Abstract
The new species Iotonchus lotilabiatus n. sp. from Bat Xat Nature reserve in Lao Cai Province, Vietnam is described and the molecular data (18S and 28S rDNA) are given. Females of the new species are characterized by large body size (L = 3.8-5.2 mm); barrel shaped buccal cavity of large size (41–54×70–89 µm) with dorsal tooth apex located 22 to 23.5% of buccal cavity length from its base; reproductive system didelphic-amphidelphic, vagina long, corresponding almost half of body width at the vulva with distinct parrefringens vaginae, sclerotized and triangulated pieces in optical section; tail long filiform, ventrally arcuate, with three small caudal glands in tandem and prominent terminal spinneret. Males with spicules 119 to 148 µm in length, and slender, slightly curved gubernaculum, 39 to 44 µm long and with 13 to 14 ventromedian supplements. The new species Iotonchus lotilabiatus n. sp. is closest to I. miamaensis (Khan and Araki, 2002), but differs by having larger size of body length and buccal cavity, lower position of dorsal tooth apex; longer female tail with lower c but higher c′ ratios and the presence of advulval cuticular structures.
Keywords: Morphology, Ribosomal DNA, Taxonomy
The genus Iotonchus was proposed by Cobb (1916) when he split the genus Mononchus (Bastian, 1865) into five subgenera Mononchus, Prionchulus, Mylonchulus, Iotonchus, Anatonchus, and ultimate raised in rank to genus level. The known species became the type species of the genus as I. gymnolaimus (Cobb, 1893, 1916). In 1982, Jairajpuri and Khan proposed the new genus Jensenonchus based on the type species J. ovatus (Jensen and Mulvey, 1968) which was transferred from the genus Iotonchus. The genus Jensenonchus differs from the genus Iotonchus in having more anteriorly dorsal tooth position and a weak longitudinal ridge opposite to dorsal tooth, anteriorly gradually merging into the ventral wall (Jairajpuri and Khan, 1982). Siddiqi (1984a) established the new genus Mulveyellus based on the type species M. jairi (Lordello, 1959) and five species which were moved from the genus Iotonchus including I. antendontus (Mulvey, 1963a), I. antedontoides (Coetzee, 1967), I. longicaudatus (Baqri et al., 1978), I. monhystera (Cobb, 1916) and I. vorax (Mulvey, 1963a). This genus is distinguished from the genus Iotonchus by having more anteriorly dorsal tooth position (Siddiqi, 1984a). Recently, Siddiqi (2015) proposed the new genus Megaiotonchus (Siddiqi, 2015) from the genus Iotonchus based on more anteriorly dorsal tooth position and the presence of dorsal and ventral body pores in the rectal region. The species Iotonchus ophiocercus (Andrássy, 1993b; Clark, 1961) became the type species of the genus Megaiotonchus and eight species which were transferred from the genus Iotonchus including I. caesar (Alekseev, 2001), I. candelabri (Yeates, 1992), M. kheri (Mohadas and Prabhoo, 1979), I. maragnus (Clark, 1961), I. montanus (Yeates, 1992), I. percivali (Clark, 1961), I. spinicaudatus (Coetzee, 1967) and I. vulvapapillatus (Andrássy, 1964) and two new species as M. loofi (Siddiqi, 2015), and M. nacobbi (Siddiqi, 2015) were described (Siddiqi, 2015).
Currently, 77 valid Iotonchus species have been described with the most recent three being I. goshiensis (Khan et al., 2008), I. hinokumaensis (Khan et al., 2008), and I. ogiensis (Khan et al., 2008). The main diagnostic features of the genus are: (i) body length 0.8 to 5.2 µm long; (ii) medium to large size of buccal cavity, roomy shape, dorsal tooth located at or nearly at the base of buccal cavity, no tooth or denticle on subventral wall; (iii) pharyngo-intestinal junction tuberculate; (iv) female genital system amphidelphic or monodelphic; (v) spicule (if male present) more or less arcuate, bifurcate lateral guiding pieces present; and (vi) tail similar in both sexes, variable in shape and length, predominantly conoid or filiform, caudal glands and spinneret present or absent. At species level, taxa are differentiated using mainly morphometric features such as: tail length or c′ index, size of buccal cavity, position of dorsal tooth, body length, type of reproductive systems, the degree of development of spinneret, and the position of caudal glands opening.
To date, among predaceous nematodes of the order Mononchida in Vietnam, 17 Iotonchus species have been recorded from several provinces (Vu, 2015). In the present study, Iotonchus lotilabiatus n. sp. is described based on morphological, morphometric, and molecular data from the Bat Xat Natural Reserve in Lao Cai Province, Vietnam. An updated key to species based on female characteristics and a compendium of all the known species are also provided.
Material and methods
Nematode extraction, preservation, and morphological studies
Soil samples were collected randomly from a pristine forest inthe Bat Xat Nature Reserve, Lao Cai Province, Vietnam. Nematodes were extracted from soil samples using modified Baermann funnel technique (Southey, 1986).
They were heat killed, fixed in 4% formaldehyde (for morphological observations) or in a DESS mixture (Yoder et al., 2006) (for molecular analyses), transferred to anhydrous glycerol (Seinhorst, 1962), and mounted on glass slides for microscopic observation. Measurements were performed with a Nikon digital camera on a Nikon Eclipse Ni microscope at the Institute of Ecology and Biological Resources, Vietnam Academy of Science and Technology (VAST), Vietnam. Observations of morphological diagnostic features and light microscope were taken with a Nikon digital camera mounted on a Nikon Eclipse Ni microscope. Illustrations were drawn using a Nikon Eclipse Ni microscope equipped with a Nikon Y-IDT drawing tube. Photographs and illustrations were edited by using Adobe Photoshop CC 2018.
DNA extraction, polymerase chain reaction (PCR), and sequencing
Nematode DNA was extracted from a single individual as described by Holterman et al. (2006) and DNA extracts were stored at –20° until used as PCR template. The D2-D3 expansion segment 28S rDNA and 18S were amplified using the forward D2A (5′–ACAAGTACCGTGGGGAAAGTTG–3′) and reverse D3B (5′–TCGG AAGGAACCAGCTACTA–3′) primers (Subbotin et al., 2006) and primers 18S (18F : 5′-TCTAGAGCTAATAC ATGCAC-3′/18R: 5′-TACGGAAACCTTGTTACGAC-3′). All PCR reactions contained 12.5 μl Hot start green PCR Master Mix (2x) (Promega, USA), 1 μl of the forward and reverse primer (10 μM each), the 3 μl DNA template and sterile Milli-Q water to 25 μl of the total volume. All PCR reactions were performed in SimpliAmp Thermal cycler (Thermo Fisher Scientific) as follows: an initial denaturation step at 95°C for 4′min, followed by 40 cycles at 95°C for 30 sec, 54°C for 30 sec, and 72°C for 60 sec with a final incubation for 5 min at 72°C. Amplicons were visualised under UV illumination after Simplisafe gel staining and gel electrophoresis. Purified PCR products were sent to Apical Scientific Company for sequencing (Selangor, Malaysia). After sequencing the obtained Iontonchus lotilabiatus n. sp. rDNA sequence fragments were deposited in GenBank under the following accession numbers: MW218936-MW218937 (18S rDNA) and MW218934-MW228378 (28S rDNA).
Phylogenetic analyses
For phylogenetic relationships, analyses were based on 18S and 28S rDNA. The newly obtained rDNA sequences were analysed using the BioEdit sequences avalaible in GenBank using the ClustelW aligment tool implemented in the MEGA 7 version 7.0 (Kumar et al., 2016). The final 18S and 28S rDNA datasets for phylogenetic study included sequences from the current study Iotonchus lotilabiatus sp. nov. and available sequences of Mononchida representatives from GenBank. The prepared multiple alignments of 18S and 28S rDNA generated by the ClustalW algorithm were routinely manually edited in order to eliminate improper phylogenetic signals. The phylogenies were constructed with the program MEGA 7 version 7.0. Maximum likelihood with T92+G substitution model for both, 18S and 28S data sets was used.
Description and discussion
Iotonchus lotilabiatus n. sp.
Figure 1:
Holotype female Iotonchus lotilabiatus n. sp. Female. A. Head region. B. Pharyngo-intestinal junction. C. Vulval region with advulval ventromedian papillary structures. D. Tail terminus. E. Tail region. F. Female reproductive systems. Scale bar: A, B, C, D = 20 µm, E = 100 µm.
Figure 2:
Paratype male Iotonchus lotilabiatus n. sp. Male. A. Head region. B. Tail region. C. Spicule, gubernaculum and accessory piece. Scale bar: A, C = 20 µm, B = 100 µm.
Figure 3:
Holotype female Iotonchus lotilabiatus n. sp. A. Head region. B. Amphidial aperture. C. Entire body. D. Reproductive system. Scale bars indictaed.
Figure 4:
Paratype male Iotonchus lotilabiatus n. sp. Male. A. Head region. B. Head region with protruding papillae. C. Reproductive system with spicule, gubernaculum and lateral guiding piece. D. Tail region with ventromedian supplements. Scale bars indicated.
Table 1.
Morphometrics of females and Males of Iotonchus lotilabiatus n. sp. from Lao Cai Province, Vietnam.
Bat Xat Natural Reserve | |||
---|---|---|---|
Characters/ratios | Holotype | Paratypes | |
n | 1 female | 4 females | 6 males |
L | 3643 | 3768–5163 (4519 ± 585) | 2950-4230 (3487± 530) |
a | 49.2 | 49.8-59.2 (56.3 ± 4.4) | 44.1-51.5 (48.9 ± 2.8) |
b | 4.8 | 4.9-5.4 (5.1 ± 0.2) | 4.7-5.4 (5.0 ± 0.3) |
c | 6.4 | 4.5-6.3 (5.6 ± 0.8) | 5.3-5.9 (5.6 ± 0.2) |
c′ | 12.2 | 14.4-19.0 (15.7 ± 2.2) | 8.2-13.1 (10.4 ± 1.7) |
V (%) | 58.3 | 54.2-59.4 (55.9 ± 2.4) | – |
Lip region height | 16.5 | 18.0-21.0 (19.8 ± 1.5) | 14.5-17.5 (16.3 ± 1.1) |
Lip region width | 50.0 | 52.5-70 (59.5 ± 7.5) | 46-52 (48.3 ± 2.7) |
Buccal cavity length | 73 | 69.5-88.5 (79.6 ± 8.9 | 61.5-67.2 (64.1 ± 2.2) |
Buccal cavity width | 41.5 | 41.0-54.0 (46.9 ± 6.1) | 36.0-41 (37.9 ± 1.6) |
Position of tooth apex from the base of buccal cavity | 16.7 | 16.5-19.5 (17.7± 1.5) | 14-17 (15.5 ± 1.5) |
Nerve ring from anterior end | 190 | 210-244 (226.4± 15.1) | 154-204 (174.9 ± 20.0) |
Excretory pore from anterior end | 225 | 224-271 (253 ± 22.2) | 180.8-232 (204 ± 21.8) |
Pharynx length | 761.0 | 770-975.7 (870 ± 98.5) | 627.7-789.3 (693.2 ± 70.9) |
Anterior branch of genital system | 341 | 341-477 (424 ± 37) | – |
Posterior branch of genital system | 314 | 314-462 (406 ± 38) | – |
Maximum body width | 74.0 | 75.5-87.0 (80.0 ± 5.1) | 60.0-82.0 (71.0 ± 8.0) |
Anal body width | 46.8 | 48.0-58.0 (52.0 ± 4.4) | 55.0-63.0 (59.8 ± 3.3) |
Rectum/cloaca length | 49.2 | 49.0-53.0 (51.5 ± 1.8) | 55-64 (59.5 ± 3.4) |
Vagina length | 34.0 | 36.5-38.5 (37.7 ± 1.0) | – |
Spicule length | – | – | 130-141 (136.8 ± 4.1) |
Spicule width at widest part | – | – | 8.0-11 (9.3 ± 1.4) |
Lateral guiding piece length | – | – | 17.5-23.5 (19.6 ± 2.9) |
Gubernaculum length | – | – | 39.5-44 (42.3± 1.7) |
Number of supplements | – | – | 13-14 |
Distance from cloacal opening to posteriormost supplement | – | – | 20.5-23 (21.4 ± 1.0) |
Distance from cloacal opening to anterior most supplement | – | – | 201-241.5 (218.9 ± 15.8) |
Tail length | 572 | 694-974 (818 ± 125.3) | 500-798 (623 ± 114) |
Notes: All measurements are in µm except where indicated. a = body length/maximum body width; b = body length/pharyngeal length; c = body length/tail length; c′ = tail length/body width at anus; V = (distance from anterior end to vulva/body length)x100. L = body length.
Type material
Holotype female, four paratype females and six paratype males in good condition of preservation. Holotype female on slide Iotonchus lotilabiatus n. sp. No. 1; four paratype femaleson slides Iotonchus lotilabiatus n. sp. No. 2-5, and six paratype males on slides Iotonchus lotilabiatus n. sp. No. 6-11 in permanent mounts in glycerin. All slides have been deposited in the nematode collection at the Department of Nematology, Institute of Ecology and Biological Resources, Vietnam Academy of Science and Technology (VAST), Vietnam.
Type habitat and locality
Soil around the roots of random forest trees in the Bat Xat Nature reserve (N = 22°37′14″ and E = 103°37′24″, altitude 1,900 m), Bat Xat District, Lao Cai Province, Vietnam.
Etymology
The specific epithet refers to the morphology of the labial region (lips lotus-petals shaped) that characterizes this species.
Measurements: see Table 1.
Description
Females
Large size of nematodes. Body ventrally arcuate after fixation. Body tapering slightly anterior to vulva position but more sharply toward posterior end. Maximum body width at the level of vulva. Cuticle smooth, 4.7 (3.4-5) µm thick at the base of pharynx, sub-cuticle distinctly striated. Labial region offset by a depression from the body contour, 2.8 to 3 times as wide as high. Labial region slightly separated six lips in the shape of lotus-petals with prominent labial papillae. Anterior sensilla arranged in two circles: an anterior one of six inner labial papillae, posterior crown with six outer labial papillae and four cephalic papillae protruding beyond the body outline. Buccal cavity begins at 19-22 μm from the anterior end of the body, large size, 1.6-1.8 as long as wide, barrel shaped, its wall strongly sclerotized, vertical plates parallel, basal oblique plates flattened. Amphidial fovea small, cup-shaped, with oval aperture 4-5 μm wide, located around at the beginning of buccal cavity or slightly lower. Dorsal tooth small size, located at the base of vertical plates, apex pointed forward, at 22.5 (21.6-23.4) % its length from the base of buccal cavity. Two small but prominent foramina present at the base of the buccal cavity. About the posterior fifth of buccal cavity embedded in pharyngeal tissues.
Body diameter length at the pharynx base about 1.2 to 1.4 times head width. Pharynx cylindrical, surrounded by the nerve ring, located at 26 (24-27) % of its length, measured from the anterior body end, respectively. Secretory-excretory (SE) pore conspicuous, situated just posterior to nerve ring at 29 (28-30) % of its length from anterior body end. Pharyngo-intestinal junction tuberculate; cardia with conoid projection into wide intestinal lumen. Distance between pharynx base and vulva 1.7 to 2.0 times of the pharynx length. Rectum slightly curved, as long as anal body width. Tail long filiform, 0.7 to 1 mm long, ventrally curved, correspondence 16 to 22% of body length or 12.2 to 19.0 anal body diameters long; three small caudal glands in tandem and opening on terminal tail.
Genital system typical for the genus, didelphic-amphidelphic, both branches about equally developed: anterior branch occupies 9.4 (8.9-10.4) % of body length and posterior branch occupies 9.0 (8.5-10.2) % of body length. Ovaries reflexed, 100 to 145μm long in anterior branch and 85 to 120 μm long in posterior branch; oocytes arranged in a row except at its tips. The uterus is relatively long, 170 to 240 μm long in each branch; sphincter present at the oviduct-uterus junction, valve sclerotized. Oviduct length 133 to 203 μm in anterior branch and 123 to 200 μm in posterior branch, with well-marked pars dilatata, connected to the uterus with a muscular sphincter. Vulva a transverse slit, situated on the posterior half of the body. Zero to one pre- and one to two conspicuous post advulval papillae. Vulva-anus distance 1.4 to 1.7 times its tail length. Uterus in one paratype female with two large eggs (177 μm long × 63.4 μm wide in anterior branch and 200.4 μm long × 61 μm wide in posterior branch). Vagina length corresponds to almost half of body width. Pars proximalisvaginae as long as wide, gradually expanded in distal part, surrounded by strong circular muscles. Pars refringensvaginae appearing as two prominent, triangular sclerotized pieces (6.7×7 µm) in longitudinal optical section. Pars distalisvaginae short. Vulva transverse in ventral view.
Males
Males are similar to females in general morphology, but more strongly curved to coiled in the posterior region. Buccal cavity smaller than females, 36–41×61.5–67 μm. Genital system diorchic, testes pared, outstretched and opposed, 1.2 to 1.7 mm long. Spicules slender, ventrally arcuated with bifurcate terminus, 2.1 to 2.4 times longer than body diameter at cloacal aperture and 8 to 11 μm long at the widest part. The head of spicule round-shape, 13 to 19 μm long and 7.5 to 9.5 μm wide; offset by shallow depression. The median piece is 104 to 115 μm long and 3.5 to 4.5 μm wide; round blade part. Lateral guiding pieces straight with bifurcate terminus, 18 to 24 μm long. This furcation is symmetrical and well-marked. Gubernaculum is well developed, 39 to 44 µm long (following Peña-Santiago et al., 2014). Ventromedian supplements 13 to 14 in number, conical and regularly arranged, occupies 5 to 7.7% of the body length. The most anterior supplement is situated at 201 to 242 µm from cloacal aperture. The distance between the first and last supplement is 178 to 220 µm. Male tail is 500 to 800 µm long, slightly shorter than the female tail.
Diagnosis
Iotonchus lotilabiatus n. sp. is characterized by large adult body size (3.8-5.2 mm); long length of buccal cavity (69.5-88.5 µm); posterior position of dorsal tooth apex (21.6-23.4)% of buccal cavity length from its base; didelphic-amphidelphic with both branches equally developed, pars refringens vaginae sclerotized (6.7×7 µm), intriangulated shape; the presence of small ventromedian papillary structures on the vulval region; the presence of males with long spicules (119-148 µm) with rounded head and blade part, gubernaculum (39-44 µm) and lateral guiding piece (17-24 µm) well developed; 13 to 14 ventromedian supplements.
In general appearance Iotonchus lotilabiatus n. sp. is similar to I. apapillatus (Dhanam and jairajpuri, 1998), I. brachylaimus (Cobb, 1917), and I. miamaensis (Khan and Araki, 2002) based on the morphological characters as: a large body length (L>3 mm), long length of buccal cavity (>65 µm), didelphic-amphidelphic, caudal glands opening on terminal tail and the presence of males. From I. apapillatus, it differs by having larger body length (3.8-5.2 vs 2.7-3.5 mm), slenderer nematodes (a = 49-59 vs 35-39); larger buccal cavity (41-54×70–89 μm vs 40-44×68-70 μm); lower c value (4.5-6.3 vs 10-13) but higher c′ value (12.2-19 vs 4.3-5.8); vulval more anterior (V = 54.2-59.4% vs V = 62-74%), the presence of advulval cuticular structures and the number of ventromedian supplements in males (13-14 vs 17-19). The new species Iotonchus lotilabiatus n. sp. differs from I. brachylaimus by having larger body length (3.8-5.2 vs 3.2 mm), slenderer nematodes (a = 49-59 vs 33); longer length of buccal cavity (70-89 μm vs 64 μm); lower c value (4.5-6.3 vs 17) but higher c′ value (12.2-19 vs 3.7); the presence of advulval cuticular structures; longer spicule length (130-141 vs 95 μm) and the number of ventromedian supplements (13-14 vs 16).
From I. miamaensis, it is distinguished by having larger size of body length (3.8-5.2 vs 3.2-3.5 mm); larger size of buccal cavity (41-54×70-89 μm vs 42-45×64-72 μm), more posterior dorsal tooth apex (21.6-23.4% vs 24-27%); longer female tail (0.57-0.97 vs 0.4-0.43 mm), lower c (4.5-6.3 vs 7.6-8.4) but higher c′ (12.2-19.0 vs 7.5-8.3) ratios and the presence of advulval cuticular structures.
Table 2 presents a compendium of Iotonchus species morphometrics for comparative purposes (However, five species were not included in Table 2 and the key because of unavailable literatures: I. brachylaimium (Aboul-Eid and Ameen, 1982); I. kvavadezi (Eliava); I. longisaccatus (Mohilal et al., 2000); I pharoensis (Aboul-Eid and Ameen, 1982), and I. terminus (Mohilal et al., 2000).
Table 2.
Compendium of the species belonging to the genus Iotonchus (Cobb, 1917).
Species | n | L | a | b | c | c' | V | B.C.L. | B.C.W. | %DT | Spinneret | Female gonad | Spicule length | Number Suppls | Country | Reference |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
abrahmami | 9♀♀ | 2.7-3 | 40-51 | 4.6-5.0 | 5.8-12.3 | 5.9-12.8 | 64-72 | 42-47 | 27-31 | 33-36 | Terminal | Pseudo-prodelphic | Malaysia | Loof (2006) | ||
2♂♂ | 2.7-2.8 | 54 | 4.7-4.8 | 6.8 | 8.3-8.5 | 42-43 | 25-26 | 90-91 | 11 | |||||||
acuticaudus | 11♀♀ | 1.9-2.1 | 29-34 | 3.8-4.7 | 9.1-11.8 | 6.1a | 71-75 | 40-50 | 28-32 | 23a | Subdorsal | Monodelphic | Nigeria | Mulvey and Jensen (1967) | ||
11♂♂ | 2.0-2.4 | 27-34 | 4.0-4.4 | 9.5-11.8 | 4.3a | 40-45 | 27-31 | 78-88 | 6-8 | |||||||
Acutus | 10♀♀ | 1.8-2.2 | 32-39 | 5.3-6 | 12-15.5 | 4.3a | 61-66 | 37-38 | 24-26 | 28a | No | Didelphic | South Africa | Heyns and Lagerwey (1965) | ||
10♂♂ | 1.4-1.9 | 28-40 | 4.4-5.5 | 13.2-15.6 | 2.7a | 26-37 | 17-23 | 67-83 | 9-12 | |||||||
4♀♀ | 1.7-2.4 | 31-41 | 13.6-18 | 3.9a | 63-66 | 39-43 | 20-27 | No | Didelphic | USA | Mulvey (1963a) | |||||
aequabilis | ?♀♀ | 2.2-2.5 | 36-43 | 5.4-5.6 | 34-41 | 1.3-1.8 | 70-72 | 44-48 | 28-33 | No | Didelphic | Ukraine | Susulovsky (1998) | |||
aequatorialis | 5♀♀ | 2.2-2.4 | 20-30 | 4.4-4.7 | 4.3-4.8 | 8.3-10 | 51-54.4 | 57-65 | 32-38.5 | 23a | Terminal | Didelphic | Ecuado | Vinciguerra and Orselli (2006) | ||
anisostomus | 1♀ | 1.72 | 30 | 3.7 | 12.9 | 5a | 68 | 40 | 17 | 23a | Terminal | Monodelphic | Thailand | Buangsuwon and Jensen (1966) | ||
arcuatus | 8♀♀ | 1.7-1.8 | 35-41 | 4.4-4.7 | 4.9-6 | 9.2-10.5 | 55-57 | 38-41 | 24-28 | 24-34 | No | Didelphic | Japan | Khan et al. (2000) | ||
apapillatus | 8♀♀ | 2.7-3.5 | 35-39 | 4.4-4.7 | 10-13 | 4.3-5.8 | 62-74 | 67-80 | 40-44 | 19-27 | Terminal | Didelphic | India | Dhanam and Jairajpuri (1998) | ||
3♂♂ | 2.9 | 41 | 4.6-4.7 | 11-15 | 2.9-4.3 | 64-67 | 34-35 | 125-138 | 17-19 | |||||||
baqrii | 9♀♀ | 1.5-1.7 | 28-37 | 4.0-4.6 | 5-7 | 12.2a | 62-70 | 32-37 | 28-32 | 29-34 | Subventral | Monodelphic | India | Jairajpuri (1969) | ||
9♂♂ | 1.5-1.7 | 31-35 | 4.3-4.8 | 5-7 | 6.8a | 28-32 | 24-26 | 25-28 | 80-93 | 9-10 | ||||||
basidontus | 6♀♀ | 1.7-2.4 | 25-32 | 3.7-4.3 | 6.5-8.6 | 6.6a | 55-60 | 48a | 30a | 25 | Terminal | Didelphic | New zealand | Clark (1960) | ||
1♂ | 2 | 30 | 3.9 | 8.6 | 4.8a | 83a | 14 | |||||||||
brachylaimus | 1♀ | 3.2 | 33.3 | 4.8 | 17 | 3.7a | 65 | 64a | 53a | Terminal | Didelphic | USA | Mulvey (1963a), (after Cobb, 1917) | |||
1♂ | 3.5 | 40 | 5.3 | 17 | 95 | 16 | ||||||||||
carpathicus | 13♀♀ | 2.5-3.5 | 31-44 | 4.2-5.1 | 4.3-6.6 | 12.1a | 56.5-60 | 46-62 | 36-52 | 23-35 | No | Didelphic | Romania | Popovici (1990) | ||
16♂♂ | 2.1-3.7 | 33-47 | 4.3-5.1 | 4.9-6.7 | 47-57 | 33-50 | 72-100 | 11-13 | ||||||||
chantaburensis | 4♀♀ | 0.8-1 | 24-32 | 3.5-4.5 | 3.8-4.9 | 59-64 | 22-25 | 9-14 | Terminal | Monodelphic | Thailand | Buangsuwon and Jensen (1966) | ||||
6♀♀ | 0.9-1 | 24-26 | 3.8-3.9 | 5.8-6 | 6.7-7.4 | 63-65 | 26-30 | 14-17 | Subventral | Monodelphic | India | Mohadas and Prabhoo (1979) | ||||
clarki | 6♀♀ | 1.7-2 | 28-34 | 3.9-5.2 | 4.6-5.9 | 8.8a | 52-58 | 40-43 | 23-29 | 20a | No | Didelphic | Nigeria | Mulvey and Jensen (1967) | ||
consimilis | ?♀♀ | 2.8-3.5 | 34-41 | 4.5-4.9 | 6.6-7.6 | 7.3a | 68-69 | 60-63 | 37-40 | Terminal | Monodelphic | Brazil, Hawaii | Mulvey (1963a), (after Cobb, 1917) | |||
cucumis | 5♀♀ | 2.9-3.2 | 39-44 | 4.2-4.3 | 10.7-12.2 | 4.7-5.2 | 64-66 | 57-60 | 34-39 | 23 | Terminal | Didelphic | Korea | Khan et al. (2002) | ||
cuticaudatus | 12♀♀ | 2.8-3 | 30-37 | 4.6-5.8 | 7-10 | 5.5-7.8 | 62-64.5 | 57-65 | 33-37 | 22-25 | Terminal | Didelphic | India | Jana et al. (2007) | ||
7♂♂ | 2.3-3.1 | 30-39 | 4.4-5.4 | 9.6-14.5 | 3.1-3.6 | 50-57 | 26-30 | 123-133 | 11-15 | |||||||
damsanensis | 3♀♀ | 1.6-1.7 | 20-22 | 2.9-3 | 17-1.7 | 1.7-2.2 | 71-75 | 58-61 | 35-37 | 29-32 | No | Didelphic | Korea | Choi and Khan (2000) | ||
devius | 1♀ | 2.4 | 37.5 | 4.2 | 6.5 | 9.5 | 69 | 54 | 30 | 26 | No | Monodelphic | Côte d’Ivoire | Siddiqi (2001) | ||
geminus | 8♀♀ | 1.7-2.1 | 25-30 | 3.9-4.5 | 12.4-14 | 3.4a | 65-68 | 38-43 | 22-24 | 29a | Terminal | Didelphic | South Africa | Heyns and Lagerwey (1965) | ||
7♂♂ | 1.7-1.9 | 28-33 | 4.0-4.8 | 14.6-17.5 | 2.5a | 37-39 | 18-20 | 77-88 | 11-14 | |||||||
globibucca | ?♀♀ | 2.4 | 31 | 5 | 7.1 | 8.2 | 59 | 54 | 37 | No | Didelphic | India | Dhanam and Jairajpuri (2002) | |||
goshiensis | 4♀♀ | 1.5-1.6 | 28-30 | 3.7-4.1 | 24-26 | 1.7-1.9 | 63-65 | 40-42 | 26-27 | 24-25 | No | Didelphic | Japan | Khan et al. (2008) | ||
guineae | 1♀ | 2 | 33 | 4 | 7.1 | 7.1 | 70 | 58 | 34 | 20a | Terminal | Monodelphic | Guinae | Siddiqi (2001) | ||
2♂♂ | 1.9-2.0 | 35-43 | 3.9-4.7 | 5.9-6.9 | 6.9-8.3 | 47 | 26-27 | 74-89 | 4-6 | |||||||
gymnolaimus | 1♀ | 2.9 | 40 | 4.2 | 7.1 | 9a | 67 | 57 | 40 | Terminal | Monodelphic | Fiji, Brazil, USA | Mulvey (1963a), (after Cobb, 1917) | |||
hinokumaensis | 4♀♀ | 2-2.2 | 33-44 | 4.7-5.4 | 9.4-10.8 | 5.3-6.1 | 60-63 | 37-40 | 24-26 | 26-27 | No | Didelphic | Japan | Khan et al. (2008) | ||
3♂♂ | 2.1-2.3 | 41-44 | 4.4-5.4 | 8.7-9.3 | 5.9-6.3 | 38-40 | 24-25 | 68-75 | 9-11 | |||||||
indicus | 28♀♀ | 1.5-2 | 21-32 | 4.0-4.8 | 5-8 | 10a | 57-65 | 40-47 | 28-32 | 23-25 | Subventral | Didelphic | India | Jairajpuri (1969) | ||
kilumicus | 4♀♀ | 2.6-2.7 | 50-57 | 4.9-5.2 | 4.0-4.5 | 17-18 | 53-55 | 43-48 | 23-25 | 23-27 | Subventral | Didelphic | Cameroon | Siddiqi (2001) | ||
3♂♂ | 2.4-2.5 | 49-57 | 4.9-5.1 | 4.1-4.6 | 13-14.6 | 41-43 | 18-19 | 63-73 | 10-11 | |||||||
kirbyi | 5♀♀ | 3-3.3 | 40-46 | 4.2-4.6 | 6.8-7.8 | 7.8-9.1 | 67-72 | 58-64 | 32-33 | 26a | Terminal | Pseudo–prodelphic | Fiji | Siddiqi (1984) | ||
4♀♀ | 2.8-3.3 | 37-40 | 3.6-4.2 | 13.5-17.8 | 3.1-4.2 | 72-74 | 60-62 | 31-33 | ||||||||
kirghistanicus | ?♀♀ | 1.4-1.8 | 20-23 | 3.2-3.7 | 23-28 | 1.5-2 | 72-75 | 42 | 30 | No | Didelphic | Kirghistan | Sultanalieva (1983) | |||
?♂ | 1.6 | 19-22 | 3.3-3.8 | 20-25 | 22 | |||||||||||
koupensis | 4♀♀ | 2.1-2.5 | 30-36 | 4.1-4.2 | 4.1-5.5 | 8-11 | 54-58 | 57-60 | 29-30 | 19-20 | Subventral | Didelphic | Cameroon | Siddiqi (2001) | ||
1♂ | 1.8 | 29 | 4.5 | 5.8 | 7.2 | 49 | 24 | 90 | 12 | |||||||
lacuplanarum | 2♀♀ | 2 | 39-45 | 4.6 | 6.1-6.2 | 10.2 | 63-64 | 36-37 | 26 | 24-25 | Subventral | Monodelphic | New Caledonia | Yeates (1992) | ||
3♂ | 1.8-2.1 | 38-45 | 4.2-4.9 | 6.1-7.2 | 7.4-8.9 | 32-35 | 23-29 | 27-29 | 47-57 | 9-12 | ||||||
lamottei | 4♀♀ | 1.6 | 32-35 | 4.1-4.4 | 7.2-7.9 | 6.4a | 65-66 | 33-41 | 25-27 | 22a | No | Monodelphic | Côte | Malcevschi (1981) | ||
1♂ | 1.6 | 31 | 4 | 8.3 | 4.1a | 35 | 22 | 50 | 9 | d’Ivoire | ||||||
litoralis | 2♀♀ | 2.1-2.3 | 24-26 | 5 | 10-11 | 4.5a | 61-62 | 61a | 42a | 25 | Terminal | Didelphic | South | Coetzee (1967b) | ||
2♂♂ | 2.6-2.8 | 36-37 | 4-5 | 16 | 2.7a | 104-112 | 15-17 | Africa | ||||||||
1♀ | 2.7 | 34 | 4.1 | 15.1 | 3.6 | 68 | 54 | 39 | Terminal | Didelphic | South Africa | De Bruin and Heyns (1992) | ||||
2♂♂ | 2.6-2.8 | 35-37 | 4.4-4.7 | 18.4-21 | 2.2-2.6 | 49 | 32-35 | 107-111 | 13-14 | |||||||
longisaccus | 2♀♀ | 1.8-2.4 | 32-38 | 4.1 | 9.1-10.9 | 5.2-5.4 | 71 | 50-60 | 25-31 | 28a | Terminal | Monodelphic | Côte | Siddiqi (2001) | ||
1♂ | 2.35 | 47 | 3.9 | 7.3 | 7.8 | 54 | 25 | 88 | 4 | d’Ivoire | ||||||
loteniae | 3♀♀ | 1.9-2 | 34-42 | 4.3-5.1 | 7.3-8.6 | 6.8-9.5 | 61-68 | 30-38 | 22-25 | 29a | No | Didelphic | South Africa | De Bruin and Heyns (1992) | ||
lotilabiatus | 5♀♀ | 3.8-5.2 | 50-59 | 4.9-5.4 | 4.5-6.3 | 12-20 | 54-59 | 70-88 | 41-54 | 22-23 | Terminal | Didelphic | Vietnam | Currently paper | ||
6♂♂ | 3-4.2 | 44-52 | 4.7-5.4 | 5.3-5.9 | 8.2-13 | 62-67 | 36-41 | 21-25 | 130-141 | 13-14 | ||||||
magyar | 1♀ | 4.2 | 38 | 4.9 | 86 | 0.7 | 69 | 51 | 26 | 40 | No | Didelphic | Hungary | Andrássy (1973) | ||
mboticus | 2♀♀ | 2.2-2.3 | 42-44 | 5.2-5.3 | 4.2-4.3 | 14-14.7 | 52-53 | 40 | 23 | 23a | Subdorsal | Didelphic | Cameroon | Siddiqi (2001) | ||
3♂♂ | 2.0-2.1 | 46-47 | 5.3-5.6 | 4.0-4.4 | 12-13.5 | 37-39 | 19-20 | 56-62 | 10 | |||||||
miamaensis | 9♀♀ | 3.2-3.5 | 44-50 | 4.6-5.0 | 7.6-8.4 | 7.5-8.3 | 60-61 | 64-72 | 42-45 | 24-27 | Terminal | Didelphic | Japan | Khan and Araki (2002) | ||
5♂♂ | 2.8-3.1 | 45-48 | 4.5-4.7 | 11.2-14 | 3.5-4.7 | 57-62 | 34-40 | 127-138 | 12-13 | |||||||
microdontus | 4♀♀ | 1.2-1.3 | 29-31 | 3.7-3.9 | 5.7-6 | 61-64 | 34-36 | 19-20 | Terminal | Monodelphic | Singapore | Thong (1970) | ||||
muneris | 3♀♀ | 1.5-1.6 | 33-36 | 4.1-4.4 | 4.1-4.7 | 11-13.7 | 58-62 | 36-37 | 19-20 | 17-19 | Subventral | Monodelphic | Cameroon | Siddiqi (2001) | ||
nayari | 13♀♀ | 2.3-2.7 | 31-34 | 4.2-4.6 | 12-16 | 4.0-4.9 | 62-67 | 55-64 | 34-38 | 27-28 | Terminal | Didelphic | India | Mohadas and Prabhoo (1979) | ||
4♂♂ | 2.2-2.5 | 31-33 | 4.1-4.6 | 13-16.5 | 2.5-2.9 | 52-54 | 28-30 | 117-126 | 15-16 | |||||||
8♀♀ | 2.3-2.7 | 27-34 | 4.0-4.6 | 10-12 | 65-70 | 51-54 | 32-36 | Terminal | Didelphic | India | Khan and Jairajpuri (1980) | |||||
10♂♂ | 2.3-2.6 | 30-37 | 4.1-4.7 | 10-13 | 112-131 | 12-16 | ||||||||||
ndu | 8 ♀♀ | 1.8-2.7 | 39-47 | 4.3-4.9 | 4.3-6.9 | 8-15 | 50-57 | 46-54 | 21-27 | 24-26 | Subventral | Didelphic | Cameroon | Siddiqi (2001) | ||
3♂♂ | 1.8-2.2 | 42-45 | 4.3-4.8 | 4.4-6.9 | 8.9-11.7 | 45-50 | 21-22 | 66-75 | 10-12 | |||||||
nepotum | 7♀♀ | 1-1.2 | 22-25 | 3.1-3.8 | 13-16 | 2.2-2.8 | 66-70 | 36-40 | 22-23 | 17-20 | Terminal | Monodelphic | Papua New Guinea | Andrássy (2008) | ||
nigeriensis | 11♀♀ | 1.6-1.9 | 25-35 | 3.9-4.6 | 10-13 | 5.4a | 68-72 | 36-40 | 21-29 | 23a | No | Monodelphic | Nigeria | Mulvey and Jensen (1967) | ||
11♂♂ | 1.4-1.7 | 28-36 | 3.9-4.5 | 12-16 | 3.3a | 32-35 | 20-23 | 63-70 | 6-8 | |||||||
ogiensis | 4♀♀ | 2-2.3 | 33-36 | 4.1-4.4 | 18-20 | 2.7-3.3 | 62-63 | 38-41 | 24-26 | 24 | No | Didelphic | Japan | Khan et al. (2008) | ||
2♂♂ | 2.1-2.3 | 32-34 | 4.4-4.6 | 14-15 | 2.5-2.7 | 45-47 | 25-28 | 90-95 | 12-14 | |||||||
obtusus | 1♀ | 2.8 | 33 | 4.2 | 61 | 1 | 68 | 61 | 45 | 21 | No | Didelphic | Korea | Choi et al. (1999) | ||
onchus | 2♀♀ | 2.4-2.5 | 35-36 | 4.6-4.8 | 7-8 | 7 | 61 | 55 | 33-35 | 26-28 | No | Didelphic | Korea | Jairajpuri et al. (2000) | ||
1♂ | 2.1 | 34 | 4.6 | 8 | 5 | 50 | 30 | 23 | 82 | 11 | ||||||
parabasidontus | 7♀♀ | 2.2-2.6 | 26-37 | 4.3-4.9 | 7.2-8.7 | 6.9a | 56-60 | 48-55 | 29-32 | 23a | Terminal | Didelphic | Nigeria | Mulvey and Jensen (1967) | ||
5♂♂ | 2.0-2.4 | 29-38 | 4.3-4.7 | 9.1-11.2 | 4.2a | 42-50 | 25-28 | 26a | 90 | 13-15 | ||||||
1♀ | 1.7 | 24.4 | 4.3 | 6.6 | 6.5 | 58 | 49 | 26 | Cameroon | Siddiqi (2001) | ||||||
paracutus | 2♀♀ | 1.9-2.2 | 23-26 | 5-5.1 | 9.4-10.4 | 3.5-4.6 | 62-63 | 57-68 | 35-40 | 23a | No | Didelphic | Italia | Vinciguerra and Orselli (2000) | ||
2♂♂ | 1.6 | 23-24 | 4.6 | 10-11.3 | 2.8-3.0 | 52.5 | 30-32.5 | 57.5-66 | 10-11 | |||||||
parageminus | 31♀♀ | 1.8-2.4 | 39-53 | 5.1-6.2 | 17-24.9 | 2.5-4.3 | 63-69 | 29-40 | 20-27 | 25-37 | Subdorsal | Didelphic | Spain | Jiménez-Guirado (1994) | ||
20♂♂ | 1.7-2.2 | 36-53 | 5.1-6.1 | 24-32 | 1.6-2.2 | 27-34 | 18.5-21.5 | 53.5-67 | 9-13 | |||||||
paratrichurus | 5♀♀ | 1.4-1.5 | 27-35 | 4.2-4.6 | 3.6-4.1 | 13.5-15 | 55-58 | 30-32 | 15.5-17 | 23-25 | Subventral | Monodelphic | Cameroon | Siddiqi (2001) | ||
2♀♀ | 1.3-1.4 | 23-25 | 4.3-4.5 | 3.1-3.9 | 10.3-13 | 30 | 17-19 | |||||||||
pauli | 5♀♀ | 1.3-1.6 | 35-42 | 4.8-5.1 | 8.4-9.3 | 6.2a | 59-63 | 29-30 | 18-19 | 30a | No | Didelphic | South Africa | Heyns and Lagerwey (1965) | ||
6♂♂ | 1.3-1.4 | 38-45 | 4.6-5.1 | 10-11.2 | 3.7a | 26-29 | 14-15 | 52-53 | 8-9 | |||||||
pseudodigonicus | 6♀♀ | 1.4-1.6 | 31-34 | 4.2-4.7 | 4.1-4.7 | 60-63 | 36-39 | 25-27 | 31-36 | Subventral | Pseudo-prodelphic | India | Ahmad and Jairajpuri (1983) | |||
4♂♂ | 1.4-1.7 | 33-41 | 4.4-4.7 | 4.6-5.1 | 60-64 | 6-8 | ||||||||||
pusillus | 14♀♀ | 0.7-1 | 24-30 | 3.6-4.3 | 7.0-8.1 | 4.7-6.9 | 63-67 | 22-24 | 10-13 | 20-29 | No | Monodelphic | Malaysia | Loof (2006) | ||
recessus | 1♀ | 2.1 | 43 | 4.6 | 5.8 | 11 | 63 | 38 | 26 | 26 | Subventral | Monodelphic | New Caledonia | Yeates (1992) | ||
rayongensis | 1♀ | 2 | 37 | 4.9 | 9.5 | 7.7a | 57 | 46 | 22 | 33a | Subdorsal | Didelphic | Thailand | Buangsuwon and Jensen (1966) | ||
rinae | 5♀♀ | 1.5-1.8 | 30-38 | 5 | 14-15 | 4.2a | 68-72 | 34a | 22a | 29 | Terminal | Didelphic | South | Coetzee (1967b) | ||
12♂♂ | 1.7-1.9 | 31-40 | 5 | 15-19 | 3.2a | 60-70 | 11-12 | Africa | ||||||||
10♀♀ | 1.4-1.9 | 27-35 | 3.9-4.5 | 10-13.3 | 3.6-5.1 | 61-70 | 29-39 | 18-24 | Terminal | Didelphic | South Africa | De Bruin and Heyns (1992) | ||||
8♂♂ | 1.3-1.7 | 28-37 | 4.1-5.1 | 14-17.7 | 2.5-2.8 | 66-74 | 6-11 | |||||||||
risoceiae | 1♀ | 3.3 | 33 | 4.6 | 8.9 | 6.2a | 64 | 58 | 47 | 29a | Terminal | Didelphic | South Africa | Heyns and Lagerwey (1965) | ||
4♀♀ | 2.7-3.4 | 34-37 | 4.5-4.7 | 8-10 | 6.3a | 60-64 | 53-64 | 32-40 | Terminal | Didelphic | India | Khan and Jairajpuri (1980) | ||||
?♂♂ | 3.1-3.7 | 36-39 | 4.5-5.1 | 11 | 14-18 | India | Ahmad and Jairajpuri (2010) | |||||||||
rotundicaudatus | 29♀♀ | 2.3-2.8 | 45-63 | 5.9-7.7 | 55-108 | 0.8-1.4 | 62-69 | 32-45 | 23-25 | 25-32 | No | Didelphic | Spain | Peña Santiago and Jiménez–Guirado (1991) | ||
sacculatus | 3♀♀ | 1.7-2.1 | 28-35 | 4.4-4.5 | 7.6-8.0 | 6.3-6.6 | 70-72 | 53-55 | 30-31 | 13-15a | Subdorsal | Monodelphic | Guinea | Siddiqi (2001) | ||
3♂♂ | 1.5-1.8 | 35-39 | 3.9-4.5 | 6.8-8.2 | 5.3-5.5 | 40-49 | 22-26 | 76-79 | 8-9 | |||||||
sagaensis | 4♀♀ | 2.5-2.9 | 40-42 | 4.1-4.6 | 9.3-11 | 5.3-6 | 60-65 | 58-60 | 38-40 | 23-27 | Terminal | Didelphic | Japan | Khan et al. (2000) | ||
5♂♂ | 2.2-2.6 | 39-46.5 | 4.1-4.6 | 11.5-14 | 3.2-4.5 | 46-55 | 30-32 | 102-109 | 10-12 | |||||||
silvallus | 4♀♀ | 1.4-1.9 | 27-36 | 4.0-4.3 | 4.8-5.4 | 11.3a | 62-65 | 41-42 | 24-25 | 27-29 | Subventral | Monodelphic | India | Ahmad and Jairajpuri (1983) | ||
singaporensis | 16♀♀ | 1-1.23 | 36-41 | 3.7-4.2 | 5.1-6.7 | 6.3-8.3 | 59-65 | 31-33 | 18-19 | 29-33 | Terminal | Monodelphic | Sigapore | Ahmad et al. (2005) | ||
southi | 8♀♀ | 1.8-2.6 | 31-38 | 3.7-4.5 | 6-7 | 8-11 | 66-80 | 46-54 | 25-31 | 26-31 | Subventral | Monodelphic | India | Dhanam and Jairajpuri (1998) | ||
1♂ | 2.2 | 35 | 4.3 | 9 | 5 | 52 | 24 | 24 | 76 | 12 | ||||||
stockdilli | 9♀♀ | 3.3-4.3 | 41-49 | 5.2-5.9 | 7.1-8.8 | 7.4-10.2 | 58-73 | 50-57 | 32-41 | 33a | No | Didelphic | New Zealand | Yeates (1988) | ||
9♂♂ | 3.2-3.7 | 45-54 | 5.1-6 | 7.9-9.2 | 6.2-7.5 | 48-55 | 28-41 | 68-70 | 11-12 | |||||||
tarjani | 21♀♀ | 1.7-2.2 | 27-41 | 4.4-5.9 | 3.3-4.0 | 16a | 47-51 | 40-43 | 23-27 | 23a | No | Didelphic | Nigeria | Mulvey and Jensen (1967) | ||
2♂♂ | 1.6-1.7 | 34-39 | 4.3-4.4 | 4 | 38 | 23 | 60-65 | ? | ||||||||
3♀♀ | 2.1-2.4 | 34-37 | 4.1-5.5 | 4.1-4.5 | 15-17 | 51-54 | 44-47 | 22-26 | 19a | No | Didelphic | Cameroon | Siddiqi (2001) | |||
tenuidentatus | 10♀ | 1.9-2.5 | 28-35 | 4.0-4.5 | 4.9-5.6 | 10a | 53-57 | 45-52 | 27-31 | 23a | Subventral | Didelphic | Nigeria | Mulvey and Jensen (1967) | ||
togoensis | 4♀♀ | 2.2-2.8 | 41-48 | 4.8-5.2 | 4.4-5.9 | 12.6-17 | 51.5-59 | 49-50 | 23-24 | 26a | Terminal | Didelphic | Togo | Siddiqi (2001) | ||
transkeiensis | 2♀♀ | 1.5-1.6 | 28-35 | 4.5 | 7.3-7.9 | 6.7a | 62 | 36-38 | 21-23 | 31a | No | Didelphic | South Africa | Heyns and Lagerwey (1965) | ||
6♀♀ | 1.6-1.7 | 38-48 | 3.7-5.7 | 6.0-7.2 | 8.7a | 56-66 | 32-35 | 21-25 | 36.4a | No | Didelphic | Thailand | Buangsuwon and Jensen (1966) | |||
trichurus | ?♀ | 1.2 | 34.5 | 4.8 | 3 | 15-20 | 52 | 28 | 17 | Australia, Fiji, Brazil, Nigeria, Mauritius | Mulvey (1963a), (after Cobb, 1917) | |||||
?♀♀ | 1.3-2.1 | 28-46 | 3.5-5.4 | 3-5 | 15-20 | 53-62 | 20-35 | 20-25 | Terminal | Monodelphic | Mulvey (1963a) | |||||
?♂ | 1.7 | 28 | 4.4 | 3.6 | 78 | 8-10 | ||||||||||
7♀♀ | 1.3-1.6 | 37-41 | 3.7-4.7 | 3.4-4 | 13-18 | 54-60 | 26-28 | 16-18 | 25-27 | Terminal | Monodelphic | India | Jairajpuri (1969) | |||
1♀ | 1.7 | 37 | 4.6 | 4 | 16 | 61 | 30 | 16 | 26 | Subventral | Monodelphic | Costa Rica | Zullini et al. (2002) | |||
uisongensis | 7♀♀ | 1.5-1.6 | 23-26 | 2.8-3.2 | 17-19.4 | 2.0-2.4 | 67-73 | 52-63 | 31-36.5 | 27-36 | No | Didelphic | Korea | Choi and Khan (2000) | ||
5♂♂ | 1.5-1.7 | 24-27 | 3.2-3.3 | 19.6-23 | 1.4-1.6 | 52-58 | 30-34 | 75-92 | 20-22 | |||||||
zullinii | 20♀♀ | 1.3-2 | 27-36 | 3.8-4.7 | 9.6-13.3 | 4a | 69-76 | 33-41 | 22-27 | 22a | Subdorsal | Monodelphic | Côte | Malcevschi (1981) | ||
8♂♂ | 1.3-2 | 29-37 | 3.9-4.6 | 10.3-13 | 3a | 32-37 | 20-24 | 68-73 | 7-10 | d’Ivoire |
Notes: Measurements in µm excepted L in mm. L = body length, a = body length/maximum body diameter, b = body length/pharynx length, c = body length/tail length, c′ = tail length/anal body diameter, V = distance from vulva to the anterior end of bodyx100/body length, B.C.L .= buccal cavity length, B.C.W. = buccal cavity width, %DT = dorsal tooth apex length from the base of buccal cavityx100/buccal cavity length, Suppls = ventromedian supllements. aCalculated from original illustrations.
Key to species
Currently, 78 species of the genus Iotonchus (Cobb, 1917) have been recorded. The following key is based on main characteristics of females.
-
Female genital organ unpaired, prodelphic, or pseudo-prodelphic with rudimentary post genital branch .........................…..….…. 2
Female genital organ paired, amphidelphic ……….................................................................... 28
-
Genital organ pseudo-prodelphic with rudimantary post genital branch ….........…………. 3
Genital organ monoprodelphic …………………. 5
-
Small nematode: L = 1.4-1.6 mm ...……… pseudodigonicus (Ahmad and Jairajpuri, 1983)
Large nematode: L≥2.7 mm …….....………................................................................................……... 4
-
L = 2.7-3 mm; smaller buccal cavity = 42-47×27-31 μm .….. abrahmani (Loof, 2006)
L = 3-3.3 mm, larger buccal cavity = 58-64×32-33 μm …........................…. kirbyi (Siddiqi, 1984b)
-
Caudal spinneret absent………...............… 6
Caudal spinneret present ….……..................… 9
-
Larger body size: L = 2.4 mm; larger buccal cavity = 54×30 μm; ♂: unknown ....……......…. devius (Siddiqi, 2001)
Smaller body size: L<2 mm …………………... 7
-
L = 0.7-1 mm; buccal cavity = 22-24×10-13 μm; post-uterine sac absent; ♂: unknown …................…… pulsillus (Loof, 2006)
L>1 mm; larger buccal cavity size; post-uterine sac present …….…………......................………. 8
-
Shorter body length: L = 1.6 mm; c = 7.2-7.9; post-uterine sac 2 body diameter long ……… lamottei (Malcevschi, 1981)
Longer body length: L = 1.6-1.9 mm; c = 10.3-12.9; post-uterine sac 1 body diameter long ............… nigeriensis (Mulvey and Jensen, 1967)
-
Caudal spinneret subterminal ……………… 10
Caudal spinneret terminal …………………...…19
-
Caudal spinneret subdorsal ………………… 11
Caudal spinneret subventral …………………... 13
-
Buccal cavity length >50 µm (53-55×30-31) ………….… sacculatus (Siddiqi, 2001)
Buccal cavity length <50 µm ………………… 12
-
Tail 6 anal body diameter long; larger size of buccal cavity = 40-50×28-32 µm ..………..… acuticaudatus (Mulvey and Jensen, 1967)
Tail 4 anal body diameter long; smaller size of buccal cavity = 33-41×22-27 µm …................. …………...…....………...zullini (Malcevschi, 1981)
-
Post-uterine sac completely absent …………. 14
Post-uterine sac present …..…....................... 15
-
Buccal cavity length >40 µm (41-42×24-25 µm); ♂: unknown ……..……..….. silvallus (Ahmad and Jairajpuri, 1983)
Buccal cavity length <40 µm (32-37×28-32 µm); ♂: unknown ……...……. barqrii (Jairajpuri, 1969)
-
Post-uterine sac = 3.5 body diameter long; ♂: unknown ……… recessus (Yeates, 1992)
Post-uterine sac <1 body diameter long …… 16
-
V = 66-80; buccal cavity = 46-54×25-31 µm … southi (Dhanam and Jairajpuri, 1998)
V<66 …….............................................................. 17
-
L = 2 mm; V = 63-64 .….........................................................................… lacuplanarum (Yeates, 1992)
L<2 mm; V<63 ……......................................…... 18
-
V = 55-58; buccal cavity = 30-32×15-17 µm ………… paratrichurus (Siddiqi, 2001)
V = 58-62; buccal cavity = 36-37×19-20 µm …………..................…..… muneris (Siddiqi, 2001)
-
L>2.5 mm .................................................……… 20
L<2.5 mm ………............................................…. 21
-
Buccal cavity length ≥60 µm (buccal cavity = 60-63×37-40 µm); ♂: unknown ............ ...................................... consimilis (Cobb, 1917)
Buccal cavity length ≤60 µm (buccal cavity = 57×40 µm); ♂: unknown ….........................................………. gymnolaimus (Cobb, 1893, 1916)
-
Post-uterine sac completely absent ………… 22
Post-uterine sac present …….......................... 26
-
Shorter body length: L≤1.3 mm …………...… 23
Longer body length: L>1.3 mm ….........................................................………. trichurus (Cobb, 1917)
-
Buccal cavity length ≤30 µm (22-24×10-13 µm) …………......................................................... chantaburensis (Buangsuwon and Jensen, 1966)
Buccal cavity length >30 µm ………………. 24
-
V = 68-72; larger buccal cavity = 36-40×21-29 µm; ♂: unknown ............................………….… …...….................... nepotum (Andrássy, 2008)
V<68 ….............................................................…. 25
-
Slenderer nematode: a = 36-41; smaller buccal cavity = 31-33×18-19 µm; par refringens vaginae well developed; tail terminus not swollen; ♂: unknown .….............…..… singaporensis (Ahmad et al., 2005)
a = 29-31; tail terminus swollen; larger buccal cavity = 34-36×19-20 µm; par refringens vaginae absent; ♂: unknown ….......................................... microdontus (Thong, 1971)
-
Post-uterine sac<body diameter long; buccal cavity = 40×17 µm; ♂: unknown … ……….. anisostomus (Buangsuwon and Jensen, 1966)
Post-uterine sac>body diameter long; larger buccal cavity size …….………................…….. 27
-
Buccal cavity oval; 50-60×25-31 µm; post-uterine sac = 2.5-3.5 body diameter long ………… longisaccus (Mohilal et al., 2000)
Broader buccal cavity; 58×34 µm; post-uterine sac = body diameter long …............................................................................... guineae (Siddiqi, 2001)
-
Caudal spinneret absent …….......……….. 29
Caudal spinneret present ………..................... 50
-
Tail broadly rounded, hemispheroid, less than 1.5 anal body diameter long ……….... 30
Tail conoid-arcuate of filiform, longer than 1.5 anal body diameter long ……….….................. 32
-
Larger nematode: L = 4.2 mm; buccal cavity = 51×26 µm; tail blunt-conoid, c′ = 0.7 .........…...…................. magyar (Andrássy, 1973)
Smaller nematodes: L≤2.8 mm; tail hemispheroid …...…........................................... 31
-
Slenderer nematodes: a = 45-63; smaller buccal cavity = 32-35×23-25 µm; advulval papillae absent ….………... rotundicaudatus (Peña-Santiago and Jiménez-Guirado, 1991)
Stout nematode: a = 33; larger buccal cavity = 61×45 µm; advulval papillae present …........................….… obtusus (Choi et al., 1999)
-
Tail<6.5 anal body diameter long ……………. 33
Tail>6.5 anal body diameter long ………….... 42
-
V≥67 …...........................................................…. 34
V<67 …….............................................................. 37
-
Buccal cavity length >50 µm ……………… 35
Buccal cavity length <50 µm …………...…… 36
-
Lip region lower (17-20 µm), labial papillae weakly developed; buccal cavity flattened at base …………... uisongensis (Choi and Khan, 2000)
Lip region higher (21-22 µm); labial papillae prominent, protruded; buccal cavity narrowing posteriorly ………....................................................................… damsanensis (Choi and Khan, 2000)
-
Large nematode: L = 2.2-2.5 mm; slenderer: a = 36-43; c = 34-41; buccal cavity = 44-48×28-33 µm …………... aequabilis (Susulovsky, 1998)
Smaller nematode: L = 1.4-1.8 µm; stout: a = 20-23; c = 23-28; buccal cavity = 42×30 µm ..……..........… kirghistanicus (Sultanalieva, 1983)
-
Vagina without sclerotised pieces ……… pauli (Heyns and Lagerwey, 1965)
Vagina with sclerotised pieces …………....… 38
-
Larger buccal cavity = 57.5-67.5×35-40 µm ...…..…. paracutus (Vinciguerra and Orselli, 2000)
Buccal cavity length <50 µm ……………...… 39
-
Tail>4 anal body diameter long ……………… 40
Tail<4 anal body diameter long …………........ 41
-
Tail conoid, c′ = 4.3; advulval papillae present ………………...................…... acutus (Cobb, 1917)
Tail elongated-conoid, c′ = 5.3-6; advulval papillae absent …........................................................................... .… hinokumaensis (Khan et al., 2008)
-
Shorter nematode: L = 1.5-1.6 mm; shorter tail: c = 24-26; c′ = 1.7-1.9 ........................……… ….………… goshiensis (Khan et al., 2008)
Larger nematode: L = 2-2.3 mm; longer tail: c = 18-20; c′ = 2.7-3.3 …....……...........................................................……… ogiensis (Khan et al., 2008)
-
Tail>12 anal body diameter long …………..… 43
Tail<12 anal body diameter long ……….....… 44
-
Larger nematode: L = 2.5-3 mm; vulva posteriorly V = 55-60; c′ = 12; larger buccal cavity = 46-62×36-52 µm ………..…......... carpathicus (Popovici, 1990)
Smaller nematode: L = 1.7-2.2 mm; vulva anteriorly: V = 47-51; c′ = 15-17; smaller buccal cavity = 40-43×23-27 µm ……..……….................................................…..… tarjani (Mulvey and Jensen, 1967)
-
L>3 mm ………………… stockdilli (Yeates, 1988)
L<3 mm .……...................................................… 45
-
Advulval papillae absent ……………….……… 46
Advulval papillae present ……………...…...… 48
-
Smaller nematode: L = 1.5-1.6 mm; tail≤7 anal body diameter long; vulva posteriorly: V = 62; ♂: unknown ……..............................................................… transkeiensis (Heyns and Lagerwey, 1965)
Larger nematode: L>1.6 mm; tail>7 anal body diameter long; vulva anteriorly ..........................… 47
-
Slenderer nematode: a = 35-41; tail strongly curved, narrowing near terminus; c′ = 9-10.5; smaller buccal cavity = 38-41×24-28 µm; ♂: unknown .…………….… arcuatus (Khan et al., 2000)
a = 28-34; tail only slightly ventrally curved; c′ = 8.8; larger buccal cavity = 40-43×23-29 µm; ♂: unknown ……………..…………...............................………. clarki (Mulvey and Jensen, 1967)
-
Vagina without sclerotised pieces ……….… onchus (Jairajpuri et al., 2000)
Vagina with sclerotised pieces .........................… 49
-
Slenderer nematode: a = 34-42; vulva posteriorly: V = 61-68; smaller buccal cavity = 30-37×25 µm; ♂: unknown ……………..……...… loteniae (De Bruin and Heyns, 1992)
a = 31; vulva anteriorly: V = 59; larger buccal cavity = 54×37 µm; ♂: unknown … ….…….. globibuca (Dhanam and Jairajpuri, 2002)
-
Caudal spinneret subterminal …………..... 51
Caudal spinneret terminal …........................… 58
-
Caudal spinneret subdorsal .................………. 52
Caudal spinneret subventral ……….……...… 54
-
Tail>14 anal body diameter long …......................................................…..… mboticus (Siddiqi, 2001)
Tail<14 anal body diameter long ……….....… 53
-
c′ = 7-8; V = 57; buccal cavity = 46×22 µm; ♂: unknown …….. rayongensis (Buangsuwon and Jensen, 1966)
c′ = 2.5-4; V = 63-69; buccal cavity = 29-40×20-27 µm …............................................................................................... parageminus (Jimenez-Guirado, 1994)
-
Advulval papillae absent …………….………… 55
Advulval papillae present ………………......… 57
-
Longer length of buccal cavity = 57-60 µm ….................… koupensis (Siddiqi, 2001)
Length of buccal cavity<55 µm ………...…… 56
-
Vulva posteriorly: V = 57-65…................................……... indicus (Jairajpuri, 1969)
Vulva anteriorly: V = 53-57 ...............................…........… tenuidentatus (Goodey, 1951; Kreis, 1924)
-
Slenderer nematode: a = 50-57; c′ = 17-18; tail terminus conoid-rounded; caudal pores absent ………...………..… kilumicus (Siddiqi, 2001)
a = 39-47; c′ = 8-15; tail terminus broadly rounded; caudal pores present …....................................................................………..… ndu (Siddiqi, 2001)
-
Large nematode: L>3 mm ….…....................…… 59
Smaller nematode: L<3 mm …….................… 64
-
Length of buccal cavity>65 µm …………… 60
Length of buccal cavity<65 µm …….......…… 62
-
Advulval papillae absent …..............…… apapillatus (Dhanam and Jairajpuri, 1998)
Advulval papillae present .......................……... 61
-
Larger body length: L = 3.8-5.2 mm; slenderer: a = 50-59; longer tail: c = 4.5-6.3; c′ = 12-20 ………….....….....…… lotilabiatus n. sp.
L = 2.7-3.5 mm; a = 44-50; shorter tail: c = 7.6-8.4; c′ = 7.5-8.3 ………….........................................................…....… miamaensis (Khan and Araki, 2002)
-
Tail shorter: c = 17; c′ = 3-4 .....................…….… brachylaimus (Cobb, 1917)
Tail longer: c≤12; c′>4 …...………….....................................…...… 63
-
c = 10.7-12; c′ = 4.5-5.2 ……..............................................................…….… cucumis (Khan et al., 2002)
c = 8-11; c′ = 6.3 …............................................................................…... risoceiae (De Carvalho, 1955)
-
Advulval papillae present …………………...… 65
Advulval papillae absent ……………..….…… 68
-
V = 56-60 .................................................….. parabasidontus (Mulvey and Jensen, 1967)
Vulva posteriorly: V>60 .…..…......................… 66
-
Caudal cuticular pores absent …………….……… nayari (Mohadas and Prabhoo, 1979)
Caudal cuticular pores present …...………… 67
-
Length of buccal cavity width = 39-42 µm; Tail shorter: c = 10-15; c′ = 3.6-4.5 ………………...………… litoralis (Coetzee, 1967b)
Length of buccal cavity width = 33-37 µm; c = 7-10; c′ = 5.5-7.8 ….................................................................…… cuticaudatus (Jana et al., 2007)
-
L<2 mm; small buccal cavity = 29-39×18-24 µm ……..…….. rinae (Coetzze, 1967b)
L>2 mm; buccal cavity length>39 µm…….... 69
-
Tail short: c′ = 3-4 ….....................................................… geminus (Heyns and Lagerwey, 1965)
c′ >4 ……………....................................……..… 70
-
c′ = 12.6-17 .................................................................................………….… togoensis (Siddiqi, 2001)
c′ <12 ……..................................................…..… 71
-
c′ = 8.3-10; V = 51.4-54.4 …................……….…… aequatorialis (Vinciguerra and Orselli, 2006)
c′<8; V>55 …................................................…… 72
V = 55-60; buccal cavity = 48×30 µm ……… basidontus (Clark, 1961)
V = 60-65; buccal cavity = 58-60×38-40 µm …………….............................................…. sagaensis (Khan et al., 2000)
Sequence analysis
Molecular sequences of two individuals of Iotonchus lotilabiatus n. sp. were analysed in this study. After sequencing and editing, four sequences were obtained: two 906 to 919 bp length of rRNA (18S), GenBank accession No. MW218936, MW218937 and two 747 bp length D2D3 expansion of rRNA (28S), GenBank accession No. MW218934 and MW228378 were obtained for phylogenetic analyses. This is the first sequences of both 18S and 28S rDNA are provided for a representative of the genus Iotonchus and submitted to GenBank. There are only a few sequences of super family Anatonchoidea presented on the Genbank.
A BLAST search for matches to the partial 18S rDNA sequence of new species Iotonchus lotilabiatus n. sp. revealed 99% similarity to unidentified species Miconchus sp. 1JH–2014 (accession No. KJ636436) and 98% similarity to Anatonchus tridentatus (accession No. AJ966474, AY284768). Based on the 28S rDNA sequences, the new species Iotonchus lotilabiatus n. sp. only identically 89 to 94% to sequences of Anatonchus tridentatus (accession No. AY593065, MG994941).
rDNA phylogenetic relationships among Mononchida
The results derived from the analyses of these 18S and D2-D3 region of 28S sequences are presented in the molecular trees of Figures 5 and 6, respectively. In both phylogenetic trees, the new species Iotonchus lotilabiatus n. sp. were positioned within the M4 clade (following the nomenclature of Holterman et al., 2008, Olia et al., 2008), encompassing representatives of genera Anatonchusand Miconchus (Anatonchoidea super family) (Figs. 5 and 6). This positioning was confirmed by phylogenetic analyses based on both the 18S and 28S rDNA data.
Figure 5:
Phylogenetic relationships of Iotonchus lotilabiatus n. sp. among other Mononchida, from the analysis of the 18S rDNA sequences under ML (T92+G model (BIC = 5,919.848, AICc = 5,216.912; lnL = ‒2,524.232, G = 0.23, R = 1.78, f(A) = 0.284, f(T) = 0.284, f(C) = 0.216, f(G) = 0.216)). Numbers to the left of the branches are bootstrap values for 1,000 replications.
Figure 6:
Phylogenetic relationships of Iotonchus lotilabiatus n. sp. among other Mononchida, from the analysis of the 28S rDNA sequences under ML (K2+G model (BIC = 2,373.292, AICc = 2,087.600; lnL = ‒1,000.469, G = 0.23, R = 2.00, f(A) = 0.25, f(T) = 0.25, f(C) = 0.25, f(G) = 0.25)). Numbers to the left of the branches are bootstrap values for 1,000 replications.
Conclusions
During this study, the new species Iotonchus lotilabiatus n. sp. is supported by its morphological and molecular characterization. An updated key to species of the genus Iotonchus (Cobb, 1916) based on female characteristics and the compendium of all the known species are also supported.
Acknowledgments
The authors would like to thank Dr. Nguyen, Thi Phuong Lien (Institute of Ecology and Biological Resources) for supporting the interesting soil specimens. Financial support: this work was supported by Vietnam Academy of Science and Technology (VAST) grant number VAST04.05/21-22 with the project title ‘The role of predatory nematodes Mononchida in the nematode communities at the Nature Reserves in Lao Cai Province’.
References
- Aboul-Eid, H. Z. and Ameen, H. H. . 1982. Species of the genera Iotonchus . Mononchus and Mylonchulus (Nematoda: Mononchida) from Egypt. Zoological Society of Egypt Bulletin 31:51–65. [Google Scholar]
- Ahmad, W. , Baniyamuddin, M. and Jairajpuri, M. S. . 2005. Three new and a known species of Mononchida (Nematoda) from Singapore. Journal of Nematode Morphology and Systematics 7:97–107. [Google Scholar]
- Ahmad, W. and Jairajpuri, M. S. . 1983. Two new species of Iotonchus (Nematoda:Mononchida) from the Silent Valley, Kerala, India. Systematic Parasitology 5:83–87. [Google Scholar]
- Ahmad, W. and Jairajpuri, M. S. . 2010. Mononchida: the predaceous nematodes Leiden-Boston: Brill. [Google Scholar]
- Alekseev, V. M. 2001. A new species of the predatory nematodes of the genus Iotonchus (Nematoda:Mononchida) from Khanka Lake. Zoologichesky Zhurnal 80:749–753; (in Russian). [Google Scholar]
- Andrássy, I. 1964. Süsswassar-Nematoden aus den Grossen Gebirgagegenden Ostafrika. Acta Zoologica Academiae Scientiarum Hungaricae 10:1–59. [Google Scholar]
- Andrássy, I. 1973. 100 neue Nematode narteninderungarishen Fauna. Opuscula Zoologica Budapest 11:7–48. [Google Scholar]
- Andrássy, I. 1993b. A taxonomy survey of the family Anatonchidae (Nematoda). Opuscula Zoologica Budapest 26:9–52. [Google Scholar]
- Andrássy, I. 2008. Four new species of Mononchida (Nematoda) from tropical regions. Opuscula Zoologica Budapest 39:3–13. [Google Scholar]
- Batistian, H. C. 1865. Monograph on the Anguillulidae, free nematoids, marine, land and fresh water; with descriptions of 100 new species. Transactions of the Linnean Society of London 25:73–184. [Google Scholar]
- Baqri, Q. H. , Baqri, S. Z. and Jairajpuri, M. S. . 1978. Studies on Mononchida. XI. Two new species of Iotonchus, Cobbonchus indicus n. sp. and Anatonchus ginglymodontus Mulvey, 1961. Nematologica 24:436–44. [Google Scholar]
- Buangsuwon, D. K. and Jensen, H. R. . 1966. A taxonomy study of Mononchidae (Enoplida:Nemata) inhabiting cultivated areas of Thailand. Nematologica 12:259–274, doi: 10.1163/187529266X00671. [DOI] [Google Scholar]
- Choi, Y. S. , Khan, Z. and Lee, S. M. . 1999. Descriptions of new species of predatory nematodes (Mononchida) from Korea. Korean Journal of Soil Zoology 4:89–100. [Google Scholar]
- Choi, Y. E. and Khan, Z. . 2000. Descriptions of two new species of Iotonchus and first record of Coomansus zschokkei (Mononchida) from Korea. Annales Zoologici (Specialissue: M. W. Brzeski (1937-1999) in memoriam) 50:183–191. [Google Scholar]
- Clark, W. 1961. The Mononchidae (Enoplida, Nematoda) of New Zealand II. The genus Iotonchus (Cobb, 1916) Altherr, 1950. Nematologica 5:275–84. [Google Scholar]
- Clark, W. C. 1961a. The mononchidae (Enoplida, Nematoda) of New Zealand. II. The genus Iotonchus (Cobb, 1916) Altherr, 1950. Nematologia 5:260–274, doi: 10.1163/187529260X00073. [DOI] [Google Scholar]
- Cobb, N. A.. 1893. Nematode worms found attacking sugarcane. Plant diseases and their remedies. Agricultural Gazette of New South Wales 4:808–33. [Google Scholar]
- Cobb, N. A. 1916. Notes on new genera and species of nematodes. Four subdivisions of Mononchus . Journal of Parasitology 2:195–196. [Google Scholar]
- Cobb, N. A. 1917. The mononchs (Mononchus Bastian, 1865). A genus of free-living predatory nematodes. Soil Science 3:431–486. [Google Scholar]
- Coetzee, V. 1967. Species of the genus Iotonchus (Nematoda, Mononchidae) occurring in Southern Africa. Nematologica 13:367–77. [Google Scholar]
- Coetzee, V. 1967b. Species of genus Iotonchus (Nematoda:Mononchidae) occurring in Southern Africa. Nematologica 13:367–377, doi: 10.1163/187529267X00599. [DOI] [Google Scholar]
- DeBruin, S. and Heyns, J. . 1992. Mononchida (Nematoda) from Southern Africa: genus Iotonchus (Cobb, 1916) Altherr, 1950. Phytophylactica 24:39–60,https://hdl.handle.net/10520/AJA03701263_1458. [Google Scholar]
- De Carvalho, J. C. 1955. Mononchus risoceiae, novaespécie (Nematoda: Mononchidae). Revistado Instito Aldolfo Lutz 15:129–134. [Google Scholar]
- Dhanam, M. and Jairajpuri, M. S. . 1998. Five new species of mononchs from Malnad tracts of Karnataka, India. Nematologica 44:21–35, doi: 10.1163/005225998X00037. [DOI] [Google Scholar]
- Dhanam, M. and Jairajpuri, M. S. . 2002. Two new species of the genus Iotonchus Cobb, 1916 (Mononchida: Nematoda) from Malnad tracts of Karnataka, India. Journal of Coffee Research 27:93–102. [Google Scholar]
- Heyns, J. and Lagerwey, G. . 1965. South African species of the genus Cobb, 1916 (Nematoda: Mononchidae). South African Journal of Agricultural Science 8:775–784. [Google Scholar]
- Holterman, M. , Rybarczyk, K. , Evan den Elsen, S. , van Megen, H. , Mooyman, P. , Pena Santiago, R. , Bongers, T. , Bakker, J. and Helder, J. . 2008. Aribosomal DNA-based framework for the detection and quantification of stress-sensitive nematode families in terrestrial habitats. Molecular Ecology Resources 8:23–34, doi: 10.1111/j.1471-8286.2007.01963.x. [DOI] [PubMed] [Google Scholar]
- Holterman, M. , vanderWurff, A. , vandenElsen, S. , vanMegen, H. , Bongers, T. , Holovachov, O. , Bakker, J. and Helder, J. . 2006. Phylum-wide analysis of SSUr DNA reveals deep phylogenetic relationships among nematodes and accelerated evolution toward crown clades. Molecular Biology and Evolution 23:1792–1800, doi: 10.1093/molbev/msl044. [DOI] [PubMed] [Google Scholar]
- Jairajpuri, M. S. 1969. Studies on Mononchida of India. I. The genera Hadronchus, Iotonchus and Miconchus and a revised classification of Mononchida, neworder. Nematologica 15:557–581, doi: 10.1163/187529269X00894. [DOI] [Google Scholar]
- Jairajpuri, M. S. and Khan, W. . 1982. Predatory nematodes (Mononchida) with special reference to India New Delhi, India: Associated Publishing Company. [Google Scholar]
- Jairajpuri, M. S. , Tahseen, Q. and Choi, Y. E. . 2000. Description of Iotonchus onchus n. sp. and detailed observationon I. litoralis Coetzee, 1967 (Anatonchiodea: Mononchida) from Korea. Journal of Asia-Pacific Entomology 3:19–24. [Google Scholar]
- Jana, T. , Chatterjee, A. and Manna, B. . 2007. Iotonchus cuticaudatus sp. n., a new mononchid species from West Bengal, India with an unusual case of bivulvarity. Russian Journal of Nematology 15:41–7. [Google Scholar]
- Jensen, H. J. and Mulvey, R. H. . 1968. Predaceous nematodes (Mononchidae) of Oregon. Oregon State Monographs. Studies in Zoology. No 12.
- Jiménez-Guirado, D. 1994. Mononchid nematodes from Spain. Iotonchus parageminus sp. n. and its relationship with I. geminus Heyns & Lagerwey, 1965 and I. rinae Coetzee, 1967. Fundamental and Applied Nematology 17:347–356. [Google Scholar]
- Jana, T. , Chatterjee, A. and Manna, B. . 2007. Iotonchus cuticaudatus sp. n., a new mononchid species from West Bengal, India with an unusual case of bivulvarity. Russian Journal of Nematology 15:41–7. [Google Scholar]
- Khan, Z. and Araki, M. . 2002. A new and two first recorded species of mononchids (Nematoda: Mononchida) from Japan. Nematologia Mediteranea 30:167–173 https://journals.flvc.org/nemamedi/article/view/86705. [Google Scholar]
- Khan, Z. , Araki, M. and Bilgrami, L. . 2000. Iotonchus saganensis sp. n., I. arcutus sp. n. and Miconchusjaponicus sp. n. from Japan. Nematologia Mediterranea 30:167–173. [Google Scholar]
- Khan, Z. , Araki, M. and Bilgrami, A. L. . 2002. Iotonchus sagaensis sp. n., I. arcuatus sp. n. and Miconchus japonicus sp. n. (Nematoda: Mononchida) from Japan. International Journal of Nematology 10:143–52. [Google Scholar]
- Khan, W. U. and Jairajpuri, M. S. . 1980. Studies on Mononchida of India XIII. The genus Iotonchus (Cobb, 1916) Altherr, 1950 with a key to the species. Nematologica 26:1–9, doi: 10.1163/187529280X00503. [DOI] [Google Scholar]
- Khan, Z. , Park, S. D. , Bae, S. G. and Shin, Y. S. . 2002. Two new and two first recorded species of predatory soil nematodes (Nematoda:Mononchida) from Korea. Korean Journal of Soil Zoology 7:51–57. [Google Scholar]
- Khan, Z. , Yoshiga, T. , Okumura, E. and Tanaka, R. . 2008. Descriptions of four new species of predatory soil nematodes (Nematoda: Mononchida) from Japan. International Journal of Nematology 18:144–150. [Google Scholar]
- Kumar, S. , Stecher, G. and Tamura, K. . 2016. MEGA 7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Molecular Biology and Evolution 33:1870–1874, doi: 10.1093/molbev/msw054. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Loof, P. A. A. 2006. Mononchina (Dorylaimida) from Western Malaysia. Nematology 8:287–310, doi: 10.1163/156854106777998737. [DOI] [Google Scholar]
- Lordello, L. G. E. 1959. Nota sobre ao genero Mononchus de nematodes predadores. Anais Escola Superior de. Agricultura ‘Luiz de Queiroz’ 14/15:119–24. [Google Scholar]
- Malcevschi, S. 1981. Mononchidae from Ivory Coast savannahs: genera Iotonchus (Cobb, 1916) and Miconchus Andrássy, 1958. Nematologia Mediterranea 9:63–74. [Google Scholar]
- Mohadas, C. and Prabhoo, N. R. . 1979. New predatory nematodes of the genus Iotonchus (Iotonchidae: Mononchida) from the soil of Kerala (India). Proceedings of the Indian Academy of Sciences 88:433–440. [Google Scholar]
- Mohilal, N. , Anandi, Y. and Dhanachand, C. H. . 2000. Studies on soil nematodes of Manipur-IX. Two new species and a male of Iotonchinae. Uttar Pradesh Journal of Zoology 20:175–81. [Google Scholar]
- Mulvey, R. H. 1963a. The Mononchidae: a family of predaceous nematodes. IV. Genus Iotonchus (Enoplida: Mononchidae). Canadian Journal of Zoology 41:79–98. [Google Scholar]
- Mulvey, R. H. and Jensen, H. J. . 1967. The Mononchidae of Nigeria. Canadian Journal of Zoology 56:1847–1868. [Google Scholar]
- Olia, M. , Ahmad, W. , Araki, M. , Minaka, N. , Oba, H. and Okada, H. . 2008. Actus salvadoricus Baqri & Jairajpuri (Mononchida: Mylonchulidae) from Japan with comment on the phylogenetic position of the genus Actus based on 18S rDNA sequences. Japanese Journal of Nematology 38:361–373, doi: 10.3725/jjn.38.57. [DOI] [Google Scholar]
- Peña-Santiago, R. and Jiménez-Guirado, D. . 1991. Mononchid nematodes from Spain. Description of Iotonchus rotundicaudatus sp. n. and observations on I. zschokkei (Menzel, 1913) Altherr, 1950. Revue de Nematologie 14:353–60. [Google Scholar]
- Peña-Santiago, R. , Abolafia, J. and Álvarez-Ortega, S. . 2014. New proposal for a detailed description of the dorylaim spicule (Nematoda: Dorylaimida). Nematology 16:1091–1095, doi: 10.1163/15685411-00002834. [DOI] [Google Scholar]
- Popovici, I. 1990. Studies on Mononchida (Nemata) from Romania. Nematologica 36:161–180, doi: 10.1163/002925990X00130. [DOI] [Google Scholar]
- Seinhorst, J. W. 1962. On the killing, fixation and transferring to glycerine of nematodes. Nematologica 8:29–32, doi: 10.1163/187529262X00981. [DOI] [Google Scholar]
- Siddiqi, M. R. 1984a. Four genera and four new species of mononchs (Nematoda). Pakistan Journal of Nematology 2:1–13. [Google Scholar]
- Siddiqi, M. R. 1984b. Two new species of Iotonchus Cobb (Nematoda: Mononchidae) from Fiji Islands. Nematologia Mediterranea 12:81–85. [Google Scholar]
- Siddiqi, M. R. 2001. Studies of Iotonchus species (Mononchida) from West Africa with descriptions eleven new species. International Journal of Nematology 11:104–23. [Google Scholar]
- Siddiqi, M. R. 2015. Descriptions of seven new genera and ten new species of Mononchida (Nematoda). International Journal of Nematology 25:39–64. [Google Scholar]
- Subotin, S. A. , Sturhan, D. , Chizhov, V. N. , Vovlas, N. and Baldwin, J. G. . 2006. Phylogenetic analysis of Tylenchida Thorne, 1949 as inferred from D2 and D3 expansion fragmants of the 28S rDNA gen sequences. Nematology 8:455–74. [Google Scholar]
- Southey, J. F. 1986. Laboratory methods for work with plant and soil nematodes London: Her Majesty’ Stationery Office. [Google Scholar]
- Sultanalieva, G. B. 1983. New species of soil nematodes from genus Iotonchus (Mononchida). Trudy Zoologicheskogo Instituta, Akademiya Nauk SSR 180:80–81; (In Russian). [Google Scholar]
- Susulovsky, A. S. 1998. Iotonchus aequabilis sp. n. from Ukraine Proceedings of Sciences of the State Natural History Museum, Ukraine, National Academy of Sciences of Ukraine.
- Thong, C. H. S. 1971. Five species of Mononchidae (Nematoda) from Singapore Island. Nematologica 16:470–476, doi: 10.1163/187529270X00649. [DOI] [Google Scholar]
- Vinciguerra, M. T. and Orselli, L. . 1990. Nematodes from Italian sand dunes. 5. Two new species of Dorylaimida and three known species of Enoplida. Nematologia Mediterranea 28:301–312. [Google Scholar]
- Vinciguerra, M. T. and Orselli, L. . 2000. Nematodes from Italian sand dunes. 5. Two new species of Dorylaimida and three known species of Enoplida. Nematologia Mediterranea 28:301–12. [Google Scholar]
- Vinciguerra, M. T. and Orselli, L. . 2006. Iotonchus aequatorialis sp. n. (Nematoda: Mononchida) from Ecuador with a key to species of Iotonchus Cobb, 1916 and remarks on the identification of the genus. Nematology 8:837–46. [Google Scholar]
- Vu, T. T. T. 2015. New records of five Iotonchus species (Mononchida, Iotonchidae) for Vietnam fauna and updated key to species of the genus Iotonchus occurring in the country. Journal of Biology 37:272–281, doi: 10.15625/0866-7160/v37n3.6238. [DOI] [Google Scholar]
- Yeates, G. W. 1988. Distribution of Mononchoidea (Nematoda: Enoplea) in pasture soils, with description of Iotonchus stockdilli n. sp. New Zealand Journal of Zoology 14:351–358. [Google Scholar]
- Yeates, G. W. 1992. Nematodes from New Caledonia. 1. Introduction and Mononchoidea. Fundamental and Applied Nematology 15:101–126. [Google Scholar]
- Yoder, M. , De Ley, I. T. , King, I. , Mundo-Ocampo, M. , Mann, J. , Blaxter, M. , Poiras, L. and De Ley, P. . 2006. DESS: a versatile solution for preserving morphology and extractable DNA of nematodes. Nematology 8:367–376 10.1163/156854106778493448. [DOI] [Google Scholar]