A-Type Carrier Proteins Are Involved in [4Fe-4S] Cluster Insertion into the Radical S-Adenosylmethionine Protein MoaA for the Synthesis of Active Molybdoenzymes

ABSTRACT

Iron sulfur (Fe-S) clusters are important biological cofactors present in proteins with crucial biological functions, from photosynthesis to DNA repair, gene expression, and bioenergetic processes. For the insertion of Fe-S clusters into proteins, A-type carrier proteins have been identified. So far, three of them have been characterized in detail in Escherichia coli, namely, IscA, SufA, and ErpA, which were shown to partially replace each other in their roles in [4Fe-4S] cluster insertion into specific target proteins. To further expand the knowledge of [4Fe-4S] cluster insertion into proteins, we analyzed the complex Fe-S cluster-dependent network for the synthesis of the molybdenum cofactor (Moco) and the expression of genes encoding nitrate reductase in E. coli. Our studies include the identification of the A-type carrier proteins ErpA and IscA, involved in [4Fe-4S] cluster insertion into the radical S-adenosyl-methionine (SAM) enzyme MoaA. We show that ErpA and IscA can partially replace each other in their role to provide [4Fe-4S] clusters for MoaA. Since most genes expressing molybdoenzymes are regulated by the transcriptional regulator for fumarate and nitrate reduction (FNR) under anaerobic conditions, we also identified the proteins that are crucial to obtain an active FNR under conditions of nitrate respiration. We show that ErpA is essential for the FNR-dependent expression of the narGHJI operon, a role that cannot be compensated by IscA under the growth conditions tested. SufA does not appear to have a role in Fe-S cluster insertion into MoaA or FNR under anaerobic growth employing nitrate respiration, based on the low level of gene expression.

IMPORTANCE Understanding the assembly of iron-sulfur (Fe-S) proteins is relevant to many fields, including nitrogen fixation, photosynthesis, bioenergetics, and gene regulation. Remaining critical gaps in our knowledge include how Fe-S clusters are transferred to their target proteins and how the specificity in this process is achieved, since different forms of Fe-S clusters need to be delivered to structurally highly diverse target proteins. Numerous Fe-S carrier proteins have been identified in prokaryotes like Escherichia coli, including ErpA, IscA, SufA, and NfuA. In addition, the diverse Fe-S cluster delivery proteins and their target proteins underlie a complex regulatory network of expression, to ensure that both proteins are synthesized under particular growth conditions.

INTRODUCTION

Iron-sulfur (Fe-S) clusters are inorganic cofactors that have been shown to play important roles in key biological processes, including respiration, photosynthesis, metabolism of nitrogen, sulfur, carbon, and hydrogen, biosynthesis of antibiotics, gene regulation, protein translation, replication, and DNA repair (1–6). Based on their functional diversity, Fe-S clusters can act as catalysts or redox sensors and are predicted to be used by a large number of proteins, with more than 165 that have been identified in Escherichia coli to date (2). The most common types of Fe-S clusters are rhombic [2Fe-2S] and cubic [4Fe-4S] clusters (6). In E. coli, the assembly of Fe-S clusters is catalyzed by two different enzyme systems: (i) the ISC (iron sulfur cluster) system, which is encoded by the iscRSUA-hscBA-fdx-iscX operon (7), is the housekeeping system that plays important roles under normal growth conditions, and (ii) the SUF (sulfur mobilization) system, which is encoded by the sufABCDSE operon and has a main role under stress conditions such as iron starvation or oxidative stress (3, 8, 9). Initial mobilization of sulfur for Fe-S cluster biosynthesis is catalyzed by the l-cysteine desulfurases IscS and SufS, which convert l-cysteine to l-alanine and form a protein-bound persulfide that is further transferred to scaffold-proteins for the formation of Fe-S clusters (2, 10–12). After Fe-S cluster assembly on the scaffold proteins IscU or SufB by the additional involvement of the chaperones HscA and HscB (in the ISC system) (13) and reducing equivalents (14), the formed [2Fe-2S] or [4Fe-4S] clusters are transferred to target apo-enzymes (3). Remaining critical gaps in our knowledge include how Fe-S clusters are transferred to their target proteins and how the specificity in this process is achieved (2). Specific proteins involved in Fe-S cluster insertion into target enzymes are known as A-type carriers (ATC) (15). So far, three of them have been characterized in detail in E. coli, namely, IscA, SufA, and ErpA (15, 16). IscA has been shown to be involved in Fe-S cluster transfer to ferredoxin and the transcriptional regulator for fumarate and nitrate reduction (FNR) under anaerobic fermentative growth conditions (17, 18). Moreover, roles of IscA and ErpA in Fe-S cluster delivery to formate:hydrogen lyase (19) and the hydrogen oxidizing [NiFe]-hydrogenase (19) have been reported. Besides A-type carriers, NfuA also binds [4Fe-4S] clusters and transports them to target enzymes like apo-aconitase (20), the iron-sulfur cluster-containing subunit NuoG of NADH dehydrogenase I (21), and the isopentenyl-adenosine tRNA methylthiolase MiaB (22). Further, NfuA is able to replace the degraded auxiliary [4Fe-4S] cluster of the lipoyl synthase LipA, which belongs to the superfamily of radical S-adenosyl-methionine (SAM) enzymes (23, 24). ErpA and NfuA have been shown to interact with each other and with apo-proteins to deliver Fe-S clusters under oxidative stress conditions (25).

In recent years, it has become evident that the biosynthesis of the molybdenum cofactor (Moco) and the assembly of Fe-S clusters are directly connected to each other (26). In E. coli, Moco biosynthesis thereby directly depends on the presence of Fe-S clusters or components of the Fe-S cluster assembly machinery at several levels. In the first step of Moco biosynthesis, involving the conversion of 5′GTP to cyclic pyranopterin monophosphate (cPMP), the MoaA protein requires two [4Fe-4S] clusters for activity (27). MoaA also belongs to the superfamily of radical SAM enzymes (26, 28), and contains two [4Fe-4S] clusters per monomer that are involved in the reductive cleavage of SAM and the binding of 5′GTP, respectively (27, 29, 68). In the second step of Moco biosynthesis, the conversion of cPMP to molybdopterin (MPT), the l-cysteine desulfurase IscS, as a major player for Fe-S cluster assembly, has a crucial role in mobilizing the sulfur for the synthesis of the dithiolene group present in MPT (30). Further, the expression of most genes encoding molybdoenzymes and some genes involved in Moco biosynthesis are regulated by FNR (31).

FNR is an important transcription factor involved in the regulation of genes with a role in anaerobic respiration, where FNR senses the availability of oxygen via the functionality of a [4Fe-4S] cluster that is converted to a [2Fe-2S] cluster in the presence of oxygen (32–35). Consequently, the expression of most genes encoding molybdoenzymes will not be activated when Fe-S clusters are not assembled. Last, most molybdoenzymes in E. coli harbor numerous Fe-S clusters that are involved in intramolecular electron transfer reactions and are essential for the activity of the enzymes (26, 36). Most molybdoenzymes in E. coli are part of respiratory systems. Nitrate is one of the commonly used alternative electron acceptors under anaerobic conditions (37), and the nitrate reductases catalyze the reduction of nitrate to nitrite using electrons usually supplied from the quinone pool. Under anaerobic conditions, the predominant respiratory nitrate reductase in E. coli is the NarGHI system. This enzyme forms a heterotrimer in the cytosol and binds Moco as bis-molybdopterin guanine dinucleotide (bis-MGD) and one [4Fe-4S] cluster to NarG, 4× [4Fe-4S] clusters and one [3Fe-4S] cluster to NarH, and several heme b cofactors to NarI (38). NarGH form a stable dimer that is attached to NarI at the cytoplasmic side of the membrane (39).

Overall, aerobic or anaerobic respiration depends on a functional Fe-S cluster assembly pathway based on the requirement of quinones as electron carriers, which are derived from isopentenyl diphosphate (IPP), the synthesis of which depends on the two essential [4Fe-4S] cluster-containing proteins IspG and IspH (40, 41). So far, however, most studies on the insertion of Fe-S clusters into target proteins have been performed under aerobic or anaerobic fermentative conditions (with glucose) in E. coli (16, 18, 24, 25, 42, 43). Only a few studies have been performed under anaerobic conditions using nitrate as the terminal electron acceptor, conditions which depend on both a functional Fe-S cluster assembly/insertion and a functional Moco biosynthesis pathway (19, 44, 45).

In this study, we aimed to further expand the knowledge of [4Fe-4S] cluster insertion into proteins. We analyzed the complex Fe-S cluster-dependent network for the synthesis of Moco and active molybdoenzymes, including MoaA, FNR, and the target molybdoenzyme nitrate reductase (NarGHI) under conditions of nitrate respiration. Before this study, it was unknown which proteins are involved in the insertion of the [4Fe-4S] clusters into MoaA. We used mutations in the genes erpA, iscA, and sufA, encoding A-type carrier proteins, in addition to a nfuA deletion strain, and analyzed the Moco content of these strains. Additionally, double mutant strains were analyzed, to reveal whether some of the proteins can functionally replace each other. The usage of ΔbolA, ΔgrxA, ΔgrxB, and ΔgrxC mutant strains were omitted in our study, since the absence of these gene products did not influence the cellular Moco content or the activity of nitrate reductase (see Fig. S1 in the supplemental material). The lethality of the erpA mutant and iscA and sufA double mutant strains was avoided by the introduction of the eukaryotic genes for the synthesis of mevalonate (MVA⁺), which allows for the synthesis of IPP in an Fe-S cluster-independent pathway. The results show that under anaerobic conditions, ErpA and IscA are involved in the insertion of the [4Fe-4S] clusters into MoaA. Both proteins were shown to partially replace one another in this role. In addition, we analyzed the activity of FNR in the same mutant strains. Our results show that ErpA has an important role for the activity of FNR that cannot be compensated by IscA or SufA under conditions of nitrate respiration.

RESULTS

Analysis of the expression of the moaABCDE operon in A-type carrier and nfuA mutant strains.

To analyze the insertion of [4Fe-4S] clusters into MoaA for the production of Moco, it was necessary to ensure that the expression of moaA remained unaltered in E. coli strains carrying mutations in the A-type carrier protein genes ΔerpA, ΔiscA, and ΔsufA and in the ΔnfuA mutant strain compared to the MG1655 MVA⁺ wild-type strain. This analysis is important, since the moaABDCE operon has been shown to be activated by the FNR protein (46, 47), the activity of which depends on a functional [4Fe-4S] cluster (35). We used the previously reported PmoaA-L–lacZ fusion on the replicative plasmid pGE593 that includes a 477-bp fragment upstream of the moaA ATG start codon containing the reported FNR-binding site (46). The E. coli wild type and the strains ΔerpA, ΔiscA, ΔnfuA, ΔsufA, and Δfnr were grown under anaerobic conditions in the presence of 15 mM potassium nitrate and 1 mM mevalonate, and the β-galactosidase activities were measured after 8 h of growth. This time point was chosen because, despite a growth defect in mutant strains of some of the A-type carrier proteins, all strains reached the late exponential phase after 8 h (see Fig. S2 in the supplemental material). The results show an ∼40% lower β-galactosidase activity of the PmoaA-L–lacZ fusion under anaerobic conditions in the Δfnr mutant strain (Fig. 1), which is consistent with previous reports and shows that FNR acts as a transcriptional activator of the operon but is not completely essential for its expression (46). In comparison, the ΔiscA mutant showed an ∼20% reduced β-galactosidase activity and the ΔerpA mutant strain an ∼15% reduced β-galactosidase activity. In the ΔsufA and ΔnfuA strains, the β-galactosidase activities remained unchanged in comparison to the MG1655 MVA⁺ wild-type strain (Fig. 1).

FIG 1.

Expression of a PmoaA-L–lacZ fusion in mutant strains of A-type carrier proteins and nfuA and fnr. The β-galactosidase activities in Miller units were determined for the PmoaA-L–lacZ fusion in wild type (Wt, MG1655 MVA⁺), ΔerpA, ΔiscA, ΔnfuA, ΔsufA, and Δfnr mutant strains. Standard deviations were calculated from three biological replicates. The P values were calculated using an unpaired t test (ns, P > 0.05; *, P ≤ 0.05; **, P ≤ 0.01).

Conclusively, since the moaABCDE operon is expressed in the A-type carrier mutant strains ΔerpA, ΔiscA, and ΔsufA, and in the ΔnfuA mutant strain, the production of Moco and the activities of molybdoenzymes can be studied in these strains. The slightly reduced expression of the operon in the ΔiscA and ΔerpA strains might indicate that these two proteins are involved in [4Fe-4S] cluster insertion into FNR, as suggested previously (18).

Detection of IscS abundance and expression of iscR and sufA in A-type carrier and nfuA mutant strains.

Since the IscS protein not only is involved in Fe-S cluster biosynthesis but also provides the sulfur for the biosynthesis of Moco, it is additionally important to verify whether the cellular levels of IscS remain unaltered in the absence of the A-type carrier proteins IscA, SufA, and ErpA, or the NfuA protein. Otherwise, changes in cellular Moco levels might be based on lower levels of IscS in these strains. To analyze the cellular levels of IscS, an antiserum raised against IscS was used in Western blotting. The Moco-deficient strain ΔmoeB was used as a control. MG1655 MVA⁺ wild type and the mutant strains were grown anaerobically for 8 h in LB medium supplemented with 15 mM potassium nitrate and 1 mM mevalonate. The results show that IscS was detectable in similar amounts in the mutant strains ΔmoeB, ΔiscA, ΔnfuA and ΔsufA, with slightly higher levels in strain ΔerpA (Fig. 2). Conclusively, any effects observed in the A-type carrier and ΔnfuA mutant strains will generally not be based on reduced levels of IscS in these strains.

FIG 2.

Immunodetection of IscS in mutant strains of A-type carrier proteins and nfuA. Aliquots of 50 μg of the total protein fraction of cell extracts of strains MG1655 MVA⁺ (wild type), ΔmoeB, ΔiscA, ΔerpA, ΔnfuA, and ΔsufA were separated by 12% SDS-PAGE and transferred onto a PVDF membrane. An IscS-specific antiserum (1:5,000 dilution) was used and visualized by enhanced chemiluminescence. The ΔiscS cell extract served as a negative control. The band at 45 kDa corresponds to IscS.

Further, the expression of the iscRSUA-hscBA-fdx-iscX and the sufABCDSE operons is regulated by IscR, a protein that represses the expression of iscRSUA-hscBA-fdx-iscX in its [2Fe-2S] cluster-bound form and activates the expression of sufABCDSE in its apo-form (48). To analyze the role of ErpA, IscA, SufA, and NfuA for [2Fe-2S] cluster insertion into IscR, we additionally analyzed the expression of a replicative PiscR-lacZ and a PsufA-lacZ fusion in the ΔerpA, ΔiscA, ΔnfuA, and ΔsufA mutant strains under anaerobic conditions in the presence of 15 mM potassium nitrate and 1 mM mevalonate, growth conditions that have not been reported previously for the expression of these two operons.

The results show an increased β-galactosidase activity of the PiscR-lacZ fusion in the ΔerpA and ΔiscA strains but not in the ΔnfuA strain (Fig. 3A), which is consistent with previous reports analyzing the expression of a chromosomal iscR::lacZ fusion in these strains under aerobic conditions (42, 49). In comparison, the PsufA-lacZ fusion showed slightly increased β-galactosidase activities in the ΔerpA, ΔnfuA, and ΔsufA mutant strains and a ∼38% reduced β-galactosidase activity in the ΔiscA mutant strain (Fig. 3B). Overall, as expected, the expression of the PsufA-lacZ fusion is more than 20-fold lower than the expression of the PiscR-lacZ fusion, underlining the more important role of the ISC system under anaerobiosis, while the SUF system is more important under aerobic growth and iron-limiting conditions. Comparable results were obtained for the expression of a chromosomal PiscR::lacZ fusion by Vinella et al. (42) under aerobic conditions, showing a more than 3-fold higher expression in ΔerpA, ΔiscA, ΔsufA ΔiscA, and ΔsufA ΔiscA ΔerpA mutant strains. Studies by Giel et al. (49) and Mettert et al. (50) of a PiscR::lacZ fusion under anaerobic fermentative conditions also showed a derepression in mutant strains of the SUF and ISC systems. However, under anaerobic conditions, the activation of the two operons and in particular of the suf operon seems to be lower in the absence of Fe-S clusters in comparison to aerobic or fermentative growth conditions. In summary, we conclude that any effects based on the absence of A-type carrier proteins and NfuA will not be based on the lack of expression of the ISC system, while the SUF system only shows an overall low expression.

FIG 3.

Expression of a PiscR-lacZ (A) and a PsufA-lacZ fusion (B) in mutant strains of A-type carrier proteins and nfuA. The β-galactosidase activities in Miller units were determined for the PiscR-lacZ (A) and the PsufA-lacZ (B) fusion in wild type (Wt, MG1655 MVA⁺), ΔerpA, ΔiscA, ΔnfuA, and ΔsufA mutant strains. Standard deviations were calculated from three biological replicates. The P values were calculated using an unpaired t test (ns, P > 0.05; **, P ≤ 0.01; ***, P ≤ 0.005).

Synthesis of Moco in A-type carrier and nfuA mutant strains.

To identify the protein that inserts [4Fe-4S] clusters into MoaA, we analyzed the effect of mutations on Moco production in the single mutant strains ΔmoeB (negative control), ΔerpA, ΔiscA, ΔnfuA, ΔsufA, and Δfnr and the double mutant strains ΔerpA ΔiscA, ΔsufA ΔiscA, and ΔsufA ΔerpA, in comparison to the wild-type strain MG1655 MVA⁺. The amounts of Moco produced in the respective strains were quantified after anaerobic growth for 8 h in the presence of 15 mM potassium nitrate and 1 mM mevalonate. For the quantification of produced Moco, all cofactor forms in the cell extract were converted into the oxidized fluorescent derivative FormA, which was purified afterward from crude extracts after oxidation and separated on a reversed-phase high-pressure liquid chromatography (HPLC) column.

The results in Fig. 4A show that in the ΔmoeB negative control, as expected, no Moco was detected, while mutant strains containing deletions in either iscA or erpA showed a reduced Moco content. In the single ΔerpA and ΔiscA mutants, the Moco content was ∼40% reduced, whereas no Moco was detected in the ΔerpA ΔiscA double mutant strain. Since expression of the moaABCDE operon was shown to be slightly reduced in the single ΔerpA and ΔiscA mutants (Fig. 1), we additionally introduced the moaABCDE operon on a replicative plasmid under the control of an arabinose-inducible promoter into the mutant strains. The overexpression of the moaABCDE operon is expected to compensate for lower levels of Moco that might be based on the absence of active FNR, which is required for full activation of moaABCDE transcription. The cells were grown with 15 mM potassium nitrate, 1 mM mevalonate, and 0.2% arabinose. The results in Fig. 4B show that no major difference in comparison to the results with the cell extracts from the endogenous moaABCDE expression were obtained, even with an overall ∼2-fold higher level of Moco in the cells. A reduced Moco content of ∼60% was obtained in the ΔerpA mutant strain and a ∼50% reduced Moco content in the ΔiscA mutant strain in comparison to the wild type. No Moco was detected in the ΔiscA ΔerpA double mutant strain. The Δfnr mutant strain was used as control to show the Moco levels are not influenced by FNR (since the moaABCDE operon is activated by FNR and the moeAB operon is repressed by FNR) (46, 51, 52). This confirms the importance of IscA and ErpA for Moco biosynthesis. Since the single ΔerpA and ΔiscA mutant strains, but not the double mutant ΔerpA ΔiscA, were still able to produce Moco, we conclude that the two proteins can likely replace each other in their role in [4Fe-4S] cluster insertion into MoaA.

FIG 4.

The levels of Moco in different E. coli strains. Quantification of relative amounts of Moco in the indicated mutant strains (A) and the same mutant strains transformed with a moaABCDE expression plasmid under the control of an arabinose-inducible promoter (B). Expression was induced by the addition of 0.2% l-arabinose. Total Moco is oxidized to FormA, which is quantified by its fluorescence (LU) monitored at an excitation of 383 nm and an emission of 450 nm. The integrated areas of the FormA peaks were normalized to the OD₆₀₀. Standard deviations were calculated from three biological replicates. The P values were calculated using an unpaired t test (ns, P > 0.05; *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.005). n.d., not detectable.

Nitrate reductase activities in A-type carrier and nfuA mutant strains.

To confirm the results obtained for Moco production in the A-type carrier mutant and nfuA deletion strains, we additionally analyzed the activity of nitrate reductase in these strains. E. coli harbors three nitrate reductases (NarGHI, NarZYV, and NapAB), with NarGHI being the predominant one induced under anaerobic growth conditions in the presence of nitrate (53). To confirm that under the growth conditions used in this study only the activity of NarGHI is measured, and not the other two nitrate reductases, we determined nitrate reductase activity in mutant strains ΔnarG, ΔnapA, and ΔnarZ in comparison to the corresponding parental strain (BW25113). Figure 5 shows that under our growth conditions, NarGHI contributes to all of the nitrate reductase activities detected, reflected by the complete absence of nitrate reductase activity in the ΔnarG mutant strain. Strains ΔnapA and ΔnarZ showed comparable activities to the parental strain.

FIG 5.

Nitrate reductase activities in different E. coli strains. Nitrate reductase (NR) activities in E. coli BW25113 and ΔnarG, ΔnapA, or ΔnarZ mutant strains were quantified. Nitrate reductase activities (in units) were normalized to the OD₆₀₀ value. Standard deviations were calculated from three biological replicates. n.d., not detectable.

For further experiments, we only focused on the expression of narGHJI and the activity of NarGHI under the growth conditions used. Since the expression of the narGHJI operon is strictly dependent on the activation by FNR under anaerobic conditions, we additionally constructed a plasmid that expresses narGHJI from an IPTG (isopropyl-β-D-thiogalactopyranoside)-inducible promoter and transformed the mutant strains with this plasmid. Figure 6A shows nitrate reductase activities from the endogenous promoter, while Fig. 6B shows nitrate reductase activities obtained after induction of the plasmid-encoded narGHJI operon with 20 μM IPTG for comparison.

FIG 6.

Nitrate reductase activities in different E. coli strains. Nitrate reductase activities in different E. coli mutant strains (A) and the same mutant strains transformed with a narGHJI expression plasmid under the control of an IPTG-inducible promoter (B). Expression was induced by the addition of 20 μM IPTG. Nitrate reductase activities (in units) were normalized to the OD₆₀₀ value. Standard deviations were calculated from three biological replicates. The P values were calculated using an unpaired t test (ns, P > 0.05; *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.005).

Surprisingly, the overall nitrate reductase activities did not increase after expression of the narGHJI operon from an IPTG-inducible promoter. We conclude this this is likely based on the cellular limitation of Moco (Fig. 4B shows that the relative Moco levels can be increased after overexpression of the moaABCDE operon from an arabinose-inducible promoter).

The comparison of the activities of nitrate reductase expressed from the native promoter in comparison to the IPTG-inducible promoter in the Δfnr mutant strain clearly shows the dependence of narGHJI expression on FNR. While the nitrate reductase activities mainly remained unchanged in the nfuA and sufA deletion strains (Fig. 6), no nitrate reductase activities were obtained in the single and double ΔerpA mutant strains when nitrate reductase was expressed from the native promoter (Fig. 6A). When nitrate reductase expression was independent from the activation by FNR, however, the activity increased to ∼55% of the level of the wild-type strain (Fig. 6B). A similar increase of nitrate reductase was obtained in the ΔiscA strain after the expression of narGHJI from an FNR-independent promoter, where ∼59% of the nitrate reductase activity was obtained in the single ΔiscA mutant and wild-type levels in the ΔsufA ΔiscA mutant strain. When the genes encoding nitrate reductase were expressed from the native promoter, nitrate reductase activities were nevertheless obtained in these mutants, with levels of ∼20% of wild-type activity in the single ΔiscA mutant strain and ∼50% of wild-type activity in the ΔsufA ΔiscA double mutant strain.

Overall, after uncoupling narGHJI expression from the control of FNR, the nitrate reductase activity obtained matched the overall cellular Moco content. This additionally implies that ErpA, and likely also IscA, are involved in the activation of FNR.

Quantitative real-time PCR expression analysis of erpA, iscA, and sufA.

So far, the results indicated that both ErpA and IscA are involved in [4Fe-4S] cluster insertion into MoaA. Therefore, it was important to show that both genes were expressed in the respective mutant strains to perform this specific role. In previous studies it has also been shown that sufA, when expressed, can partially replace the role of ErpA or IscA for Fe-S cluster insertion. To determine the transcript levels of erpA, iscA, and sufA in the various mutant strains, we performed quantitative real-time PCR (qRT-PCR) expression analyses. Cells were grown under anaerobic conditions in the presence of 15 mM potassium nitrate and 1 mM mevalonate for 8 h. The results in Fig. 7A show the transcript levels of erpA in the respective mutant strains. While, as expected, no erpA transcripts were detected in the ΔerpA single and double mutant strains, the transcription levels of erpA increased 2.6-fold in the ΔiscA single mutant and about 4.6-fold in the ΔiscA ΔsufA double mutant strain. This higher expression of erpA in the ΔiscA ΔsufA double mutant strain might explain the increased nitrate reductase activity (Fig. 6A) in this strain in comparison to the ΔiscA single mutant strain, and shows that higher ErpA levels result in a better substitution of the role of IscA in this strain.

FIG 7.

Relative expression levels of erpA, iscA, and sufA in different E. coli mutant strains. Expression analysis was carried out using qRT-PCR. The expression levels of erpA (A), iscA (B), and sufA (C) in different E. coli mutant strains are shown. The y axis denotes the relative expression values in log of fold changes relative to the wild type, which was set to 1. Data represent the means from three biological replicates (±standard deviation [SD]). The P values were calculated using an unpaired t test (ns, P > 0.05; *, P ≤ 0.05; **, P ≤ 0.01). n.d., no expression detectable.

Similar results were obtained for the iscA transcript levels, showing that in the ΔerpA and ΔsufA ΔerpA mutants, the transcript levels of iscA were about 3-fold increased, while no iscA transcripts were detected in the ΔiscA or ΔiscA ΔerpA mutant strains (Fig. 7B). This also shows that IscA can partially replace ErpA in its role in Fe-S cluster insertion into MoaA, a functional substitution that is based on higher levels of IscA protein in ΔerpA mutant strains.

So far, the results indicated that SufA has no role in Fe-S cluster insertion into MoaA. To be able to functionally substitute IscA or ErpA, sufA needs to be expressed under the anaerobic nitrate respiration conditions used in our studies. While studies of the expression of a replicative PsufA-lacZ fusion indicated no major changes in expression and, rather, a ∼38% reduced expression in the ΔiscA strain, detection of the transcript levels determined by qRT-PCR for sufA showed the same levels of transcripts in the wild type and in ΔerpA, ΔiscA, and ΔiscA ΔerpA mutants (Fig. 7C). Since the cellular mRNA levels detected by qRT-PCR showed no higher levels of expression of the suf operon or sufA in the A-type carrier mutant strains, and the main role of the SUF system appears to be specific to aerobic growth, e.g., in the repair of oxidative damaged Fe-S clusters, we conclude that SufA has no major role in substituting for IscA or ErpA under anaerobic conditions.

Functional complementation studies of mutant strains in A-type carrier proteins by sufA, iscA, and erpA.

The increased expression of iscA in the ΔerpA mutant strain and of erpA in the ΔiscA mutant strain suggested that IscA and ErpA can functionally replace each other in their roles in Fe-S cluster insertion into MoaA, while SufA appears unable to perform these roles based on low expression levels. To analyze whether an increased expression of erpA, iscA or sufA has an effect on Moco production and nitrate reductase activity in the ΔerpA, ΔiscA, and ΔiscA ΔerpA mutant strains, plasmids expressing either erpA, iscA, or sufA from an arabinose-inducible promoter were introduced into these strains. The results show that after the introduction of a plasmid expressing erpA, up to wild-type levels of Moco were obtained in the ΔerpA and ΔiscA mutant strains, while the ΔiscA ΔerpA mutant strain was complemented to ∼85% of the wild type (Fig. 8A). Even higher activities of nitrate reductase were obtained after introduction of a plasmid-borne copy of erpA in these strains, in particular in the ΔerpA mutant strain (Fig. 8B). This shows that ErpA is able to replace IscA in its role for Moco biosynthesis and for the activity of nitrate reductase. In comparison, iscA was also able to complement erpA in its role for Moco biosynthesis and for the activity of nitrate reductase, but to a slightly smaller extent. In the ΔerpA mutant strain, ∼73% of the Moco was obtained compared to the wild type after the introduction of a plasmid-borne copy of iscA, while the ΔiscA ΔerpA double mutant strain was complemented to ∼62% of the Moco content of the wild-type strain (Fig. 8C). For nitrate reductase activities, similar results were obtained, yielding ∼56% of the wild-type activity after introduction of iscA in the ΔerpA mutant strain and ∼25% of the wild-type activity in the ΔiscA ΔerpA mutant strain (Fig. 8D). Overall, this shows that IscA is able to functionally replace the role of ErpA in these strains.

FIG 8.

Levels of Moco and the activity of nitrate reductase in different E. coli strains. (A, C, and E) Quantification of relative amounts of Moco in the indicated mutant strains. Total Moco is oxidized to FormA and monitored at an excitation of 383 nm and an emission of 450 nm. The integrated areas of the FormA peaks (in LU per second) were normalized to the OD₆₀₀ value. Standard deviations were calculated from three biological replicates. (B, D, and F) Nitrate reductase activities in different E. coli mutant strains. Nitrate reductase activities (in units) were normalized to the OD₆₀₀ value. Standard deviations were calculated from three biological replicates. The P values were calculated using an unpaired t test (ns, P > 0.05; *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.005). n.d., not detectable. Black bars correspond to the indicated mutant strains, and white bars correspond to the same mutant strains containing either a plasmid expressing erpA (A and B), iscA (C and D), or sufA (E and F). Protein expression was induced by the addition of 0.2% l-arabinose.

In contrast, sufA was not able to functionally complement erpA or iscA in these strains for Moco biosynthesis (Fig. 8E). Here, the Moco content was not increased in ΔerpA, ΔiscA or ΔiscA ΔerpA mutant strains after the introduction of a plasmid-borne copy of sufA. However, in contrast, nitrate reductase activity was obtained in the erpA mutant strain containing the plasmid expressing sufA. Here, similar nitrate reductase activities were obtained as in the ΔiscA mutant strain, showing that SufA is only partially able to replace ErpA in its role for nitrate reductase (Fig. 8F). This is also obvious in the ΔiscA and ΔerpA double mutant strains, where only ∼5% of the wild-type nitrate reductase activity was obtained after introduction of sufA (Fig. 8F). Since ErpA has also been reported to be involved in the insertion of [4Fe-4S] clusters into FNR, SufA might replace ErpA in its role for the synthesis of nitrate reductase, a role that can also be replaced after overexpression of IscA. Therefore, it is additionally important to analyze the expression of the genes encoding nitrate reductase in these mutant strains.

Detection of narG transcript levels in A-type carrier and nfuA mutant strains.

Since the results above indicated that the lower nitrate reductase activities in the ΔerpA and ΔiscA mutant strains were at least partially based on a reduced expression of the genes based on an inactive FNR protein, we quantified the transcript levels of narG in the mutant strains by qRT-PCR.

Figure 9 shows the transcript levels of narG in the respective mutant strains. The transcript levels of narG were increased about 1.5-fold in the ΔiscA mutant and 2.2-fold in the ΔiscA ΔsufA strain. In contrast, no narG transcripts were detected in the ΔerpA, ΔiscA ΔerpA, ΔerpA ΔsufA or Δfnr mutant strains. Conclusively, ErpA is essential for the expression of the narGHJI operon, while IscA is not. Therefore, ErpA likely has a role in providing Fe-S clusters for FNR under conditions of nitrate respiration.

FIG 9.

Expression levels of narG in different E. coli mutant strains. Expression analysis was carried out using qRT-PCR. The expression levels of narG in different E. coli mutants were quantified. The y axis denotes the relative expression values in log of fold changes relative to the wild type, which was set to 1. Data represent the means of three biological replicates (± SD). The P values were calculated using an unpaired t test (ns, P > 0.05; *, P ≤ 0.05; **, P ≤ 0.01). n.d., no expression detectable.

Insertion of Fe-S clusters into FNR by A-type carrier proteins.

The results from the nitrate reductase activities shown above implied that the A-type carrier proteins ErpA and, to a lesser extent, IscA are required for the expression of the genes encoding nitrate reductase by inserting Fe-S clusters into FNR under growth conditions of nitrate respiration. To test the activity of FNR in the ΔerpA, ΔiscA, ΔnfuA, and ΔsufA single mutant strains and the ΔerpA ΔiscA, ΔsufA ΔiscA, and ΔsufA ΔerpA double mutant strains compared to the wild-type strain, we analyzed the expression of a PpepT-lacZ fusion, which we used previously to investigate regulatory effects by FNR (54). The pepT gene codes for peptidase T, a tripeptidase that cleaves the amino-terminal leucine, lysine, methionine, or phenylalanine residue from certain tripeptides. The binding site of FNR to the pepT promoter has been reported previously (55, 56). The β-galactosidase activities of the PpepT-lacZ fusion showed that in the ΔiscA mutant the expression of pepT was ∼60% lower, while no β-galactosidase activity was obtained in the ΔerpA single mutant or the ΔerpA ΔiscA or ΔsufA ΔerpA double mutant strains. As expected, no β-galactosidase activity was obtained in the Δfnr mutant strain (Fig. 10).

FIG 10.

Expression of a PpepT-lacZ fusion in different E. coli mutant strains. The β-galactosidase activities in Miller units were determined for the PpepT-lacZ fusion in MG1655, ΔerpA, ΔiscA, ΔsufA, ΔnfuA, Δfnr, ΔiscA ΔerpA, ΔiscA ΔsufA, and ΔsufA ΔerpA mutant strains. The standard deviations were calculated from three biological replicates. The P values were calculated using an unpaired t test (ns, P > 0.05; **, P ≤ 0.01; ***, P ≤ 0.005). n.d., not detectable.

To exclude that the lack of expression of the PpepT-lacZ fusion was based on a lack of expression of fnr in the ΔerpA mutant strains, we additionally analyzed the expression of a Pfnr-lacZ fusion in the Δfnr, ΔerpA, ΔiscA, ΔnfuA, and ΔsufA single mutant strains (Fig. 11). The expression of fnr has been described previously to be repressed by [4Fe-4S] cluster-containing FNR. The results in Fig. 11 show that β-galactosidase activities are increased to comparable levels in the Δfnr, ΔerpA, and ΔiscA mutant strains, while activities in the ΔnfuA and ΔsufA single mutant strains were comparable to the wild-type strain. This shows that FNR is expressed in the ΔerpA and ΔiscA mutant strains, but is likely inactive due to the lack of [4Fe-4S] clusters in these strains. As a consequence, higher expression levels are obtained, since apo-FNR is unable to bind to the promoter region of FNR to repress its own expression.

FIG 11.

Expression of a Pfnr-lacZ fusion in different E. coli mutant strains. The β-galactosidase activities in Miller units were determined for the Pfnr-lacZ fusion in MG1655, ΔerpA, ΔiscA, ΔnfuA, ΔsufA, and Δfnr mutant strains. Standard deviations were calculated from three biological replicates. The P values were calculated using an unpaired t test (ns, P > 0.05; **, P ≤ 0.01; ***, P ≤ 0.005).

Analysis of the expression of the PpepT-lacZ fusion after functional complementation with plasmids expressing erpA, iscA, and sufA.

To analyze whether increased expression of erpA, iscA, or sufA results in a functional complementation of FNR in ΔerpA, ΔiscA, and ΔiscA ΔerpA mutant strains, plasmids expressing either erpA, iscA, or sufA from an arabinose-inducible promoter were introduced into these mutant strains and coexpressed with the PpepT-lacZ fusion from plasmid pGE539. The results show that after the introduction of plasmids expressing erpA, iscA, or sufA, a functional complementation of the defect of FNR for the expression of the PpepT-lacZ fusion was obtained, with β-galactosidase activities up to as high as in the wild-type strain (Fig. 12). The β-galactosidase activities were only slightly lower after expression of iscA and sufA in the ΔiscA ΔerpA double mutant strain in comparison to the strains expressing erpA. This shows that IscA and SufA are able to insert [4Fe-4S] clusters into FNR; however, at a cellular level, SufA does not appear to perform this role, based on its low expression (see above). IscA seems to be unable to compensate ErpA in this role of inducing expression of the PpepT-lacZ fusion under cellular conditions, since the ΔerpA mutant strain showed no β-galactosidase activity.

FIG 12.

Expression of a PpepT-lacZ fusion in different E. coli mutant strains with coexpression of plasmids containing erpA, iscA, or sufA. The β-galactosidase activities in Miller units were determined for the PpepT-lacZ fusion in MG1655, ΔerpA, ΔiscA, and ΔiscA/ΔerpA mutant strains. Standard deviations were calculated from three biological replicates. The P values were calculated using an unpaired t test (ns, P > 0.05; **, P ≤ 0.01). n.d., not detectable. Black bars correspond to the indicated mutant strains, and white bars correspond to the same mutant strains containing either a plasmid expressing erpA (A), iscA (B), or sufA (C). Expression was induced by the addition of 0.2% l-arabinose.

DISCUSSION

To date, E. coli has been described to harbor about 165 proteins that bind Fe-S clusters (2). The insertion of the Fe-S clusters into these proteins and the specificity of this process still remains one of the open questions in the field of Fe-S cluster assembly and trafficking. A-type carrier proteins like ErpA, IscA, and SufA, (15, 16), in addition to P-loop NTPases (like ApbC in Salmonella) (57, 58), monothiol glutaredoxins (Grx in E. coli) (22, 59), or NFU-type proteins like NfuA (20), have been identified to interact with target proteins and are involved in the transfer of Fe-S clusters in prokaryotes. In E. coli it has been reported that strains with a defect in the A-type carrier protein ErpA were unable to respire with nitrate, trimethylamine N-oxide (TMAO), or fumarate as terminal electron acceptors under anaerobic conditions (16). It has been shown previously that two membrane-bound hydrogenases along with the NarGHI nitrate reductase, the FdnGHI formate dehydrogenase, aconitase, the ThiC protein, and the endonuclease III require A-type carrier proteins for the insertion of [4Fe-4S] clusters (18, 19, 45, 60).

To further expand the knowledge of [4Fe-4S] cluster insertion into proteins, in this study we analyzed the complex Fe-S cluster-dependent network for the synthesis of Moco and active molybdoenzymes, including MoaA, FNR, and the target molybdoenzymes nitrate reductase (NarGHI). We were able to dissect that the insertion of [4Fe-4S] clusters into MoaA is mediated by the A-type carrier proteins ErpA and IscA under anaerobic conditions. Both proteins were shown to partially replace each other in the absence of the partner protein. We could show that in the absence of one A-type carrier protein, the expression of the genes encoding the other A-type carrier proteins was increased under cellular conditions, leading to a compensation of the loss of function of the other one. Previous phylogenetic studies have classified ErpA and IscA into two different families; while ErpA belongs to family ATC-I, IscA was classified into family ATC-II (15). ATC-I family members are predicted to directly interact with the apo-target proteins, while ATC-II family members are predicted to interact with the scaffold proteins. A recent study investigating the insertion of the auxiliary [4Fe-4S] cluster into the radical SAM protein LipA showed that NfuA is the specific protein in this process (23, 24). In LipA, this auxiliary cluster is sacrificed during catalysis to supply the sulfur atoms for the synthesis of lipoic acid. NfuA might have a specific function solely for LipA that is distinct from the [4Fe-4S] cluster insertion by ErpA and IscA into MoaA, which allows for a more rapid exchange of the inactive Fe-S cluster in LipA. It remains speculative that the role of NfuA is more specialized in the repair of damaged or oxidized Fe-S clusters in the presence of oxygen, as suggested by a recent study of Py and coworkers (25). Since MoaA is more important under anaerobic conditions for the synthesis of Moco, NfuA consequently does not have a role in [4Fe-4S] cluster insertion under these growth conditions. In our study, we cannot exclude that ErpA and IscA are both involved in the insertion of [4Fe-4S] clusters into MoaA, one in the insertion of the N-terminal cluster and the other in the insertion of the C-terminal cluster, and the role of the insertion of the specific cluster can be only partially compensated by the other protein. This specific scenario can be addressed in future studies.

Since the synthesis of MoaA, in addition to most molybdoenzymes, is regulated at the transcriptional level by FNR, a protein that requires [4Fe-4S] clusters for binding to the DNA, we also analyzed Fe-S cluster insertion into FNR. In the case of FNR, both A-type carrier proteins ErpA and IscA were also involved in the insertion of Fe-S clusters, however, with a slightly shifted hierarchy. When analyzing the expression of pepT, the transcription of which is regulated by FNR (54), ErpA seems to be more important for its activation, since in the ΔerpA mutant no transcription of pepT was obtained. Here, IscA was unable to replace the role of ErpA at a cellular level. In contrast, in the ΔiscA mutant, pepT expression was obtained with a 60% reduced level compared to the wild type. Conclusively, ErpA at least partially replaced the role of IscA in transferring Fe-S clusters to FNR. Our results also show that SufA is unable to replace IscA in its role in Fe-S cluster insertion into FNR under cellular conditions. While Mettert et al. (18) suggested that IscA provides the Fe-S clusters for FNR under anaerobic fermentative conditions, we were able to show that ErpA has a more important role in producing active FNR than IscA under conditions of nitrate respiration. Our results also explain the inability of ΔerpA mutants to respire with alternative electron acceptors like nitrate, based on a lack of expression of the operon. We show that the absence of ErpA results in the inactivation of FNR, the major regulatory protein under anaerobic conditions. After overexpression of iscA and sufA, the synthesized proteins were able to substitute for ErpA in its role in inserting Fe-S clusters into FNR; however, this does not seem to occur at a cellular level. Likely, the expression of sufA is too low under conditions of anaerobic nitrate respiration and additional factors seem to hinder IscA in compensating the role of ErpA in the regulation of pepT and narGHJI expression by FNR.

In our study, we did not focus on the identification of the proteins that insert Fe-S clusters into the E. coli nitrate reductase NarGHI. This was mainly based on the fact that in the absence of ErpA, the narGHJI operon is not expressed. In the ΔiscA deletion strain, in contrast, narG transcripts were even elevated, because an active FNR was still produced. However, since MoaA also requires IscA and ErpA for [4Fe-4S] cluster insertion, only 50% of functional nitrate reductase was produced in this mutant strain. Our results are in contrast to the studies by Pinske and Sawers (19, 45, 61), who concluded that ErpA and IscA are involved in Fe-S cluster insertion into the NarGH subunits. Their studies did not consider the reduced production of active bis-MGD for insertion into NarG in these strains, and the correspondingly reduced nitrate reductase activity. As shown in our analysis, nitrate reductase is inactive based on a combination of both the reduced expression by an inactive FNR protein and a reduced bis-MGD content based on inactive MoaA.

Overall, we summarize our results in the model in Fig. 13. We investigated the role of Fe-S cluster insertion into target proteins under anaerobic conditions in the presence of nitrate as the terminal electron acceptor. Under these conditions, it is expected that the ISC system is the major system for assembling Fe-S clusters, since the SUF system is generally expressed under conditions of oxidative stress and iron limitation.

FIG 13.

Model for the insertion of Fe-S clusters into MoaA and FNR under anaerobic respiration with nitrate. The ISC system is the major system for assembling Fe-S clusters under anaerobic conditions, since the SUF system is generally expressed under aerobic conditions of oxidative stress and iron limitation. The [2Fe-2S] clusters assembled on IscU with help of IscS are passed to IscA and further to ErpA, which delivers it to the target protein (the dotted line shows that IscU is also able to directly supply the [4Fe-4S] clusters to ErpA). Both IscA and ErpA can insert Fe-S clusters into MoaA. SufA is unable to substitute the roles of both proteins under these conditions, based on a low gene expression. For FNR, ErpA is the major A-type carrier protein, a role that is not substituted by IscA and SufA under cellular conditions of nitrate respiration. FNR activates the transcription of the narGHJI operon and the moaABCDE operon. Moco, in general, is inserted into apo-molybdoenzymes, like NarG, after the insertion of Fe-S clusters into the enzyme. The proteins that insert Fe-S clusters inti NarGHI were not investigated in this study (more details are given in the text).

The [2Fe-2S] clusters assembled on IscU with help of IscS are passed to IscA and further to ErpA, which delivers it to the target protein. It is expected that the [4Fe-4S] clusters are assembled on these proteins. We mainly analyzed two target proteins in our study, i.e., MoaA for Moco biosynthesis and FNR, the major transcriptional regulator under anaerobic conditions. Both IscA and ErpA can insert Fe-S clusters into MoaA, as revealed by the 50% reduced activity of ΔerpA and ΔiscA single mutants. Since the ΔerpA ΔiscA double mutant was completely devoid of Moco, SufA is unable to substitute the roles of both proteins under these conditions, based on a low expression. For FNR, ErpA is the major A-type carrier protein, a role that is not substituted by IscA and SufA under cellular conditions of nitrate respiration. Consequently, in ΔerpA mutant strains, no transcripts of narG were obtained. Moco, in general, is inserted into apo-molybdoenzymes, like NarG, after the insertion of Fe-S clusters into the enzyme. The proteins that insert Fe-S clusters into NarGHI still need to be determined. Likely, ErpA and IscA are also involved in this step, as suggested by Pinske and Sawers (45). However, in this case FNR is the dominant factor to regulate the expression of narGHJI. Consequently, FNR targets operons coding for Fe-S cluster-containing enzymes that, in the absence of A-type carrier proteins, are not expressed. This might be a way for the cell to conserve energy to prevent the unnecessary production of apo-enzymes that will not be functional when either Fe-S clusters or A-type carrier proteins are absent. In conclusion, the expression of genes encoding molybdoenzymes is regulated via dependence on their cofactor requirement, which is a combination based on both the availability of Moco and Fe-S clusters.

MATERIALS AND METHODS

Bacterial strains, plasmids, media, and growth conditions.

Strains and plasmids used in this study are listed in Table 1. The gene deletions in the E. coli MG1655 MVA⁺ (referred to as wild-type strain) were introduced by P1 transduction. Successful deletion of the respective genes was validated by PCR amplification. E. coli cultures were grown in LB medium in closed Schott flasks at 37°C without shaking to avoid oxygenation. When required, ampicillin (150 μg/ml), kanamycin (50 μg/ml), or chloramphenicol (50 μg/ml) was added to the medium during growth. Also, 15 mM potassium nitrate and 1 mM mevalonate were added as indicated. Protein expression from the moaABCDE operon cloned into the pCDF-duet1 vector was induced by the addition of 0.2% l-arabinose. For expression of narGHJI, the operon was cloned into the pTrcHis vector and expression was induced by the addition of 20 μM IPTG.

TABLE 1.

List of plasmids and strains used in this study

Plasmid or strain	Genotype or relevant characteristics	Source or reference
Plasmids
pmoa ABCDE	moaABCDE coding region cloned into HindIII/XhoI of pCDF-duet1, Specr	This study
pnarGHJI	narGHJI coding region cloned into pTrcHis Ndel/Sall	This study
psufA	sufA coding region expressed from an arabinose inducible promoter cloned into pCDF BamHI/XhoI	This study
piscA	iscA coding region expressed from an arabinose inducible promoter cloned into pCDF NdeI/XhoI	This study
perpA	erpA coding region expressed from an arabinose inducible promoter cloned into pCDF BamHI/XhoI	This study
pLAS-A	sufA coding region expressed from an arabinose inducible promoter cloned into pBAD-I EcoRI/XhoI	15
pLAI-A	iscA coding region expressed from an arabinose inducible promoter cloned into pBAD-I EcoRI/XhoI	15
pLAE-A	erpA coding region expressed from an arabinose inducible promoter cloned into pBAD-I EcoRI/XhoI	15
psufA	sufA coding region expressed from an arabinose inducible promoter cloned into pCDF BamHI/XhoI	This study
piscA	iscA coding region expressed from an arabinose inducible promoter cloned into pCDF BamHI/XhoI	This study
perpA	erpA coding region expressed from an arabinose inducible promoter cloned into pCDF BamHI/XhoI	This study
PpepT-lacZ	Gene region −200 bp to −1 bp upstream of pepT transcriptional start cloned into EcoRI/BamHI sites of pGE593, Ampr	54
Pfnr-lacZ	Gene region −200 bp to −1 bp upstream of fnr transcriptional start cloned into BamHI site of pGE593, Ampr	This study
PmoaA-L-lacZ	Gene region −477 bp to −1 bp upstream of moaA transcriptional start cloned into EcoRI/BamHI sites of pGE593, Ampr	46
iscR-lacZ	Gene region −200 bp to −1 bp upstream of iscR transcriptional start cloned into EcoRI/BamHI sites of pGE593, Ampr	63
PsufA-lacZ	Gene region −200 bp to −1 bp upstream of sufA transcriptional start cloned into EcoRI/BamHI sites of pGE593, Ampr	This study
pGE593	pBR322Δtet lacZ lacY’	62
pTrcHis	Expression vector pTrcdel containing the His6 tag and trc promotor, Ampr	66
pCDF-duet1	T7 RNA polymerase-based expression vector, CloDF13 origin, Specr	Novagen
Strains
MG1655 MVA+	Parental strain, MG1655 derivative carrying the MVA pathway genes in the chromosome	15
ΔmoeB strain	MG1655 derivative, ΔmoeB::cat MVA+	This study
ΔerpA strain (DV1094)	MG1655 derivative, ΔerpA::cat MVA+	15
ΔiscA strain (DV700)	MG1655 derivative, ΔiscA::kan MVA+	15
ΔnfuA MVA+ strain	MG1655 derivative, ΔnfuA::kan MVA+	25
ΔsufA strain	MG1655 derivative, ΔsufA::cat MVA+	This study
ΔiscA ΔerpA strain (DV1217)	MG1655 derivative, ΔiscA::ΔerpA::cat MVA+	15
ΔsufA ΔiscA strain (DV1219)	MG1655 derivative, ΔsufA::ΔiscA::cat MVA+	15
ΔsufA ΔerpA strain (DV1220)	MG1655 derivative, ΔsufA::ΔerpA::cat MVA+	15
Δfnr strain	MG1655 derivative, ΔerpA::kan MVA+	This study
BW25113	laclq rrnBT14 lacZWJ16 hsdR514 araBADAH33 rhaBADLD78	67
ΔnarG strain	BW25113 derivative, ΔnarG::kan	67
ΔnarZ strain	BW25113 derivative, ΔnarZ::kan	67
ΔnapA strain	BW25113 derivative, ΔnapA::kan	67
ΔiscS strain	BW25113 derivative, ΔiscS::kan	67

For coexpression of sufA, iscA, and erpA, the genes were cloned into the pCDF-duet1 vector and expression was induced by the addition of 0.2% l-arabinose for 8 h.

Quantification of β-galactosidase activities.

For the construction of a Pfnr-lacZ fusion, the respective promoter region 200 bp upstream of fnr, including the ATG start codon, was PCR amplified and cloned into the EcoRI/BamHI sites of the plasmid pGE593 (pBR322Δtet lacZ lacY’) (62). MG1655 MVA⁺ and the respective mutant strains were transformed either with the PpepT-lacZ fusion (pJD84) (54), the PmoaA-L–lacZ fusion (46), or the Pfnr-lacZ fusion. Cells were grown under anaerobic conditions in the presence of 15 mM potassium nitrate and 1 mM mevalonate at 37°C for 8 h. Cells were permeabilized using chloroform-SDS in 500 μl of Z buffer (60 mM Na₂HPO₄, 40 mM NaH₂PO₄, pH 8.0), supplemented with 10 mM KCl, 1 mM MgSO₄, and 0.05 mM β-mercaptoethanol. The reaction was started by the addition of 100 μl of 4 mg/ml ortho-nitrophenyl-β-galactoside (ONPG) and was stopped by addition of 250 μl of 1 M Na₂CO₃. The amount of formed ortho-nitrophenol was measured at 420 nm, corrected for light scattering at 550 nm, and normalized to the volume of cells, their optical density at 600 nm, and the reaction time (Miller units). For each strain, a respective blank reaction mixture containing cells transformed with the vector control was subtracted.

Immunodetection of IscS.

E. coli strain MG1655 MVA⁺ (wild type) and the mutant strains were cultivated 8 h under anaerobic conditions in the presence of 15 mM potassium nitrate and 1 mM mevalonate. Cells were lysed by sonification in 50 mM Tris-HCl (pH 7.5) and the cell debris was removed by centrifugation. Protein concentrations were quantified by Bradford. The cell extracts (50 μg) were separated by 12% SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes (GE Healthcare). The membrane was blocked with 5% milk powder in Tris-buffered saline with Tween 20 (TBST) for 1 h at room temperature, rinsed with TBST, and incubated with rabbit anti-IscS serum (1:5,000) (63) overnight at 4°C. The blots were washed with TBST and incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody (1:10,000) (Thermo Scientific). Target proteins were visualized by enhanced chemiluminescence.

Detection of Moco in cell extracts.

To determine the total Moco content (as MPT and Moco), 50-ml cultures of E. coli strain MG1655 MVA⁺ (wild type) and the indicated mutant strains were grown for 8 h under anaerobic conditions in the presence of 15 mM potassium nitrate and 1 mM mevalonate, harvested by centrifugation, and resuspended in 100 mM Tris-HCl, pH 7.2. Cells were lysed by sonification and the cell debris was removed by centrifugation. Samples were oxidized in the presence of acidic iodine at 95°C for 30 min and excess iodine was removed by the addition of 100 μl of 1% (wt/vol) ascorbic acid (64). The pH of the samples was adjusted with 1 M Tris-HCl to pH 8.3. After addition of 10 μl of 1 M MgCl₂ and 1 unit of fast alkaline phosphatase, FormA was obtained. For purification of FormA, the samples were loaded onto a 500 μl QAE ion exchange resin (Sigma) equilibrated in water. The column was washed with 10 column volumes of water and with 1,300 μl of 10 mM acetic acid. FormA was eluted with 6 × 500 μl of 10 mM acetic acid. The fractions were separated on a C₁₈ reversed-phase HPLC column (4.6 × 250 mm ODS Hypersil, particle size 5 μm) equilibrated with 5 mM ammonium acetate and 15% (vol/vol) methanol at a flow rate of 1 ml/min. Elution of FormA was monitored by an Agilent 1100 series fluorescence detector with an excitation at 383 nm and emission at 450 nm. The total FormA content was normalized to the growth of cells at an optical density of 600 nm (OD₆₀₀).

Quantification of nitrate reductase activities.

The activity of nitrate reductase was measured in crude extracts obtained from MG1655 MVA⁺ and the indicated mutant strains after anaerobic growth for 8 h in the presence of 15 mM potassium nitrate and 1 mM mevalonate. Cells were harvested by centrifugation and resuspended in 50 mM Tris-HCl (pH 7.5). Cell lysates were obtained by sonification, transferred into an anaerobic chamber, and incubated at 4°C for at least 3 h. An aliquot of 50 μl of each cell lysate was analyzed for nitrate reductase activities in a volume of 4 ml containing 0.3 mM benzyl viologen, 10 mM KNO₃ in 20 mM Tris-HCl (pH 7.5). The reactions were started by the addition of sodium dithionite and the oxidation of benzyl viologen was recorded at 600 nm for 30 sec. The activity was calculated using the equation U = 0.5 × (ΔA₆₀₀/min)/ε₆₀₀ (benzyl viologen)/V, using the extinction coefficient for benzyl viologen of 7.4 mmol⁻¹ × cm⁻¹. One unit is defined as the oxidation of 1 μM reduced benzyl viologen per minute. The activity was normalized to the OD₆₀₀ of the cells before harvesting.

Quantitative real-time PCR analyses.

Total RNA was extracted from MG1655 MVA⁺ and the indicated mutant strains after anaerobic growth for 8 h in the presence of 15 mM potassium nitrate and 1 mM mevalonate using the high pure RNA isolation kit (Roche). The cDNA was obtained using the Quantitect reverse transcription kit from Qiagen. Quantitative real-time PCR (qRT-PCR) was performed in a final volume of 10 μl according to the instructions of Power SYBR Green PCR Master Mix (Applied Biosystems, Darmstadt, Germany) using the CFX96 system (Bio-Rad, Munich, Germany). The relative quantification of transcript levels of erpA, iscA, sufA, or narG was performed as described previously (65). The qRT-PCRs were performed on three to four biological replicates. The primer sequences are listed in Table 2.

TABLE 2.

Primer sequences used for qRT-PCR

Primer name	Sequence
erpA forward	TAACCCGAATCTGAAATTACGCG
erpA reverse	GTATAATCAACGGAACCGCC
iscA forward	TCTGGGCGTGAGAACCTCCG
iscA reverse	AGCTGCGTACCGTCCAGAAA
narG forward	ACAAACTGCCGGTGAAACGC
narG reverse	CACATCGTCATAGCTGGTTG
sufA forward	GTATGGTCGGCGTGCGCTTA
sufA reverse	CGTGCCATCAATAAACGGCATCG