Abstract
Lactobacillus plantarum (renamed as Lactiplantibacillus plantarum) has been isolated from many sources but very rarely from rhizospheric soil. This is the first report on isolation and assessment of probiotic capabilities of L. plantarum strains isolated from rhizospheric soil. The isolates were confirmed by 16S rRNA gene sequencing and named as NS14, NS16 and NGG. All the isolates were evaluated for bile salt hydrolysis, hypocholestrolemic potential and probiotic attributes. Our results indicated that all the strains harboured bsh and showed in vitro cholesterol assimilation capabilities which increased when bile salts were also present in the culture medium. Also, all the strains remained viable at high temperatures and in the presence of NaCl, lysozyme, simulated gastric juice, bile salts and, exhibited auto- and co-aggregation capabilities. Additionally, L. plantarum strain NS14 survived in the presence of phenols, acidic environment (pH 2–3) and was resistant to many clinically relevant antibiotics. Since, L. plantarum NS14 exhibited most of the desirable and essential characteristics of a probiotic it should be further investigated as a potent probiotic with an additional benefit as a hypocholesterolemic biotherapeutic. Moreover, rhizosphere can be explored as a useful ecological niche for isolating microorganisms with biotechnological and probiotic potential.
Subject terms: Biotechnology, Microbiology
Introduction
According to the World Health Organization (WHO) cardiovascular diseases result in the death of ~ 30% of the world population. It is estimated that by the end of the year 2030, around 23.3 million people would suffer from cardiovascular diseases1. The primary reason underlying cardiovascular diseases in human population is the elevated level of serum cholesterol. Although, dietary interventions and drug therapy are useful in reducing the serum cholesterol, several side effects are associated with drug therapy2. In recent years, several researchers have demonstrated that probiotics, especially strains of Lactobacillus and Bifidobacterium were effective in reducing the levels of cholesterol3,4. Probiotics are viable microbes whose consumption is associated with several health benefits. Probiotics might lower the serum cholesterol levels by various mechanisms like, assimilating cholesterol in the bacterial cell membranes, deconjugating the bile salts by producing enzymes like bile salt hydrolases (BSH) and converting the cholesterol into coprostanol, etc5–7. Several studies have indicated that BSH activity improves the adhesion ability of lactobacilli in the gastrointestinal tract8 and, organisms which cannot deconjugate bile salts show a reduced capability to remove cholesterol from the culture medium. Thus, BSH activity is an essential attribute for selecting novel probiotic strains with cholesterol-lowering potential9.
Bacteria which qualify as probiotics include several genera of lactic acid producing bacteria like, Lactobacillus, Lactococcus, Streptococcus spp. etc. The genus Lactobacillus with more than 200 species is the largest group of lactic acid bacteria (LAB). Lactobacillus plantarum (recently reclassified as Lactiplantibacillus plantarum)10 is the most versatile and metabolically diverse Lactobacillus sp. which has been widely used in industrial fermentation for production of fermented food products like cheese, kefir, sauerkraut, etc11,12. L. plantarum has been associated with a documented history of usage in food13. Additionally, it has been conferred the “generally recognized as safe” (GRAS) status by the US Food and Drug Administration (US FDA) and, the “qualified presumption of safety” (QPS) status by the European Food Safety Authorities (EFSA)14. Several strains of L. plantarum have demonstrated antibacterial and antifungal properties and many probiotic formulations based on L. plantarum strains are available in the market15,16. L. plantarum have been isolated from diverse sources like gastrointestinal, vaginal and urogenital tracts17–19, dairy products20, vegetables21 etc.
An earlier study reported the biotechnological properties of L. plantarum isolated from rhizosphere of olive trees and desert truffles22. However, to the best of our knowledge, the BSH activity, cholesterol assimilation and probiotic attributes of L. plantarum isolated from rhizosphere have not been reported. BSH activity has been rarely reported from bacteria isolated from environments where bile salts are usually absent23–26. Rhizospheric soil is an important ecological site for identification of probiotics because there is a competition among the resident microbes for the growth factors available in rhizosphere. Thus, rhizospheric bacteria evolve with plant pathogenic bacteria and fungi, which enhance their competence for survival in the microbe-rich human GI tract. This is the first report about isolation and evaluation of probiotic characteristics of L. plantarum isolated from rhizospheric soils collected from different sites located in India.
Results
Molecular identification of L. plantarum strains
Of the ten samples isolated from rhizospheric soils, three yielded pure cultures which were presumptively identified as LAB and named by us in our laboratory as NS14, NS16 and NGG. These were confirmed as L. plantarum based on 16S rRNA gene sequencing and BLAST-based homology search. The GenBank accession numbers of 16S rRNA gene sequences of NS14, NS16 and NGG were MW136055-57, respectively.
BSH activity and bsh gene
All the strains exhibited a white zone of precipitation (an opaque halo with a silvery shine) around their respective wells, indicating the production of BSH. In all the strains, PCR-amplification with the bsh primers (BF and BR) resulted in the desired amplicon of 913 bp. Gel purification; gene sequencing and BLAST analysis confirmed that the PCR amplicons encoded the bsh of L. plantarum. The results of multiple sequence alignment of BSH proteins revealed that the amino acid sequences were identical, except a variation from V to I at amino acid position 92 in L. plantarum strain NS14 (Fig. 1).
Figure 1.
Multiple sequence alignment of amino acid sequences of bile salt hydrolases (BSH) of L. plantarum strains NS14, NS16 and NGG.
Cholesterol assimilation
All the L. plantarum strains assimilated about 50% of the cholesterol from the medium, which improved further when bile salts were also present in the culture medium. L. plantarum strain NGG assimilated 48.84% cholesterol, while both NS14 and NS16 assimilated 60% cholesterol from the medium. In the presence of the bile salts, both NS16 and NGG assimilated 74% cholesterol from the medium while NS14 assimilated 92% cholesterol (Table 1). However, cholesterol assimilation capability of the strains were not statistically different from each other, (p > 0.05).
Table 1.
Cholesterol removal capability of L. plantarum strains in cholesterol containing medium with and without bile salts.
| L. plantarum strain | Mean cholesterol removal percentage (%) ± SD | |
|---|---|---|
| Cholesterol only | Bile salts + cholesterol | |
| NS14 | 60.52 ± 0.13 | 92.20 ± 0.60 |
| NS16 | 60.40 ± 0.14 | 72.21 ± 0.15 |
| NGG | 48.84 ± 0.60 | 72.21 ± 0.16 |
The mean of three values ± SD are presented.
Tolerance to temperature, salt and lysozyme
All the three L. plantarum strains thrived in temperatures ranging between 28 and 45 °C however, optimum growth was observed at 37 °C. Similarly, all the strains survived in MRS broth containing increasing concentrations of NaCl. All the L. plantarum isolates were lysozyme tolerant, showing 80% survival after 2 h of incubation in culture medium containing lysozyme (results not shown).
Tolerance to bile salts, low pH and simulated gastric juice
All the L. plantarum strains survived when the bile salt concentrations were lower or equal to 0.5% even after 2–4 h i.e.0.125% and 0.25% (Table 2). However, none of them survived when the concentration of the bile salts in the culture medium was 1% (results not shown).
Table 2.
Viable cells (log10 cfu/ml) of L. plantarum strains in the presence of 0.5% bile salts.
| L. plantarum strain | Log10 cfu/ml | ||
|---|---|---|---|
| 0 h | 2 h | 4 h | |
| NS14 | 8.93 ± 0.04 | 8.86 ± 0.03 | 8.75 ± 0.03 |
| NS16 | 8.97 ± 0.02 | 8.75 ± 0.04 | 8.73 ± 0.01 |
| NGG | 8.27 ± 0.03 | 8.20 ± 0.04 | 8.18 ± 0.02 |
The mean of three values ± SD are presented.
The viability of all the L. plantarum strains in the culture medium of pH 1.5 decreased drastically and none of the strains survived after 1–3 h. In the culture medium of pH 2, the viabilities of all the strains were reduced to almost half after 1–3 h. Both the L. plantarum strains NS14 and NS16 remained viable in the culture medium of pH 3.0 but the viability of NGG decreased, after 1–3 h (Table 3). Though the viability decreased slightly, but all the L. plantarum strains survived in simulated gastric juice even after 2 h and 3 h (Table 4).
Table 3.
Viable cells (log10 cfu/ml) of L. plantarum strains in MRS broth at different pH and time intervals.
| L. plantarum strain | pH 1.5 | pH 2.0 | pH 3.0 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| 0 h | 1 h | 3 h | 0 h | 1 h | 3 h | 0 h | 1 h | 3 h | |
| NS14 | 2.10 ± 0.03 | – | – | 2.10 ± 0.03 | 1.20 ± 0.01 | 1.03 ± 0.03 | 2.10 ± 0.03 | 2.31 ± 0.03 | 2.70 ± 0.03 |
| NS16 | 3.72 ± 0.01 | – | – | 3.72 ± 0.01 | 1.57 ± 0.03 | 1.21 ± 0.01 | 3.72 ± 0.01 | 3.50 ± 0.02 | 3.70 ± 0.03 |
| NGG | 4.31 ± 0.02 | – | – | 4.31 ± 0.02 | 2.39 ± 0.02 | 2.10 ± 0.01 | 4.31 ± 0.02 | 4.10 ± 0.03 | 3.91 ± 0.03 |
The mean of three values ± SD are presented.
Table 4.
Viable cells (log10 cfu/ml) of L. plantarum strains in simulated gastric juice.
| L. plantarum strain | Viable cells (log10 cfu/ml) | ||
|---|---|---|---|
| 0 h | 2 h | 3 h | |
| NS14 | 2.82 ± 0.01 | 2.61 ± 0.01 | 2.30 ± 0.02 |
| NS16 | 2.47 ± 0.01 | 2.37 ± 0.02 | 2.20 ± 0.01 |
| NGG | 2.60 ± 0.02 | 2.30 ± 0.02 | 2.12 ± 0.02 |
The mean of three values ± SD are presented.
Auto-aggregation and co-aggregation capabilities
The relative auto-aggregation and co-aggregation percentage values of NS14 were 32.08% and 40.30%, respectively while of NGG were 21% and 20.10%, respectively. The relative auto-aggregation and co-aggregation percentage values of NS16 were the least i.e.9.15% and 9.05%, respectively. The relative auto-aggregation and co-aggregation percentage values of the L. plantarum strains are shown in the Table 5. However, the relative auto- and co-aggregation percentage values of the strains were not statistically different from each other (p > 0.05).
Table 5.
Relative auto-aggregation and co-aggregation capabilities of L. plantarum strains.
| L. plantarum strain | Auto-aggregation (%) | Co-aggregation with E. coli (%) |
|---|---|---|
| NS14 | 32.08 ± 0.04 | 40.30 ± 0.03 |
| NS16 | 9.15 ± 0.03 | 9.05 ± 0.02 |
| NGG | 21 ± 0.05 | 20.10 ± 0.03 |
The mean of three values ± SD are presented.
Phenol tolerance and antimicrobial susceptibilities
The L. plantarum strains NS14 and NS16 maintained their viability, while the viability of NGG reduced after 24 h in the culture medium containing 0.40% phenol (Table 6). L. plantarum strain NS14 was susceptible to amoxicillin but resistant to kanamycin, streptomycin, gentamycin tetracycline, erythromycin and tetracycline. L. plantarum strain NS16 was susceptible to amoxicillin, gentamicin, erythromycin and ciprofloxacin while it was resistant to streptomycin and tetracycline. L. plantarum strain NGG was susceptible to all the antibiotics but resistant to tetracycline (Table 7).
Table 6.
Viable cells (log10 cfu/ml) of L. plantarum strains in 0.4% phenol.
| L. plantarum strain | Viable cell count (log10 cfu/ml) | |
|---|---|---|
| 0 h | 24 h | |
| NS14 | 5.01 ± 0.01 | 5.94 ± 0.02 |
| NS16 | 5.65 ± 0.06 | 5.18 ± 0.03 |
| NGG | 6.01 ± 0.01 | 4.24 ± 0.02 |
The mean values of each sample are presented along with ± SD.
Table 7.
Antimicrobial susceptibilities of L. plantarum strains.
| L. plantarum strain | AMX (10) | K (30) | STM (10) | GEN (10) | TET (30) | E (15) | CIP (5) |
|---|---|---|---|---|---|---|---|
| NS14 | S | R | R | R | R | R | R |
| NS16 | S | S | R | S | R | S | S |
| NGG | S | S | S | S | R | S | S |
Amoxycillin (AMX), Kanamycin (K), Streptomycin (STM), Gentamicin (GEN), Tetracycline (TET), Erythromycin (E), Ciprofloxacin (CIP). S-sensitive, R-resistant. Numbers in parenthesis indicate concentration of antibiotic (µg/disc).
Discussion
Lactiplantibacillus plantarum strains have been reportedly isolated from various plant and animal sources but very rarely from rhizospheric soil22. This is the first report about isolation and assessment of probiotic potential of L. plantarum strains isolated from rhizospheric soils which were collected from several sites located in central India. Rhizosphere is an interesting environmental niche which is enriched with root secretions and various plant-associated bacteria and fungi. Thus, it can be a good source for isolating probiotics exhibiting competence for survival in the microbe-rich human GI tract27. The 16S rRNA gene sequencing results confirmed that the three pure rhizospheric isolates named in our laboratory as NS14, NS16 and NGG were L. plantarum. These isolates were further assessed for bile salt hydrolysis, hypocholestrolemic and probiotic potential.
Since capability to hydrolyze bile salts has been recommended by the WHO as an important attribute for probiotic selection hence; all the L. plantarum strains were evaluated for bile salt hydrolysis and the presence of bsh9. The results of the phenotypic assay and gene sequencing confirmed that bsh was present in all the strains. Thus, our strains qualified an important attribute for probiotic selection. Also, the fact that bsh was present in L. plantarum strains isolated from rhizosphere is interesting because very few studies have reported the presence of BSH in bacteria isolated from environment naturally deficient of bile salts, like rhizospheric soil. An earlier study reported that BSH-positive L. plantarum strains show a greater adhesion capability for Caco-2 intestinal cell lines than BSH-negative strains8. This suggested that BSH-producing L. plantarum strains identified by us from the rhizospheric soil might pose a similar behaviour. Moreover, similarity in the amino acid sequences of the studied BSH might indicate that these proteins can be conserved in L. plantarum.
All the L. plantarum strains assimilated ~ 50% cholesterol from the culture medium which increased when bile salts were also present. For instance, L. plantarum strain NS14 showed higher cholesterol assimilation capability (92.20%) when bile salts were also present in the medium compared with the medium without bile salts (60.52%). The cholesterol assimilation capability of NS14 observed by us is much higher than that reported for L. plantarum strain RYPR1 (isolated from a fermented drink) which could assimilate only 59% of the cholesterol present in the culture medium28. However, the cholesterol assimilation capability of L. plantarum strain NS14 was lesser than that discerned for rhizospheric Enterococcus faecium LR13 which assimilated 98% cholesterol from the medium containing bile salts and 75% from the medium without bile salts27. This suggested that rhizospheric bacteria might be explored as appropriate probiotic candidates, if they can also qualify other criteria essential for probiotic status. Additionally, all the strains were assessed for various technological and probiotic characteristics. Our results indicated that all the L. plantarum strains could survive at temperatures as high as 45 °C and in salt concentrations up to 10% (w/v). Previous studies reported that Lactobacillus spp. isolated from food were tolerant to only 1–6% salt concentrations, while L. plantarum strain 8RA 3-pl B-RKM 0015 isolated from a commercial preparation was reportedly tolerant to 2–6% salt concentration29,30. Another study reported that at salt concentrations above 6%, the bacterial density of L. plantarum ATCC 14917 decreased drastically31. Food products might be heated at various temperatures during food processing for safety and/or industrial purposes. Also, some food products contain higher amounts of salt. The fact that these rhizopsheric L. plantarum strains could survive at high temperatures and salt concentrations demonstrates their biotechnological potential for inclusion in such processed food products.
Before reaching the human gut, the orally ingested probiotics must overcome the effect of lysozyme which is present in the human saliva. Lysozyme disrupts the bacterial cell wall. Our results indicated that all the rhizosperic L. plantarum strains remained viable when exposed to lysozyme for 2 h, indicating their potential to reach the human GI tract in sufficient numbers. After reaching the human GI tract, the potential probiotics must sustain the effect of low pH and gastric juices present in the stomach. The pH of the stomach normally ranges between 2.5 and 3.5, although it might be as low as 1.5 during prolonged fasting or as high as 4.5 after a meal32. None of the L. plantarum strains survived at pH 1.5. However, the strain NS14 survived at both pH 2 and pH 3. All the L. plantarum strains remained viable in simulated gastric juice even after 2–3 h. Thus, the fact that L. plantarum strain NS14 could withstand assaults like acidic environment (pH 2–3) and simulated gastric juice reflects its potential to survive in the human stomach. An earlier study also reported about a probiotic strain, L. plantarum 9 which remained viable at acidic pH33.
Phenols are produced in the human GI tract as a result of deamination of aromatic aminoacids contained in the dietary proteins hence; phenol tolerance is also an essential attribute for survival of probiotics in the GI tract34. Both NS14 and NS16 could survive in culture medium containing 0.4% phenol for 24 h, while NGG could not (Table 6). Previous studies also indicated that among several L. plantarum strains tested for probiotic potential, only a few were phenol tolerant28. Another assault the potential probiotics need to overcome after their passage through the stomach is the action of bile juices (concentration ~ 0.3–0.5%) of the intestine35. Thus, the probiotic organisms should survive in the presence of bile salts. Though the number of bacterial colonies decreased slightly, all the L. plantarum strains remained viable in culture medium containing 0.5% bile salts even after after 2–4 h. Of all the L. plantarum strains tested, strain NS14 was found to be resistant to most of the clinically relevant antibiotics, except amoxicillin. Antibiotic resistance has been regarded as a beneficial probiotic property because a resistant probiotic when co-administered with an antibiotic might reduce the gastrointestinal side effects associated with the antibiotics36.
The ability to auto-aggregate and co-aggregate are important characteristics of probiotics because auto-aggregation ability helps them in adhering to mucosal surfaces and epithelial cells37 while co-aggregation ability helps them in preventing the colonization of human gut by pathogenic bacteria38. Both, L. plantarum strains NS14 and NGG exhibited a moderate capability of auto- and co-aggregation. Testing for hemolytic and DNase activities confirmed that all the L. plantarum strains might be safe for human consumption.
To summarize, our results indicated that all the rhizospheric L. plantarum isolates were capable of assimilating cholesterol in vitro, produced BSH, remained viable at high temperatures and in the presence of NaCl, lysozyme, simulated gastric juice, bile salts and, exhibited auto- and co-aggregation capabilities. Besides these attributes L. plantarum strain NS14 could survive in the presence of phenols, acidic environment (pH 2–3) and was resistant to many clinically relevant antibiotics. This suggests that it should be further investigated as potent probiotic in vivo with an additional benefit as a hypo-cholesterolemic biotherapeutic. Also, it can be stated that rhizosphere might be explored as a useful ecological niche for isolating L. plantarum strains which not only exhibit biotechnological potential, but also possess several essential and desirable probiotic attributes.
Materials and methods
Sample processing and isolation of LAB
Ten rhizospheric soil samples were collected from different parts of central India (Uttar Pradesh, Haridwar and New Delhi) following the standard microbial procedures and inoculated in screw capped plastic bottles containing 99 ml of De Man, Rogosa and Sharpe (MRS) broth. The methodology for sample processing and isolation were the same as described earlier27. Finally, three cultures that yielded pure colonies were presumed as LAB based on their growth in selective media like MRS broth and other characteristics like catalase negative test and Gram-positive staining. The glycerol stocks were prepared and preserved at − 80 °C which were revived at 37 °C prior to use.
Identification of the isolates by sequencing of the gene encoding 16S rRNA
The three pure cultures that yielded pure colonies were designated in the laboratory as NS14, NS16 and NGG. The genomic DNA was extracted from the isolates using a commercial kit, mdi Genomic DNA Miniprep Kit (Ambala Cantt, India) and the gene encoding 16S rRNA was PCR-amplified using universal eubacterial primers (forward primer 5′AGAGTTTGATCCTGGCTCAG3′ and reverse primer 5′AGAGTTTGATCCTGGCTCAG3′). The contents of the PCR reaction mixture and the PCR reaction conditions were the same as reported earlier27. The PCR amplicons were purified using QIA Quick Gel Extraction Kit (Qiagen, Hilden, Germany) and sequenced using Sanger’s method at the Central Instrumentation Facility of University of Delhi South Campus, New Delhi. The homology in the gene sequences was determined using BLASTn.
Temperature and sodium chloride tolerance
The ability of the strains to grow at different temperatures was investigated by growing them in MRS broth at 28, 37 and 45 °C. The capability to tolerate different concentrations of salt was investigated by inoculating them in MRS medium containing varying NaCl concentrations (0.5, 2, 3, 4, 5, 7 and 10%; w/v) at 37 °C. In either case, the absorbance of the inoculated and the control samples was recorded at 600 nm after 24 h. The experiment was repeated thrice for each isolate and the mean values were reported (± SD).
Evaluation of probiotic characteristics
Tolerance to lysozyme and phenol
The tolerance of the strains to lysozyme was evaluated following a published method39. Briefly, overnight grown isolates were centrifuged, washed twice with PBS and suspended in Ringer solution. A 10 μl of this suspension was inoculated in a sterile electrolyte solution containing 100 mg/L lysozyme. The viable cell counts were determined for each strain after a time interval of 0.5, 1 and 2 h. For determining tolerance to phenol, overnight grown LAB strains were cultured in MRS broth containing 0.4% phenol at 37 °C, for 24 h. A 100 µl aliquot was removed at 0 h and 24 h and appropriate serial dilutions were made which were spread on the surface of MRS agar plates. These were further incubated at 37 °C and the number of colonies was determined after 24 h. Both the experiments were repeated thrice for each isolate and the mean values were reported (± SD).
Tolerance to acid and bile
The acid and the bile tolerance of the strains were evaluated following a published method27. The strains were inoculated in three separate flasks in which the pH of MRS medium ranged from 1.5, 2 and 3. After an interval of 1 h and 3 h, appropriate serial dilutions of 100 µl aliquots from each flask were inoculated on the surface MRS agar plates for 18–24 h, at 37 °C. The numbers of viable colonies were enumerated and results were expressed as log10 cfu/ml. The bile tolerance of L. plantarum strains was determined by inoculating them in MRS medium containing a commercial preparation of bile salts (sodium salts of cholic and deoxycholic acid; Sigma-Aldrich) at varying concentrations ranging from 0.125, 0.25, 0.5 and 1% (w/v), at 37 °C. Samples were withdrawn after 2 h and 4 h, 100 µl of appropriate serial dilutions were inoculated on MRS agar plates, viable cell colonies were enumerated and results were expressed as log10 cfu/ml. Both the experiments were repeated thrice for each isolate and the mean values were reported (± SD).
Tolerance to simulated gastric juice (pepsin)
The tolerance to simulated gastric juice (pepsin) was determined following a published method27. To prepare simulated gastric juice, 0.3% pepsin (w/v) was dissolved in 0.5% saline (v/v). The pH of this solution was adjusted to 3.0. Overnight grown L. plantarum strains were collected by centrifugation and the washed bacterial cells were suspended in 4 ml of sterile NaCl (0.8%) solution. Nine ml of the simulated gastric juice (pH 3) was mixed with 1 ml of the bacterial suspension. The cultures were kept at 37 °C in an incubator at 200 rpm. The viable cell counts were determined after 0, 2 and 4 h and the results were expressed as log10 cfu/ml. The experiment was repeated thrice for each strain and the mean values were reported (± SD).
Auto-aggregation and co-aggregation
The ability of L. plantarum strains for auto-aggregation was determined following a published method40. Briefly, the L. plantarum strains were grown in MRS broth overnight and the cells were collected by centrifugation. The bacterial cells were washed and re-suspended in PBS and the cell density was adjusted to an absorbance of 0.5 at 600 nm. The suspension was kept for 2 h at 37 °C and the absorbance of the 1 ml of the upper phase was measured at 600 nm. The percentage cell auto aggregation was calculated as the percentage decrease in initial and final absorbance of the bacterial suspension relative to the initial absorbance of the bacterial suspension. The potential of L. plantarum strains to co-aggregate was determined by measuring the percentage reduction in absorbance of the mixed suspensions (Escherichia coli strain NG9 + L. plantarum strains) relative to the absorbance of the individual suspension (L. plantarum strain only) following a published method41.
Bile salt hydrolase (BSH) activity and bsh gene
The BSH activity of L. plantarum strains was evaluated using a published method27. A sterile cork borer was used to punch wells of 6-mm diameter in MRS plates supplemented with a commercial preparation of 0.5% bile salts (sodium salt of cholic and deoxycholic acid; Sigma-Aldrich, United States). Then 200 µl of overnight MRS broth grown cultures were inoculated into these wells and the plates were incubated for 24–48 h at 37 °C. The presence of white zones of precipitation (opaque halo with silvery shine) around the wells was considered as a positive reaction. MRS agar plates without bile salt supplementation were used as controls.
Primer-Blast was used to design primers for PCR-amplification of bsh gene. The sequences of the forward (BF) and reverse (BR) primers were 5′TTACTTCGGTAGAAATTTCG 3′ and 5′TGATCGTAATGGATAAGAAA 3′, respectively. The components of the PCR reaction mixture and conditions were the same as described earlier42, except the annealing temperature which was kept at 55 °C. The PCR amplicons were purified and sequenced using the same methods as used for gene sequencing of 16S rRNA. The gene homology was determined using BLASTn. The gene sequences of bsh were translated using ExPASy and aligned using Clustal Ω.
Potential for cholesterol assimilation
The potential of the LAB strains to assimilate cholesterol in MRS broth with and without bile salts was measured using published methods27,43. Briefly, LAB strains were incubated at 37 °C for 20 h in MRS broth supplemented with sodium tauroglycocholate (6 mM) and cholesterol (70 μg/ml). One ml of the supernatant was mixed with 2 ml of ethanol (95%) and 1 ml KOH (33%) and, heated for 15 min at 37 °C. This was followed by addition of 3 ml of n-hexane and 2 ml of distilled water. The mixture was left at the room temperature undisturbed and the hexane layer was transferred to another test tube and heated at 90 °C. The resultant residue was dissolved in 2 ml of o-phthalaldehyde (5 mg/ml), followed by the addition of 500 μl of concentrated sulphuric acid. The absorbance of the inoculated and un-inoculated samples was measured after 15 min at 570 nm. The cholesterol assimilation potential of each strain was calculated by dividing the assimilated cholesterol (μg/ml) after 20 h by the initial amount of cholesterol (μg/ml) at 0 h. The experiments were repeated for each isolate in triplicate and the mean percentage of cholesterol assimilation was reported ± standard deviation (SD).
Antibiotic susceptibilities
The susceptibilities of the strains for commonly used antibiotics were determined using the Kirby Bauer disk diffusion method. The antibiotic disks (HiMedia, India) which were used in this study were—amoxicillin (10 μg), kanamycin (30 μg), streptomycin (10 μg), gentamycin (10 μg), ciprofloxacin (5 μg), erythromycin (15 μg) and tetracycline (30 μg). Antibiotic disks were placed on the bacterial lawn spread over the surface of Muller–Hinton (MH) agar plates and incubated at 37 °C for 24 h. The diameter of zone of inhibition around each antibiotic disk was measured and antibiotic susceptibilities of the strains were interpreted according to the guidelines of the Clinical Laboratory Standards Institute44.
Evaluation of safety—hemolytic and DNase activities
The hemolytic activity of L. plantarum strains was determined following a published method45. Overnight grown strains were streaked on the surface of blood agar plates (7% v/v sheep blood). The plates were incubated at 37 °C for 48–72 h for development of a zone of hemolysis around the colonies. For DNase activity, the isolates were streaked on the surface of DNase agar medium plates and incubated at 37 °C. Formation of clear and pinkish zone around the colonies was considered as indication of DNase production46.
Statistical analysis
All the experiments were performed in triplicates and the mean values ± standard deviation (calculated using Microsoft Excel) were reported. The statistical significance was calculated using the Mann–Whitney U test and p value < 0.05 was considered as significant.
Acknowledgements
NS was supported by Senior Research Associateship (Council of Scientific and Industrial Research—Scientists’ Pool Scheme) File no. 13(9089-A)/2019-POOL. The authors are thankful to the Indian Council of Medical Research projects (ISRM/12(33)/2019) and (VIR/25/2019/ECD-I) for financial support.
Author contributions
Conceptualization: [N.S.]; Methodology: [N.S.S.], [S.M.], [N.S.]; Formal analysis and investigation: [N.S.], [M.K.]; Writing—original draft preparation: [N.S.]; Writing—review and editing: [N.S.], [M.K.]; Resources: [J.S.V.]; Supervision: [N.S.], [J.S.V.]. All authors contributed to the study conception and design. All authors read and approved the final manuscript.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher's note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Contributor Information
Neelja Singhal, Email: neelja30@gmail.com.
Jugsharan Singh Virdi, Email: virdi_dusc@rediffmail.com.
References
- 1.World Health Organization. Cardiovascular Disease Fact Sheet No. 317 (2013). http://www.who.int/mediacentre/factsheets/fs317/en/index.html.
- 2.Bliznakov EG. Lipid-lowering drugs (statins) cholesterol and coenzyme Q10 The Baycol case—A modern Pandora’s box. Biomed. Pharmacother. 2002;56:56–59. doi: 10.1016/S0753-3322(01)00150-0. [DOI] [PubMed] [Google Scholar]
- 3.Pan DD, Zeng XQ, Yan YT. Characterisation of Lactobacillus fermentum SM-7 isolated from koumiss, a potential probiotic bacterium with cholesterol-lowering effects. J. Sci. Food Agric. 2011;91:512–518. doi: 10.1002/jsfa.4214. [DOI] [PubMed] [Google Scholar]
- 4.Wang J, Zhang H, Chen X, Chen Y, Menghebilige W, Bao Q. Selection of potential probiotic lactobacilli for cholesterol-lowering properties and their effect on cholesterol metabolism in rats fed a high-lipid diet. J. Dairy Sci. 2012;95:1645–1654. doi: 10.3168/jds.2011-4768. [DOI] [PubMed] [Google Scholar]
- 5.Trautwein EA, Rieckhoff D, Erbersdobler HF. Dietary inulin lowers plasma cholesterol and triacylglycerol and alters biliary bile acid profile in hamsters. J. Nutr. 1998;128:1937–1943. doi: 10.1093/jn/128.11.1937. [DOI] [PubMed] [Google Scholar]
- 6.Kimoto H, Ohmomo S, Okamoto T. Cholesterol removal from media by lactococci. J. Dairy Sci. 2002;85:3182–3188. doi: 10.3168/jds.S0022-0302(02)74406-8. [DOI] [PubMed] [Google Scholar]
- 7.Lye HS, Rusul G, Liong MT. Removal of cholesterol by lactobacilli via incorporation and conversion to coprostanol. J. Dairy Sci. 2010;93:1383–1392. doi: 10.3168/jds.2009-2574. [DOI] [PubMed] [Google Scholar]
- 8.Yang Y, Liu Y, Zhou S, Huang L, Chen Y, Huan H. Bile salt hydrolase can improve Lactobacillus plantarum survival in gastrointestinal tract by enhancing their adhesion ability. FEMS Microbiol. Lett. 2019;366:fnz100. doi: 10.1093/femsle/fnz100. [DOI] [PubMed] [Google Scholar]
- 9.FAO/WHO. Guidelines for the Evaluation of Probiotics in Food. Report of a Joint FAO/WHO Working Group on Drafting Guidelines for the Evaluation of Probiotics in Food (FAO, 2002).
- 10.Zheng J, et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Microbiol. 2020;70:2782–2858. doi: 10.1099/ijsem.0.004107. [DOI] [PubMed] [Google Scholar]
- 11.Todorov SD, Franco BD. Lactobacillus plantarum: Characterization of the species and application in food production. Food Rev. Int. 2010;26:205–229. doi: 10.1080/87559129.2010.484113. [DOI] [Google Scholar]
- 12.Capozzi V, Russo P, Ladero V, Fernández M, Fiocco D, Alvarez MA, Grieco F, Spano G. Biogenic amines degradation by Lactobacillus plantarum: Toward a potential application in wine. Front. Microbiol. 2012;3:122. doi: 10.3389/fmicb.2012.00122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Mogensen G, et al. Food microorganisms—health benefits, safety evaluation and strains with documented history of use in foods. Bull. Int. Dairy Fed. 2002;377:4–19. [Google Scholar]
- 14.EFSA Panel on Biological Hazards (BIOHAZ) et al. Update of the list of QPS-recommended biological agents intentionally added to food or feed as notified to EFSA 5: Suitability of taxonomic units notified to EFSA until September 2016. EFSA J. 2017;15:e04663. doi: 10.2903/j.efsa.2017.4663. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Seddik HA, Bendali F, Gancel F, Fliss I, Spano G, Drider D. Lactobacillus plantarum and its probiotic and food potentialities. Probiotics Antimicrob. Proteins. 2017;9:111–122. doi: 10.1007/s12602-017-9264-z. [DOI] [PubMed] [Google Scholar]
- 16.Behera SS, Ray RC, Zdolec N. Lactobacillus plantarum with functional properties: An approach to increase safety and shelf-life of fermented foods. Biomed. Res. Int. 2018;2018:9361614. doi: 10.1155/2018/9361614. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Wang J, et al. Assessment of probiotic properties of Lactobacillus plantarum ZLP001 isolated from gastrointestinal tract of weaning pigs. Afr. J. Biotechnol. 2011;10:11303–11308. doi: 10.5897/AJB11.255. [DOI] [Google Scholar]
- 18.Nami Y, Abdullah N, Haghshenas B, Radiah D, Rosli R, Khosroushahi AY. Assessment of probiotic potential and anticancer activity of newly isolated vaginal bacterium Lactobacillus plantarum 5BL. Microbiol. Immunol. 2014;58:492–502. doi: 10.1111/1348-0421.12175. [DOI] [PubMed] [Google Scholar]
- 19.Jose NM, Bunt CR, Hussain MA. Comparison of microbiological and probiotic characteristics of lactobacilli isolates from dairy food products and animal rumen contents. Microorganisms. 2015;3:198–212. doi: 10.3390/microorganisms3020198. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Agaliya PJ, Jeevaratnam K. Screening of Lactobacillus plantarum isolated from fermented idli batter for probiotic properties. Afr. J. Biotechnol. 2012;11:12856–12864. [Google Scholar]
- 21.Chang MH, Hong SF, Chen JH, Lin MF, Chen CS, Wang SC. Antibacterial activity Lactobacillus plantarum isolated from fermented vegetables and investigation of the plantaricin genes. Afr. J. Microbiol. Res. 2016;10:796–803. doi: 10.5897/AJMR2016.7922. [DOI] [Google Scholar]
- 22.Fhoula I, Najjari A, Turki Y, Jaballah S, Boudabous A, Ouzari H. Diversity and antimicrobial properties of lactic acid bacteria isolated from rhizosphere of olive trees and desert truffles of Tunisia. Biomed. Res. Int. 2013;2013:405708. doi: 10.1155/2013/405708. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Elkins CA, Moser SA, Savage DC. Genes encoding bile salt hydrolases and conjugated bile salt transporters in Lactobacillus johnsonii 100–100 and other Lactobacillus species. Microbiology (Reading) 2001;147:3403–3412. doi: 10.1099/00221287-147-12-3403. [DOI] [PubMed] [Google Scholar]
- 24.Moser SA, Savage DC. Bile salt hydrolase activity and resistance to toxicity of conjugated bile salts are unrelated properties in lactobacilli. Appl. Environ. Microbiol. 2001;67:3476–3480. doi: 10.1128/AEM.67.8.3476-3480.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.O’Flaherty S, Crawley AB, Theriot CM, Barrangou R. The Lactobacillus bile salt hydrolase repertoire reveals niche-specific adaptation. mSphere. 2018;3:e00140-18. doi: 10.1128/mSphere.00140-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ru X, Zhang CC, Yuan YH, Yue TL, Guo CF. Bile salt hydrolase activity is present in nonintestinal lactic acid bacteria at an intermediate level. Appl. Microbiol. Biotechnol. 2019;103:893–902. doi: 10.1007/s00253-018-9492-5. [DOI] [PubMed] [Google Scholar]
- 27.Singhal N, Maurya AK, Mohanty S, Kumar M, Virdi JS. Evaluation of bile salt hydrolases, cholesterol-lowering capabilities, and probiotic potential of Enterococcus faecium isolated from rhizosphere. Front. Microbiol. 2019;10:1567. doi: 10.3389/fmicb.2019.01567. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Yadav R, Puniya AK, Shukla P. Probiotic properties of Lactobacillus plantarum RYPR1 from an indigenous fermented beverage raabadi. Front Microbiol. 2016;7:1683. doi: 10.3389/fmicb.2016.0168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Pundir RK, Rana S, Kashyap N, Kaur A. Probiotic potential of lactic acid bacteria isolated from food samples: An in vitro study. J. Appl. Pharm. Sci. 2013;3:85–93. [Google Scholar]
- 30.Sarmurzina Z, Bissenova G, Zakarya K, Dospaeva R, Shaikhin S, Abzhalelov A. Characterization of probiotic strains of Lactobacillus candidates for development of synbiotic product for Kazakh population. J. Pure Appl. Microbiol. 2017;11:151–161. doi: 10.22207/JPAM.11.1.20. [DOI] [Google Scholar]
- 31.Wang PP, Wu Z, Wu J, Pan DD, Zeng XQ, Cheng KM. Effects of salt stress on carbohydrate metabolism of Lactobacillus plantarum ATCC 14917. Curr. Microbiol. 2016;73:491–497. doi: 10.1007/s00284-016-1087-8. [DOI] [PubMed] [Google Scholar]
- 32.Huang Y, Adams MC. In vitro assessment of the upper gastrointestinal tolerance of potential probiotic dairy propionibacteria. Int. J. Food Microbiol. 2004;91:253–260. doi: 10.1016/j.ijfoodmicro.2003.07.001. [DOI] [PubMed] [Google Scholar]
- 33.Kaushik JK, Kumar A, Duary RK, Mohanty AK, Grover S, Batish VK. Functional and probiotic attributes of an indigenous isolate of Lactobacillus plantarum. PLoS ONE. 2009;4:e8099. doi: 10.1371/journal.pone.0008099. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Xanthopoulos V, Ztaliou I, Gaier W, Tzanetakis N, Litopoulou-Tzanetaki E. Differentiation of Lactobacillus isolates from infant faeces by SDS-PAGE and rRNA-targeted oligonucleotide probes. J. Appl. Microbiol. 1999;87:743–749. doi: 10.1046/j.1365-2672.1999.00920. [DOI] [PubMed] [Google Scholar]
- 35.Luo Y, et al. Identification and characterization of lactic acid bacteria from forest musk deer feces. Afr. J. Microbiol. Res. 2012;6:5871–5881. [Google Scholar]
- 36.Belkacem B, Mebrouk K. Antibiotic resistance of some Lactobacilli isolated from the digestive tract of broiler in western Algeria. J. Anim. Vet. Adv. 2011;10:1859–1862. doi: 10.3923/javaa.2011.1859.1862. [DOI] [Google Scholar]
- 37.Collado MC, Meriluoto J, Salminen S. Adhesion and aggregation properties of probiotic and pathogen strains. Eur. Food Res. Technol. 2008;226:1065–1073. doi: 10.1007/s00217-007-0632-x. [DOI] [Google Scholar]
- 38.Abushelaibi A, Al-Mahadin S, El-Tarabily K, Shah NP, Ayyash M. Characterization of potential probiotic lactic acid bacteria isolated from camel milk. LWT Food Sci. Technol. 2017;79:316–325. doi: 10.1155/2018/7970463. [DOI] [Google Scholar]
- 39.Zago M, et al. Characterization and probiotic potential of Lactobacillus plantarum strains isolated from cheeses. Food Microbiol. 2011;28:1033–1040. doi: 10.1016/j.fm.2011.02.009. [DOI] [PubMed] [Google Scholar]
- 40.Tomás MSJ, Wiese B, Nader-Macías ME. Effects of culture conditions on the growth and auto-aggregation ability of vaginal Lactobacillus johnsonii CRL 1294. J. Appl. Microbiol. 2005;99:1383–1391. doi: 10.1111/j.1365-2672.2005.02726.x. [DOI] [PubMed] [Google Scholar]
- 41.Golowczyc MA, Mobili P, Garrote GL, Abraham AG, De Antoni GL. Protective action of Lactobacillus kefir carrying S-layer protein against Salmonella enterica serovar Enteritidis. Int. J. Food Microbiol. 2007;118:264–273. doi: 10.1016/j.ijfoodmicro.2007.07.042. [DOI] [PubMed] [Google Scholar]
- 42.Singhal N, Srivastava A, Kumar M, Virdi JS. Structural variabilities in β-lactamase (blaA) of different biovars of Yersinia enterocolitica: Implications for β-lactam antibiotic and β-lactamase inhibitor susceptibilities. PLoS ONE. 2015;10:e0123564. doi: 10.1371/journal.pone.0123564. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Rudel LL, Morris MD. Determination of cholesterol using o-phthalaldehyde. J. Lipid Res. 1973;14:364–366. doi: 10.1016/S0022-2275(20)36896-6. [DOI] [PubMed] [Google Scholar]
- 44.Clinical and Laboratory Standards Institute Performance Standards for Antimicrobial Susceptibility Testing . 22th Informational Supplement (M100–S22) Clinical and Laboratory Standards Institute Clinical and Laboratory Standards Institute; 2012. [Google Scholar]
- 45.Pieniz S, Andreazza R, Anghinoni T, Camargo F, Brandelli A. Probiotic potential, antimicrobial and antioxidant activities of Enterococcus durans strain LAB18s. Food Control. 2014;37:251–256. doi: 10.1016/j.foodcont.2013.09.055. [DOI] [Google Scholar]
- 46.Gupta H, Malik RK. Incidence of virulence in bacteriocin-producing enterococcal isolates. Lait. 2007;87:587–601. doi: 10.1051/lait:2007031. [DOI] [Google Scholar]

