Skip to main content
eLife logoLink to eLife
. 2021 Jul 29;10:e69597. doi: 10.7554/eLife.69597

An autoinhibitory clamp of actin assembly constrains and directs synaptic endocytosis

Steven J Del Signore 1,, Charlotte F Kelley 1, Emily M Messelaar 1, Tania Lemos 1, Michelle F Marchan 1, Biljana Ermanoska 1, Markus Mund 2, Thomas G Fai 3, Marko Kaksonen 2, Avital Adah Rodal 1,
Editors: Suzanne R Pfeffer4, Suzanne R Pfeffer5
PMCID: PMC8321554  PMID: 34324418

Abstract

Synaptic membrane-remodeling events such as endocytosis require force-generating actin assembly. The endocytic machinery that regulates these actin and membrane dynamics localizes at high concentrations to large areas of the presynaptic membrane, but actin assembly and productive endocytosis are far more restricted in space and time. Here we describe a mechanism whereby autoinhibition clamps the presynaptic endocytic machinery to limit actin assembly to discrete functional events. We found that collective interactions between the Drosophila endocytic proteins Nwk/FCHSD2, Dap160/intersectin, and WASp relieve Nwk autoinhibition and promote robust membrane-coupled actin assembly in vitro. Using automated particle tracking to quantify synaptic actin dynamics in vivo, we discovered that Nwk-Dap160 interactions constrain spurious assembly of WASp-dependent actin structures. These interactions also promote synaptic endocytosis, suggesting that autoinhibition both clamps and primes the synaptic endocytic machinery, thereby constraining actin assembly to drive productive membrane remodeling in response to physiological cues.

Research organism: D. melanogaster

eLife digest

Neurons constantly talk to each other by sending chemical signals across the tiny gap, or ‘synapse’, that separates two cells. While inside the emitting cell, these molecules are safely packaged into small, membrane-bound vessels. Upon the right signal, the vesicles fuse with the external membrane of the neuron and spill their contents outside, for the receiving cell to take up and decode.

The emitting cell must then replenish its vesicle supply at the synapse through a recycling mechanism known as endocytosis. To do so, it uses dynamically assembling rod-like ‘actin’ filaments, which work in concert with many other proteins to pull in patches of membrane as new vesicles. The proteins that control endocytosis and actin assembly abound at neuronal synapses, and, when mutated, are linked to many neurological diseases. Unlike other cell types, neurons appear to ‘pre-deploy’ these actin-assembly proteins to synaptic membranes, but to keep them inactive under normal conditions. How neurons control the way this machinery is recruited and activated remains unknown.

To investigate this question, Del Signore et al. conducted two sets of studies. First, they exposed actin to several different purified proteins in initial ‘test tube’ experiments. This revealed that, depending on the conditions, a group of endocytosis proteins could prevent or promote actin assembly: assembly occurred only if the proteins were associated with membranes. Next, Del Signore et al. mutated these proteins in fruit fly larvae, and performed live cell microscopy to determine their impact on actin assembly and endocytosis.

Consistent with the test tube findings, endocytosis mutants had more actin assembly overall, implying that the proteins were required to prevent random actin assembly. However, the same mutants had reduced levels of endocytosis, suggesting that the proteins were also necessary for productive actin assembly. Together, these experiments suggest that, much like a mousetrap holds itself poised ready to spring, some endocytic proteins play a dual role to restrain actin assembly when and where it is not needed, and to promote it at sites of endocytosis.

These results shed new light on how neurons might build and maintain effective, working synapses. Del Signore et al. hope that this knowledge may help to better understand and combat neurological diseases, such as Alzheimer’s, which are linked to impaired membrane traffic and cell signalling.

Introduction

At neuronal presynaptic terminals, actin assembly affects many physiological processes including synapse morphogenesis, traffic of numerous vesicular cargoes, and synaptic vesicle endocytosis, organization, and mobility (Dillon and Goda, 2005; Nelson et al., 2013; Papandréou and Leterrier, 2018). However, the molecular mechanisms that control F-actin dynamics in space and time at presynaptic membranes are largely unknown. Presynaptic terminals maintain constitutively high local concentrations of actin-associated endocytic regulatory proteins at synaptic membranes (Reshetniak et al., 2020; Wilhelm et al., 2014), yet only a small fraction of this protein pool is likely to be active at any point in time (in response to vesicle release) and space (at <100-nm-diameter endocytic sites), suggesting that the endocytic machinery is held in an inactive state at synaptic membranes. However, we do not know the mechanisms that maintain this machinery in an inactive state at the membrane, or how it is activated when and where it is needed.

One plausible mechanism to restrict membrane-cytoskeleton remodeling and endocytic activity to specific locations and times may lie in autoinhibition, which is a property of multiple endocytic proteins (Gerth et al., 2017; Kim et al., 2000; Rao et al., 2010; Stanishneva-Konovalova et al., 2016). One example is the F-BAR-SH3 protein Nervous Wreck (Nwk), which regulates synaptic membrane traffic at the Drosophila neuromuscular junction (NMJ) (Coyle et al., 2004; O'Connor-Giles et al., 2008; Rodal et al., 2008; Rodal et al., 2011; Ukken et al., 2016) and whose mammalian homolog FCHSD2 regulates endocytosis and endocytic traffic in mammalian cells (Almeida-Souza et al., 2018; Xiao and Schmid, 2020; Xiao et al., 2018). Nwk/FCHSD2 proteins couple two activities: membrane remodeling and WASp-dependent actin polymerization (Almeida-Souza et al., 2018; Rodal et al., 2008; Stanishneva-Konovalova et al., 2016). Intramolecular autoinhibitory interactions between the Nwk F-BAR and its two SH3 domains mutually inhibit both Nwk membrane binding and activation of WASp (Stanishneva-Konovalova et al., 2016). Unlike other F-BAR-SH3 proteins, which are completely released from autoinhibition upon membrane binding (Guerrier et al., 2009; Meinecke et al., 2013; Rao et al., 2010), the SH3b domain of Nwk continues to restrict SH3a-mediated WASp activation even after Nwk binds membranes (Stanishneva-Konovalova et al., 2016). This suggests that autoinhibition allows Nwk-WASp to remain inactive even after recruitment to the membrane, thus keeping the endocytic machinery in a primed but inactive state. We hypothesized that additional binding partners of NwkSH3b may be required to fully activate membrane remodeling at discrete times and locations at the synapse.

An excellent candidate for release of Nwk autoinhibition at synapses is the endocytic adaptor intersectin (Dap160 in Drosophila). Intersectin interacts with numerous endocytic proteins to regulate endocytosis in mammalian cells (Henne et al., 2010; Okamoto et al., 1999; Praefcke et al., 2004; Pucharcos et al., 2000; Schmid et al., 2006; Sengar et al., 1999; Teckchandani et al., 2012) and has been implicated in several steps of the synaptic vesicle cycle (Evergren et al., 2007; Gerth et al., 2017; Jäpel et al., 2020; Pechstein et al., 2010; Pechstein et al., 2015). Of particular note, intersectin recruits the Nwk homolog FCHSD2 to sites of endocytosis (Almeida-Souza et al., 2018), though it is not yet known how this affects FCHSD2 autoinhibition. In Drosophila, Dap160 interacts with WASp, Nwk, and other membrane-remodeling proteins via its four SH3 domains (SH3AD), and regulates the levels and localization of many of these proteins, including Nwk (Koh et al., 2004; Marie et al., 2004; Roos and Kelly, 1998). Further, dap160 mutant phenotypes overlap with those of Nwk and WASp mutants, including impaired synaptic vesicle cycling and synaptic overgrowth (Coyle et al., 2004; Khuong et al., 2010; Koh et al., 2004; Marie et al., 2004Winther et al., 2013). Finally, intersectin and Dap160 shift localization from synaptic vesicle pools to the plasma membrane in response to synaptic activity (Evergren et al., 2007; Gerth et al., 2017; Winther et al., 2015), suggesting that Dap160 may provide the spatiotemporal link between salient physiological triggers and Nwk/WASp activation.

The high concentration and broad membrane distribution of inactive endocytic proteins (Reshetniak et al., 2020; Wilhelm et al., 2014) make it difficult to characterize the molecular dynamics of synaptic endocytosis (in contrast to non-neuronal cells; Kaksonen and Roux, 2018). To overcome this barrier, we quantified discrete actin assembly events at the Drosophila NMJ as a proxy for productive endocytosis, as actin assembly is both a primary target of the endocytic apparatus under investigation and is required for synaptic vesicle endocytosis in all forms, including at the Drosophila NMJ (Kononenko et al., 2014; Wang et al., 2010; Wu et al., 2016). This synapse is an ideal system to investigate the molecular dynamics of the endocytic machinery due to its large size, ease of genetic manipulation, and accessibility to live and super-resolution imaging. Here we combine in vitro biochemical approaches with quantitative imaging at the NMJ to define the interactions among Dap160, Nwk, and WASp that relieve autoinhibition. These interactions drive robust membrane-associated actin assembly in vitro, regulate the frequency and dynamics of synaptic actin structures in vivo, and are functionally required for normal endocytosis at the NMJ.

Results

Actin assembles in discrete dynamic patches despite broad distribution of presynaptic membrane-cytoskeleton-remodeling machinery

While the importance of actin in synaptic endocytosis is clear (Kononenko et al., 2014; Wang et al., 2010; Wu et al., 2016), until now there has been no quantitative analysis of individual actin-dependent membrane-remodeling events at synapses. To better understand presynaptic F-actin dynamics and to identify sites where the cytoskeleton- and membrane-remodeling machinery is active, we quantified individual F-actin assembly events by spinning disc confocal microscopy of NMJs presynaptically expressing fluorescent actin probes. To control for developmental variation, all experiments were performed on late third-instar larvae (~96–120 hr after egg laying) on muscle 6/7 NMJs at abdominal segments 3–4, since the development and physiology of these synapses are well characterized (Harris and Littleton, 2015). To control for variation in size between neurons, we normalized patch frequencies by the synapse area measured and presented data per 10 µm2, which is approximately the size of a synaptic bouton in this system. We performed these experiments under resting conditions, where vesicle release is spontaneous at a rate of ~5–6 vesicles/10 µm2/min (Akbergenova et al., 2018; Melom et al., 2013), presumably requiring a similar rate of compensatory endocytosis (Sabeva et al., 2017).

We first compared the dynamics of three actin markers: GFP::actin, GFP-tagged moesin F-actin-binding domain (GMA), and Lifeact::Ruby. The predominant structures labeled by these markers were transient patches at the presynaptic membrane (Video 1, Figure 1A, Figure 1—figure supplement 1A), as has been previously observed (Nunes et al., 2006; Pawson et al., 2008; Piccioli and Littleton, 2014). We then quantified individual actin patch dynamics using automated particle tracking and quantification (Berro and Pollard, 2014; Tinevez et al., 2017), which captured on the order of 30–50% of visible actin structures (see 'Materials and methods', Figure 1—figure supplement 2, and Figure 6—figure supplement 1 for more details on optimization and validation of actin particle analysis). We first imaged at 0.25 Hz and measured an average of 1.2 GMA patches/10 μm2/min, exhibiting a mean duration of 48.0 s ± 45.6 s, with an average relative amplitude of 68 ± 32% ((Imax-Imin)/Imean) (Figure 1B–D). Quantification of GFP::actin and Lifeact::Ruby showed very similar dynamics to GMA, suggesting that these measurements robustly reflect the underlying actin dynamics and not the specific properties of a particular probe. We did note a high percentage of patches in the minimum duration bin, suggesting the existence of even briefer patches. To address this, we also performed imaging at 1 Hz, which could not capture the entire lifetime distribution due to photobleaching but was able to identify a larger population of short-duration patches (Figure 1—figure supplement 1B) with an average duration of ~16 +/- 20 s. Given this range of measurements at different sampling frequencies and the efficiency of our automated detection, we estimate that patch frequency is between 2.8 and 10.3 events/10 µm2/min (see 'Materials and methods' for calculations), on par with the expected frequency of endocytic events, and with a similar albeit broader distribution of durations compared to yeast (15 s; Berro and Pollard, 2014) and mammalian cells (~40 s; Taylor et al., 2011).

Figure 1. Synaptic actin patches are dynamic WASp-dependent structures.

(A) Representative maximum intensity projections (MaxIPs) of single spinning disc confocal microscopy time points, showing C155-Gal4-driven actin probes GFP::actin, GMA, and Lifeact::Ruby. (B–D) Automatic detection and analysis of movies acquired at 0.25 Hz of F-actin patch intensity amplitude (B), frequency (C), and duration distribution (D) show similar dynamics for different reporters. (E, F) Single plane Airyscan image of a live muscle 6/7 neuromuscular junction (NMJ) expressing Lifeact::Ruby (magenta) and Arp3::GFP (green). Actin patches colocalize extensively with Arp3::GFP. (F) Quantification of colocalization by Pearson’s coefficient. Arp3 colocalizes with Lifeact significantly more than BRP::GFP, a similarly punctate and membrane-associated negative control. Graph shows mean ± sem; n represents NMJs. (G–I) Patch assembly requires the Arp2/3 activator WASp. GMA patch dynamics in control and WASp mutant animals imaged at 0.25 Hz. (G) MaxIPs of single spinning disc confocal microscopy time points, showing pan-neuronally expressed GMA localization in control and wsp1 mutant muscle 6/7 NMJs. (H) Quantification of patch frequency. Graph shows mean ± sem; n represents NMJs. (I) Quantification of patch-duration distribution. Bins are 20 s; X-axis values represent bin centers. n represents patches. Scale bars in (A) and (G) are 5 µm, and scale bar in (E) is 2.5 µm. Associated with Figure 1—figure supplement 1, Figure 1—figure supplement 2, and Video 1.

Figure 1—source data 1. Source data for Figure 1 and associated figure supplements.
Source data quantifying raw actin patch dynamics data for control actin markers. Source data quantifying Pearson’s correlation values between Lifeact::Ruby, clc::GFP, BRP::GFP, and Arp3::GFP. Source data quantifying actin patch dynamics data for control and WASp mutant neuromuscular junctions (NMJs). Source data quantifying raw actin patch dynamics data for control and WASp mutant NMJs. Source data quantifying raw data measuring WASp::Myc levels at control and Wsp RNAi NMJs. Source data quantifying raw patch frequency values in control NMJs and % difference between control and WASp mutant NMJs measured over the indicated parameter space. Samples analyzed are the same video dataset as in Figure 1G–I.

Figure 1.

Figure 1—figure supplement 1. Additional characterization of actin patches.

Figure 1—figure supplement 1.

(A) Images from Video 1 highlighting patch structures and dynamics. All patch and track regions of interest are color coded identically in all panels. Left - last frame of the GMA video from Video 1 showing all patch tracks (colored lines) and current patch detections (colored circles). Center - sum intensity projection of the video with locations of representative patches circled. Right - representative kymographs and intensity traces of patches. Kymograph represents entire timelapse from time 0 (top) to 6 min (bottom), with patch dynamics highlighted by color. As discussed in the text, not all patches are tracked due to overlapping signals or missing frames. (B) Quantification of patch frequency in neuromuscular junctions (NMJs) expressing GMA and imaged at 1 Hz. Data are from the same experiment as controls in Figure 6A–C. (C) Representative maximum intensity projections (MaxIPs) of single spinning disc confocal microscopy time points of neuronally expressed GMA in control and WASp RNAi (expressed in neurons via C155-GAL4) NMJs. (D, E) Quantitative analysis of patch frequency and patch-duration distribution (imaged at 0.25 Hz) shows that presynaptic WASp RNAi recapitulates the decreased patch frequency observed at WASp mutant NMJs. Histogram bins are 20 s; X-axis values represent bin centers. (F) Validation of wsp RNAi knockdown by quantification of presynaptic myc::WASp accumulation. Scale bars in (A) and (C) are 5 µm. Graphs show mean ± sem; n represents NMJs. Associated with Figure 1, Video 1.
Figure 1—figure supplement 2. Actin dynamics analysis is robust to tracking parameters.

Figure 1—figure supplement 2.

(A) Quantification of patch frequency in the control genotype of Figure 1G–I across a range of patch detection and tracking parameters. Link distance and patch detection threshold have a small effect on patch frequency. Lower graph highlights the effect of linking distance vs detection threshold specifically at 0.3 quality filter (as used in all analyses). (B) Quantification of the percent difference in patch frequency between WASp mutant neuromuscular junctions (NMJs) and controls, from the same experiment shown in Figure 1G–I. Across the majority of the parameter space, WASp mutants show a decrease in patch frequency, as reported. Results diverge only at extreme tracking and detection parameters. Lower graph highlights the effect of linking distance vs detection threshold at 0.3 quality filter. Associated with Figure 1.

Video 1. Dynamics of actin patches labeled by complementary reporters.

Download video file (1.5MB, mp4)

We next examined the molecular determinants of synaptic actin patch assembly. Patches strongly co-labeled with Arp3::GFP (Pearson coefficient 0.70), significantly higher than the active zone marker Bruchpilot (BRP), which served as a punctate and membrane-localized negative control (Figure 1E–F). These data suggest that actin patches are predominantly composed of branched F-actin, similar to sites of endocytosis in other cell types (Akamatsu et al., 2020; Collins et al., 2011). To test whether synaptic actin patches require Arp2/3 activation, we analyzed patch dynamics in larvae lacking the Arp2/3 activator WASp. We compared a genomic mutant (Figure 1G–I), likely hypomorphic due to maternal contribution (Ben-Yaacov et al., 2001), to presynaptic depletion in neurons expressing WASp RNAi (Figure 1—figure supplement 1 and C–F). Using both approaches allows us to distinguish neuron-autonomous from non-autonomous effects of WASP, which is present both pre- and postsynaptically (Coyle et al., 2004). Both genomic and RNAi manipulations significantly reduced the number of actin patches, while genomic mutants also skewed the distribution of patch durations toward both shorter and longer events (Figure 1I). These differences could reflect variable loss of function between the RNAi and mutant, or identify separable presynaptic autonomous (patch frequency) vs non-autonomous (patch duration) effects of WASp. Overall, these data clearly indicate that WASp is autonomously required in neurons to initiate assembly of presynaptic actin patches, similar to its involvement in endocytosis in yeast, mammalian non-neuronal cells, and in the NMJ (Hussain et al., 2001; Kessels and Qualmann, 2004; Khuong et al., 2010; Madania et al., 1999).

We next examined the synaptic distribution of two likely WASp regulators, Nwk and Dap160. By conventional and super-resolution microscopy of neurons in diverse organisms, these and other presynaptic membrane-remodeling proteins localize to a broad membrane domain surrounding active zones, termed the periactive zone (PAZ) (Coyle et al., 2004; Denker et al., 2011; Gerth et al., 2017; Koh et al., 2004; Marie et al., 2004; Sone et al., 2000). Consistent with these prior descriptions, we observed by structured illumination microscopy (SIM) that the PAZ proteins Nwk and Dap160 localize to a membrane-proximal mesh that surrounds active zones, which were labeled with BRP (Figure 2A). We observed similar results by live imaging of an endogenously tagged Nwk protein by SIM, which revealed most proteins to be close to the plasma membrane (Figure 2B). We then compared the localization of PAZ proteins to F-actin patches at the NMJ. As expected, actin patches were much sparser than the endocytic machinery, and GMA-labeled patches only partially overlapped with each of the presynaptic WASp, Nwk, and Dap160 (Figure 2C–F; Pearson’s coefficients of 0.38, 0.38, and 0.36, respectively). These data confirm that, in sharp contrast to the actin regulatory machinery, which localizes broadly across the PAZ, actin assembly itself is much sparser both spatially and temporally at the NMJ. This raises the question of how PAZ machinery might itself be locally regulated to promote the formation of productive synaptic actin assemblies.

Figure 2. Periactive zone proteins accumulate broadly across the NMJ.

Figure 2.

(A) The periactive zone (PAZ) proteins Nwk (magenta) and Dap160 (green) accumulate in a micron-scale mesh adjacent to active zones (AZ) (Bruchpilot, blue). Image shows maximum intensity projection (MaxIP) of a structured illumination microscopy (SIM) Z-stack. (B) Surface projection (top) and medial optical section (bottom) SIM images of live-imaged endogenous Nwk::GFP showing abundant and specific membrane recruitment, similar to fixed imaging. (C–F) PAZ proteins partially colocalize with actin patches. Optical slices of SIM micrographs showing F-actin (labeled with GMA) localization with presynaptically expressed WASp::Myc and Nwk (C) or Dap160 (E). (D, F) Quantification of colocalization between GMA and WASp::Myc, and Nwk (D) or Dap160 (F). (D, F) Quantification (Pearson correlation coefficient R) of colocalization between the indicated pairs of proteins. Graphs show mean ± sem; n represents neuromuscular junctions (NMJs).

Figure 2—source data 1. Source data for Figure 2.
Source data quantifying Pearson R values between Nwk, WASp, and GMA. Source data quantifying Pearson R values between Dap160, WASp, and GMA.

Multiple interaction interfaces between Dap160 and Nwk regulate Nwk autoinhibition

The hypothesis that PAZ protein-mediated actin assembly might be locally activated is particularly interesting given that we and others have previously shown that autoinhibition of both Nwk and its mammalian homolog FCHSD2 suppresses both WASp activation and membrane binding (see Figure 3A for summary model; Almeida-Souza et al., 2018; Rodal et al., 2008; Stanishneva-Konovalova et al., 2016). These results suggest that transient or localized relief of autoinhibition could explain how the PAZ controls actin assembly. To determine if and how the candidate activator Dap160 might relieve Nwk autoinhibition, we first mapped their specific interaction domains using glutathione-S-transferase (GST) pulldown assays and found that purified Dap160 SH3C-containing protein fragments (SH3C, SH3CD, or SH3ABCD) directly interact with NwkSH3b, while SH3D alone does not (Figure 3B, Figure 3—figure supplement 1; see Figure 3—figure supplement 2A for details of constructs used). Unexpectedly, Dap160 SH3C, SH3D, and SH3CD domain fragments also, each, interact with the isolated Nwk F-BAR domain (Figure 3—figure supplement 1B). We next determined how Dap160 interacts with NwkF-BAR compared to a Nwk fragment containing the F-BAR and both SH3 domains. Dap160-NwkF-BAR interactions were progressively eliminated by increasing salt, suggesting they are mediated by electrostatic interactions. By contrast, Dap160SH3CD-Nwk interactions were maintained (Figure 3B, Figure 3—figure supplement 1C), suggesting that the SH3-SH3 interaction is mediated primarily by hydrophobic interactions, consistent with their mammalian homologs (Almeida-Souza et al., 2018; see summary of interactions in Figure 3C). Finally, we found that truncation of Dap160SH3CD decreased the levels of Nwk in synaptic boutons similarly to Dap160 knockdown (Figure 3D, Figure 3—figure supplement 2B–C). Dap160ΔSH3CD also exhibited reduced colocalization with Nwk compared to wild-type Dap160 (Figure 3E, Figure 3—figure supplement 2C), further supporting an in vivo requirement for this interaction. Notably, truncation of Dap160SH3D did not exhibit a phenotype in these assays despite lower levels of expression (Figure 3—figure supplement 2B), suggesting that additional factors absent from our in vitro assays may collaborate to regulate Nwk in vivo.

Figure 3. Distinct SH3-SH3 and SH3-BAR domain interactions drive Dap160-Nwk association in vitro and at synapses.

(A) Model for autoinhibition of Nwk membrane binding and WASp activation. Neither membrane-bound nor membrane-free Nwk efficiently activates WASp-mediated actin polymerization, due to persistent SH3b-mediated autoinhibitory interactions, suggesting that an SH3b domain ligand is required for activation. (B) Dap160SH3CD exhibits electrostatic and hydrophobic interactions with the Nwk F-BAR and SH3 domains, respectively. Glutathione-S-transferase (GST) fusion proteins were immobilized on glutathione agarose and incubated with the indicated purified proteins. Pellets and supernatants were fractionated by sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS-PAGE), Coomassie stained, and quantified by densitometry. Graphs show the average ± sem of three independent reactions. [NwkF-BAR] = 1.5 μM, [Nwk] = 0.8 μM, [GST-Dap160SH3CD] = 1.6 μM, [GST-Dap160SH3C/D] = 1.2 μM. (C) Summary of Dap160SH3CD-NwkSH3ab interactions. Gray and black arrows indicate electrostatic and hydrophobic interactions, respectively. (D, E) Maximum intensity projection (MaxIP) spinning disc confocal (D) or single Z-plane structured illumination microscopy (SIM) micrographs (E) of muscle 4 neuromuscular junctions (NMJs) expressing C155-GAL4-driven UAS-Dap160 rescue transgene variants in a dap160 null background (dap160Δ1/Df). Loss of the Dap160SH3CD domains (Dap160ΔSH3CD), but not the SH3D domain alone (Dap160ΔSH3D), decreases the abundance of Nwk (D, right) and Dap160-Nwk colocalization (E, right) at synapses. Contrast-matched panels in (E) are displayed with the same brightness/contrast. Adjacent panels are contrast-adjusted per image to facilitate comparison of Nwk-Dap160 colocalization. Graphs show mean ± sem; n represents NMJs. Scale bars in (D) and (E) are 5 μm and 2.5 μm, respectively. Associated with Figure 3—figure supplements 12.

Figure 3—source data 1. Source data for Figure 3 and associated figure supplements.
Whole Coomassie gels measuring the interaction between GST-Dap160 fragments and Nwk proteins, as indicated in each file name. Collected and annotated gels for Figure 3B with lanes and constructs labeled. Quantification of blots for Figure 3B. Quantification of Nwk intensity in Dap160 rescue larvae, also containing raw data for Figure 3—figure supplement 2B (Dap160 transgene abundance). Source data quantifying Nwk-Dap160 transgene colocalization and intensity in Dap160 rescue larvae; also containing raw data for Figure 3—figure supplement 2C (Dap160 transgene abundance). Collected and annotated gels measuring Dap160 fragment pulldowns of Nwk SH3b for Figure 3—figure supplement 1A with lanes and constructs labeled. Raw gels for Figure 3—figure supplement 1A. Raw data quantifying Figure 3—figure supplement 1A. Collected and annotated gels measuring Dap160 fragment pulldowns of Nwk FBAR in Figure 3—figure supplement 1B with lanes and constructs labeled. Raw gels for Figure 3—figure supplement 1B. Data quantifying Dap160 fragment pulldowns of Nwk FBAR. Raw data quantifying Dap160 abundance in control and dap160 rnai-expressing NMJs.

Figure 3.

Figure 3—figure supplement 1. Domain specific interactions between Dap160 and Nwk.

Figure 3—figure supplement 1.

(A, B) Glutathione-S-transferase (GST) fusion proteins were immobilized on glutathione agarose and incubated with the indicated purified proteins. Pellets and supernatants were fractionated by sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS-PAGE), immunoblotted (A) or Coomassie stained (B), and quantified by densitometry. (A) NwkSH3b interacts directly with Dap160SH3C, Dap160SH3CD, or Dap160SH3ABCD, but not with Dap160SH3D alone. [NwkSH3b] = 7 μM. (B) The Nwk F-BAR domain interacts directly with Dap160SH3, Dap160SH3D, and Dap160SH3CD. [NwkF-BAR] = 1.5 μM, [GST-Dap160SH3CD] = 8.5 μM, [GST-Dap160SH3C/D] = 11 μM. (C) Representative Coomassie-stained gels for Figure 3B. Associated with Figure 3.
Figure 3—figure supplement 2. Validation of Dap160 transgene rescue and knockdown experiments.

Figure 3—figure supplement 2.

(A) Schematic of Dap160 rescue transgenes used in in vivo and Nwk fragments used in in vitro experiments. (B, C) Quantification of Dap160 variant transgene expression (mCherry signal) at neuromuscular junctions (NMJs) from datasets in Figure 3D and Figure 3E, respectively. All transgenes were expressed in neurons by C155-GAL4 in a dap160 null background (dap160Δ1/Df). (D) Maximum intensity projections (MaxIPs) (left) and quantification (right) of spinning disc confocal micrographs of control and dap160 RNAi-expressing NMJs showing knockdown of Dap160 protein levels, using the same conditions as in Figure 3D. Associated with Figure 3.

Dap160SH3CD and membranes relieve inhibition of Nwk-WASp-Arp2/3 actin assembly in vitro

We have previously shown that Nwk only weakly activates WASp-dependent actin assembly in vitro, due to Nwk autoinhibition (Stanishneva-Konovalova et al., 2016). To test whether Dap160SH3CD might relieve Nwk autoinhibition, we performed pyrene-actin assembly assays (Figure 4). At moderate Nwk-Dap160 concentrations (500 nM and 2 µm, respectively), Nwk and Dap160SH3CD significantly enhanced the rate of WASp-Arp2/3-mediated actin assembly compared to Nwk plus WASp alone (Figure 4A). This effect is through Nwk, as Dap160SH3CD had no effect on WASp-Arp2/3 in the absence of Nwk. Further, Dap160 enhancement of Nwk-WASp actin assembly required the Dap160SH3D domain, further showing that the specific Dap160SH3D-NwkF-BAR interaction relieves functional Nwk autoinhibition in vitro. Thus, multiple Nwk-Dap160 interactions work together to relieve autoinhibition of Nwk.

Figure 4. Nwk, Dap160, and PI(4,5)P2 potentiate WASp-mediated actin assembly at membranes.

Figure 4.

(A, B) Pyrene-actin assembly assay (2.5 µM actin, 5% pyrene-labeled). Curves are representative single experiments demonstrating actin assembly kinetics; graphs represent rates calculated from the linear range of assembly from at least two independent experiments. (A) The combination (red trace) of Nwk and Dap160SH3CD enhances WASp-Arp2/3-mediated actin assembly. Either alone (magenta and blue traces) has no effect on WASp activity. [Nwk] = 500 nM, [Dap160] = 2 µM, [WASp] = 50 nM, [Arp2/3] = 50 nM. (B) PI(4,5)P2 enhances Nwk-Dap160 activation of WASp-mediated actin assembly. Nwk alone or in combination with 10% PI(4,5)P2 liposomes fails to activate WASp, while the addition of Dap160SH3CD and PI(4,5)P2 synergistically enhances WASp-mediated actin assembly. [Nwk] = 100 nM, [Dap160] = 500 nM, [WASp] = 50 nM, [Arp2/3] = 50 nM. (C) Single slices from spinning disc confocal micrographs of water-droplet actin assembly assay: SNAP-labeled Nwk constructs (red) and Oregon Green actin (green) were mixed with the indicated proteins in an aqueous solution and emulsified in 97.5% 1,2-diphytanoyl-sn-glycero-3-phosphocholine (DPHPC), 2.5% PI(4,5)P2 in decane. Both deregulated NwkΔSH3b and Nwk + Dap160SH3CD promote F-actin assembly in droplets. However, while Nwk - Dap160SH3CD derived F-actin associates with the lipid interface, de-regulated NwkΔSH3b promotes actin assembly from asters that do not associate with membranes. [Nwk1-xxx] = 500 nM, [Dap160] = 2 µM, [WASp] = 50 nM, [Arp2/3] = 50 nM. Graph indicates percentage of droplets with observable actin filament assembly. Scale bar in (C) is 10 µm.

Figure 4—source data 1. Source data for Figure 4.
Raw data quantifying pyrene-actin assembly kinetics with Nwk, Dap160, and WASp. Raw data quantifying pyrene-actin assembly kinetics with Nwk, Dap160, WASp, and liposomes.

To generate salient physiological force, actin assembly must be coupled to membranes, and negatively charged lipids are an important ligand for both Nwk and WASp. Thus, we next tested whether addition of PI(4,5)P2-rich liposomes modified actin assembly by Nwk, Dap160, and WASp (Figure 4B). Indeed, PI(4,5)P2-containing liposomes synergistically activated WASp-mediated actin assembly in concert with Dap160 and Nwk. By contrast, neither Nwk, PI(4,5)P2, nor Nwk + PI(4,5)P2 on their own were sufficient to activate WASp above baseline (Figure 4B). Since PI(4,5)P2 is also insufficient to robustly activate either WASp or Nwk under these conditions (Stanishneva-Konovalova et al., 2016), our data suggest that WASp activation reflects coordinated relief of Nwk autoinhibition by both Dap160 and membranes. To further explore the coupling between lipid association and actin assembly, we conducted F-actin assembly assays in a droplet assay, in which protein-containing aqueous droplets are surrounded by a lipid interface, with lipid head groups facing the aqueous phase (Figure 4C). In this assay, we found that coordinated interactions among Nwk, Dap160, and WASp directed actin assembly to the lipid interface. By contrast, substitution of Nwk lacking its autoinhibitory and Dap160-interacting SH3b domain (NwkΔSH3b) caused actin to assemble as free-floating asters (Figure 4C). We have previously found that expression of a similarly deregulated fragment (Nwk1-631) at the NMJ led to diffuse actin filament assembly throughout the synapse (Stanishneva-Konovalova et al., 2016). Together, these data suggest that NwkSH3b has a dual role in maintaining autoinhibition via Nwk-F-BAR interactions and permitting actin assembly at specific synaptic locations via Dap160-mediated activation.

Dap160 and WASp relieve Nwk autoinhibition and promote its membrane association

Our actin assembly data suggest that membrane recruitment is a critical regulator of the Nwk-Dap160-WASp complex (Figure 4B–C). To test whether Nwk-Dap160 interactions directly regulate membrane recruitment, we performed liposome cosedimentation assays. We found that Dap160SH3CD enhanced Nwk membrane binding in a dose-dependent fashion (Figure 5A). This effect depended on membrane charge, as Dap160SH3CD significantly enhanced Nwk membrane binding at both 5 and 10%, but not at 2.5% PI(4,5)P2 (Figure 5B). Only at 10% PI(4,5)P2 did Dap160SH3CD promote Nwk membrane binding to the same extent as the completely uninhibited NwkFBAR domain alone, suggesting that membrane charge and intermolecular interactions with Dap160 together tune Nwk membrane recruitment. Indeed, this effect required the full Dap160SH3CD-NwkSH3b interaction: Dap160SH3C alone was unable to promote membrane binding by Nwk, and Dap160SH3CD did not enhance membrane binding of Nwk lacking its Dap160-interacting SH3b domain (Figure 5—figure supplement 1A). These data further support the hypothesis that Dap160SH3CD relieves NwkSH3b-mediated autoinhibition.

Figure 5. Dap160SH3CD and WASp promote Nwk membrane association.

(A–C) Liposome cosedimentation assays between the indicated purified proteins and liposomes composed of [mol% = DOPC/DOPE/DOPS/PI(4,5)P2 = 80-x/15/5/x], with x representing PI(4,5)P2 concentration as noted. Quantification from Coomassie-stained gels represents the mean fraction of total protein that cosedimented with the liposome pellet ± sem. (A) 1:3 Nwk:Dap160SH3CD saturates enhancement of Nwk membrane association at 5% PI(4,5)P2, but not to the level of the isolated Nwk F-BAR alone (NwkF-BAR, black bar). [NwkF-BAR] = 3 µM, [Nwk] = 1.125 µM, [Dap160SH3CD] = 1.7–6.8 µM. (B) Dap160SH3CD (but not Dap160SH3C) enhances Nwk association with membranes at a range of PI(4,5)P2 concentrations. Maximum binding (comparable to NwkF-BAR) occurs only at 5–10% PI(4,5)P2 concentrations. [Nwk1-xxx] = 2 µM, [Dap160] = 6 µM. (C) Nwk, WASp, and Dap160SH3CD mutually enhance membrane recruitment. Addition of Dap160SH3CD and WASp additively enhances Nwk membrane association, while Dap160SH3CD and WASp show maximum recruitment to 10% PI(4,5)P2 liposomes in the presence of both other proteins. [Nwk] = 1 µM, [WASp] = 1 µM, [Dap160SH3CD] = 3 µM. (D) Giant unilamellar vesicle (GUV) decoration assay, with 10% PI(4,5)P2 GUVs labeled with <1% TopFluor-PE. The addition of WASp to Nwk (red) and Dap160SH3CD (blue) enhances the recruitment of Dap160SH3CD to the membrane (green, note diffuse blue signal in (-) WASp condition). [Nwk] = 250 nM, [WASp] = 250 nM, [Dap160SH3CD] = 1 µM. Scale bar is 10 μm. (E, F) Fluorescence recovery after photobleaching (FRAP) assay of endogenously labeled Nwk in control and C155-GAL4/UAS-Dicer-driven Dap160RNAineuromuscular junctions (NMJs). Images show individual medial optical sections of Airyscan confocal images at the indicated time point. Control Nwk signal shows membrane association (see strong peripheral signal) and slower recovery kinetics, while loss of Dap160 eliminates the strong peripheral accumulation of Nwk::GFP and increases the recovery kinetics of Nwk::GFP in the bleached region (dashed circles). Graph shows mean ± sem; n represents NMJs. Scale bar is 5 μm. Associated with Figure 5—figure supplement 1.

Figure 5—source data 1. Source data for Figure 5 and associated figure supplements.
Source data quantifying liposome cosedimentation of Nwk with increasing concentrations of Dap160SH3CD. Annotated gels quantifying liposome cosedimentation of Nwk with increasing concentrations of Dap160SH3CD. Raw gels quantifying liposome cosedimentation of Nwk with increasing concentrations of Dap160SH3CD. Annotated gels quantifying liposome cosedimentation of Nwk and Dap160 fragments with increasing concentrations of PI(4,5)P2. Raw gels quantifying liposome cosedimentation of Nwk and Dap160 fragments with increasing concentrations of PI(4,5)P2. Source data quantifying liposome cosedimentation of Nwk and Dap160 fragments with increasing concentrations of PI(4,5)P2. Source data quantifying FRAP recovery and curve fitting of Nwk::GFP in control and dap160 RNAi-expressing neuromuscular junctions (NMJs). Annotated gels quantifying liposome cosedimentation of NwkΔSH3b and Dap160 fragments. Raw gels quantifying liposome cosedimentation of NwkΔSH3b and Dap160 fragments. Source data quantifying liposome cosedimentation of NwkΔSH3b and Dap160 fragments.

Figure 5.

Figure 5—figure supplement 1. Membrane binding and bending by Dap160-WASp-Nwk.

Figure 5—figure supplement 1.

(A) Cosedimentation assay between the indicated purified proteins and liposomes composed of [mol% = DOPC/DOPE/DOPS/PI(4,5)P2 = 75/15/5/5]. Dap160SH3CD is unable to enhance membrane binding of NwkΔSH3b (which lacks the autoinhibitory and Dap160-binding SH3b domain) or WASp. Conversely, NwkΔSH3b is unable to promote membrane recruitment of Dap160SH3CD. Quantification from Coomassie-stained gels represents the mean fraction of total protein that cosedimented with the liposome pellet ± sem. [NwkΔSH3b] = 1 µM, [WASp] = 1 µM, [Dap160] = 3 µM. Graph shows mean ± sem. (B) Representative Coomassie-stained gel from (A). (C) Representative Coomassie-stained gel from Figure 5C. (D) Confocal timelapse of deformation of GUVs (10% PI(4,5)P2, labeled with <1% TopFluor-PE) decorated with the indicated proteins [Nwk1-xxx] = 250 nM, [WASp] = 250 nM, [Dap160] = 1.25 µM. The Nwk-Dap160-WASp complex retains the same membrane-remodeling activity as Nwk alone. Associated with Figure 5.

As we found that Dap160SH3CD is insufficient to fully activate membrane binding by Nwk at intermediate phosphoinositide concentrations (Figure 5A), we asked whether WASp could further enhance Nwk membrane recruitment. Indeed, the addition of Dap160SH3CD and WASp together enhanced Nwk membrane association to the level of the isolated F-BAR domain (Figure 5C). Moreover, coordinated binding of all three components resulted in significantly enriched membrane association of both WASp and Dap160 (Figure 5C). We directly observed the coordinated recruitment of Nwk and Dap160 in the presence of WASp using fluorescently labeled proteins on GUVs (Figure 5D). Consistent with the direct Dap160-NwkSH3b interaction, we found that deletion of the NwkSH3b domain abolished both the Dap160SH3CD-dependent increase and the coordinated recruitment of WASp and Dap160 (Figure 5—figure supplement 1A). Notably, addition of Dap160 and WASp did not change the nature of membrane deformations generated by Nwk (scalloped and pinched membranes; Becalska et al., 2013), suggesting that Dap160 and WASp together potentiate rather than alter the inherent activity of Nwk (Figure 5—figure supplement 1D). These data indicate that Dap160-Nwk SH3-mediated interactions potentiate Nwk association with membranes in vitro.

Finally, to test whether Dap160 promotes Nwk membrane association in vivo, we examined the dynamics of Nwk at the synapse in the presence and absence of Dap160. Knockdown of Dap160 by RNAi (Figure 5E, Figure 3—figure supplement 2D) led to a striking loss of endogenously tagged Nwk::GFP from synaptic membranes (note strong peripheral labeling in control bouton cross-sections; Figure 5E). Further, Dap160 knockdown significantly increased the rate of recovery of Nwk::GFP after photobleaching, consistent with a shift in localization from membrane-bound to cytosolic (Figure 5F). These data suggest that the Dap160SH3CD-Nwk interaction promotes Nwk membrane association in vivo. Taken together, our data indicate that multiple coordinated interactions between Nwk, WASp, Dap160SH3CD, and membranes are required to relieve Nwk autoinhibition, allowing for tight control of membrane-coupled actin assembly in the PAZ.

Dap160-Nwk interactions regulate synaptic F-actin patch dynamics

To determine how these mechanisms direct WASp-mediated actin assembly at the synapse, we measured actin dynamics in nwk (Figure 6A–C, Video 2) and dap160 domain (Figure 6D–F) mutant NMJs. We predicted two possible but non-exclusive functions based on the dual roles that we found for the Nwk-Dap160-WASp module in vitro: if Nwk and Dap160 are primary activators of WASp, then loss-of-function mutants are likely to diminish patch frequency, duration, or intensity. Importantly, multiple WASp activators exist in the synaptic endocytic machinery (e.g., Cip4 and Snx9; Almeida-Souza et al., 2018; Gallop et al., 2013; Nahm et al., 2010; Ukken et al., 2016), and therefore, these could make significant contributions to WASp activation in addition to Nwk. Conversely, if an important function of autoinhibition is to ‘clamp’ actin assembly at the synapse, we expected that loss of Nwk and/or Dap160 would lead to spurious actin assembly events by these other WASp regulators. We found that both nwk and Dap160ΔSH3CD mutants significantly increased patch frequency (Figure 6B,E, Figure 6—figure supplement 1), supporting a clamp function for these proteins. We did not detect a difference in the distribution of patch lifetimes, suggesting that it is the frequency of events, and not their duration per se, that changes (Figure 6C,F).

Figure 6. Loss of the Dap160-Nwk interaction disrupts actin patch dynamics at synapses in vivo.

(A, D) Maximum intensity projections (MaxIPs) of live spinning disc confocal micrographs of presynaptically expressed GMA in muscle 6/7 neuromuscular junctions (NMJs) of the indicated genotypes, imaged at 1 Hz. Graphs quantify patch frequency (B, E) and distribution of patch durations (C, F). Loss of nwk (A–C) or of the Nwk-interacting Dap160SH3CD domain (D–F) increases the frequency of actin patch assembly. In both cases, there is no change in the distribution of patch durations (C, F). Scale bars in (A, D) are 5 μm. Associated with Figure 6—figure supplements 12, Video 2.

Figure 6—source data 1. Source data for Figure 6 and associated figure supplements.
Source data quantifying actin patch dynamics in control and nwk mutant neuromuscular junctions (NMJs). Source data quantifying actin patch dynamics in control and Dap160 transgene rescue NMJs. Source data showing raw patch frequency values in control NMJs and % difference between control and nwk mutant NMJs measured over the indicated parameter space. Samples are the same video dataset as in Figure 6A–C. Data showing the coefficient of variation over time of GMA signal intensity in control and nwk mutant NMJs. Samples are the same video dataset as in Figure 6A–C. Data showing the area fraction of highly variant (Std Dev over time) pixels in control and nwk mutant NMJs, thresholded by two methods. Samples are the same video dataset as in Figure 6A–C.

Figure 6.

Figure 6—figure supplement 1. Analysis of actin dynamics is robust to tracking parameters at 1 Hz imaging.

Figure 6—figure supplement 1.

(A) Quantification of patch frequency in the control genotype of Figure 6A–C across a range of patch detection and tracking parameters. Consistent with the 0.25 Hz imaging (Figure 1—figure supplement 2), link distance and patch detection threshold have a small effect on patch frequency. Lower graph highlights the effect of linking distance vs detection threshold specifically at the 0.3 quality filter (as used in all analyses). (B) Quantification of the percent difference in patch frequency between nwk mutant neuromuscular junctions (NMJs) and controls, from the same experiment shown in Figure 6A–C. Across the majority of the parameter space, nwk mutants show an increase in patch frequency, as reported. Lower graph highlights the effect of linking distance vs detection threshold at the 0.3 quality filter. Associated with Figure 6.
Figure 6—figure supplement 2. Validation of actin particle analysis in nwk mutants.

Figure 6—figure supplement 2.

(A) Coefficient of variation (CoV) projections of timelapse videos of GMA dynamics in control and nwk mutant neuromuscular junctions (NMJs) (analysis of the same dataset as shown in Figure 6A–C; different representative images shown).(B) Average temporal CoV values across NMJs. nwk mutants exhibit greater temporal variation in GMA signal than controls. (C) Quantification of the fraction of NMJ area covered by ‘high’ CoV pixels (identified by automated thresholding using either Li (Li and Tam, 1998) or Moments (Tsai, 1995) algorithm). nwk mutants show no difference in the fraction of high CoV pixels, suggesting that actin dynamics are confined to a restricted region of the synapse and vary more over time rather than space. (D) Example of results from temporal CoV analysis of synthetic data, in which the frequency and lifetime were systematically varied. (Left) Representative images of synthetic data created using a custom FIJI script. (Right) Quantification of CoV over time. Shaded green region indicates values that most closely match in vivo measurements drawn from Patchtracker particle-based analysis. In this regime, our model indicates that the nwk mutant effect size in panel (B) corresponds to a 43% increase in patch frequency, slightly higher than the particle-based measurement of 28%. Associated with Figure 6.

Video 2. Loss of nwk increases the frequency of brief actin patches.

Download video file (1.3MB, mp4)

We also analyzed actin dynamics using a complementary approach in which we measured the normalized intensity variation (coefficient of variation, CoV) over time across the entire NMJ. Interestingly, the magnitude of variation was significantly higher in nwk mutants (Figure 6—figure supplement 2A–B), but the area of the NMJ that was highly variant was similar between genotypes, suggesting that actin assembly is more dynamic in time in these mutants, rather than more extensive in space (Figure 6—figure supplement 2C). We validated this analysis for its sensitivity in detecting changes in event frequency by analyzing synthetic data (Figure 6—figure supplement 2D, see 'Materials and methods' for details). The modeled data suggest that the difference in CoV that we measured between Control and nwk is consistent with a 43% increase in patch frequency, which is slightly higher than our measurement by particle tracking (28%; Figure 6A). This complementary analysis does not rely on particle tracking and makes no assumptions about the nature of actin dynamics, and is consistent with our particle-based metrics. Thus, we conclude that these phenotypes are robust to the method of analysis used.

Nwk and Dap160SH3CD are required for normal synaptic vesicle endocytosis

We next investigated the physiological function of actin patches in vivo. Considering that patch morphology, frequency, and duration resembled endocytic dynamics, we first compared actin patches with the endocytic adaptors Clc and AP2α. Like other endocytic proteins, both presynaptically expressed Clc::GFP and endogenously tagged AP2α::GFP were primarily enriched at the plasma membrane relative to the cytoplasm (Figure 7—figure supplement 1A) and covered a large area fraction of the membrane, similar to other endocytic proteins (Figure 2). In addition to diffuse signal, both probes localized to short- and long-lived puncta, a subset of which dynamically colocalized with actin patches (Figure 7A–C, Figure 7—figure supplement 1B, Video 3). A significant proportion of endogenously labeled AP2 at the NMJ is likely associated with the closely apposed postsynaptic membrane, which accounts for its slightly lower correlation coefficient with Lifeact::Ruby. Considering that the rates of exo/endocytosis at this synapse at rest are relatively low (see above), these observations suggest that like other PAZ endocytic proteins, a large pool of membrane-localized clathrin coat and adaptor proteins are not actively engaged in endocytosis. Despite these caveats, we found that actin significantly colocalized with both Clc (Figure 7C) and AP2 (Figure 7—figure supplement 1C), consistent with a role in endocytosis for these actin-enriched sites. To more rigorously and functionally test the hypothesis that actin patches are endocytic, we acutely disrupted endocytic dynamics using the temperature-sensitive dominant-negative dynamin/shiTS1 allele. When imaged under restrictive conditions, shi disruption decreased the frequency of actin patch dynamics (Figure 7D–E). Together, these data suggest that a significant fraction of presynaptic actin patches are associated with endocytosis.

Figure 7. Actin patches and the Nwk-Dap160 interaction are associated with synaptic endocytosis.

(A, B) Sum intensity projection (A) and representative kymographs (B) of spinning disc confocal timelapse of presynaptically expressed Lifeact::Ruby and clc::GFP. (A) Sum projection of 41 frames (82 s) highlights overlapping intensities of clc and Lifeact (circles and arrowheads). Circles indicate locations of kymographs in panel (B). (B) Kymographs of clc and Lifeact signals. Kymographs span the full duration of the movie from left (0 s) to right (82 s). Intensity profiles were normalized per channel from the minimum to the maximum value of each profile. (C) Quantification of colocalization between Lifeact::Ruby and Clc::GFP. Presynaptically expressed Lifeact::Ruby was co-expressed with either presynaptically expressed Clc::GFP or a BRP::GFP knockin and imaged in 3D stacks by Airyscan. Bruchpilot (BRP) control is the same dataset as in Figure 1F (all data were acquired contemporaneously). (D, E) Normal patch assembly requires dynamin activity. (D) Maximum intensity projections (MaxIPs) of single spinning disc confocal microscopy time points, showing pan-neuronally expressed GFP::actin in control and shiTS1 mutant muscle 6/7 neuromuscular junctions (NMJs), imaged at 1 Hz, at the restrictive temperature of 31oC under stimulating conditions to drive the terminal shiTS1 phenotype (45 mM KCl, 2 mM CaCl2). Graph shows mean ± sem. n represents NMJs. (E) Quantification of patch frequency. (F–I) FM dye uptake assays at muscle 6/7 NMJs following 5 min of 90 mM potassium stimulation at 36°C. (F, H) MaxIPs of spinning disc confocal micrographs of FM dye uptake assays. Dotted lines highlight synapse outline in shiTS1 NMJs. (F, G) nwk mutants exhibit partially defective FM4-64fx dye uptake relative to shiTS1 mutants. (H, I) Loss of Dap160-Nwk interactions in a Dap160ΔSH3CD truncation (but not Dap160ΔSH3D) exhibits partially defective FM1-43 dye uptake relative to shiTS1, similar to nwk mutants. Graphs show mean ± sem; n represents NMJs. Scale bars are 2.5 µm (A, B) or 5 µm (D, F, H). Associated with Figure 7—figure supplements 13, Video 3.

Figure 7—source data 1. Source data for Figure 7 and associated figure supplements.
Source data showing intensity dynamics over time from the kymographs shown in Figure 7A. Contains raw Pearson’s correlation values between Lifeact::Ruby, clc::GFP, BRP::GFP, and Arp3::GFP. Source data quantifying actin dynamics in control and shiTS1 mutant neuromuscular junctions (NMJs). Source data quantifying FM dye uptake in control and nwk mutant NMJs. Source data quantifying FM dye uptake in control and Dap160 transgene rescue NMJs. Source data quantifying the radial distribution (from edge to center of boutons) of AP2 and Clc. Source data quantifying colocalization between AP2 and Lifeact::Ruby. Source data quantifying satellite bouton counts in Dap160 transgene rescue NMJs. Source data quantifying FM dye uptake and unloading in control and nwk mutant NMJs. Source data quantifying FM dye uptake and unloading in control and Dap160 transgene rescue NMJs.

Figure 7.

Figure 7—figure supplement 1. Colocalization of actin with AP2α and Clathrin light chain.

Figure 7—figure supplement 1.

(A) Clc::GFP and AP2α::GFP are enriched at the synaptic plasma membrane. Images show single plane Z-slices of the mid-bouton region (effectively a cross-section through the bouton) from live Airyscan imaging of presynaptically expressed Clc::GFP (green) and endogenously tagged AP2α::GFP (magenta). Right: radial intensity profile from the outside edge (left) to the center (right) of boutons similar to those shown (values are mean ± Std Dev across n = 6 (Clc::GFP) or 7 (AP2 α::GFP) boutons). (B, C) Spinning disc confocal imaging maximum intensity projections (MaxIPs) of Airyscan micrographs of endogenously tagged AP2α::GFP (green) and Lifeact::Ruby (magenta) in live (B) or fixed (C) preparations. (C) Actin and AP2α partially colocalize; note a significant fraction of endogenously labeled AP2α::GFP is postsynaptic. Graph shows quantification of colocalization by Pearson’s coefficient. Scale bars in (A) and (B) are 2.5 μm. Associated with Figure 7.
Figure 7—figure supplement 2. All Dap160 transgenes rescue dap160 satellite bouton phenotype.

Figure 7—figure supplement 2.

(A) Maximum intensity projections (MaxIPs) of epifluorescence micrographs of muscle 4 neuromuscular junctions (NMJs) stained for anti-HRP (magenta) and anti-Dlg (green). Dap160 RNAi-expressing NMJs exhibit many satellite boutons, which are restored to normal levels by presynaptic expression of Dap160FL, Dap160ΔSH3D, or Dap160ΔSH3CD (in dap160Δ1/Df larvae). (B) Quantification of satellite boutons. Graph shows mean ± sem; n represents NMJs. Scale bar in (A) is 10 µm. Associated with Figure 7.
Figure 7—figure supplement 3. nwk and dap160 domain mutants do not disrupt FM dye unloading.

Figure 7—figure supplement 3.

Loading and unloading of FM dyes in nwk and dap160 domain mutants by stimulation in 90 mM KCl + 2 mM CaCl2. (A, D) Maximum intensity projections (MaxIPs) of spinning disc confocal stacks acquired after loading (left) and unloading (right) of FM dyes. (B, C) Quantification of FM4-64 loading (B) and unloading (C) in nwk mutants. (E, F) Quantification of FM1-43 loading (E) and unloading (F) in dap160 domain mutants.

Video 3. Clc-GFP and Lifeact::Ruby partially colocalize.

Download video file (509.2KB, mp4)

We next tested the physiological requirement of the Nwk and Dap160SH3CD interaction. As both Nwk and Dap160 are implicated in the endocytic trafficking of synaptic growth-promoting bone morphogenetic protein (BMP) receptors (O'Connor-Giles et al., 2008; Rodal et al., 2008), we tested whether the Dap160-Nwk interaction was required for normal synaptic growth, which we assayed by counting satellite boutons, a hallmark phenotype of both null mutants. Surprisingly, we found that both Dap160ΔSH3D and Dap160ΔSH3CD truncations rescued satellite bouton numbers to wild-type levels (Figure 7—figure supplement 2). These data indicate that synaptic vesicle and growth factor endocytosis are mechanistically separable, and suggest that actin dynamics phenotypes in the Dap160ΔSH3CD mutant are not associated with synaptic growth regulation. We next examined synaptic vesicle endocytosis and recycling by FM dye uptake. nwk1/2 null mutants led to a 34% decrease in FM4-64fx uptake compared to controls (Figure 7F–G), an intermediate phenotype compared to dominant negative dynamin in shiTS1 mutants (72% decrease). dap160 null mutants have been previously shown to exhibit an endocytosis defect (Koh et al., 2004; Marie et al., 2004), so we next tested whether the interaction between Dap160 and Nwk is required to support normal endocytosis. Indeed, we found that expression of Dap160ΔSH3CD in dap160 null mutants also significantly diminished FM dye uptake to a similar extent as loss of nwk (27% reduction; Figure 7H–I). By contrast, loss of the Dap160SH3D domain alone caused no defects in FM uptake, consistent with the lack of effect of this mutation on Nwk accumulation and localization (Figure 3D–E), suggesting that this interaction, though required in vitro, may be compensated by additional factors in vivo. Both nwk and Dap160ΔSH3CD mutants unloaded FM dye to the same extent as controls, suggesting that diminished endocytosis is a direct phenotype, and not secondary to exocytic deficits (Figure 7—figure supplement 3). Importantly, these data indicate that spurious actin assembly events in nwk and dap160 mutants are likely to be unproductive for normal endocytosis. Overall, our data support the hypothesis that normal synaptic actin patches represent active endocytic events and indicate that Dap160-Nwk regulation of actin patch dynamics is functionally required for synaptic vesicle endocytosis.

Discussion

Here we have identified a mechanism by which autoinhibition clamps the presynaptic endocytic machinery to regulate the dynamics of discrete synaptic actin assembly events and the efficiency of synaptic endocytosis. Our data suggest a model in which specific interactions among Nwk, Dap160, and WASp function in two ways to potentiate membrane-associated actin dynamics. (1) Persistent autoinhibition of Nwk allows for stable binding of inactive PAZ machinery to presynaptic membranes to constrain spurious actin assembly events. (2) Coordinated relief of Nwk autoinhibition by Dap160 and WASp robustly activates F-actin assembly and ensures that actin assembles into structures that are likely to productively remodel membranes. This provides a mechanism by which synapses can use the micron-scale PAZ organization of endocytic machinery as a regulated reservoir to efficiently generate 50- to 100-nm-scale endocytic events, in response to physiological cues such as synaptic transmission.

Predominant presynaptic actin structures resemble endocytic patches

Here we provide the first quantitative analysis of the composition and dynamics of individual presynaptic F-actin structures. Numerous studies have examined actin dynamics at the level of entire synapses or qualitatively described dynamics of discrete actin structures (Bloom et al., 2003; Colicos et al., 2001; Nunes et al., 2006; Piccioli and Littleton, 2014; Sankaranarayanan et al., 2003; Zhao et al., 2013), and identified diverse roles for actin, including synaptic vesicle endocytosis (Holt et al., 2003; Kononenko et al., 2014; Soykan et al., 2017; Watanabe et al., 2013; Wu et al., 2016; Zhao et al., 2013), synaptic vesicle organization and mobilization (Guzman et al., 2019; Lee et al., 2012; Marra et al., 2012; Owe et al., 2009; Sakaba and Neher, 2003; Wolf et al., 2015), active zone organization and function (Pilo Boyl et al., 2007; Morales et al., 2000; Wagh et al., 2015; Waites et al., 2011; Wang et al., 1999), and receptor-mediated endocytosis (Kim et al., 2019; Rodal et al., 2008). Bulk analyses, which do not separate individual dynamic actin structures in space and time, are limited in their ability to discern how the regulation and dynamics of actin contribute to these distinct functions. We leveraged our ability to extract data describing individual structures to find that synaptic actin predominantly assembled into discrete Arp2/3-associated patches, and identified points of control over their dynamics. Specifically, we found that loss of endocytic proteins differentially affected the frequency and kinetics of individual actin patches, which correlate with functional deficits in endocytosis.

The link between the actin structures that we observed and endocytic events is supported by several lines of evidence: the morphology and duration of synaptic actin patches are similar to WASp/Arp2/3-dependent endocytic actin dynamics in yeast (16 s; Berro and Pollard, 2014) and somewhat briefer than in cultured mammalian cells (~40 s; Grassart et al., 2014Merrifield et al., 2004; Taylor et al., 2011). Given the measured time constant for endocytosis (~14 s; Poskanzer et al., 2006) and clathrin dependence of vesicle cycling in this synapse (Heerssen et al., 2008), these values support the hypothesis that synaptic actin patches are likely sites of clathrin-mediated endocytosis. Further, the frequency of patch assembly, which we measured in resting synapses, approaches the rate of spontaneous synaptic vesicle release at this synapse (Figure 1—figure supplement 1B, Figure 1—figure supplement 2A) (~5–6/10 μm2/min; Melom et al., 2013; Akbergenova et al., 2018). Further, actin patches colocalize partially with endocytic adaptors, and their assembly is sensitive to disruption of endocytosis (Figure 7). Finally, we found that the same endocytic proteins and protein interactions that regulate endocytosis at this synapse also alter the dynamics of actin patches.

Technical challenges due to the high density of endocytic proteins and synaptic vesicle cargoes, and the difficulty of conducting sparse single vesicle measurements at this synapse (compared to neurons in culture; Chanaday and Kavalali, 2018; Peng et al., 2012), make it difficult to directly link the dynamics of actin structures to specific membrane or cargo internalization events. However, the frequency of the events captured by our approach makes it unlikely that they represent rare F-actin-dependent events at this synapse, such as those that control macropinocytosis or new bouton growth (Khuong et al., 2010; Kim et al., 2019; Piccioli and Littleton, 2014), and more likely that they represent bona fide endocytic events. Thus, while we do not rule out other biological functions for a subset of patches, together our data indicate that a significant and measurable fraction of synaptic actin patches are associated with endocytosis.

Autoinhibition clamps PAZ membrane-remodeling machinery at synapses

Many endocytic proteins accumulate across broad membrane domains at the Drosophila NMJ and other synapses (Gerth et al., 2017; Guichet et al., 2002; Koh et al., 2007; Roos and Kelly, 1998; Verstreken et al., 2008, Verstreken et al., 2003). Our data indicate that much of this membrane-remodeling machinery is likely held in an inactive state at the presynaptic membrane: Nwk and Dap160 accumulate in a micron-scale membrane domain (Figure 2), and their loss increases the frequency of short-lived actin patches (Figure 6). These data suggest that these PAZ proteins are held in a partially autoinhibited state at the membrane in vivo, consistent with our prior in vitro observations (Stanishneva-Konovalova et al., 2016). This is further consistent with the broad distribution of Clc and AP2 to the membrane (Figure 7, Figure 7—figure supplement 1). Given the comparatively low rate of endocytosis expected at rest at this synapse, this suggests that most Clc and AP2 puncta at the synapse are either not stabilized to form productive endocytic sites (Aguet et al., 2013) or associated with some non-endocytic functions (Gimber et al., 2015).

The fact that loss of Nwk increases the frequency of patches while decreasing FM uptake suggests that the actin structures assembled in the nwk mutant are unproductive for synaptic vesicle endocytosis. These spurious patches could reflect non-specific actin assembly, perhaps due to unmasking of the Nwk ligand PI(4,5)P2 at the membrane and/or inappropriate activation of alternative WASp-dependent actin assembly pathways. Indeed, additional WASp activators such as Snx9 and Cip4/Toca-1 may play accessory roles in endocytic actin assembly (Almeida-Souza et al., 2018; Gallop et al., 2013), consistent with our finding that loss of presynaptic WASp leads to a decrease in the total number of patches (Figure 1G–I, Figure 1—figure supplement 1C–E). Our data indicate that at the synapse, where endocytic machinery accumulates at high concentrations (Wilhelm et al., 2014) and recruitment appears uncoupled from activation, these layers of autoregulation are critical to constrain actin assembly generally.

Our findings on autoinhibition and clamping connect two prevailing models of the organization and function of the synaptic endocytosis machinery—preassembly and delivery. In the first model, preassembly of clathrin and accessory proteins is hypothesized to ensure fast endocytosis in response to synaptic vesicle fusion (Hua et al., 2011; Mueller et al., 2004; Wienisch and Klingauf, 2006). Here, Nwk autoinhibition provides a mechanism to assemble an inactive, yet poised endocytic apparatus. In the second model, endocytic machinery associates with the synaptic vesicle pool, providing a ready source or buffer of proteins that can be released to the plasma membrane upon calcium signaling or vesicle fusion (Bai et al., 2010; Denker et al., 2011; Gerth et al., 2017; Winther et al., 2015). Because Dap160/intersectin can shuttle between the synaptic vesicle pool and the plasma membrane, is itself subject to autoregulation (Gerth et al., 2017), and can regulate other endocytic proteins (e.g., dynamin, Nwk), it could serve as a single activator that couples the preassembly and delivery models.

Coordinated relief of autoinhibition directs membrane-associated actin dynamics

Our in vitro data show that beyond functioning as a clamp, Nwk and Dap160 collaboratively activate WASp to promote robust actin assembly. Together with the defects we observed in vivo for actin dynamics and FM dye uptake, these data suggest that Dap160-Nwk-WASp interactions could serve as a coincidence detection mechanism to relieve autoinhibition of Nwk and promote productive actin assembly with other WASp activators. Coincidence detection has been demonstrated in several systems to control membrane-associated actin assembly (Case et al., 2019; Sun et al., 2017), suggesting that amplification of WASp membrane binding could drive robust actin patch assembly at synapses. Similarly, in human cells, the interaction between FCHSD2, intersectin, and WASp promotes actin assembly and endocytic maturation (Almeida-Souza et al., 2018) or initiation (Xiao et al., 2018). The Dap160-Nwk module could act by directing and/or organizing actin assembly specifically at endocytic events, akin to the membrane-directed actin assembly we observed in vitro (Figure 5D), and/or ensure that it is sufficiently robust for productive membrane remodeling (Akamatsu et al., 2020). Direct support for these models will require new analytical or imaging approaches to directly visualize the coupling of membranes and actin to the endocytic machinery, in order to distinguish spurious (due to unclamping) vs bona fide but underpowered endocytic actin assembly events.

Physiological implications of autoregulatory mechanisms in the periactive zone

Our data suggest that the endocytic machinery can be deployed as clamped, primed, or activated complexes at different locations at the synapse. The next critical step will be to determine the mechanisms that control switching between these states. Many potential mechanisms that link calcium-dependent exocytosis and endocytosis could activate actin assembly. These include direct effects of calcium on the endocytic machinery (Maritzen and Haucke, 2018), the accumulation of synaptic vesicle cargoes (Cousin, 2017), stoichiometry-dependent changes in protein interactions or activities (Case et al., 2019), changes in membrane mechanics (Anantharam et al., 2010; Dai et al., 1997; Roux et al., 2010), and changes in membrane charge/mode of membrane binding (Kelley et al., 2015). One intriguing possibility is that these mechanisms might enable an endocytic PAZ to rapidly switch between different modes of endocytosis (e.g., ultrafast, conventional, or bulk) in response to a wide range of synaptic activity patterns (Gan and Watanabe, 2018). These endocytic regulatory mechanisms could also be locally poised to regulate, respond, or adapt to the specific release properties of nearby active zones (Akbergenova et al., 2018; Melom et al., 2013Dickman et al., 2006), and serve as novel points of control over synaptic plasticity and homeostasis.

Materials and methods

Key resources table.

Reagent type
(species) or
resource
Designation Source or
reference
Identifiers Additional
information
Gene (Drosophila melanogaster) nwk GenBank FLYB: FBgn0263456
Gene (D. melanogaster) dap160 GenBank FLYB: FBgn0023388
Gene (D. melanogaster) wsp GenBank FLYB: FBgn0024273
Gene (D. melanogaster) shi GenBank FLYB: FBgn0003392
Gene (D. melanogaster) clc GenBank FLYB: FBgn0024814
Gene (D. melanogaster) AP-2α GenBank FLYB: FBgn0264855
Genetic reagent (D. melanogaster) AP2α::GFP This study Maintained in Kaksonen Lab -
see 'Methods' for description
Genetic reagent (D. melanogaster) w; UAS-WASp::TEV-Myc IIB (chromosome II insertion) This study Maintained in Rodal Lab -
see 'Methods' for description
Genetic reagent (D. melanogaster) w; UAS-GFP::Moesin Actin Binding Domain (GMA) Bloomington Drosophila Stock Center BDSC:31776; FLYB: FBti0131132; RRID:BDSC_31777 FlyBase symbol: P{UAS-GMA}3
Genetic reagent (D. melanogaster) w; UAS-Lifeact::Ruby Bloomington Drosophila Stock Center BDSC:35545; FLYB: FBst0035545; RRID:BDSC_35545 FlyBase symbol: P{UAS-Lifeact-Ruby}VIE-19A
Genetic reagent (D. melanogaster) w; UAS-Arp3::GFP Bloomington Drosophila Stock Center BDSC: 39722; FLYB: FBst0039722; RRID:BDSC_39722 FlyBase symbol: P{w[+mC]=UASp-Arp3.GFP}3
Genetic reagent (D. melanogaster) w; e1, wsp1/TM6b,Tb Bloomington Drosophila Stock Center BDSC: 51657; FLYB: FBst0051657; RRID:BDSC_51657 FlyBase symbol: e[1] WASp[1]
Genetic reagent (D. melanogaster) w; UAS-GFP::actin Bloomington Drosophila Stock Center BDSC: 9258; FLYB: FBst0009258; RRID:BDSC_9258 FlyBase symbol: P{w[+mC]=UASp-GFP.Act5C}2-1
Genetic reagent (D. melanogaster) yv; P{TRiP.HMC03360}attP40 - Wasp RNAi Bloomington Drosophila Stock Center BDSC: 51802; FLYB: FBst0051802; RRID:BDSC_51802 FlyBase symbol: P{y[+t7.7] v[+t1.8]=TRiP.HMC03360}attP40
Genetic reagent (D. melanogaster) yw; UAS-luciferase RNAi Bloomington Drosophila Stock Center BDSC: 31603; FLYB: FBst0031603; RRID:BDSC_31603 FlyBase symbol: P{y[+t7.7] v[+t1.8]=TRiP.JF01355}attP2
Genetic reagent (D. melanogaster) w; UAS-Dap160ΔSH3D::mCherry VK00027 This study Maintained in Rodal Lab -
see 'Methods' for description
Genetic reagent (D. melanogaster) w; UAS-Dap160ΔSH3CD::mCherry VK00027 This study Maintained in Rodal Lab - see 'Methods' for description
Genetic reagent (D. melanogaster) w; UAS-Dap160FL::mCherry VK00027 This study Maintained in Rodal Lab -
see 'Methods' for description
Genetic reagent (D. melanogaster) yw; UAS-Dap160-RNAi Bloomington Drosophila Stock Center BDSC: 25879; FLYB: FBst0025879; RRID:BDSC_25879 FlyBase symbol: P{y[+t7.7] v[+t1.8]=TRiP.JF01918}attP2
Genetic reagent (D. melanogaster) yw; Mi{PT-GFSTF.1}nwkMI05435-GFSTF.1 Bloomington Drosophila Stock Center BDSC: 64445; FLYB: FBst0064445; RRID:BDSC_64445 FlyBase symbol: Mi{PT-GFSTF.1}nwk[MI05435-GFSTF.1]
Genetic reagent (D. melanogaster) w; nwk2,h Coyle et al., 2004 FLYB: FBal0154818 FlyBase symbol: nwk[2]
Genetic reagent (D. melanogaster) w; nwk1 Bloomington Drosophila Stock Center BDSC: 51626; FLYB: FBst0051626; RRID:BDSC_51626 FlyBase symbol: nwk[1]
Genetic reagent (D. melanogaster) w; dap160Δ1 Bloomington Drosophila Stock Center BDSC: 24877; FLYB: FBst0024877; RRID:BDSC_24877 FlyBase symbol: Dap160[Delta1]
Genetic reagent (D. melanogaster) w; Df(2L)Exel6047, P{XP-U}Exel6047/CyOGFP (Dap160Df) Bloomington Drosophila Stock Center BDSC: 7529; FLYB: FBst0007529; RRID:BDSC_7529 FlyBase symbol: Df(2L)Exel6047, P{w[+mC]=XP-U}Exel6047
Genetic reagent (D. melanogaster) dvglut(X)-GAL4 Daniels et al., 2008 FLYB: FBti0129146 FlyBase symbol: P{VGlut-GAL4.D}NMJX
Genetic reagent (D. melanogaster) elavc155-GAL4 Bloomington Drosophila Stock Center BDSC: 458; FLYB: FBst0000458; RRID:BDSC_458 FlyBase symbol: P{w[+mW.hs]=GawB}elav[C155]
Genetic reagent (D. melanogaster) UAS-Dcr2 Bloomington Drosophila Stock Center BDSC: 24646; FLYB: FBst0024646; RRID:BDSC_24646 FlyBase symbol: P{w[+mC]=UAS-Dcr-2.D}1
Genetic reagent (D. melanogaster) CD8-mCherry Bloomington Drosophila Stock Center BDSC:32218; FLYB: FBst0032218; RRID:BDSC_32218 FlyBase symbol: P{y[+t7.7] w[+mC]=10XUAS-IVS-mCD8::RFP}attP2
Antibody Rabbit α-Nwk
Polyclonal
Coyle 2004 #970
RRID:AB_2567353
IF(1:1000), WB (1:1000)
Antibody Mouse α-Brp
Monoclonal
DSHB RRID:AB_2314866 IF(1:100)
Antibody Mouse α-Myc
Monoclonal
DSHB RRID:AB_2266850 IF(1:50)
Antibody Rabbit α-Dap160
Polyclonal
Davis/Kelly RRID:AB_2569367 IF(1:1000)
Antibody Mouse α-Xpress
Monoclonal
ThermoFisher RRID:AB_2556552 WB(1:1000)
Antibody Mouse α-Tubulin
Monoclonal
Sigma RRID:AB_477579 WB(1:1000)
Antibody α-HRP
Polyclonal
Jackson ImmunoResearch RRID:AB_2338967 IF(1:500)
Recombinant DNA reagent His-Nwk607-731 Kelley et al., 2015
Recombinant DNA reagent GST Kelley et al., 2015
Recombinant DNA reagent 6His-Dap160SH3C This study Maintained in Rodal Lab -
see 'Methods' for description
Recombinant DNA reagent 6His-Dap160SH3D This study Maintained in Rodal Lab -
see 'Methods' for description
Recombinant DNA reagent 6His-Dap160SH3CD This study Maintained in Rodal Lab -
see 'Methods' for description
Recombinant DNA reagent GST-Dap160SH3C This study Maintained in Rodal Lab -
see 'Methods' for description
Recombinant DNA reagent GST-Dap160SH3D This study Maintained in Rodal Lab -
see 'Methods' for description
Recombinant DNA reagent GST-Dap160SH3CD This study Maintained in Rodal Lab -
see 'Methods' for description
Recombinant DNA reagent His-Nwk1-428 Becalska et al., 2013
Recombinant DNA reagent His-Nwk1-633 Kelley et al., 2015
Recombinant DNA reagent His-Nwk1-731 Kelley et al., 2015
Recombinant DNA reagent His-WASp1-143 Rodal et al., 2008
Recombinant DNA reagent His-SNAP-Nwk1-731 Kelley et al., 2015
Recombinant DNA reagent His-SNAP-Nwk1-633 This study Maintained in Rodal Lab -
see 'Methods' for description
Recombinant DNA reagent His-SNAP-Dap160SH3CD This study Maintained in Rodal Lab -
see 'Methods' for description
Sequence-based reagent UAS-Dap160SH3ΔCD-FWD This paper PCR primers ATGAACTCGGCGGTGGATGCGTGG
Sequence-based reagent UAS-Dap160SH3ΔCD-REV This paper PCR primers CCACATCAGCCTTTTGGACAT
Sequence-based reagent UAS-Dap160SH3ΔD-FWD This paper PCR primers ATGAACTCGGCGGTGGATGCGTGG
Sequence-based reagent UAS-Dap160SH3ΔD-REV This paper PCR primers GAGAACCTTCACGTAAGTGGC
Sequence-based reagent UAS-Dap160SH3FL-FWD This paper PCR primers ATGAACTCGGCGGTGGATGCGTGG
Sequence-based reagent UAS-Dap160SH3FL-REV This paper PCR primers TCTTCTTGGTGGTGCCATTTG
Sequence-based reagent His/GST-Dap160SH3C-FWD This paper PCR primers GGAATGCGTGCCAAGCGG
Sequence-based reagent His/GST-Dap160SH3C-REV This paper PCR primers TTGGAGAACCTTCACGTAAGTGG
Sequence-based reagent His/GST-Dap160SH3CD-FWD This paper PCR primers GGAATGCGTGCCAAGCGG
Sequence-based reagent His/GST-Dap160SH3CD-REV This paper PCR primers TCACTTCTTGGTGGTGCCATTTGC
Sequence-based reagent His/GST-Dap160SH3D-FWD This paper PCR primers CAAGGTCATTGCTCTCTATCCG
Sequence-based reagent His/GST-Dap160SH3D-REV This paper PCR primers TCACTTCTTGGTGGTGCCATTTGC
Sequence-based reagent His/GST-Dap160SH3ABCD-FWD This paper PCR primers CACAGGCTCTTCCAGTGCTTGG
Sequence-based reagent His/GST-Dap160SH3ABCD-REV This paper PCR primers TCACTTCTTGGTGGTGCCATTTGC
Peptide, recombinant protein Arp2/3 Complex Cytoskeleton, Inc RP01-P
Biological sample
(Oryctolagus cuniculus)
Rabbit Muscle Pel-Freez 41225 -2
Software, algorithm Prism Graphpad RRID:SCR_002798
Software, algorithm FIJI FIJI RRID:SCR_002285
Other DOPC Echelon 1182
Other DOPS Avanti 840035C
Other PI(4,5)P2 Avanti 840046X
Other TopFluor-PE Avanti 810282C
Other DOPE Echelon 2182
Other FM1-43FX ThermoFisher F35355
Other FM4-64FX ThermoFisher F34653

Resource availability

Lead contact

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Avital Rodal (arodal@brandeis.edu).

Material availability

All plasmids and fly lines generated in these studies are available upon request.

Experimental model

Drosophila culture

Flies were cultured using standard media and techniques. All flies were raised at 25°C, with the exception of experiments using Dcr2; Dap160 RNAi or WASp RNAi, for which flies were raised at 29°C. See 'Key resources' table for all fly lines used and see Supplementary file 1 for full genotypes for each experiment in this study.

Methods

Cloning

UAS-Dap160 constructs were generated in pBI-UASC-mCherry (derived from Wang et al., 2011; see Deshpande et al., 2016). Fragments were amplified from the genomic Dap160 locus with primers described in the 'Key resources' table. These transgenes were injected into flies (Rainbow Gene), using ΦC31-mediated integration at the VK00027 locus (Venken et al., 2006), to ensure that all constructs were in a similar genomic context. UAS-WASp-tev-myc was generated in pUAST (Brand and Perrimon, 1993) by inserting a Tobacco Etch Virus protease recognition site and nine copies of the myc epitope tag at the 3’ end of the Wsp cDNA, and injected into w1118 flies at the Duke Model Systems Transgenic Facility (Duke University, Durham, NC).

Generation of AP2α::GFPKI

The vector pHD-sfGFP-dsRed was created using Gibson assembly by amplifying sfGFP from pScarlessHD-sfGFP-DsRed (gift from Kate O'Connor-Giles, Addgene plasmid # 80811) and inserting it in between the multiple cloning site and the first loxP site in the pHD-DsRed backbone (gift from Kate O'Connor-Giles, Addgene plasmid # 51434). 1 kb sequences upstream and downstream of the stop codon were amplified from the genomic locus of AP2α and inserted into pHD-sfGFP-dsRed using AarI and SapI, respectively, to create the HDR donor pMM007_pHD-AP2a-C-sfGFP-dsRed. The guide RNA GGAAATCTGCGATCTGTTGA was cloned into pU6-BbsI-chiRNA (gift from Melissa Harrison, Kate O'Connor-Giles, and Jill Wildonger, Addgene plasmid # 45946; Gratz et al., 2013) using BbsI to create pMM008_pU6-AP2a-chiRNA. 500 ng/ul HDR donor plasmid and 100 ng/ul gRNA plasmid were injected into vas-Cas9(III) flies (BDSC 51324, injections by BestGene). Correct integration of the transgene was validated by sequencing.

FM dye uptake

FM dye (FM1-43 in dap160 experiments or FM4-64FX in nwk experiments) uptake experiments were performed essentially as described (Ramachandran and Budnik, 2010; Verstreken et al., 2008). For fixed experiments (nwk mutants), larvae were dissected in groups of four to six (with each dish having at least two control larvae) in low-calcium HL3 (Stewart et al., 1994), and axons were cut to dissociate central nervous system input. For live imaging (dap160 rescues), larvae were dissected, stained, and imaged in pairs, with one control (Dap160FL) and one experimental larva per dish. This temperature has been shown to exacerbate endocytic defects in some mutants, including dap160 (Koh et al., 2004). Following extensive washing in Ca++-free saline, larvae were fixed in 4% paraformaldehyde in Ca++-free saline (for nwk experiments) or imaged live (for dap160 transgene rescue experiments). Images of muscle 6/7 NMJs (abdominal segments 3–5) were acquired by confocal microscopy and FM dye intensity was measured within mCherry (in dap160 experiments) or GFP (in nwk experiments)-labeled presynaptic masks, and intensities were normalized to dish-matched control larvae. For unloading experiments, larvae were analyzed individually. In all experiments, dye loading (4 μM) was performed in 90 mM KCl, 2 mM CaCl2 HL3 saline for 5 min at 36°C on a submerged metal block using prewarmed buffer. For unloading, larvae were stimulated for an additional 5 min with 90 mM KCl, 2 mM CaCl2, washed extensively in Ca++-free HL3, then imaged and analyzed as for fixed larvae.

Immunohistochemistry

For analysis of NMJ morphology and protein localization, flies were cultured at a low density at 25°C. Wandering third-instar larvae were dissected in calcium-free HL3.1 saline (Feng et al., 2004) and fixed for 30 min in HL3.1 containing 4% formaldehyde. For analysis of NMJ overgrowth (satellite boutons), samples were stained with α-HRP and α-Dlg (4F3) antibodies, and images were blinded before manual bouton counting. Boutons were counted on muscle 4 NMJs, abdominal segments 2–4, and satellite boutons were defined as any string of fewer than five boutons that branched from the main NMJ branch (O'Connor-Giles et al., 2008).

Western blots

Drosophila heads (10 pooled heads/genotype) were homogenized in 100 µl 2x Laemmli buffer. 10 ul of extract per lane was fractionated by sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotted with α-Dap160 (Roos and Kelly, 1998) and α-tubulin antibodies (clone B-5-1-2; Sigma), and infrared-conjugated secondary antibodies (Rockland, Inc). Blots were analyzed on a Biorad Chemidoc system.

Imaging and analysis

Spinning disc confocal imaging of Drosophila larvae was performed at room temperature (except shiTS1 experiments) on a Nikon Ni-E upright microscope equipped with 60x (NA 1.4) and 100x (NA 1.45) oil-immersion objectives, a Yokogawa CSU-W1 spinning disc head, and an Andor iXon 897U EMCCD camera. Images were collected using Nikon Elements AR software. For shiTS1 GFP::actin imaging experiments, temperature was controlled using a CherryTemp temperature control unit (Cherry Biotech).

FRAP data (Figure 5E) were acquired on a Zeiss 880 microscope with Airyscan in super resolution acquisition mode, using a x63 NA 1.4 objective. Single Z-slices through the middle of individual boutons were acquired at 4 Hz for 90 s, with manual focus adjustment. Following acquisition of two or three initial Z-stacks to assess prebleach intensity, <20% of individual boutons were photobleached by the 488 laser at60% intensity and a scan speed of 6. Intensities of background, unbleached, and bleached ROIs were acquired manually using FIJI, and bleached area was normalized to prebleach and unbleached ROIs (to correct for imaging-induced photobleaching), and analyzed with GraphPad Prism.

Confocal imaging of GUVs and cell-sized water droplets was conducted at room temperature on a Marianas spinning disc confocal system (3I, Inc, Denver, CO), consisting of a Zeiss Observer Z1 microscope equipped with a Yokagawa CSU-X1 spinning disc confocal head, a QuantEM 512SC EMCCD camera, PLAN APOCHROMAT 63x or 100x oil-immersion objectives (NA 1.4), a Photonics Instruments Micropoint photo-ablation device, and Slidebook software.

3D-SIM was performed on a Nikon N-SIM E system (consisting of an inverted Eclipse Ti-E microscope, 100x (NA 1.45) oil-immersion objective, and a Hamamatsu OrcaFLASH4 sCMOS camera). Channel alignment was calculated for each imaging session using tetraspeck beads (Invitrogen, cat no. T-7284). Images were collected at room temperature with a regime of three grid orientations and five phases and were reconstructed using Nikon Elements software, using a theoretical, ideal optical transfer function generated by the software. Super-resolution images of protein localization in live samples were acquired with a Zeiss 880FAS microscope in fast Airyscan mode with a 63x (NA 1.4) oil-immersion objective, using Zen Blue software.

Analysis of actin dynamics at the NMJ

Spinning disc confocal time series were acquired at 15 stacks/min (Figure 1), 60 stacks/min (Figure 6, Figure 7E), or 2.2 stacks/min (Figure 7A). A maximum intensity projection was made of each time point, videos were registered using the FIJI plugin StackReg, and analyzed by Patchtracker, based on Trackmate (Berro and Pollard, 2014) as follows. First, we qualitatively evaluated the optimal intensity threshold for patch detection by identifying the maximum threshold intensity at which all obvious patch structures were detected in the first frame of videos. This process was performed independently by three independent observers over multiple datasets. The threshold for patch detection was normalized to the mean probe intensity in the presynaptic area (threshold = Probe Mean * 0.32). All other settings for patch detection and tracking were default: estimated patch diameter = 0.6 μm, median filter = false, subpixel detection = true, linking max distance = 0.5 μm, gap-closing distance = 0.5 μm, gap-closing frame gap = 0. For 0.25 Hz imaging experiments, patches between 16 and 356 s could be detected. For 1 Hz imaging experiments, patches between 4 and 139 s could be detected. Because this analysis rejects a significant number of detected patches due to tracking defects or tracking path overlap, we estimated the true patch frequency as follows. We combined detections from 0.25 Hz and 1 Hz imaging experiments by averaging the frequencies over the shared detection range (20–150 s) and adding the lower and higher duration patches that were specific to each imaging regime (4–16 s for 1 Hz and 150–360 s for 0.25 Hz). Then we ‘corrected’ for rejected tracks and considered the lower bound of the estimate to be the actual, corrected merged frequency of detection (2.8 patches/10 μm/min) and the upper bound to include every rejected track (10.3 patches/10 μm/min).

We further validated our patch dynamics analysis by measuring patch frequencies at a wide range of patch intensity thresholds and track linking distances. For both 0.25 Hz WASp (Figure 1—figure supplement 2) and 1 Hz Nwk (Figure 6—figure supplement 2) datasets, we found measurements of control patch frequencies to be robust to these parameters and in strong agreement with the estimates described above across the entire parameter space tested (1.1–8.4 for 0.25 Hz imaging, 1.2–7.9 for 1 Hz imaging). Further, our phenotypic analyses (decreased patch frequency in WASp mutants and increased frequency in Nwk mutants) were also both highly robust to tracking parameters.

Actin dynamics were also analyzed by measuring intensity variation over time over the entire NMJ, that is, without thresholding or particle tracking. We measured this by extracting the intensity value for each pixel over time and calculating the CoV (Std Dev/Mean) for each pixel. We estimated the percentage of ‘highly variant’ pixels by thresholding these values using Li (Li and Tam, 1998) and Moments (Tsai, 1995) algorithms. While these two algorithms gave different estimates of the fraction of NMJs covered by highly variant pixels, both indicated the same relationship between genotypes. To validate this approach, we created synthetic data using a custom FIJI script, with a spatial and temporal scale that matched our in vivo imaging, and in which we varied parameters expected to impact this metric (signal intensity, noise level, fraction of dynamic pixels, dynamics frequency, dynamics duration, dynamics amplitude), and subjected the synthetic data to the same CoV over time analysis.

Intensity and colocalization analysis

For intensity and colocalization, the presynaptic region was masked in 3D using a presynaptically enriched label: either HRP (Figure 3—figure supplement 2D), Nwk (Figure 2A, Figure 2C), Dap160 (Figure 2E, Figure 3D–E, Figure 3—figure supplement 2B–C), or Lifeact::Ruby (Figure 1E, Figure 7C. Figure 7—figure supplement 1C). For mask generation, images were subjected to a gaussian blur filter and thresholded by intensity. Blur radius and the specific threshold algorithms used were empirically optimized for each experiment to consistently and accurately reflect the presynaptic area in control and mutant groups (and the same settings were used for all NMJs within any given experiment). Signal intensities were measured in 3D using a FIJI script, and colocalization analysis was performed in 3D on Airyscan or SIM reconstructed image stacks using the Coloc2 plugin for ImageJ (https://imagej.net/Coloc_2). For all images, background was subtracted using the rolling ball method with a radius of 50 pixels.

In vitro assays

Protein purification

His-Dap160 fragments were amplified from Dap160 isoform A and cloned into pTrcHisA (see 'Key resources' table for primer details). N-terminally His-Xpress–tagged proteins (Nwk1-633, Nwk1-731, Nwk607-731, Nwk1-428, Wsp143-529, Dap160SH3C, Dap160SH3CD) were purified as described previously (Becalska et al., 2013; Kelley et al., 2015; Rodal et al., 2008; Stanishneva-Konovalova et al., 2016). In brief, proteins were purified from BL21(DE3) Escherichia coli using cobalt or nickel columns, followed by ion exchange and gel filtration into 20 mM Tris, pH 7.5, 50 mM KCl, 0.1 mM ethylenediaminetetraacetic acid, and 0.5 mM dithiothreitol (DTT). GST fusions (Dap160SH3CD, Dap160SH3C, Dap160SH3D) were amplified from Dap160 isoform A and cloned into pGEX4t (see 'Key resources' table for primer details). Proteins were purified with glutathione agarose (Thermo Scientific, Waltham, MA) in 20 mM Tris 7.5, 20 mM KCl, and 0.5 mM DTT supplemented with protease inhibitors (P2714 [Sigma-Aldrich, St Louis, MO] and 0.5 mg/ml pepstatin A). Arp2/3 complex was purchased from Cytoskeleton, Inc. Actin was purified from acetone powder (Spudich and Watt, 1971) generated from frozen ground hind leg muscle tissue of young rabbits (PelFreez, Rogers, AR).

Coprecipitation assays

Coprecipitation with GST-tagged proteins was conducted as described previously (Kelley et al., 2015). Concentrations of GST fusions on beads were normalized using empty beads and bead volume was restricted to two-thirds of the total reaction volume. GST fusions were incubated by agitation with His-tagged target proteins at room temperature for 1 hr in binding buffer (20 mM Tris, pH 8.0, 20 mM KCl, 0.5 mM DTT). For salt sensitivity experiments, the indicated concentrations of NaCl were used in place of KCl in the binding buffer. Beads were then pelleted and washed once with buffer after removing the supernatant. Pellets and supernatants were then boiled in Laemmli sample buffer and fractionated by SDS-PAGE, followed by Coomassie staining or immunoblotting as noted in figure legends, followed by imaging and analysis on a LICOR Odyssey device.

Liposome cosedimentation

Lipid cosedimentation assays were conducted as described previously (Becalska et al., 2013). In brief, liposomes were swelled from dried lipid films in 20 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.5, and 100 mM NaCl. Specific lipid compositions are indicated in the figure legends. Proteins were then mixed with 1 mg/ml liposomes, incubated for 30 min at room temperature, and then pelleted for 20 min at 18,000 ×g at 4°C. Pellets and supernatants were then denatured in Laemmli sample buffer and fractionated by SDS-PAGE, followed by Coomassie staining, and imaging and analysis conducted on a LICOR Odyssey device.

GUV decoration

GUVs were generated by gentle hydration. Briefly, 10 µl of 10 mg/ml lipids dissolved in 19:1 chloroform:methanol were dried under vacuum, and then swelled in 300 µl of 5 mM HEPES 300 mM sucrose, pH 7.5, overnight at 70°C. GUVs were imaged on a Marianas spinning disc confocal system (see above). 3 µl GUVs were diluted into 5 mM HEPES 150 mM KCl, pH7.5, incubated with protein as noted in figures, and imaged using a x100/NA 1.4 objective in multiwell slides (Lab-Tek) precoated with 1 mg/ml bovine serum albumin. After 30 min of incubation, 1% agarose in 5 mM HEPES 150 mM KCl, pH 7.5, was added (final agarose concentration, 0.5%) to limit GUV mobility. Images were analyzed by line tracing intensity profiles across a medial optical section of GUVs.

Actin assembly in droplets

Lipids (97.5% DPHPC [1,2-diphytanoyl-sn-glycero-3-phosphocholine] [Avanti Polar Lipids] and 2.5% DPHPC:PI(4,5)P2) were mixed in chloroform, dried under vacuum, and rehydrated to 23 mM (20 mg/ml) in decane. The indicated proteins were added to the lipid mix at 1:50 vol ratio and pipetted vigorously until cloudy before imaging by spinning disc confocal microscopy.

Pyrene-actin assembly

Rabbit muscle actin [5% (mol/mol) pyrene-labeled] was gel-filtered, prespun at 90,000 xg, exchanged from Ca2+ to Mg2+, and assembled at a final concentration of 2.5 µM as described previously (Moseley et al., 2006). Proteins were preincubated with 74 µg/ml liposomes or control buffer for 30 min before actin assembly reactions. Assembly was monitored with a spectrofluorometer (Photon Technology International) using an excitation wavelength of 365 nm and an emission wavelength of 407 nm. Rates were calculated from slopes of curves in the linear range, and curves were plotted using GraphPad Prism software.

Quantification and statistical analysis

Graphs were prepared and statistical analyses performed using Graphpad Prism software. For normally distributed data, comparisons were made using either t-test or analysis of variance with posthoc Bonferroni’s multiple comparisons test. For non-normally distributed data, comparisons were made using either Mann-Whitney U test or Kruskal-Wallis test with posthoc Dunn’s test. No specific power analyses were performed; sample sizes were chosen based on established protocols and statistical analyses for significance, as detailed for all experiments here and in Supplementary file 1. Comparison of patch-duration distributions was performed using a Kolmogorov-Smirnoff test. Please see Supplementary file 1 for each statistical test performed for each experiment presented in this study. All data are shown as the mean ± sem. Statistical significance denoted in all graphs *p<0.05, **p<0.01, ***p<0.001.

Acknowledgements

The authors would like to thank Bruce Goode for actin reagents and advice, Julien Berro for particle tracking advice, Troy Littleton and Oleg Shupliakov for helpful discussions, Graeme Davis for anti-Dap160 antibody, and the Bloomington Drosophila Stock Center (Indiana University, Bloomington, IN, NIH P40OD018537) for providing fly stocks. This work was supported by a Basil O’Connor Scholar Award from the March of Dimes and a Pew Scholar award (AAR); by R01 NS116375 (AAR and TGF); by the Brandeis NSF MRSEC, Bioinspired Soft Materials (NSF-DMR 2011846); by T32 NS007292 (SJD), T32 GM007122 (CFK), and R90 DA03243501 (MFM); and by the Swiss National Science Foundation (grant 310030B_182825) and NCCR Chemical Biology funded by the SNSF (MK, MM).

Funding Statement

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Contributor Information

Steven J Del Signore, Email: sdelsig@gmail.com.

Avital Adah Rodal, Email: arodal@brandeis.edu.

Suzanne R Pfeffer, Stanford University School of Medicine, United States.

Suzanne R Pfeffer, Stanford University School of Medicine, United States.

Funding Information

This paper was supported by the following grants:

  • March of Dimes Foundation to Avital Adah Rodal.

  • Pew Charitable Trusts to Avital Adah Rodal.

  • National Institutes of Health NS116375 to Thomas G Fai, Avital Adah Rodal.

  • National Science Foundation NSF-DMR 2011846 to Steven J Del Signore, Thomas G Fai, Avital Adah Rodal.

  • National Institutes of Health GM007122 to Charlotte F Kelley.

  • National Institutes of Health NS007292 to Steven J Del Signore.

  • National Institutes of Health DA032435 to Michelle F Marchan.

  • Swiss National Science Foundation 310030B_182825 to Markus Mund, Marko Kaksonen.

  • Swiss National Science Foundation NCCR Chemical Biology to Markus Mund, Marko Kaksonen.

Additional information

Competing interests

No competing interests declared.

Author contributions

Conceptualization, Data curation, Software, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing.

Conceptualization, Resources, Data curation, Formal analysis, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing.

Conceptualization, Resources, Formal analysis, Investigation, Methodology.

Investigation.

Investigation.

Investigation, Writing - review and editing.

Resources, Writing - review and editing.

Methodology.

Resources, Supervision, Funding acquisition.

Conceptualization, Data curation, Supervision, Funding acquisition, Validation, Visualization, Methodology, Writing - original draft, Project administration, Writing - review and editing.

Additional files

Source code 1. This file contains the code used in this manuscript as follows.

Code used to generate toy data analyzed in Figure 6—figure supplement 2. Code used to analyze toy data analyzed in Figure 6—figure supplement 2. Code used to analyze channel intensity and distribution for Figure 1—figure supplement 1F, Figure 3D, Figure 3—figure supplement 2B-D, Figure 7F–I, Figure 7—figure supplement 3. Code used to analyze channel colocalization in 3D for Figure 1F, Figure 2D,F, Figure 3E, Figure 7C, Figure 7—figure supplement 1C.

elife-69597-code1.zip (19KB, zip)
Supplementary file 1. Summary of genotypes and statistics for all experiments in this study.
elife-69597-supp1.docx (23.6KB, docx)
Transparent reporting form

Data availability

Source data files and source code have been provided for all figures accompanying this manuscript.

References

  1. Aguet F, Antonescu CN, Mettlen M, Schmid SL, Danuser G. Advances in analysis of low signal-to-noise images link dynamin and AP2 to the functions of an endocytic checkpoint. Developmental Cell. 2013;26:279–291. doi: 10.1016/j.devcel.2013.06.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Akamatsu M, Vasan R, Serwas D, Ferrin MA, Rangamani P, Drubin DG. Principles of self-organization and load adaptation by the actin cytoskeleton during clathrin-mediated endocytosis. eLife. 2020;9:e49840. doi: 10.7554/eLife.49840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Akbergenova Y, Cunningham KL, Zhang YV, Weiss S, Littleton JT. Characterization of developmental and molecular factors underlying release heterogeneity at Drosophila synapses. eLife. 2018;7:e38268. doi: 10.7554/eLife.38268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Almeida-Souza L, Frank RAW, García-Nafría J, Colussi A, Gunawardana N, Johnson CM, Yu M, Howard G, Andrews B, Vallis Y, McMahon HT. A Flat BAR Protein Promotes Actin Polymerization at the Base of Clathrin-Coated Pits. Cell. 2018;174:325–337. doi: 10.1016/j.cell.2018.05.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Anantharam A, Onoa B, Edwards RH, Holz RW, Axelrod D. Localized topological changes of the plasma membrane upon exocytosis visualized by polarized TIRFM. Journal of Cell Biology. 2010;188:415–428. doi: 10.1083/jcb.200908010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bai J, Hu Z, Dittman JS, Pym EC, Kaplan JM. Endophilin functions as a membrane-bending molecule and is delivered to endocytic zones by exocytosis. Cell. 2010;143:430–441. doi: 10.1016/j.cell.2010.09.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Becalska AN, Kelley CF, Berciu C, Stanishneva-Konovalova TB, Fu X, Wang S, Sokolova OS, Nicastro D, Rodal AA. Formation of membrane ridges and scallops by the F-BAR protein nervous wreck. Molecular Biology of the Cell. 2013;24:2406–2418. doi: 10.1091/mbc.e13-05-0271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Ben-Yaacov S, Le Borgne R, Abramson I, Schweisguth F, Schejter ED. Wasp, the Drosophila Wiskott-Aldrich syndrome gene homologue, is required for cell fate decisions mediated by notch signaling. The Journal of Cell Biology. 2001;152:1–14. doi: 10.1083/jcb.152.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Berro J, Pollard TD. Local and global analysis of endocytic patch dynamics in fission yeast using a new "temporal superresolution" realignment method. Molecular Biology of the Cell. 2014;25:3501–3514. doi: 10.1091/mbc.e13-01-0004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Bloom O, Evergren E, Tomilin N, Kjaerulff O, Löw P, Brodin L, Pieribone VA, Greengard P, Shupliakov O. Colocalization of synapsin and actin during synaptic vesicle recycling. Journal of Cell Biology. 2003;161:737–747. doi: 10.1083/jcb.200212140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Brand AH, Perrimon N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 1993;118:401–415. doi: 10.1242/dev.118.2.401. [DOI] [PubMed] [Google Scholar]
  12. Case LB, Zhang X, Ditlev JA, Rosen MK. Stoichiometry controls activity of phase-separated clusters of actin signaling proteins. Science. 2019;363:1093–1097. doi: 10.1126/science.aau6313. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Chanaday NL, Kavalali ET. Optical detection of three modes of endocytosis at hippocampal synapses. eLife. 2018;7:e36097. doi: 10.7554/eLife.36097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Colicos MA, Collins BE, Sailor MJ, Goda Y. Remodeling of synaptic actin induced by photoconductive stimulation. Cell. 2001;107:605–616. doi: 10.1016/s0092-8674(01)00579-7. [DOI] [PubMed] [Google Scholar]
  15. Collins A, Warrington A, Taylor KA, Svitkina T. Structural organization of the actin cytoskeleton at sites of clathrin-mediated endocytosis. Current Biology. 2011;21:1167–1175. doi: 10.1016/j.cub.2011.05.048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Cousin MA. Integration of synaptic vesicle cargo retrieval with endocytosis at central nerve terminals. Frontiers in Cellular Neuroscience. 2017;11:234. doi: 10.3389/fncel.2017.00234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Coyle IP, Koh YH, Lee WC, Slind J, Fergestad T, Littleton JT, Ganetzky B. Nervous wreck, an SH3 adaptor protein that interacts with Wsp, regulates synaptic growth in Drosophila. Neuron. 2004;41:521–534. doi: 10.1016/s0896-6273(04)00016-9. [DOI] [PubMed] [Google Scholar]
  18. Dai J, Ting-Beall HP, Sheetz MP. The Secretion-coupled endocytosis correlates with membrane tension changes in RBL 2h3 cells. Journal of General Physiology. 1997;110:1–10. doi: 10.1085/jgp.110.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Daniels RW, Gelfand MV, Collins CA, DiAntonio A. Visualizing glutamatergic cell bodies and synapses in Drosophila larval and adult CNS. The Journal of Comparative Neurology. 2008;508:131–152. doi: 10.1002/cne.21670. [DOI] [PubMed] [Google Scholar]
  20. Denker A, Kröhnert K, Bückers J, Neher E, Rizzoli SO. The reserve pool of synaptic vesicles acts as a buffer for proteins involved in synaptic vesicle recycling. PNAS. 2011;108:17183–17188. doi: 10.1073/pnas.1112690108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Deshpande M, Feiger Z, Shilton AK, Luo CC, Silverman E, Rodal AA. Role of BMP receptor traffic in synaptic growth defects in an ALS model. Molecular Biology of the Cell. 2016;27:2898–2910. doi: 10.1091/mbc.E16-07-0519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Dickman DK, Lu Z, Meinertzhagen IA, Schwarz TL. Altered synaptic development and active zone spacing in endocytosis mutants. Current Biology. 2006;16:591–598. doi: 10.1016/j.cub.2006.02.058. [DOI] [PubMed] [Google Scholar]
  23. Dillon C, Goda Y. The actin cytoskeleton: integrating form and function at the synapse. Annual Review of Neuroscience. 2005;28:25–55. doi: 10.1146/annurev.neuro.28.061604.135757. [DOI] [PubMed] [Google Scholar]
  24. Evergren E, Gad H, Walther K, Sundborger A, Tomilin N, Shupliakov O. Intersectin is a negative regulator of dynamin recruitment to the synaptic endocytic zone in the central synapse. Journal of Neuroscience. 2007;27:379–390. doi: 10.1523/JNEUROSCI.4683-06.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Feng Y, Ueda A, Wu CF. A modified minimal hemolymph-like solution, HL3.1, for physiological recordings at the neuromuscular junctions of normal and mutant Drosophila larvae. Journal of Neurogenetics. 2004;18:377–402. doi: 10.1080/01677060490894522. [DOI] [PubMed] [Google Scholar]
  26. Gallop JL, Walrant A, Cantley LC, Kirschner MW. Phosphoinositides and membrane curvature switch the mode of actin polymerization via selective recruitment of toca-1 and Snx9. PNAS. 2013;110:7193–7198. doi: 10.1073/pnas.1305286110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Gan Q, Watanabe S. Synaptic vesicle endocytosis in different model systems. Frontiers in Cellular Neuroscience. 2018;12:171. doi: 10.3389/fncel.2018.00171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Gerth F, Jäpel M, Pechstein A, Kochlamazashvili G, Lehmann M, Puchkov D, Onofri F, Benfenati F, Nikonenko AG, Fredrich K, Shupliakov O, Maritzen T, Freund C, Haucke V. Intersectin associates with synapsin and regulates its nanoscale localization and function. PNAS. 2017;114:12057–12062. doi: 10.1073/pnas.1715341114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Gimber N, Tadeus G, Maritzen T, Schmoranzer J, Haucke V. Diffusional spread and confinement of newly exocytosed synaptic vesicle proteins. Nature Communications. 2015;6:8392. doi: 10.1038/ncomms9392. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Grassart A, Cheng AT, Hong SH, Zhang F, Zenzer N, Feng Y, Briner DM, Davis GD, Malkov D, Drubin DG. Actin and dynamin2 dynamics and interplay during clathrin-mediated endocytosis. The Journal of Cell Biology. 2014;205:721–735. doi: 10.1083/jcb.201403041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Gratz SJ, Cummings AM, Nguyen JN, Hamm DC, Donohue LK, Harrison MM, Wildonger J, O'Connor-Giles KM. Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics. 2013;194:1029–1035. doi: 10.1534/genetics.113.152710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Guerrier S, Coutinho-Budd J, Sassa T, Gresset A, Jordan NV, Chen K, Jin WL, Frost A, Polleux F. The F-BAR domain of srGAP2 induces membrane protrusions required for neuronal migration and morphogenesis. Cell. 2009;138:990–1004. doi: 10.1016/j.cell.2009.06.047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Guichet A, Wucherpfennig T, Dudu V, Etter S, Wilsch-Bräuniger M, Hellwig A, González-Gaitán M, Huttner WB, Schmidt AA. Essential role of endophilin A in synaptic vesicle budding at the Drosophila neuromuscular junction. The EMBO Journal. 2002;21:1661–1672. doi: 10.1093/emboj/21.7.1661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Guzman GA, Guzman RE, Jordan N, Hidalgo P. A Tripartite Interaction Among the Calcium Channel α1- and β-Subunits and F-Actin Increases the Readily Releasable Pool of Vesicles and Its Recovery After Depletion. Frontiers in Cellular Neuroscience. 2019;13:125. doi: 10.3389/fncel.2019.00125. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Harris KP, Littleton JT. Transmission, development, and plasticity of synapses. Genetics. 2015;201:345–375. doi: 10.1534/genetics.115.176529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Heerssen H, Fetter RD, Davis GW. Clathrin dependence of synaptic-vesicle formation at the Drosophila neuromuscular junction. Current Biology. 2008;18:401–409. doi: 10.1016/j.cub.2008.02.055. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Henne WM, Boucrot E, Meinecke M, Evergren E, Vallis Y, Mittal R, McMahon HT. FCHo proteins are nucleators of clathrin-mediated endocytosis. Science. 2010;328:1281–1284. doi: 10.1126/science.1188462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Holt M, Cooke A, Wu MM, Lagnado L. Bulk membrane retrieval in the synaptic terminal of retinal bipolar cells. The Journal of Neuroscience. 2003;23:1329–1339. doi: 10.1523/JNEUROSCI.23-04-01329.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Hua Y, Sinha R, Thiel CS, Schmidt R, Hüve J, Martens H, Hell SW, Egner A, Klingauf J. A readily retrievable pool of synaptic vesicles. Nature Neuroscience. 2011;14:833–839. doi: 10.1038/nn.2838. [DOI] [PubMed] [Google Scholar]
  40. Hussain NK, Jenna S, Glogauer M, Quinn CC, Wasiak S, Guipponi M, Antonarakis SE, Kay BK, Stossel TP, Lamarche-Vane N, McPherson PS. Endocytic protein intersectin-l regulates actin assembly via Cdc42 and N-WASP. Nature Cell Biology. 2001;3:927–932. doi: 10.1038/ncb1001-927. [DOI] [PubMed] [Google Scholar]
  41. Jäpel M, Gerth F, Sakaba T, Bacetic J, Yao L, Koo SJ, Maritzen T, Freund C, Haucke V. Intersectin-Mediated Clearance of SNARE Complexes Is Required for Fast Neurotransmission. Cell Reports. 2020;30:409–420. doi: 10.1016/j.celrep.2019.12.035. [DOI] [PubMed] [Google Scholar]
  42. Kaksonen M, Roux A. Mechanisms of clathrin-mediated endocytosis. Nature Reviews Molecular Cell Biology. 2018;19:313–326. doi: 10.1038/nrm.2017.132. [DOI] [PubMed] [Google Scholar]
  43. Kelley CF, Messelaar EM, Eskin TL, Wang S, Song K, Vishnia K, Becalska AN, Shupliakov O, Hagan MF, Danino D, Sokolova OS, Nicastro D, Rodal AA. Membrane Charge Directs the Outcome of F-BAR Domain Lipid Binding and Autoregulation. Cell Reports. 2015;13:2597–2609. doi: 10.1016/j.celrep.2015.11.044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Kessels MM, Qualmann B. The syndapin protein family: linking membrane trafficking with the cytoskeleton. Journal of Cell Science. 2004;117:3077–3086. doi: 10.1242/jcs.01290. [DOI] [PubMed] [Google Scholar]
  45. Khuong TM, Habets RL, Slabbaert JR, Verstreken P. WASP is activated by phosphatidylinositol-4,5-bisphosphate to restrict synapse growth in a pathway parallel to bone morphogenetic protein signaling. PNAS. 2010;107:17379–17384. doi: 10.1073/pnas.1001794107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Kim AS, Kakalis LT, Abdul-Manan N, Liu GA, Rosen MK. Autoinhibition and activation mechanisms of the Wiskott-Aldrich syndrome protein. Nature. 2000;404:151–158. doi: 10.1038/35004513. [DOI] [PubMed] [Google Scholar]
  47. Kim N, Kim S, Nahm M, Kopke D, Kim J, Cho E, Lee MJ, Lee M, Kim SH, Broadie K, Lee S. BMP-dependent synaptic development requires Abi-Abl-Rac signaling of BMP receptor macropinocytosis. Nature Communications. 2019;10:684. doi: 10.1038/s41467-019-08533-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Koh TW, Verstreken P, Bellen HJ. Dap160/intersectin acts as a stabilizing scaffold required for synaptic development and vesicle endocytosis. Neuron. 2004;43:193–205. doi: 10.1016/j.neuron.2004.06.029. [DOI] [PubMed] [Google Scholar]
  49. Koh TW, Korolchuk VI, Wairkar YP, Jiao W, Evergren E, Pan H, Zhou Y, Venken KJ, Shupliakov O, Robinson IM, O'Kane CJ, Bellen HJ. Eps15 and Dap160 control synaptic vesicle membrane retrieval and synapse development. The Journal of Cell Biology. 2007;178:309–322. doi: 10.1083/jcb.200701030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Kononenko NL, Puchkov D, Classen GA, Walter AM, Pechstein A, Sawade L, Kaempf N, Trimbuch T, Lorenz D, Rosenmund C, Maritzen T, Haucke V. Clathrin/AP-2 mediate synaptic vesicle reformation from endosome-like vacuoles but are not essential for membrane retrieval at central synapses. Neuron. 2014;82:981–988. doi: 10.1016/j.neuron.2014.05.007. [DOI] [PubMed] [Google Scholar]
  51. Lee JS, Ho WK, Lee SH. Actin-dependent rapid recruitment of reluctant synaptic vesicles into a fast-releasing vesicle pool. PNAS. 2012;109:E765–E774. doi: 10.1073/pnas.1114072109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Li CH, Tam PKS. An iterative algorithm for minimum cross entropy thresholding. Pattern Recognition Letters. 1998;19:771–776. doi: 10.1016/S0167-8655(98)00057-9. [DOI] [Google Scholar]
  53. Madania A, Dumoulin P, Grava S, Kitamoto H, Schärer-Brodbeck C, Soulard A, Moreau V, Winsor B. The Saccharomyces cerevisiae homologue of human Wiskott-Aldrich syndrome protein Las17p interacts with the Arp2/3 complex. Molecular Biology of the Cell. 1999;10:3521–3538. doi: 10.1091/mbc.10.10.3521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Marie B, Sweeney ST, Poskanzer KE, Roos J, Kelly RB, Davis GW. Dap160/intersectin scaffolds the periactive zone to achieve high-fidelity endocytosis and normal synaptic growth. Neuron. 2004;43:207–219. doi: 10.1016/j.neuron.2004.07.001. [DOI] [PubMed] [Google Scholar]
  55. Maritzen T, Haucke V. Coupling of exocytosis and endocytosis at the presynaptic active zone. Neuroscience Research. 2018;127:45–52. doi: 10.1016/j.neures.2017.09.013. [DOI] [PubMed] [Google Scholar]
  56. Marra V, Burden JJ, Thorpe JR, Smith IT, Smith SL, Häusser M, Branco T, Staras K. A preferentially segregated recycling vesicle pool of limited size supports neurotransmission in native central synapses. Neuron. 2012;76:579–589. doi: 10.1016/j.neuron.2012.08.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Meinecke M, Boucrot E, Camdere G, Hon WC, Mittal R, McMahon HT. Cooperative recruitment of dynamin and BIN/amphiphysin/Rvs (BAR) domain-containing proteins leads to GTP-dependent membrane scission. The Journal of Biological Chemistry. 2013;288:6651–6661. doi: 10.1074/jbc.M112.444869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Melom JE, Akbergenova Y, Gavornik JP, Littleton JT. Spontaneous and evoked release are independently regulated at individual active zones. Journal of Neuroscience. 2013;33:17253–17263. doi: 10.1523/JNEUROSCI.3334-13.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  59. Merrifield CJ, Qualmann B, Kessels MM, Almers W. Neural Wiskott Aldrich Syndrome Protein (N-WASP) and the Arp2/3 complex are recruited to sites of clathrin-mediated endocytosis in cultured fibroblasts. European Journal of Cell Biology. 2004;83:13–18. doi: 10.1078/0171-9335-00356. [DOI] [PubMed] [Google Scholar]
  60. Morales M, Colicos MA, Goda Y. Actin-dependent regulation of neurotransmitter release at central synapses. Neuron. 2000;27:539–550. doi: 10.1016/s0896-6273(00)00064-7. [DOI] [PubMed] [Google Scholar]
  61. Moseley JB, Maiti S, Goode BL. Formin proteins: purification and measurement of effects on actin assembly. Meth. Enzymol. 2006;406:215–234. doi: 10.1016/S0076-6879(06)06016-2. [DOI] [PubMed] [Google Scholar]
  62. Mueller VJ, Wienisch M, Nehring RB, Klingauf J. Monitoring clathrin-mediated endocytosis during synaptic activity. Journal of Neuroscience. 2004;24:2004–2012. doi: 10.1523/JNEUROSCI.4080-03.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Nahm M, Kim S, Paik SK, Lee M, Lee S, Lee ZH, Kim J, Lee D, Bae YC, Lee S. dCIP4 (Drosophila Cdc42-interacting protein 4) restrains synaptic growth by inhibiting the secretion of the retrograde Glass bottom boat signal. Journal of Neuroscience. 2010;30:8138–8150. doi: 10.1523/JNEUROSCI.0256-10.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Nelson JC, Stavoe AK, Colón-Ramos DA. The actin cytoskeleton in presynaptic assembly. Cell Adhesion & Migration. 2013;7:379–387. doi: 10.4161/cam.24803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  65. Nunes P, Haines N, Kuppuswamy V, Fleet DJ, Stewart BA. Synaptic vesicle mobility and presynaptic F-actin are disrupted in a N-ethylmaleimide-sensitive factor allele of Drosophila. Molecular Biology of the Cell. 2006;17:4709–4719. doi: 10.1091/mbc.e06-03-0253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. O'Connor-Giles KM, Ho LL, Ganetzky B. Nervous wreck interacts with thickveins and the endocytic machinery to attenuate retrograde BMP signaling during synaptic growth. Neuron. 2008;58:507–518. doi: 10.1016/j.neuron.2008.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Okamoto M, Schoch S, Südhof TC. EHSH1/intersectin, a protein that contains EH and SH3 domains and binds to dynamin and SNAP-25 a protein connection between exocytosis and endocytosis? The Journal of Biological Chemistry. 1999;274:18446–18454. doi: 10.1074/jbc.274.26.18446. [DOI] [PubMed] [Google Scholar]
  68. Owe SG, Jensen V, Evergren E, Ruiz A, Shupliakov O, Kullmann DM, Storm-Mathisen J, Walaas SI, Hvalby Ø, Bergersen LH. Synapsin- and actin-dependent frequency enhancement in mouse hippocampal mossy fiber synapses. Cerebral Cortex. 2009;19:511–523. doi: 10.1093/cercor/bhn101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Papandréou MJ, Leterrier C. The functional architecture of axonal actin. Molecular and Cellular Neurosciences. 2018;91:151–159. doi: 10.1016/j.mcn.2018.05.003. [DOI] [PubMed] [Google Scholar]
  70. Pawson C, Eaton BA, Davis GW. Formin-dependent synaptic growth: evidence that Dlar signals via Diaphanous to modulate synaptic actin and dynamic pioneer microtubules. Journal of Neuroscience. 2008;28:11111–11123. doi: 10.1523/JNEUROSCI.0833-08.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  71. Pechstein A, Bacetic J, Vahedi-Faridi A, Gromova K, Sundborger A, Tomlin N, Krainer G, Vorontsova O, Schäfer JG, Owe SG, Cousin MA, Saenger W, Shupliakov O, Haucke V. Regulation of synaptic vesicle recycling by complex formation between intersectin 1 and the clathrin adaptor complex AP2. PNAS. 2010;107:4206–4211. doi: 10.1073/pnas.0911073107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Pechstein A, Gerth F, Milosevic I, Jäpel M, Eichhorn-Grünig M, Vorontsova O, Bacetic J, Maritzen T, Shupliakov O, Freund C, Haucke V. Vesicle uncoating regulated by SH3-SH3 domain-mediated complex formation between endophilin and intersectin at synapses. EMBO Reports. 2015;16:232–239. doi: 10.15252/embr.201439260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Peng A, Rotman Z, Deng PY, Klyachko VA. Differential motion dynamics of synaptic vesicles undergoing spontaneous and activity-evoked endocytosis. Neuron. 2012;73:1108–1115. doi: 10.1016/j.neuron.2012.01.023. [DOI] [PubMed] [Google Scholar]
  74. Piccioli ZD, Littleton JT. Retrograde BMP signaling modulates rapid activity-dependent synaptic growth via presynaptic LIM kinase regulation of cofilin. Journal of Neuroscience. 2014;34:4371–4381. doi: 10.1523/JNEUROSCI.4943-13.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Pilo Boyl P, Di Nardo A, Mulle C, Sassoè-Pognetto M, Panzanelli P, Mele A, Kneussel M, Costantini V, Perlas E, Massimi M, Vara H, Giustetto M, Witke W. Profilin2 contributes to synaptic vesicle exocytosis, neuronal excitability, and novelty-seeking behavior. The EMBO Journal. 2007;26:2991–3002. doi: 10.1038/sj.emboj.7601737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Poskanzer KE, Fetter RD, Davis GW. Discrete residues in the c(2)b domain of synaptotagmin I independently specify endocytic rate and synaptic vesicle size. Neuron. 2006;50:49–62. doi: 10.1016/j.neuron.2006.02.021. [DOI] [PubMed] [Google Scholar]
  77. Praefcke GJ, Ford MG, Schmid EM, Olesen LE, Gallop JL, Peak-Chew SY, Vallis Y, Babu MM, Mills IG, McMahon HT. Evolving nature of the AP2 alpha-appendage hub during clathrin-coated vesicle endocytosis. The EMBO Journal. 2004;23:4371–4383. doi: 10.1038/sj.emboj.7600445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  78. Pucharcos C, Estivill X, de la Luna S. Intersectin 2, a new multimodular protein involved in clathrin-mediated endocytosis. FEBS Letters. 2000;478:43–51. doi: 10.1016/S0014-5793(00)01793-2. [DOI] [PubMed] [Google Scholar]
  79. Ramachandran P, Budnik V. Fm1-43 labeling of Drosophila larval neuromuscular junctions. Cold Spring Harbor Protocols. 2010;2010:pdb.prot5471. doi: 10.1101/pdb.prot5471. [DOI] [PubMed] [Google Scholar]
  80. Rao Y, Ma Q, Vahedi-Faridi A, Sundborger A, Pechstein A, Puchkov D, Luo L, Shupliakov O, Saenger W, Haucke V. Molecular basis for SH3 domain regulation of F-BAR-mediated membrane deformation. PNAS. 2010;107:8213–8218. doi: 10.1073/pnas.1003478107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  81. Reshetniak S, Ußling JE, Perego E, Rammner B, Schikorski T, Fornasiero EF, Truckenbrodt S, Köster S, Rizzoli SO. A comparative analysis of the mobility of 45 proteins in the synaptic bouton. The EMBO Journal. 2020;39:e104596. doi: 10.15252/embj.2020104596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  82. Rodal AA, Motola-Barnes RN, Littleton JT. Nervous wreck and Cdc42 cooperate to regulate endocytic actin assembly during synaptic growth. Journal of Neuroscience. 2008;28:8316–8325. doi: 10.1523/JNEUROSCI.2304-08.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  83. Rodal AA, Blunk AD, Akbergenova Y, Jorquera RA, Buhl LK, Littleton JT. A presynaptic endosomal trafficking pathway controls synaptic growth signaling. The Journal of Cell Biology. 2011;193:201–217. doi: 10.1083/jcb.201009052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  84. Roos J, Kelly RB. Dap160, a neural-specific Eps15 homology and multiple SH3 domain-containing protein that interacts with Drosophila dynamin. The Journal of Biological Chemistry. 1998;273:19108–19119. doi: 10.1074/jbc.273.30.19108. [DOI] [PubMed] [Google Scholar]
  85. Roux A, Koster G, Lenz M, Sorre B, Manneville JB, Nassoy P, Bassereau P. Membrane curvature controls dynamin polymerization. PNAS. 2010;107:4141–4146. doi: 10.1073/pnas.0913734107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  86. Sabeva N, Cho RW, Vasin A, Gonzalez A, Littleton JT, Bykhovskaia M. Complexin Mutants Reveal Partial Segregation between Recycling Pathways That Drive Evoked and Spontaneous Neurotransmission. Journal of Neuroscience. 2017;37:383–396. doi: 10.1523/JNEUROSCI.1854-16.2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  87. Sakaba T, Neher E. Involvement of actin polymerization in Vesicle recruitment at the Calyx of held synapse. The Journal of Neuroscience. 2003;23:837–846. doi: 10.1523/JNEUROSCI.23-03-00837.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  88. Sankaranarayanan S, Atluri PP, Ryan TA. Actin has a molecular scaffolding, not propulsive, role in presynaptic function. Nature Neuroscience. 2003;6:127–135. doi: 10.1038/nn1002. [DOI] [PubMed] [Google Scholar]
  89. Schmid EM, Ford MG, Burtey A, Praefcke GJ, Peak-Chew SY, Mills IG, Benmerah A, McMahon HT. Role of the AP2 beta-appendage hub in recruiting partners for clathrin-coated vesicle assembly. PLOS Biology. 2006;4:e0040262. doi: 10.1371/journal.pbio.0040262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  90. Sengar AS, Wang W, Bishay J, Cohen S, Egan SE. The EH and SH3 domain Ese proteins regulate endocytosis by linking to dynamin and Eps15. The EMBO Journal. 1999;18:1159–1171. doi: 10.1093/emboj/18.5.1159. [DOI] [PMC free article] [PubMed] [Google Scholar]
  91. Sone M, Suzuki E, Hoshino M, Hou D, Kuromi H, Fukata M, Kuroda S, Kaibuchi K, Nabeshima Y, Hama C. Synaptic development is controlled in the periactive zones of Drosophila synapses. Development. 2000;127:4157–4168. doi: 10.1242/dev.127.19.4157. [DOI] [PubMed] [Google Scholar]
  92. Soykan T, Kaempf N, Sakaba T, Vollweiter D, Goerdeler F, Puchkov D, Kononenko NL, Haucke V. Synaptic Vesicle Endocytosis Occurs on Multiple Timescales and Is Mediated by Formin-Dependent Actin Assembly. Neuron. 2017;93:854–866. doi: 10.1016/j.neuron.2017.02.011. [DOI] [PubMed] [Google Scholar]
  93. Spudich JA, Watt S. The regulation of rabbit skeletal muscle contraction I biochemical studies of the interaction of the tropomyosin-troponin complex with actin and the proteolytic fragments of myosin. The Journal of Biological Chemistry. 1971;246:4866–4871. [PubMed] [Google Scholar]
  94. Stanishneva-Konovalova TB, Kelley CF, Eskin TL, Messelaar EM, Wasserman SA, Sokolova OS, Rodal AA. Coordinated autoinhibition of F-BAR domain membrane binding and WASp activation by Nervous Wreck. PNAS. 2016;113:E5552–E5561. doi: 10.1073/pnas.1524412113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  95. Stewart BA, Atwood HL, Renger JJ, Wang J, Wu CF. Improved stability of Drosophila larval neuromuscular preparations in haemolymph-like physiological solutions. Journal of Comparative Physiology A. 1994;175:179–191. doi: 10.1007/BF00215114. [DOI] [PubMed] [Google Scholar]
  96. Sun Y, Leong NT, Jiang T, Tangara A, Darzacq X, Drubin DG. Switch-like Arp2/3 activation upon WASP and WIP recruitment to an apparent threshold level by multivalent linker proteins in vivo. eLife. 2017;6:e29140. doi: 10.7554/eLife.29140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  97. Taylor MJ, Perrais D, Merrifield CJ. A high precision survey of the molecular dynamics of mammalian clathrin-mediated endocytosis. PLOS Biology. 2011;9:e1000604. doi: 10.1371/journal.pbio.1000604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  98. Teckchandani A, Mulkearns EE, Randolph TW, Toida N, Cooper JA. The clathrin adaptor Dab2 recruits EH domain scaffold proteins to regulate integrin β1 endocytosis. Molecular Biology of the Cell. 2012;23:2905–2916. doi: 10.1091/mbc.E11-12-1007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  99. Tinevez JY, Perry N, Schindelin J, Hoopes GM, Reynolds GD, Laplantine E, Bednarek SY, Shorte SL, Eliceiri KW. TrackMate: An open and extensible platform for single-particle tracking. Methods. 2017;115:80–90. doi: 10.1016/j.ymeth.2016.09.016. [DOI] [PubMed] [Google Scholar]
  100. Tsai W-H. Moment-preserving thresholding: a new approach. In: Kasturi R, editor. Document Image Analysis. IEEE Computer Society Press; 1995. pp. 3–22. [Google Scholar]
  101. Ukken FP, Bruckner JJ, Weir KL, Hope SJ, Sison SL, Birschbach RM, Hicks L, Taylor KL, Dent EW, Gonsalvez GB, O'Connor-Giles KM. BAR-SH3 sorting nexins are conserved interacting proteins of Nervous wreck that organize synapses and promote neurotransmission. Journal of Cell Science. 2016;129:166–177. doi: 10.1242/jcs.178699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  102. Venken KJ, He Y, Hoskins RA, Bellen HJ. P[acman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science. 2006;314:1747–1751. doi: 10.1126/science.1134426. [DOI] [PubMed] [Google Scholar]
  103. Verstreken P, Koh TW, Schulze KL, Zhai RG, Hiesinger PR, Zhou Y, Mehta SQ, Cao Y, Roos J, Bellen HJ. Synaptojanin is recruited by endophilin to promote synaptic vesicle uncoating. Neuron. 2003;40:733–748. doi: 10.1016/S0896-6273(03)00644-5. [DOI] [PubMed] [Google Scholar]
  104. Verstreken P, Ohyama T, Bellen HJ. FM 1-43 labeling of synaptic vesicle pools at the Drosophila neuromuscular junction. Methods in Molecular Biology. 2008;440:349–369. doi: 10.1007/978-1-59745-178-9_26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  105. Wagh D, Terry-Lorenzo R, Waites CL, Leal-Ortiz SA, Maas C, Reimer RJ, Garner CC. Piccolo Directs Activity Dependent F-Actin Assembly from Presynaptic Active Zones via Daam1. PLOS ONE. 2015;10:e0120093. doi: 10.1371/journal.pone.0120093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  106. Waites CL, Leal-Ortiz SA, Andlauer TF, Sigrist SJ, Garner CC. Piccolo regulates the dynamic assembly of presynaptic F-actin. Journal of Neuroscience. 2011;31:14250–14263. doi: 10.1523/JNEUROSCI.1835-11.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  107. Wang X, Kibschull M, Laue MM, Lichte B, Petrasch-Parwez E, Kilimann MW. Aczonin, a 550-kD putative scaffolding protein of presynaptic active zones, shares homology regions with Rim and Bassoon and binds profilin. The Journal of Cell Biology. 1999;147:151–162. doi: 10.1083/jcb.147.1.151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  108. Wang D, Zhang L, Zhao G, Wahlström G, Heino TI, Chen J, Zhang YQ. Drosophila twinfilin is required for cell migration and synaptic endocytosis. Journal of Cell Science. 2010;123:1546–1556. doi: 10.1242/jcs.060251. [DOI] [PubMed] [Google Scholar]
  109. Wang JW, Brent JR, Tomlinson A, Shneider NA, McCabe BD. The ALS-associated proteins FUS and TDP-43 function together to affect Drosophila locomotion and life span. The Journal of clinical investigation. 2011;121:4118–4126. doi: 10.1172/JCI57883. [DOI] [PMC free article] [PubMed] [Google Scholar]
  110. Watanabe S, Rost BR, Camacho-Pérez M, Davis MW, Söhl-Kielczynski B, Rosenmund C, Jorgensen EM. Ultrafast endocytosis at mouse hippocampal synapses. Nature. 2013;504:242–247. doi: 10.1038/nature12809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  111. Wienisch M, Klingauf J. Vesicular proteins exocytosed and subsequently retrieved by compensatory endocytosis are nonidentical. Nature Neuroscience. 2006;9:1019–1027. doi: 10.1038/nn1739. [DOI] [PubMed] [Google Scholar]
  112. Wilhelm BG, Mandad S, Truckenbrodt S, Kröhnert K, Schäfer C, Rammner B, Koo SJ, Claßen GA, Krauss M, Haucke V, Urlaub H, Rizzoli SO. Composition of isolated synaptic boutons reveals the amounts of vesicle trafficking proteins. Science. 2014;344:1023–1028. doi: 10.1126/science.1252884. [DOI] [PubMed] [Google Scholar]
  113. Winther ÅM, Jiao W, Vorontsova O, Rees KA, Koh TW, Sopova E, Schulze KL, Bellen HJ, Shupliakov O. The dynamin-binding domains of Dap160/intersectin affect bulk membrane retrieval in synapses. Journal of Cell Science. 2013;126:1021–1031. doi: 10.1242/jcs.118968. [DOI] [PMC free article] [PubMed] [Google Scholar]
  114. Winther ÅM, Vorontsova O, Rees KA, Näreoja T, Sopova E, Jiao W, Shupliakov O. An Endocytic Scaffolding Protein together with Synapsin Regulates Synaptic Vesicle Clustering in the Drosophila Neuromuscular Junction. Journal of Neuroscience. 2015;35:14756–14770. doi: 10.1523/JNEUROSCI.1675-15.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  115. Wolf M, Zimmermann AM, Görlich A, Gurniak CB, Sassoè-Pognetto M, Friauf E, Witke W, Rust MB. ADF/Cofilin Controls Synaptic Actin Dynamics and Regulates Synaptic Vesicle Mobilization and Exocytosis. Cerebral Cortex. 2015;25:2863–2875. doi: 10.1093/cercor/bhu081. [DOI] [PubMed] [Google Scholar]
  116. Wu XS, Lee SH, Sheng J, Zhang Z, Zhao WD, Wang D, Jin Y, Charnay P, Ervasti JM, Wu LG. Actin Is Crucial for All Kinetically Distinguishable Forms of Endocytosis at Synapses. Neuron. 2016;92:1020–1035. doi: 10.1016/j.neuron.2016.10.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  117. Xiao GY, Mohanakrishnan A, Schmid SL. Role for ERK1/2-dependent activation of FCHSD2 in cancer cell-selective regulation of clathrin-mediated endocytosis. PNAS. 2018;115:E9570–E9579. doi: 10.1073/pnas.1810209115. [DOI] [PMC free article] [PubMed] [Google Scholar]
  118. Xiao G-Y, Schmid SL. FCHSD2 controls oncogenic ERK1/2 signaling outcome by regulating endocytic trafficking. PLOS Biology. 2020;18:e3000778. doi: 10.1371/journal.pbio.3000778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  119. Zhao L, Wang D, Wang Q, Rodal AA, Zhang YQ. Drosophila cyfip regulates synaptic development and endocytosis by suppressing filamentous actin assembly. PLOS Genetics. 2013;9:e1003450. doi: 10.1371/journal.pgen.1003450. [DOI] [PMC free article] [PubMed] [Google Scholar]

Decision letter

Editor: Suzanne R Pfeffer1

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

[Editors' note: this paper was reviewed by Review Commons.]

Acceptance summary:

Live-cell microscopy of Drosophila larvae shows that actin patches assemble transiently in unstimulated neuromuscular junctions at the frequency of spontaneous synaptic vesicle release. Disruption of the interactions between Dap160 and Nwk in vivo leads to dysregulated and more frequent actin assembly. The authors propose that these interactions serve as a 'clamp' on the actin assembly machinery, so that it can be spatially and temporally controlled when needed for synaptic vesicle endocytosis.

eLife. 2021 Jul 29;10:e69597. doi: 10.7554/eLife.69597.sa2

Author response


We thank the reviewers for their constructive comments. We are pleased that reviewers:

1) Found our model for an autoinhibitory clamp to be an important and convincing advance in our understanding of synaptic actin assembly and function.

2) Considered our in vitro data to be rigorous and convincing, and our in vivo analysis of actin dynamics ‘an impressive feat’

3) Were convinced of the mechanism and significance of Nwk-Dap160-WASp in the regulation of actin assembly at synaptic membranes.

The primary question raised by reviewers was the extent to which actin is shown to be endocytic. We addressed this concern by more extensive and rigorous imaging and analysis of the relationship between endocytic adapters and actin patch dynamics (new Figure 7A-C, Figure 7—figure supplement 1A; and response to comments R1S, R1.4, R1.11, and R2.1). Other comments to be addressed by revisions are discussed point-by-point below.

Summary of revision experiments

Experiment 1 – Compare Clathrin and Actin dynamics

We have now added a new analysis of clathrin::GFP relative to Lifeact::Ruby, and show kymographs and line traces of the dynamics between clathrin and lifeact patches (new Figure 7A-C).

Experiment 2 – Provide control for AP2 and Arp3 co-localization data

In response to comment R2.1, which requests a negative control for colocalization analysis of AP2-lifeact and Arp3-lifeact, we compared actin distribution with the active zone marker BRP (new Figure 1E-F and Figure 7C)

Experiment 3 – Validate patch-tracking parameters

In response to comment R2.10, we have validated our patch tracker analysis as follows:

We present a new analysis that compares the frequency of patch detection in control NMJs at 0.25 Hz and 1 Hz across a wide patch detection and tracking parameter space (new Figure 1—figure supplement 2A and Figure 6—figure supplement 1A).

We show that the phenotypes presented for WASp and Nwk in the original submission are highly robust with respect to the patch detection and tracking parameters we chose (new Figure 1—figure supplement 2B and Figure 6—figure supplement 1B).

In videos and representative panels we now label tracked patches, and show representative kymographs to clarify the dynamics of structures detected by patchtracker (new Figure 1—figure supplement 1A, Figure 7A-B, revised Video 1).

Experiment 4 -Validate WASp RNAi

In response to comment R2.13 regarding Figure 1—figure supplement 1, we quantify the efficiency of WASp knockdown by the RNAi construct used (new Figure 1—figure supplement 1F).

Reviewer #1 (Evidence, reproducibility and clarity (Required)):

Summary:

R1S. The authors provide extensive biochemical and in vivo evidence that together map interactions between Dap160 and Nwk (Drosophila homologues of intersectin and FCHSD2, respectively) that regulate the ability of Nwk to activate WASp and hence actin assembly at the synapse. They show in vitro that synergistic interactions between the SH3C domain of Dap160, the SH3b domain of Nwk and membrane-associated PI45,P¬2 relieves autoinhibition of Nwk to stimulate WASp and Arp2/3-mediated actin assembly. By live-cell microscopy of neuromuscular junctions (NMJs) in Ds. larvae, they show that actin patches assemble transiently in unstimulated NMJs at about the frequency of spontaneous synaptic vesicle release with lifetimes of ~20-40s. Disruption of the interactions between Dap160 and Nwk in vivo leads in dysregulated and more frequent actin assembly. Their hypothesis is that these interactions serve as a 'clamp' on the actin assembly machinery, so that it can be spatially and temporally controlled when needed for synaptic vesicle endocytosis. The data linking these observations to synaptic vesicle endocytosis are somewhat weaker, as most sites of AP2 assembly on the membrane are devoid of actin and disruption of Nwk or Nwk-Dap160 interactions results in a considerably milder endocytosis phenotype than Shits1 the mutation. However, the weaker phenotype may reflect other mechanisms operating to regulate endocytosis and actin assembly at the synapse. This should perhaps be discussed more explicitly.

‘most sites of AP2 assembly on the membrane are devoid of actin’

Indeed, this is the main observation that sparked our study, and turns out to be a surprising and interesting feature of many components of the synaptic endocytic machinery. The wide distribution of AP2 and clathrin (though we note that we cannot make assumptions about their assembly state) is consistent with the high concentration (Wilhelm et al., 2014) and expansive localization of many endocytic regulators at synapses. The conundrum is that the expected rate of exo/endocytosis at this synapse at rest (Melom et al., 2013) is far too low to account for this broad distribution. Thus, these data argue that most of the endocytic machinery is held inactive at synaptic membranes, and is thus unlikely to always be associated with force-producing actin assembly.

The converse question is whether the actin-positive events are really functionally associated with a subset of the endocytic machinery. The following lines of evidence suggest that they are functionally associated:

1. Nwk and Dap160, which we find regulate actin in vitro and at patches at the synapse, are well-established regulators of endocytosis in other cell types.

2. We find that dynamin, a central component of the endocytic machinery, also regulates synaptic actin patch dynamics.

3. The rate of actin assembly matches the measured rate of exocytosis (and thus the expected rate of compensatory endocytosis)

4. Actin patch dynamics resemble endocytic patch dynamics in other cell types.

5. Actin/WASp is required for endocytosis in this cell type, and we find that WASp is required for formation of synaptic patches (though note we observe only a partial loss of patches since we have used a hypomorphic WASp mutant). Further, the patches are highly enriched for Arp2/3 complex, as expected for endocytic structures.

Added new experiment (Figure 7A-C): To further test the hypothesis that the actin patches are bona fide sites of endocytosis, we provide a more rigorous quantification of the relationship between Clc and actin and show tracked actin patches that dynamically colocalize with clc::GFP. Please see further discussion on this point in response to Comment 1.4.

‘disruption of Nwk or Nwk-Dap160 interactions results in a considerably milder endocytosis phenotype than Shits1 the mutation’

The magnitude of the Nwk-Dap160 FM dye uptake phenotype is similar to many other endocytic proteins at this synapse (Choudhury et al., 2016; Guichet et al., 2002). The simplest explanation for the more severe ShiTS1 phenotype is that it is a dominant negative mutant, completely blocking endocytosis by locking constricted pits, while the Nwk and Dap160 mutants are loss of function perturbations, allowing for redundant mechanisms that provide resiliency in the endocytic protein interaction network (Chen and Schmid, 2020). Indeed, even dynamin loss-of-function mutations cause more subtle phenotypes than the classic dominant negative mutants (Ferguson et al., 2007). There are dozens of endocytic proteins with overlapping molecular interactions and activities, which suggests several explanations for the intermediate Nwk/Dap160 phenotypes. First, it could reflect direct molecular redundancy with other adapters/regulators. Alternatively, it could reflect an adaptive change in the mode of membrane uptake in the mutants (as is observed in clathrin and adapter mutants, eg Heerssen et al., 2008). Regardless, the combination of actin and endocytic phenotypes of the Dap160∆SH3CD mutant provides strong support that the actin regulatory function of the Nwk-Dap160 module are required for normal endocytosis.

Major comments:

- Are the key conclusions convincing?

R1.1 The biochemical studies are very convincing. The in vivo studies are supportive, but as indicated above not as strong, perhaps unavoidably.

- Should the authors qualify some of their claims as preliminary or speculative, or remove them altogether?

R1.2 The idea of an endocytic 'clamp' is attractive, and others have suggested that this might be accomplished through phosphorylation/dephosphorylation. Indeed, while the authors show clearly that Dap160-Nwk interactions regulate Nwk activity, they do not comment on what might regulate Dap160-Nwk interactions. What would trigger these interactions for activation of Nwk?

We have added additional text discussing possible modes of regulation of the Dap160-Nwk interactions. Phosphorylation is one possibility, but is perhaps more likely to provide the kind of regulation that switches between modes of endocytosis (eg CME to bulk) over time windows in the seconds-minutes range (Salazar and Höfer, 2009). However, it seems likely that within a single mode (eg CME), this would not be fast enough for release of the clamp in response to an action potential. A plausible sequence of events that couples exocytosis and endocytosis suggests several potential ‘switching’ mechanisms, which are very interesting but beyond the scope of this study to explore.

Sequence of events:

Pre-deployment of endocytic-actin regulatory machinery (‘clamped’)

Calcium influx (may directly act on the endocytic machinery to release the clamp)

Exocytosis may also/alternatively provide the signal to release the clamp via:

– Cargo accumulation in the plasma membrane (eg vesicular SNAREs).

– Local changes in membrane composition and charge: Phosphoinositide dynamics could directly alter Nwk membrane binding and/or protein-protein interactions. Alternatively, Dap160/Intersectin activity may be altered by interactions with other PI(4,5)P2 binding proteins, including AP2, FCHo or Dynamin. Finally, membrane composition changes upon exocytosis may directly recruit or activate WASp.

– Local changes in membrane mechanics or curvature

Added text lines 399-405: The next critical step will be to determine the mechanisms that control switching between clamped and activated states. Many potential mechanisms that link calcium-dependent exocytosis and endocytosis could activate actin assembly, including direct effects of calcium on the endocytic machinery (Maritzen and Haucke, 2018), the accumulation of synaptic vesicle cargoes (Cousin, 2017), stoichiometry-dependent changes in protein interactions or activities (Case et al., 2019), changes in membrane mechanics (Anantharam et al., 2010; Dai et al., 1997; Roux et al., 2010), and changes in membrane charge/mode of membrane binding (Kelley et al., 2015).

- Would additional experiments be essential to support the claims of the paper? Request additional experiments only where necessary for the paper as it is, and do not ask authors to open new lines of experimentation.

R1.3 Given the partial effect on endocytosis upon disruption of Dap160/Nwk and the fact that most AP2 puncta do not colocalize with the actin patches, I'm curious as to the effect of latrunculin A on FM dye uptake. Does latA inhibit as strongly as shits1? I believe this is a fairly do-able experiment.

This experiment has already been published, and supports our model. Latrunculin A treatment strongly inhibits FM dye uptake at the Drosophila NMJ (Wang et al. 2010). Though this study did not compare the degree of defect to shiTS1, they report a ~80% decrease, which is very similar to our reported effect of shiTS1 (73% decrease). We cite this result (p2) as one piece of evidence to support the premise that endocytosis in this synapse is actin dependent.

R1.4 Or perhaps the AP2 puncta are not endocytic events. The authors state they are more dynamic than the actin patches, what is their lifetimes/distribution of duration relative to actin patches.

As mentioned above, we do believe that most AP2 puncta are unlikely to be active sites of endocytosis. If all puncta were active, endocytosis would far exceed exocytosis at this synapse. These abundant AP2 puncta may be in small clathrin pre-assemblies, or (less likely) serve some non-endocytic function. This is true also for the broad membrane localization of the other endocytic proteins analyzed here and in other work, which together suggest that mechanisms must be in place to limit the activity of these proteins. Indeed, this is the very observation that animates the question we are asking – how do synapses maintain such a high (inactive) concentration of membrane and cytoskeletal regulators at synaptic membranes?

Added text lines 269-271: Considering that the rates of exo/endocytosis at this synapse at rest are relatively low (see above), these observations suggest that like other periactive zone endocytic proteins, a large pool of membrane localized clathrin coat and adapter proteins are not actively engaged in endocytosis.

Added text lines 356-360: This is further consistent with the broad distribution and transient localization of AP2 to the membrane (Figure 7). Given the comparatively low rate of endocytosis expected at rest at this synapse, this suggests that most AP2 puncta at the synapse are either not stabilized to form productive endocytic sites (Aguet et al., 2013), or are associated with some non-endocytic function (Gimber et al., 2015).

Added new experiment (Figure 7A-C) as described above. A deeper analysis of the co-dynamics and functions of particular actin-clathrin structures will be interesting but very complex given the challenges of analyzing these dynamics at the synapse as compared to non-neuronal membranes, and we believe more appropriate as the topic of a future manuscript.

R1.5 In this regard, while the actin patch lifetime is indeed consistent with previous reports in yeast and cultured mammalian cells, I would think that synaptic vesicle endocytosis occurs at a much more rapid time scale, so I'm not sure of the validity of this comparison.

Vesicle endocytosis occurs over a range of time scales at this and other synapses, depending on the degree of exocytosis (Gan and Watanabe, 2018). Endocytosis at this synapse proceeds reliably with a time constant of ~14 sec with 50Hz stimulation over a range of durations, consistent with clathrin mediated endocytosis (Poskanzer et al., 2006), and multiple studies have shown that normal vesicle cycling required clathrin and adapters. These data lead us to expect similar actin dynamics between these model systems. We note also that actin patch lifetimes differ significantly between yeast (~16sec) and cultured mammalian cells (~40sec), with our measurements closely matching yeast patch lifetimes. We have revised the text to clarify this argument:

Added text lines 331-334: Given the measured time constant for endocytosis (~14 seconds, Poskanzer et al., 2006) and clathrin-dependence of vesicle cycling in this synapse (Heerssen et al., 2008), these values support the hypothesis that synaptic actin patches are likely sites of clathrin-mediated endocytosis.

- Are the data and the methods presented in such a way that they can be reproduced?

Yes.

- Are the experiments adequately replicated and statistical analysis adequate?

Yes.

Minor comments:

• R1.6 Page 2, left column. What is meant by 'we noted a strong floor effect'.

We mean that the mode of the distribution was the minimum observable duration, suggesting that we did not adequately resolve the population of shorter-lived events. We clarify this point in the text (p2):

Added text line 110-111: We did note a high percentage of patches in the minimum duration bin, suggesting the existence of even briefer patches.

• R1.7 Figure 5F. The fluorescence recovery curve for the control condition shows biphasic kinetics, which would be expected as there is both a membrane-bound and a cytosolic pool of Nwk:GFP. Tau should be recalculated. I suspect the fast phase will be the same as for Dap160siRNA and the slow phase will show a much bigger difference.

We now fit recovery data to two-phase curves, and indeed found that the fast component showed similar kinetics (.75 sec vs.74 sec), and statistically indistinguishable slow kinetics (10.7 sec vs 16.4 sec; p=.08). Strikingly, fast kinetics accounted for a significantly higher fraction of recovery in dap160RNAi boutons (76.2% vs 22.2%, p<.05). These data strongly support a shift from membrane to cytosolic localization and dynamics. While our conclusion remains the same, we agree with the reviewer that this is the more appropriate analysis of the data and have revised figure 5.

• R1.8 Page 10, left column. It is surprising that Dap160 mutants can rescue synaptic growth regulation. Is this process independent of endocytosis. Does shits1 block synaptic growth regulation?

It was also surprising to us that Dap160∆SH3CD could rescue synaptic growth, though nwk null and dap160 null mutants have synaptic growth phenotypes of varying degrees, which arise from misregulation of BMP signaling. Multiple other endocytic mutants, including ShiTS1, show the same phenotype (Dickman et al., 2006; O’Connor-Giles et al., 2008), so we do not believe that it reflects a non-endocytic process.

This surprising result with Dap160∆SH3CD is interesting for two reasons:

1. it indicates for the first time that endocytic mechanisms for synaptic vesicles/FM dye can be uncoupled from those required for growth factor receptor trafficking.

2. It raises the possibility that these do occur by somewhat different mechanisms. One interpretation is that the mechanism reported by FM dyes may be simply more sensitive to the Dap160-SH3CD perturbation than synaptic growth. Another possibility is that other ligands can activate Nwk for growth factor receptor trafficking, and that the Dap160-SH3CD mechanism is dedicated to synaptic vesicle endocytosis, perhaps as a rapid response to action potentials. Regardless, the multivalent nature of interactions in the endocytic network (Dap160SH3AB-Dynamin, Dynamin-Nwk, Dap160SH3CD-Nwk, Dap160SH3AB-WASp, WASp-NwkSH3a, just to name a few) will make this challenging to tease apart.

Added text lines 283-285: These data indicate that synaptic vesicle and growth factor endocytosis are mechanistically separable, and suggest that actin dynamics phenotypes in the Dap160ΔSH3CD mutant are not associated with synaptic growth regulation.

• R1.9 Page 10, right column. It's confusing to report 28% and 27% reduction for Nwk and DAP160 mutants and 28% of controls for Shits1. This should be reported also be reported as 72% reduction to be consistent.

We agree this is confusing and have fixed this in the manuscript.

• R1.10 Is it clear that Dap160, Nwk and actin correspond to "much of the synaptic membrane remodeling machinery" as stated on pg 11, right column? What about other BAR domain-containing proteins (endophilin, amphiphysin, syndapin) and dynamin?

The conclusion that much of the machinery is broadly deployed is based both on our observations of Nwk, Dap160, and AP2, and published reports for dynamin (Roos and Kelly, 1998), Synaptojanin (Verstreken et al., 2003), Eps15 (Koh et al., 2007), and EndophilinA (Guichet et al., 2002; Verstreken et al., 2002). We have clarified the basis for this conclusion in the text on p11.

We note here for completeness that some endocytic proteins, such as Syndapin (Kumar et al., 2009) and amphiphysin (Leventis et al., 2001; Razzaq et al., 2001; Zelhof et al., 2001) are undetectable presynaptically and not thought to function in presynaptic endocytosis at the fly larval NMJ.

Added text lines 350-354: Many endocytic proteins accumulate across broad membrane domains at the Drosophila NMJ and other synapses (Gerth et al., 2017; Guichet et al., 2002; Koh et al., 2007; Roos and Kelly, 1998; Verstreken et al., 2002, 2003). Our data indicate that much of this membrane remodeling machinery is likely held in an inactive state at the presynaptic membrane: Nwk and Dap160 accumulate in a micron-scale membrane domain (Figure 2), and their loss increases the frequency of short-lived actin patches (Figure 6).

• R1.11 Same page, while it is true that "a significant and measurable fraction of synaptic actin patches are associated with endocytosis" as stated, the converse appears not to be true (i.e. most of the endocytic sites marked by AP2 are not associated with actin). As discussed above this should be clarified.

As discussed above, it is precisely the high frequency of AP2 at the membrane, combined with the high membrane concentration of cytoskeletal regulators such as Nwk and Dap160 that prompted us to ask whether there is a mechanism to constrain actin assembly at the synapse. Please see discussion for R1.4, and see Revision Plan Experiment 1 for further discussion.

Added text lines 356-360: This is further consistent with the broad distribution and transient localization of AP2 to the membrane (Figure 7). Given the comparatively low rate of endocytosis expected at rest at this synapse, this suggests that most AP2 puncta at the synapse are either not stabilized to form productive endocytic sites (Aguet et al., 2013), or are associated with some non-endocytic function (Gimber et al., 2015).

• R1.12 The authors might wish to speculate on how Dap160-Nwk interactions are regulated in a spatial temporal manner and are they?

Added text lines 399-405: The next critical step will be to determine the mechanisms that control switching between clamped and activated states. Many potential mechanisms that link calcium-dependent exocytosis and endocytosis could activate actin assembly, including direct effects of calcium on the endocytic machinery (Maritzen and Haucke, 2018), the accumulation of synaptic vesicle cargoes (Cousin, 2017), stoichiometry-dependent changes in protein interactions or activities (Case et al., 2019), changes in membrane mechanics (Anantharam et al., 2010; Dai et al., 1997; Roux et al., 2010), and changes in membrane charge/mode of membrane binding (Kelley et al., 2015).

R1.13 These studies have examined actin patch dynamics only in unstimulated NMJ. Do actin patches form more frequently and perhaps associate more frequently with AP2 upon stimulation?

Our study focuses on unstimulated presynaptic terminals because we are primarily interested in the mechanisms that maintain the endocytic machinery at the membrane in a quiescent state. We agree that the effect of stimulation on the activity of the endocytic machinery is interesting, however this technically challenging experiment has a wide range of possible outcomes compatible with roles for actin in endocytosis. These include no change in perceived actin dynamics (if the amount of membrane uptake scales independent of actin rate/size), increased frequency of assembly events, increased amplitude of assembly events, or more unpredictable changes if the mode of uptake switches altogether with stimulation (e.g. to bulk uptake). Thus, we believe that the amount of work required to interpret any result from this line of questioning would be beyond the scope of this manuscript.

Reviewer #1 (Significance (Required)):

- Describe the nature and significance of the advance (e.g. conceptual, technical, clnical) for the field.

These studies provide insight into a potential mechanism for the spatial and temporal regulation of actin dynamics and hence endocytosis at neuromuscular junctions. The combination of live imaging, genetic perturbations and biochemical analyses make for a complete and rigorous story. The hypothesis for such a molecular 'clamp' is attractive and supported by the data.

- Place the work in the context of the existing literature (provide references, where appropriate).

The authors do a good job of this. To my knowledge these are the first studies showing high resolution imaging of individual actin patch assemblies at a NMJ and, while the authors had previously mapped Dap160-Nwk interactions the functional consequences with regard to Nwk regulation we not explored.

- State what audience might be interested in and influenced by the reported findings.

The studies will be of interest to those studying endocytic membrane trafficking both at the synapse and in general.

- Define your field of expertise with a few keywords to help the authors contextualize your point of view.

Endocytic membrane trafficking.

Reviewer #2 (Evidence, reproducibility and clarity (Required)):

This manuscript examines the role of endocytic proteins Nervous Wreck (Nwk), Intersectin (Dap160 in Drosophila) and WASp in actin dynamics associated with endocytosis in vitro and in vivo in the neuromuscular junction (NMJ) of Drosophila larvae. The authors quantify individual F-actin assemblies by spinning disk confocal in the NMJs presynaptically expressing three different fluorescent actin probes, and compared the actin patch dynamics at 0.25 Hz and 1 Hz acquisition rates using automated particle tracking and quantifications tools. Using these tools, authors identified predominantly transient actin patches, and then go on to demonstrate (using genomic and RNAi manipulations) that these actin structures required WASp-dependent activation of Arp2/3. They then investigated the role of WASp regulators NwK and Dap160 using conventional and super-resolution microscopy at the periactive zone (PAZ). They showed that actin patches were more sparsely dispersed than Nwk and Dap160 in respect to PAZ, suggesting that PAZ machinery may be locally self-regulated to control actin patches. The authors then demonstrate that Nwk autoinhibition occurs through multiple interactions between Nwk and Dap160, and that these interactions are involved in synaptic endocytosis. The author conclude that this autoinhibition clamps and primes the synaptic endocytic machinery to drive productive membrane remodelling in response to physical cues. Overall, the role of WASp, Nwk and Dap160 on membrane-associated actin dynamics in presynaptic endocytosis is an important discovery. However, there are a number of issues with the current manuscript.

Major comments:

R2.1 The first part of the manuscript is convincing demonstrating the role of WASp, Nwk and Dap160 in actin patch dynamics. The experiments showing that these actin structures are involved in synaptic endocytosis would need some more work. The authors show that Lifeact::Ruby co-localize with AP2::GFP (Figure 7A-B, Video 3). They should show a negative presynaptic control that does not localize with Lifeact::Ruby.

Added new experiment (Figure 1F, Figure 7C): To address this question, we have compared the accumulation of lifeact::Ruby with the active zone marker BRP::GFP as a negative control and repeated our analysis of Arp3::GFP-Lifeact colocalization, and added a new comparison between Lifeact::Ruby and presynaptically expressed clc::GFP. We believe this is a rigorous experimental negative control because (i) the vast majority of BRP signal is localized to the membrane (ii) BRP localizes to a dense array of punctate structures morphologically similar to AP2/clc/arp3 puncta (iii) BRP exhibits a highly complementary pattern of accumulation with endocytic proteins such as AP2. As expected, BRP exhibits an exceedingly low Pearson’s Correlation with Lifeact::Ruby (likely reflecting background levels of colocalization at the resolution of light microscopy due to their general membrane localization). Both Arp3 and Clathrin light chain exhibit significantly higher colocalization with Lifeact::Ruby, supporting the conclusion that these relationships are not spurious.

R2.2 The Video 3 is hard to follow, perhaps it would help if the authors would indicate with arrows what they like to point out, or show a smaller region of interest.

We will have replaced Video 3 with a new video, and marked patches of interest with arrows.

R2.3 Of note, the AP2::GFP signal appears very abundant, which makes the use of a negative control even more important.

Agree, see discussion to R1.4.

R2.4 The authors show that dominant negative dynamin shiTS1 mutants have impaired FM dye uptake, and decreased number of actin patches, and draw conclusion that normal actin patch assembly requires dynamin activity. It has been shown before that dynamin is part of a protein network that controls nucleation of actin from membranes and that Nwk interacts with dynamin and Dap160 and functions together with Cdc42 to promote WASp-mediated actin polymerization in vitro and to regulate synaptic growth in vivo (Rodal et al., 2008). The manuscript would perhaps be stronger if the authors would address the combined role of the proteins forming the autoinhibitory clamp, and actin polymerization promoting protein dynamin. Otherwise the dynamin results provide more of a stand-alone observation.

We used the ShiTS1 dynamin mutant as a well-characterized and robust tool to block membrane internalization at the synapse (in fact more severe than a typical loss of function mutant in the endocytic machinery, due to the dominant negative effect of ShiTS1 in arresting invaginating pits, see response to R1 overall comments). While we certainly agree that further investigating the multiple roles of dynamin in this process (through its membrane scission activity, its own actin association, and its interaction with ligands of its proline-rich region such as Nwk and Dap160-SH3AB) would be very interesting, it will require multiple years and several additional papers worth of work to sort these out. We do feel that the biochemical mechanisms we have isolated in vitro for Nwk, WASp, and Dap160, and tested in vivo with specific mutants in Dap160 that are not involved in dynamin binding, stand alone as a first step in this much longer journey.

R2.5 Table 1 indicates several experiments with 3 technical replicas per lane. The authors should specify what these technical replicas mean. Were these experiments performed once and the samples loaded 3 times, or are these 3 independent repetitions of each experiment?

These indicate three independent repetitions/reaction assemblies, and we have modified the text to clarify.

R2.6 The statistical analysis are, in general, robust and the Table 1 listing the used statistical tests is very useful. The authors should include negative controls and statistical analysis for all stand-alone experiments such as Mander's M1 in Figure 1F and 7C.

Agreed, see discussion of point R2.1

Minor comments:

R2.7 Prior relevant studies have been appropriately referenced, the figures are clear and appropriately pointed out in the text (with the exception of Page 10, where FM uptake experiments are written [Figure 7A-B], when it should be [Figure 7F-G]). The main text is well written and understandable.

Specific experimental issues are listed below:

R2.8 In general, there is a large variation of the NMJ area (µm2) (for example, Figure 1A, 3D, 5E, 1—figure supplement 1A and 1—figure supplement 1C). The authors should clarify which muscle NMJs were used in each experiment. What is the average NJM size? Does the number of the actin patches correlate with the presynaptic size, i.e. are different actin structures more abundant in larger presynapses? For example, the actin cytoskeleton and its regulatory proteins are different in dendritic spines that are at different maturity stage (i.e. filopodia, stub, mushroom. For reference please see for example Hlushchenko et al., 2016 Cytoskeleton (Hoboken) 73(9):435-41. doi: 10.1002/cm.21280). Are the different NMJ presynapses equally active?

We modified the text to better describe the NMJ system. We performed our experiments on wandering third instar larvae, at type Ib boutons on muscle 6/7 NMJs, in abdominal segments 3-4. This synapse typically contains ~80 boutons stretched over ~200 µm of muscle, with a stereotypical distribution of bouton size (~6-16um2, Lee et al., 2017; Mallik et al., 2017) and a typical active zone density (~1/um2, so ~6-16 active zones/bouton; Harris and Littleton, 2015; Saburova et al., 2017). We have imaged a sub-area of this synapse, entailing a string of 5-10 boutons from each NMJ. We have then normalized all of our actin patch measurements to the synaptic area in each image. We find that both active zone and actin patch density are similar across the typical bouton size distribution for this NMJ. We note that “synaptic strength” at the NMJ is determined by individual active zone maturity and release probability, not by the size of the bouton (in which 6-16 independent, non-motile active zones reside) (Akbergenova et al., 2018).

Overall, the effects we see are not likely to reflect different stages of neuronal maturity from image to image (because we perform all experiments at late third instar), or spatial variation in synapse physiology (because release probability is distributed similarly between active zones along the length of the NMJ (Akbergenova et al., 2018)).

Thus, in short answer to the reviewer’s questions, all measurements are already normalized to NMJ area, and different boutons are indeed equally active when summed across their multiple active zones.

Added text lines 90-93: To control for developmental variation, all experiments were performed on late third instar larvae (~96-120 hours after egg laying) on muscle 6/7 NMJs at abdominal segments 3-4. The development and physiology of these synapses is well characterized (Harris and Littleton, 2015).

Added text p2: We normalized patch frequencies by the synapse area measured, and present data per 10 µm2, which is approximately the size of a synaptic bouton in this system.

R2.9 Number of actin patches (Figure 1 and Figure 1—figure supplement 1). The authors calculate that at 0.25Hz (i.e. 1 frame/ 4 sec),1.2 GMA patches/10μm2/min were observed (Figure 1B-D). In Figure 1—figure supplement 1D, the number of patches is related to NMJ area/Time (please define what "Time" is). Would the control results shown in Figure 1—figure supplement 1D be similar to those shown in Figure 1C for GMA if the number of patches was related to 10 µm2/min? Would it make more sense to show the number actin patches per average NMJ size?

We apologize for the inconsistent and confusing labeling of axes. We have fixed all axis labels to fully indicate units. All data shown are normalized in the same way, to 10 um2/min (and are thus already normalized to NMJ size). The reason we picked the value of 10 µm2 is because that represents the size of a typical bouton, and is therefore intuitive relative to the image. Given that the measurements are all done the same way, there is not a significant difference between control values for Figure 1 and Figure 1—figure supplement 1.

R2.10 Patch detection for the analysis of actin dynamics. Video 1 shows actin patches labelled by complementary reporters. Based on the Video 1, the size of actin patches in Actin::GFP is larger than those shown in GMA or Lifeact::Ruby videos. The patch diameter was selected as 0.6 µm for the analysis of actin dynamics at the NMJ (based on Methods), which appears correct for Actin::GFP but it appears it may be an overestimate for GMA or Lifeact::Ruby (there appears to be a large number of smaller actin patches especially in Lifeact::Ruby video). The smaller patches appear to be more short lived than the bigger patches, especially in Actin::GFP video. Some of the actin patches also appear laterally mobile. The linking max distance 0.5 µm appears large considering the 1 frame / 4s acquisition frame rate, which may results in significant tracking defects. The authors should show evidence that the 0.25 Hz acquisition rate, which has been used in majority of the experiments, with linking max distance 0.5 µm, is adequate enough to detect and discriminate this type of mobility and that there is not major mistracing of the actin separate patches. The Actin::GFP signal is very high (close to saturated) at the beginning of the video: how are the individual patches detected, tracked and counted reliably? The authors should show evidence how the patches were identified and tracked by the software in time-lapse. Please also specify what the time scale in the upper right corner of the different videos is. Could you also please show kymographs of the actin live cell imaging, correlating the patch duration with the length of the kymograph signal?

The submitted videos were contrast adjusted so that the reader could see both bright and dim structures; please be assured that all of our data were collected within the linear range of our detector; none of the raw data from which measurements were made were saturated.

R2.11 Figure 1E: Does the Arp3 and lifeact signal signal originate from presynapses or adjacent axons?

We do not observe dynamic, bright actin structures in the bon-fide axonal region at the nerve entry point into the muscle. The interbouton regions at these synapses represent an exceedingly small fraction of the measured area; while we do not exclude these regions from our analysis, they are unlikely to significantly contribute to our measurements.

R2.12 Figure 6A-C and 1—figure supplement 1A: The authors point out actin cables (magenta) and dynamic actin patches (green arrowhead) in Figure 1—figure supplement 1A, and quantify the patch duration in Figure 6C. Based on Figure 1—figure supplement 1A, it appears that great majority of actin patches, which are not indicated in the figure, are stable and only a few patches disappear within the indicated 32 s time frame along with the one indicated with green arrowhead. Yet the frequency distribution in Figure 6C indicates that the great majority of the control patches are short-lived (0-10s). The authors should explain the discrepancy.

Our method analyzes only patches that begin and end within the imaging window. This certainly excludes actin structures of a very long-lived nature (such as those likely to be involved more directly in bouton growth; Piccioli and Littleton, 2014). We discuss the caveats and constraints on this quantification in the results and methods sections of the text, and emphasize that our measurements reflect the properties of the subset puncta that are dynamic over the duration of videos.

R2.13 Figure 1—figure supplement 1 C-E: The authors should show the KD efficiency of WASp RNAi. Please also note varying labelling WASp (is it WASp or wsp?).

We have revised the manuscript to make labels consistent.

New experiment (Figure 1—figure supplement 1F): We analyzed the degree of knockdown of a presynaptic WASp::myc transgene by the same RNAi construct used in Figure 1—figure supplement 1C-D. We find that WASp accumulation is reduced to background levels. We chose to quantify a presynaptically expressed transgene due to the fact that the majority of endogenous WASp labeling at the NMJ is postsynaptic. Given the limits of resolution of light microscopy and the close apposition of pre and postsynaptic membranes, this precludes quantitative analysis of knockdown of the endogenous protein, but we believe the transgene makes a good proxy to evaluate the effectiveness of the RNAi line.

R2.14 Figure 2: It is unclear what the merged channels are in the small insets in A, C and E. Please clarify. What is the scale bar in A, C and E?

The channels in the insets are pseudo-colored as in the larger panel, as labeled. We have re-colored the fonts in the single-channel insets to emphasize this.

R2.15 Figure 3: What is the scale bar in E? The Mean Nwk Intensity of Dap160FL and Dap160ΔSH3D in D is so high that it basically covers the who NMJs, which would result in high colocalization in E. The Dap160 ΔSH3CD rescue expression level in E appears significantly lower compared to the other Dap160 variants – could this be the reason why the Nwk Mean Intensity is significantly lower than in the other two Dap160 variants (graph in D)?

The scale bar in D is 5um, the scale bar in E is 2.5um. We have added this information to the legend.

We present a new replicate of the experiment presented in Figure 3E and quantify transgene expression in Figure 3 —figure supplement 2B. This experiment precisely replicates the original finding, though we did find that the levels of the Dap160ΔSH3D transgene were lower in this specific experiment. However, this did not result in a loss of Nwk expression nor colocalization and so we conclude the levels of expression were sufficient for normal function. Regardless, the primary conclusion from this experiment is that Dap160ΔSH3CD diminishes its colocalization with Nwk, and this transgene is expressed at indistinguishable levels from the full length control transgene. We have chosen new representative images and have specified the transgene expression in the text.

New text lines 170-172: Notably, truncation of Dap160SH3D did not exhibit a phenotype in these assays despite lower levels of expression in this assay (Figure 3—figure supplement 2B), suggesting that additional factors absent from our in vitro assays may collaborate to regulate Nwk in vivo.

R2.16 Figure 4A and B. The concentration of Nwk and Dap160 are different in A and B, which appear the change the actin assembly curves (compare the red curve 5 in A and curve 4 in B). The authors concluded that neither Nwk, PI(4,5)P2 or NWK+PI(4,5)P2 on their own were sufficient to activate WASp above baseline. Was that because of lower Nwk concentration used in B? Why was smaller concentrations of Nwk and Dap160 used in B? Would similar enhancement of actin assembly be observed if 10% PI(4,5)P would be supplemented in the experiments shown in A?

The reviewer is correct: in A, where we were testing the ability of Dap160SH3CD to activate Nwk/Wsp in the absence of membranes, we used 500 nM Nwk and 2 µM Dap160. In B, where we were testing potentiation by membranes, we used 100 nM Nwk and 500 nM Dap160. This was to ensure that we were in a sensitive range to detect further activation by membranes. We chose these concentrations based on our previously published experiments (Stanishneva-Konovalova, Kelly et al. 2016, Figure 4), where we observed minimal release of 100 nM Nwk from autoinhibition by WASp and membranes alone. We would expect to see the same general effect if PIP2 were added to A, but since we might be close to maximal activity for NwK+Wsp+Dap160 at these higher concentrations, we may not have been able to effectively detect additional effects of membranes.

R2.17 Table 1 and Figure 5E-F, 3—figure supplement 2D: These seems to be a mismatch between the Drosophila genotypes of control and Dap160 RNAi. What is UAS-dcr2/+ which is not present in the control RNAi strain.

Dcr2 is a component of the RNAi-processing machinery, and its overexpression improves knockdown by dsRNA. Dcr2 was included in both genetic backgrounds; the table has been updated to fix this omission.

R2.18 The role of the PAZ proteins in membrane remodelling is addressed with GUV liposomes in vitro, and this message would be stronger if the authors would address the role of these proteins driving membrane remodelling in response to physical cues in in vivo (for example doing EM of NMJ from different Drosophila genotypes that show endocytic defects).

While we agree that this would be amazing, the technology does not exist at Drosophila synapses in vivo for capturing specific endocytic membrane remodeling events by EM. This is because synaptic boutons are ~5 µm diameter structures filled with hundreds of synaptic vesicles, which obscure each other and surrounding structures, making it very difficult to identify and resolve internalization events. Thin section electron microscopy or even tomography can capture gross steady-state phenotypes such as overall depletion of synaptic vesicles in response to massive depolarization or a train of action potentials, or changes in the steady-state size or spatial distribution of synaptic vesicles. These experiments have previously been done in Dap160 and Nwk mutant synapses (Coyle et al., 2004; Koh et al., 2004, 2007; Marie et al., 2004), and at rest there is no dramatic change in synaptic vesicle or plasma membrane morphology, while upon strong induction of exocytosis, the reformed vesicles form large cisternae, which can resolve over time (Winther et al., 2013, 2015). These results suggest that endocytic phenotypes, especially those that quantitatively affect kinetics or frequency of events, would be impossible to discern by EM. On the other hand, our actin fluorescence microscopy experiments are the first time, to our knowledge, that discrete events associated with endocytic machinery have been visualized and quantified. Applying an approach like correlative light microscopy and tomography or cryotomography to these events would be incredible, but also incredibly technically challenging and difficult to do at sufficient N to quantify mutant phenotypes.

Reviewer #2 (Significance (Required)):

The role of actin in presynapses has been widely studied, but the spatio-temporal molecular mechanisms that control the actin dynamics is not well understood. Presynaptic imaging is challenging due to small size of the presynapses and the highly crowded presynaptic environment. This manuscript addresses actin dynamics in vivo in Drosophila, which is an impressive feat. The conceptual findings of this study are important for the description of the synaptic function, as well as broader understanding of the periactive zone organization and regulation. The manuscript provides important insights into how synapses auto-regulate their functions that are important for synaptic plasticity and homeostasis. These findings will be interesting for a broad readership and may serve as an opening for further studies related to the physiological implications of the autoregulatory mechanisms.

Reviewer's expertise is the fields of cell and molecular biology, and neurobiology, with methodological viewpoint of imaging (conventional and super-resolution microscopy, as well as electron microscopy). The reviewer is not an expert in Drosphila studies or Drosphila genetics.

Associated Data

    This section collects any data citations, data availability statements, or supplementary materials included in this article.

    Supplementary Materials

    Figure 1—source data 1. Source data for Figure 1 and associated figure supplements.

    Source data quantifying raw actin patch dynamics data for control actin markers. Source data quantifying Pearson’s correlation values between Lifeact::Ruby, clc::GFP, BRP::GFP, and Arp3::GFP. Source data quantifying actin patch dynamics data for control and WASp mutant neuromuscular junctions (NMJs). Source data quantifying raw actin patch dynamics data for control and WASp mutant NMJs. Source data quantifying raw data measuring WASp::Myc levels at control and Wsp RNAi NMJs. Source data quantifying raw patch frequency values in control NMJs and % difference between control and WASp mutant NMJs measured over the indicated parameter space. Samples analyzed are the same video dataset as in Figure 1G–I.

    Figure 2—source data 1. Source data for Figure 2.

    Source data quantifying Pearson R values between Nwk, WASp, and GMA. Source data quantifying Pearson R values between Dap160, WASp, and GMA.

    Figure 3—source data 1. Source data for Figure 3 and associated figure supplements.

    Whole Coomassie gels measuring the interaction between GST-Dap160 fragments and Nwk proteins, as indicated in each file name. Collected and annotated gels for Figure 3B with lanes and constructs labeled. Quantification of blots for Figure 3B. Quantification of Nwk intensity in Dap160 rescue larvae, also containing raw data for Figure 3—figure supplement 2B (Dap160 transgene abundance). Source data quantifying Nwk-Dap160 transgene colocalization and intensity in Dap160 rescue larvae; also containing raw data for Figure 3—figure supplement 2C (Dap160 transgene abundance). Collected and annotated gels measuring Dap160 fragment pulldowns of Nwk SH3b for Figure 3—figure supplement 1A with lanes and constructs labeled. Raw gels for Figure 3—figure supplement 1A. Raw data quantifying Figure 3—figure supplement 1A. Collected and annotated gels measuring Dap160 fragment pulldowns of Nwk FBAR in Figure 3—figure supplement 1B with lanes and constructs labeled. Raw gels for Figure 3—figure supplement 1B. Data quantifying Dap160 fragment pulldowns of Nwk FBAR. Raw data quantifying Dap160 abundance in control and dap160 rnai-expressing NMJs.

    Figure 4—source data 1. Source data for Figure 4.

    Raw data quantifying pyrene-actin assembly kinetics with Nwk, Dap160, and WASp. Raw data quantifying pyrene-actin assembly kinetics with Nwk, Dap160, WASp, and liposomes.

    Figure 5—source data 1. Source data for Figure 5 and associated figure supplements.

    Source data quantifying liposome cosedimentation of Nwk with increasing concentrations of Dap160SH3CD. Annotated gels quantifying liposome cosedimentation of Nwk with increasing concentrations of Dap160SH3CD. Raw gels quantifying liposome cosedimentation of Nwk with increasing concentrations of Dap160SH3CD. Annotated gels quantifying liposome cosedimentation of Nwk and Dap160 fragments with increasing concentrations of PI(4,5)P2. Raw gels quantifying liposome cosedimentation of Nwk and Dap160 fragments with increasing concentrations of PI(4,5)P2. Source data quantifying liposome cosedimentation of Nwk and Dap160 fragments with increasing concentrations of PI(4,5)P2. Source data quantifying FRAP recovery and curve fitting of Nwk::GFP in control and dap160 RNAi-expressing neuromuscular junctions (NMJs). Annotated gels quantifying liposome cosedimentation of NwkΔSH3b and Dap160 fragments. Raw gels quantifying liposome cosedimentation of NwkΔSH3b and Dap160 fragments. Source data quantifying liposome cosedimentation of NwkΔSH3b and Dap160 fragments.

    Figure 6—source data 1. Source data for Figure 6 and associated figure supplements.

    Source data quantifying actin patch dynamics in control and nwk mutant neuromuscular junctions (NMJs). Source data quantifying actin patch dynamics in control and Dap160 transgene rescue NMJs. Source data showing raw patch frequency values in control NMJs and % difference between control and nwk mutant NMJs measured over the indicated parameter space. Samples are the same video dataset as in Figure 6A–C. Data showing the coefficient of variation over time of GMA signal intensity in control and nwk mutant NMJs. Samples are the same video dataset as in Figure 6A–C. Data showing the area fraction of highly variant (Std Dev over time) pixels in control and nwk mutant NMJs, thresholded by two methods. Samples are the same video dataset as in Figure 6A–C.

    Figure 7—source data 1. Source data for Figure 7 and associated figure supplements.

    Source data showing intensity dynamics over time from the kymographs shown in Figure 7A. Contains raw Pearson’s correlation values between Lifeact::Ruby, clc::GFP, BRP::GFP, and Arp3::GFP. Source data quantifying actin dynamics in control and shiTS1 mutant neuromuscular junctions (NMJs). Source data quantifying FM dye uptake in control and nwk mutant NMJs. Source data quantifying FM dye uptake in control and Dap160 transgene rescue NMJs. Source data quantifying the radial distribution (from edge to center of boutons) of AP2 and Clc. Source data quantifying colocalization between AP2 and Lifeact::Ruby. Source data quantifying satellite bouton counts in Dap160 transgene rescue NMJs. Source data quantifying FM dye uptake and unloading in control and nwk mutant NMJs. Source data quantifying FM dye uptake and unloading in control and Dap160 transgene rescue NMJs.

    Source code 1. This file contains the code used in this manuscript as follows.

    Code used to generate toy data analyzed in Figure 6—figure supplement 2. Code used to analyze toy data analyzed in Figure 6—figure supplement 2. Code used to analyze channel intensity and distribution for Figure 1—figure supplement 1F, Figure 3D, Figure 3—figure supplement 2B-D, Figure 7F–I, Figure 7—figure supplement 3. Code used to analyze channel colocalization in 3D for Figure 1F, Figure 2D,F, Figure 3E, Figure 7C, Figure 7—figure supplement 1C.

    elife-69597-code1.zip (19KB, zip)
    Supplementary file 1. Summary of genotypes and statistics for all experiments in this study.
    elife-69597-supp1.docx (23.6KB, docx)
    Transparent reporting form

    Data Availability Statement

    Source data files and source code have been provided for all figures accompanying this manuscript.


    Articles from eLife are provided here courtesy of eLife Sciences Publications, Ltd

    RESOURCES