Acad Sci U S A 86:6052–6056. 10.1073/pnas.86.16.6052. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Lacroix JM, Loubens I, Tempete M, Menichi B, Bohin JP. 1991. The mdoA locus of Escherichia coli consists of an operon under osmotic control. Mol Microbiol 5:1745–1753. 10.1111/j.1365-2958.1991.tb01924.x. [DOI] [PubMed] [Google Scholar]
- 23.Caby M, Bontemps-Gallo S, Gruau P, Delrue B, Madec E, Lacroix JM. 2018. The EnvZ-OmpR two-component signaling system is inactivated in a mutant devoid of osmoregulated periplasmic glucans in Dickeya dadantii. Front Microbiol 9:2459. 10.3389/fmicb.2018.02459. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Gottesman S, Trisler P, Torres-Cabassa A. 1985. Regulation of capsular polysaccharide synthesis in Escherichia coli K-12: characterization of three regulatory genes. J Bacteriol 162:1111–1119. 10.1128/JB.162.3.1111-1119.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Stevenson G, Andrianopoulos K, Hobbs M, Reeves PR. 1996. Organization of the Escherichia coli K-12 gene cluster responsible for production of the extracellular polysaccharide colanic acid. J Bacteriol 178:4885–4893. 10.1128/jb.178.16.4885-4893.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Miajlovic H, Cooke NM, Moran GP, Rogers TR, Smith SG. 2014. Response of extraintestinal pathogenic Escherichia coli to human serum reveals a protective role for Rcs-regulated exopolysaccharide colanic acid. Infect Immun 82:298–305. 10.1128/IAI.00800-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Laubacher ME, Ades SE. 2008. The Rcs phosphorelay is a cell envelope stress response activated by peptidoglycan stress and contributes to intrinsic antibiotic resistance. J Bacteriol 190:2065–2074. 10.1128/JB.01740-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Ebel W, Vaughn GJ, Peters HK, III, Trempy JE. 1997. Inactivation of mdoH leads to increased expression of colanic acid capsular polysaccharide in Escherichia coli. J Bacteriol 179:6858–6861. 10.1128/jb.179.21.6858-6861.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Kaito C, Yoshikai H, Wakamatsu A, Miyashita A, Matsumoto Y, Fujiyuki T, Kato M, Ogura Y, Hayashi T, Isogai T, Sekimizu K. 2020. Non-pathogenic Escherichia coli acquires virulence by mutating a growth-essential LPS transporter. PLoS Pathog 16:e1008469. 10.1371/journal.ppat.1008469. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Ren G, Wang Z, Li Y, Hu X, Wang X. 2016. Effects of lipopolysaccharide core sugar deficiency on colanic acid biosynthesis in Escherichia coli. J Bacteriol 198:1576–1584. 10.1128/JB.00094-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Wehland M, Bernhard F. 2000. The RcsAB box: characterization of a new operator essential for the regulation of exopolysaccharide biosynthesis in enteric bacteria. J Biol Chem 275:7013–7020. 10.1074/jbc.275.10.7013. [DOI] [PubMed] [Google Scholar]
- 32.Ma Z, Masuda N, Foster JW. 2004. Characterization of EvgAS-YdeO-GadE branched regulatory circuit governing glutamate-dependent acid resistance in Escherichia coli. J Bacteriol 186:7378–7389. 10.1128/JB.186.21.7378-7389.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Itou J, Eguchi Y, Utsumi R. 2009. Molecular mechanism of transcriptional cascade initiated by the EvgS/EvgA system in Escherichia coli K-12. Biosci Biotechnol Biochem 73:870–878. 10.1271/bbb.80795. [DOI] [PubMed] [Google Scholar]
- 34.Lequette Y, Rollet E, Delangle A, Greenberg EP, Bohin JP. 2007. Linear osmoregulated periplasmic glucans are encoded by the opgGH locus of Pseudomonas aeruginosa. Microbiology (Reading) 153:3255–3263. 10.1099/mic.0.2007/008953-0. [DOI] [PubMed] [Google Scholar]
- 35.Bohin JP, Kennedy EP. 1984. Regulation of the synthesis of membrane-derived oligosaccharides in Escherichia coli: assay of phosphoglycerol transferase I in vivo. J Biol Chem 259:8388–8393. 10.1016/S0021-9258(17)39742-9. [DOI] [PubMed] [Google Scholar]
- 36.Lee S, Seo DH, Park HL, Choi Y, Jung S. 2003. Solubility enhancement of a hydrophobic flavonoid, luteolin by the complexation with cyclosophoraoses isolated from Rhizobium meliloti. Antonie Van Leeuwenhoek 84:201–207. 10.1023/a:1026075215921. [DOI] [PubMed] [Google Scholar]
- 37.Lee S, Cho E, Jung S. 2009. Periplasmic glucans isolated from proteobacteria. BMB Rep 42:769–775. 10.5483/bmbrep.2009.42.12.769. [DOI] [PubMed] [Google Scholar]
- 38.Holtje JV, Fiedler W, Rotering H, Walderich B, van Duin J. 1988. Lysis induction of Escherichia coli by the cloned lysis protein of the phage MS2 depends on the presence of osmoregulatory membrane-derived oligosaccharides. J Biol Chem 263:3539–3541. 10.1016/S0021-9258(18)68956-2. [DOI] [PubMed] [Google Scholar]
- 39.Kaito C, Kurokawa K, Matsumoto Y, Terao Y, Kawabata S, Hamada S, Sekimizu K. 2005. Silkworm pathogenic bacteria infection model for identification of novel virulence genes. Mol Microbiol 56:934–944. 10.1111/j.1365-2958.2005.04596.x. [DOI] [PubMed] [Google Scholar]
- 40.Kaito C, Akimitsu N, Watanabe H, Sekimizu K. 2002. Silkworm larvae as an animal model of bacterial infection pathogenic to humans. Microb Pathog 32:183–190. 10.1006/mpat.2002.0494. [DOI] [PubMed] [Google Scholar]
- 41.Kaito C, Murakami K, Imai L, Furuta K. 2020. Animal infection models using non-mammals. Microbiol Immunol 64:585–592. 10.1111/1348-0421.12834. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97:6640–6645. 10.1073/pnas.120163297. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H. 2006. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio Collection. Mol Syst Biol 2:2006 0008. 10.1038/msb4100050. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Thomason LC, Costantino N, Court DL. 2007. E. coli genome manipulation by P1 transduction. Curr Protoc Mol Biol 79:1.17.1–1.17.8. 10.1002/0471142727.mb0117s79. [DOI] [PubMed] [Google Scholar]
- 45.Sanchez-Vazquez P, Dewey CN, Kitten N, Ross W, Gourse RL. 2019. Genome-wide effects on Escherichia coli transcription from ppGpp binding to its two sites on RNA polymerase. Proc Natl Acad Sci U S A 116:8310–8319. 10.1073/pnas.1819682116. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The whole-genome sequencing reads of 10 highly virulent E. coli mutants were deposited in the DDBJ (accession numbers DRA010694, SAMD00241774 [HVA10], SAMD00241775 [HVA13], SAMD00241780 [HVA17], SAMD00241782 [HVA22], SAMD00241776 [HVA23], SAMD00241777 [HVK4a], SAMD00241783 [HVK5a], SAMD00241781 [HVK6a], SAMD00241779 [HVK7a], and SAMD00241778 [HVK7b]). The RNA sequencing reads for KP7600 and JD22094 were deposited in DDBJ (accession numbers DRA010695, SAMD00241787 [JD22094-1], SAMD00241789 [JD22094-2], SAMD00241791 [JD22094-3], SAMD00241786 [KP7600-1], SAMD00241788 [KP7600-2], and SAMD00241790 [KP7600-3]).