REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Mouse anti-Actin (AC-40)	Sigma	Cat#A4700; RRID:AB_476730
Mouse anti-human Gelsolin AF488 (20)	Novus Biologicals/BioTechne	NBP1-05161AF488
Rat anti-mouse DNGR-1 (1F6)	The Francis Crick Institute	N/A
Rat IgG2a mouse (R19-15)	BD Biosciences	Cat# 562028; RRID:AB_10895561
Mouse anti-mouse/rat XCR-1 BV421 (ZET)	Biolegend	Cat# 148216; RRID:AB_2565230)
Mouse anti-mouse/rat XCR-1 BV785 (ZET)	Biolegend	Cat# 148225; RRID:AB_2783119
Rat anti-mouse CD45 V500 (30-F11)	BD Biosciences	Cat# 561487; RRID:AB_10697046
Mouse anti-mouse CD45.2 BV605 (104)	Biolegend	Cat# 109841; RRID:AB_2563485
Mouse anti-mouse CD45.2 BV711 (104)	Biolegend	Cat# 109847; RRID:AB_2616859
Mouse anti-mouse CD45.2 PerCP/Cy5.5 (104)	BD Biosciences	Cat# 109827; RRID:AB_893352
Rat anti-mouse Ly-6C BV605 (HK1.4)	Biolegend	Cat# 128036; RRID:AB_2562353
Rat anti-mouse Ly-6G FITC (1A8)	Biolegend	Cat# 127605; RRID:AB_1236488
Rat anti-mouse Ly-6G/Ly-6C (Gr-1) PerCP/Cy5.5 (RB6-8C5)	Biolegend	Cat# 108428; RRID:AB_893558
Rat anti-mouse CD8α BV605 (53-6.7)	Biolegend	Cat# 100744; RRID:AB_2562609
Rat anti-mouse CD8α BV421 (53-6.7)	Biolegend	Cat# 100753; RRID:AB_2562558
Rat anti-mouse CD8α APC (53-6.7)	BD Biosciences	Cat# 553035; RRID:AB_398527
Rat anti-mouse CD8α APC/Cy7 (53-6.7)	Biolegend	Cat# 100713; RRID:AB_312752
Rat anti-mouse CD8α FITC (53-6.7)	BD Biosciences	Cat# 553031; RRID:AB_394569
Rat anti-mouse CD45R/B220 BV650 (RA3-6B2)	Biolegend	Cat# 103241; RRID:AB_11204069
Rat anti-mouse CD45R/B220 PerCP/Cy5.5 (RA3-6B2)	Biolegend	Cat# 103236; RRID:AB_893354
Rat anti-mouse/human CD11b FITC (M1/70)	BD Biosciences	Cat# 553310; RRID:AB_394774
Rat anti-mouse CD11b BV650 (M1/70)	BD Biosciences	Cat# 563402; RRID:AB_2738184
Rat anti-mouse CD4 PerCP/Cy5.5 (RM4-5)	BD Biosciences	Cat# 553052; RRID:AB_394587
Rat anti-mouse CD4 PE (RM4-5)	BD Biosciences	Cat# 553049; RRID:AB_394585
Armenian hamster anti-mouse CD103 PerCP/Cy5.5 (2E7)	Biolegend	Cat# 121416; RRID:AB_2128621
Rat anti-mouse CD103 APC (M290)	BD Biosciences	Cat# 562772; RRID:AB_2737784)
Mouse anti-mouse NK1.1 PE (PK136)	BD Biosciences	Cat# 553165; RRID:AB_394677
Mouse anti-mouse NK1.1 FITC (PK136)	Biolegend	Cat# 108706; RRID:AB_313393
Armenian hamster anti-mouse TCR γδ PE/Cy7 (GL3)	Biolegend	Cat# 118124; RRID:AB_11204423
Mouse anti-mouse CD64 PE/Cy7 (X54-5/7.1)	Biolegend	Cat# 139314; RRID:AB_2563904
Mouse anti-mouse CD64 BV421 (X54-5/7.1)	BD Biosciences	Cat# 740622; RRID:AB_2740319
Rat anti-mouse Sirpα (CD172α) AF647 (P84)	Biolegend	Cat# 144028; RRID:AB_27;1301
Rat anti-mouse Sirpα (CD172α) APC/Fire 750 (P84)	Biolegend	Cat# 144030; RRID:AB_2721317
Armenian hamster anti-mouse CD3e APC (145-2C11)	BD Biosciences	Cat# 553066; RRID:AB_398529
Armenian hamster anti-mouse CD3e APC-eFluor 780 (145-2C11)	E-Bioscience	Cat# 47-0031-82; RRID:AB_11149861
Rat anti-mouse MHC-II (I-A/I-E) AF700 (M5/114.15.2)	E-Bioscience	Cat# 56-5321-82; RRID:AB_494009
Rat anti-mouse MHC-II (I-A/I-E) FITC (M5/114.15.2)	E-Bioscience	Cat# 11-5321-85; RRID:AB_465233
Armenian hamster anti-mouse CD11c APCeFluor780 (N418)	E-Bioscience	Cat# 47-0114-82; RRID:AB_1548652
Armenian hamster anti-mouse CD11c BV421 (N418)	Biolegend	Cat# 117329; RRID:AB_10897814
Armenian hamster anti-mouse TCRβ APC/Cy7 (H57-597)	Biolegend	Cat# 109220; RRID:AB_893624
Rat anti-mouse F4/80 AF647 (BM8)	Thermo Fisher Scientific	Cat# MF48021; RRID:AB_10375289
Rat anti-mouse Siglec F PE (E50-2440)	BD Biosciences	Cat#55212; RRID:AB_394341
Rat anti-mouse CD62L FITC (MEL-14)	BD Biosciences	Cat# 553150; RRID:AB_394665
Rat anti-mouse CD44 APC-eFluor 780 (IM7)	E-Bioscience	Cat# 47-0441-82; RRID:AB_1272244
Rat anti-mouse CD44 APC (IM7)	BD Biosciences	Cat# 559250; RRID:AB_398661
Rat anti-mouse CD206 BV421 (C068C2)	Biolegend	Cat# 141717; RRID:AB_2562232
Rat anti-mouse CD86 BV711 (GL-1)	BD Biosciences	Cat# 740688; RRID:AB_2734766
Rat anti-mouse CD19 BV421 (6D5)	Biolegend	Cat# 115538; RRID:AB_11203527
Rat anti-mouse CD19 AF700 (6D5)	Biolegend	Cat# 115528; RRID:AB_49373
Mouse anti-mouse GATA-3 BV421 (16E10A23)	Biolegend	Cat# 653814; RRID:AB_2563221
Mouse anti-mouse RORγt BV650 (Q31-378)	BD Biosciences	Cat# 564722; RRID:AB_2738915
Rat anti-mouse FOXP3 PE (FJK-16 s)	E-Bioscience	Cat# 12-5773-82; RRID:AB_465936
Mouse anti-mouse T-bet APC (4B10)	BioLegend	Cat# 644814; RRID:AB_10901173
Rat anti-mouse CD16/CD32 (2.4G2)	BD Biosciences	Cat# 553141; RRID:AB_394656
InVivoMAb rat anti-mouse PD-1 (CD279) (RMP1-14)	Bio X Cell	Cat# BE0146; RRID:AB_10949053
InVivoMAb rat IgG2a isotype control (2A3)	Bio X Cell	Cat# BE0089; RRID:AB_1107769
InVivoPlus mouse anti-mouse CTLA-4 (CD152) (9D9)	Bio X Cell	Cat# BE0164; RRID:AB_10949609
InVivoMAb mouse IgG2b isotype control (MPC-11)	Bio X Cell	Cat# BE0086; RRID:AB_1107791
InVivoMAb rat anti-mouse CD8α (2.43)	Bio X Cell	Cat# BE0061; RRID:AB_1125541
InVivoMAb rat IgG2b isotype control	Bio X Cell	Cat# BE0090; RRID:AB_1107780
Mouse anti-mouse DNGR-1 (7H11)	The Francis Crick Institute	N/A
Rat anti-mouse IFN-γ ELISA capture (R4-6A2)	BD Biosciences	Cat# 551216; RRID:AB_394094
Rat anti-mouse IFN-γ ELISA detection (XMG1.2)	BD Biosciences	Cat# 554410; RRID:AB_395374
Goat anti-mouse IgG Biotin ELISA detection	SouthernBiotech	Cat# 1030-08 RRID: AB_2794296
Mouse anti-FLAG-HRP (M2)	Sigma-Aldrich	Cat# A8592; RRID:AB_439702
Rabbit anti-mouse Gelsolin (D9W8Y)	Cell Signaling Technology	Cat# 12953; RRID:AB_2632961
Mouse anti-mouse β-Actin-HRP (AC-15)	Sigma-Aldrich	Cat# A3854; RRID:AB_262011
Rabbit anti-Ovalbumin (OVA; Egg-White) polyclonal	Sigma-Aldrich	ABS818
Goat anti-rabbit IgG(H+L), mouse/human-HRP polyclonal	SouthernBiotech	Cat# 4050-05; RRID:AB_2795955
Goat anti-mouse IgG (H+L)-HRP polyclonal	Thermo Fisher Scientific	Cat# G-21040; RRID:AB_2536527
Goat anti-mouse IgG (H+L) AF488 polyclonal	Thermo Fisher Scientific	Cat# A28175 RRID: AB_2536161
Bacterial and virus strains
pMSCV-IRES-OVA-mCherry (retrovirus pseudotype)	This paper	N/A
pMSCV-IRES-Life-Act-OVA-mCherry (retrovirus pseudotype)	This paper	N/A
PLKO.1-puro-GsnshRNA (lentivirus)	This paper	N/A
Influenza A virus (X31)	The Francis Crick Institute	N/A
Chemicals, peptides, and recombinant proteins
Collagenase IV	Worthington	LS004188
DNASE I	Roche	11284932001
LIVE/DEAD Fixable Blue Dead Cell Stain Kit	Life Technologies	L34962
LIVE/DEAD® Fixable Aqua Dead Cell Stain Kit	Life Technologies	L34957
Fixation Medium A	Nordic MUbio	GAS-002A-1
CPRG Chlorophenol red-β-D-galactopyranoside	Roche	10884308001
Poly(I:C) (HMW) VacciGrade	Invivogen	Vac-pic
R-PE-conjugated H-2Kb /SIINFEKL pentamer	Proimmune	F093-2C-G
R-PE-conjugated H-2Db/ASNENMETM Influenza A NP 366-374 Pentamer	Proimmune	F119-2A-G
Albumin from chicken egg white (OVA)	Sigma	A5503
Albumin prepared from chicken eggs	Boes et al., 2003	N/A
OVA peptide (SIINFEKL)	The Francis Crick Institute	N/A
ExtrAvidin-Alkaline Phosphatase	Sigma	E2636
SIGMAFAST p-nitrophenyl phosphatase tablets	Sigma	N2770-50SET
Amersham Protran nitrocellulose blotting membrane	Cytiva	10600001
Recombinant human plasma Gelsolin	Cytoskeleton Inc.	HPG6-A
Recombinant human Cofilin 1	Cytoskeleton Inc.	CF01-A
Actin from skeletal muscle	Cytoskeleton Inc.	AKL99
Actin biotin-conjugated	Cytoskeleton Inc	AB07
Actin rhodamine-conjugated	Cytoskeleton Inc	AR05
Myosin II from rabbit skeletal muscle	Cytoskeleton Inc.	MY02
Actin Polymerization buffer (10x)	Cytoskeleton Inc	BSA02-001
Flag-tagged dimeric mDNGR-1 ECD	Ahrens et al., 2012	N/A
Critical commercial assays
TissueLyser II	QIAGEN	https://www.qiagen.com/us/products/human-id-and-forensics/automation/tissuelyser-ii/
QiaShredder	QIAGEN	https://www.qiagen.com/gb/products/instruments-and-automation/accessories/qiashredder/#orderinginformation
RNeasy Mini Kit	QIAGEN	https://www.qiagen.com/gb/products/discovery-and-translational-research/dna-rna-purification/rna-purification/total-rna/rneasy-mini-kit/#orderinginformation
SuperScritpt II Reverse Transcriptase	Thermo Fisher Scientific	18064022
PowerUp SYBR Green Master Mix	Thermo Fisher Scientific	A25741
Foxp3 / Transcription Factor Staining Buffer Set	E-Bioscience	00-5523-00
EasySep Mouse Naive CD8+ T Cell Isolation Kit	STEMCELL Technologies	19858
Cytometric bead array (CBA)	BD Biosciences	https://www.bdbiosciences.com/us/reagents/research/immunoassays/cytometric-bead-array/bd-cytometric-bead-array-cba-kits/c/745097
Deposited data
Genotype-Tissue Expression (GTEx)	The Broad Institute	https://gtexportal.org
The Cancer Genome Atlas (TCGA)	Firehose, The Broad Institute	https://gdac.broadinstitute.org/
REACTOME pathway database	(Jassal et al., 2020)	https://reactome.org
Experimental models: cell lines
bm1OVAMEF	C. Reis e Sousa (Sancho et al., 2009)	N/A
BWZ	C. Reis e Sousa (Sancho et al., 2009)	N/A
MutuDC1940	(Fuertes Marraco et al., 2012)	N/A
5555 BrafV600E	C. Reis e Sousa (Zelenay et al., 2015)	N/A
MCA-205	George Kassiotis	N/A
EG-7	The Francis Crick Institute	N/A
B16F10 OVA-GFP	The Francis Crick Institute	N/A
5555 BrafV600EGsn KD	This paper	N/A
B16F10 LA-OVA-mCherry	This paper	N/A
MCA-205 OVA-mCherry	This paper	N/A
MCA-205 LA-OVA-mCherry	This paper	N/A
MCA-205 LA-OVA-mCherry-cGSN	This paper	N/A
MCA-205 LA-OVA-mCherry-sGSN	This paper	N/A
Experimental models: organisms/strains
C57BL/6J (WT)	The Francis Crick Institute	N/A
sGsn−/− (C57BL/6-Gsnem2(sGsn)Crs)	This paper	N/A
Clec9agfp/gfp (B6(Cg)-Clec9atm1.1Crs)	(Sancho et al., 2009)	N/A
Clec9acre/cre (B6J.B6N(Cg)-Clec9atm2.1(icre)Crs)	(Schraml et al., 2013)	N/A
sGsn−/−;Clec9agfp/gfp (C57BL/6-Gsnem2(sGsn)Crs; Clec9atm1.1Crs)	This paper	N/A
sGsn−/−;Gc−/−(C57BL/6-Gsnem2(sGsn)Crs; Gctm1.1(KOMP)Vlcg)	This paper	N/A
OT-I x Rag1−/−(B6.129-Tg(TcraTcrb)1100Mjb ; Rag1tm1Bal)	The Francis Crick Institute	N/A
N. brasiliensis	Judy Allen	N/A
Oligonucleotides
Silencing-Mouse Gsn-shRNA-antisense: TTCAGACACGTGTACTTGAGC	Dharmacon Horizon Discovery	TRCN0000071930
Cloning-Primer cGsn/sGsn -Forward: CCCCAAGCTTGGCCTTCAGGCA GCCAGCTCAGC	This paper	N/A
Cloning Primer cGsn - Reverse: ACCC CAAGCTGGCCTCTGAGGCCATGG TGGTGGAGCACCCC	This paper	N/A
Cloning-Primer sGsn -Reverse: ACCC CAAGCTGGCCTCTGAGGCCA TGGCTCCGTACCGCTCTTC	This paper	N/A
Recombinant DNA
pVSV-G	C.Reis e Sousa	N/A
pHIV (gag-pol)	C.Reis e Sousa	N/A
pSBbi-GFP-hygromycin resistant vector	Addgene	605414
pCMV(CAT)T7-SB100 (SB100X transposase)	Addgene	34879
Software and algorithms
GraphPad Prism v7	GraphPad	https://www.graphpad.com/scientific-software/prism/
FlowJo v10.7.1	FlowJo	https://www.flowjo.com
cBioportal	TCGA Pan-Cancer Atlas	https://www.cbioportal.org
R: The Project for Statististical Computing	R project	N/A