Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2021 Jul 29;11:15437. doi: 10.1038/s41598-021-95041-3

In vitro monitoring of HTR2A-positive neurons derived from human-induced pluripotent stem cells

Kento Nakai 1,#, Takahiro Shiga 2,#, Rika Yasuhara 3, Avijite Kumer Sarkar 1, Yuka Abe 1, Shiro Nakamura 4, Yurie Hoashi 1, Keisuke Kotani 1, Shoji Tatsumoto 5, Hiroe Ishikawa 5, Yasuhiro Go 5,6,7, Tomio Inoue 4, Kenji Mishima 3, Wado Akamatsu 2, Kazuyoshi Baba 1,
PMCID: PMC8322101  PMID: 34326453

Abstract

The serotonin 5-HT2A receptor (5-HT2AR) has been receiving increasing attention because its genetic variants have been associated with a variety of neurological diseases. To elucidate the pathogenesis of the neurological diseases associated with 5-HT2AR gene (HTR2A) variants, we have previously established a protocol to induce HTR2A-expressing neurons from human-induced pluripotent stem cells (hiPSCs). Here, we investigated the maturation stages and electrophysiological properties of HTR2A-positive neurons induced from hiPSCs and constructed an HTR2A promoter-specific reporter lentivirus to label the neurons. We found that neuronal maturity increased over time and that HTR2A expression was induced at the late stage of neuronal maturation. Furthermore, we demonstrated successful labelling of the HTR2A-positive neurons, which had fluorescence and generated repetitive action potentials in response to depolarizing currents and an inward current during the application of TCB-2, a selective agonist of 5-HT2ARs, respectively. These results indicated that our in vitro model mimicked the in vivo dynamics of 5-HT2AR. Therefore, in vitro monitoring of the function of HTR2A-positive neurons induced from hiPSCs could help elucidate the pathophysiological mechanisms of neurological diseases associated with genetic variations of the HTR2A gene.

Subject terms: Neuroscience, Stem cells

Introduction

Serotonin is a neurotransmitter involved in many physiological functions in the brain1,2. The serotonin 5-HT2A receptor (5-HT2AR) is a serotonin receptor subtype encoded by the 5-HT2AR gene (HTR2A). Mutations in this gene are associated with susceptibility to a variety of neurological diseases. For example, rs6313 (also called T102C3) and rs6311, which is in complete linkage disequilibrium with rs631346, are genetic polymorphisms of HTR2A. They have been associated with schizophrenia7,8, psychotic symptoms in Alzheimer’s disease9, certain features of depression10, sleep breathing disorders11, and sleep bruxism12.

Understanding the functional consequences of genetic variants is a critical first step towards appreciating their roles in disease development. While previous case–control studies have reported a significant association of genetic polymorphisms of HTR2A with a variety of neurological diseases715, the effect of the variants on disease pathogenesis has not been elucidated in detail, mainly because of the limited accessibility to the brain. In vitro modelling of human diseases using disease-specific human-induced pluripotent stem cells (hiPSCs) has the potential to provide dramatic progress in the elucidation of the pathogenic mechanisms of neurological diseases1620.

To construct an in vitro HTR2A-related disease model using hiPSCs, we have previously established a protocol to induce HTR2A-expressing neurons from hiPSCs. Here, we investigated the maturation stages and electrophysiological properties of HTR2A-positive neurons induced from hiPSCs using our previously established protocol. We also developed reporter lentiviruses, which contain a HTR2A promoter-driven fluorescent protein (ZsGreen1) expression construct, to identify and enrich for HTR2A-positive neurons. Furthermore, we confirmed the electrophysiological responses of the fluorescently labelled neurons derived from hiPSCs to application of the 5-HT2A R agonist, TCB-2. Our newly established monitoring system of HTR2A-positive neurons derived from hiPSCs is expected to be a promising method to elucidate the pathological mechanism of neurological diseases associated with genetic variations of HTR2A. To the best of our knowledge, this is the first report of an in vitro, cell-level monitoring system specific to HTR2A-positive neurons.

Results

Generation and characterization of neurons derived from hiPSCs

The hiPSC line (C2)20 was cultured in D-MEM medium to induce a chemically provoked transitional embryoid-body-like state (CtraS)21. Neuronal differentiation from hiPSCs was conducted according to a previously reported protocol20 with slight modification (Fig. 1a). The day when the medium was changed to KBM medium, was defined as day in vitro (DIV) 0. To investigate the neuronal nature of hiPSC-derived neurons, the expression of Nestin (a neural progenitor cell marker), βIII-tubulin (a neuron marker), and MAP2 (a mature neuron marker) was analyzed in hiPSCs at DIV 10, 31, 41, and 51 (Fig. 1b). In early stages of the protocol, cells expressed Nestin (DIV 10) and βIII-tubulin (DIV 31), suggesting the successful neuronal differentiation of hiPSCs. The gene expression of Nestin was decreased from DIV 41 onwards. The levels of gene expression of MAP2 increased in a time-dependent manner until DIV 41. Extensive immunocytochemical analyses of MAP2 protein in hiPSCs at DIV 33 showed that 54.4 ± 10.3% (mean ± s.e.m., n = 3) of the stained cells were MAP2-positive (Fig. 1c).

Figure 1.

Figure 1

Generation and characterization of neurons induced from hiPSCs. (a) A schematic of the protocol for neuronal induction from hiPSCs. The numbers under the line show the days in culture (DIV, days in vitro). (b) Gene expression of the neural progenitor cell marker, Nestin, and the neuronal markers, βIII-tubulin and MAP2, in hiPSCs at DIV 10, 31, 41, and 51. The results are expressed as the mean ± s.e.m. of triplicate samples (n = 3). (ANOVA, Dunnet’s test, *p < 0.05, **p < 0.01). (c) MAP2 immunofluorescence (magenta) in hiPSCs at DIV 33. A merged image with DAPI-stained nuclei (blue) is shown (scale bar = 50 μm).

We next investigated the gene expression of HTR2A. The expression of HTR2A mRNA was first detected after DIV 31. Thereafter, it increased in a time-dependent manner until DIV 51 (Fig. 2a). 5-HT2AR protein immunofluorescence was found in 32.2 ± 7.0% of the induced neurons at DIV 33 (Fig. 2b,c).

Figure 2.

Figure 2

HTR2A-positive neurons among induced hiPSCs. (a) The gene expression of HTR2A in hiPSCs at DIV 10, 31, 41, and 51. The results are expressed as the mean ± s.e.m. of triplicate samples (n = 3) (ANOVA, Dunnet’s test, *p < 0.05). (b) Immunofluorescence for 5-HT2AR (green), MAP2 (red), and DAPI for nuclear staining (blue). The 5-HT2AR- and MAP2-double–positive cells (yellow) are indicated in the merged picture (scale bar = 50 μm). (c) Proportion of 5-HT2AR-positive and 5-HT2AR-negative neurons.

Live-cell labelling of hiPSC-derived neurons dependent on HTR2A promoter activity

To distinguish HTR2A-positive neurons from HTR2A-negative ones, we generated a lentiviral ZsGreen1-expressing-reporter construct dependent on HTR2A promoter activity for the live-cell labelling of neurons (Fig. S1). We amplified two different promoter sequences form human genomic DNA: Prom I and Prom II (Fig. 3a). These sequences were inserted upstream of the luciferase gene of the dual-reporter system. The promoter sequence of Prom I, but not that of Prom II, contains the promoter regulatory sequences 22. Human neuroblastoma SK-N-SH cells23 were used as HTR2A-positive cells, while 293 cells were used as HTR2A-negative cells (Fig. S1b). The HTR2A promoter activity of the reporter lentiviruses containing Prom I was much higher than that of the reporter containing Prom II in SK-N-SH. However, the HTR2A promoter activity of the reporter containing Prom I was not detected in 293 cells (Fig. 3b).

Figure 3.

Figure 3

Detection of HTR2A promoter-specific fluorescently labelled cells among induced hiPSCs. (a) Schematic representation of the HTR2A promoter regions: − 1534 to − 538 (Prom I) and − 2465 to − 1465 (Prom II) upstream of the translation start codon (+ 1). Promoter regulatory sequences contained in Prom I. (b) Luciferase activity induced by the HTR2A promoter in SK-N-SH cells and 293 cells (n = 4). (c) 5-HT2AR immunofluorescence (red) in hiPSCs at DIV 28 transduced with HTR2A promoter-ZsGreen1 (green). A merged image with DAPI for nuclear staining (blue) and extended image are shown at the bottom (scale bar = 50 μm). (d) Phase-contrast images of HTR2A-promoter specific ZsGreen1 after transduction of the empty vector (top; scale bar = 50 μm) or HTR2A promoter-ZsGreen1 (bottom; scale bar = 50 μm) at DIV − 5, 41, and 51. (e) Data were analyzed by flow cytometry after transduction of the empty vector (top) or HTR2A promoter-ZsGreen1 (bottom) at DIV -5, 41, and 51. The indicated number is the ZsGreen1-expressing cell population. (f) ZsGreen1-positive cells as shown by flow cytometry at DIV − 5, 41, and 51. The results are expressed as the mean ± s.e.m. of samples (DIV − 5 and 51: n = 3, DIV 41: n = 5). (g) The gene expression of HTR2A in whole cells at DIV 10 and 41 and ZsGreen1-positive cells at DIV 41. The results are expressed as the mean ± s.e.m. of samples (NS: n = 3, Whole: n = 4, ZsGreen1+: n = 5) (Student’s t-test, N.D. = not detected, *p < 0.01).

Extensive immunocytochemical analyses of 5-HT2AR protein in hiPSCs at DIV 28 transfected with the constructed reporter lentiviruses showed that ZsGreen1-positive cells were co-localized with those that stained positive for 5-HT2AR (Fig. 3c). The proportion of 5-HT2AR-positive cells among the ZsGreen1-positive cells was 77%, while the proportion of ZsGreen1-positive cells among the 5-HT2AR-positive cells was 9% (Fig. S2a–c).

To evaluate the function of the reporter lentivirus, lentivirus-transfected hiPSCs were analyzed using fluorescence microscopy and flow cytometry. The control lentivirus (described as “Empty” in Fig. 3d–f) and constructed reporter lentivirus (described as “HTR2Apro” in Fig. 3d–f) were transfected into hiPSCs. The ZsGreen1-positive cells (DIV-5) were not detected by either fluorescence microscopy or flow cytometry (ZsGreen1-positive cells, 0.97 ± 0.17%) (Figs. 2a, 3d–f). The ZsGreen1-positive cells were detected in neurons derived from hiPSCs at DIV 41 and 51 by fluorescence microscopy, and the positive ratio was 25.2 ± 1.5% and 63.9 ± 2.6%, respectively (Fig. 3d–f). Consistent with this, the sorted ZsGreen1-positive cells at DIV 41 showed significantly higher expression of HTR2A mRNA than the whole-cell lysate (Fig. 3g). Furthermore, single-cell RNA-sequencing (scRNA-seq) analysis performed with hiPSCs at DIV 51 showed that the induced hiPSCs were derived from neurons and glial lineages, and 90% of these cells showed MAP2 gene expression (Fig. 4a–f). In addition, these neurons also showed the expression of synaptic markers such as SYN1, SYN2, SYP and DLG4 (Fig. 4g–j), suggesting that hiPSCs had differentiated into mature neurons. These induced iPSCs-derived neurons showed expression of glutamatergic, GABAergic, cholinergic, dopaminergic, and serotonergic neuronal markers (Fig. S3a–e). A total of 24% of MAP2-positive cells were HTR2A-positive (Fig. 4b,k). In addition, 5% of the MAP2-positive cells were ZsGreen1-positive (Fig. 4l), and the HTR2A-positive rate was 80% (4 cells/5 cells; Fig. S3f). At the same time, 18% of the HTR2A-positive cells were ZsGreen1-positive (4 cells/22 cells; Fig. S3g). These results suggested that ZsGreen1 expression reflects the gene expression of HTR2A with high specificity. This is a useful tool to identify HTR2A-positive cells among hiPSC-derived neurons. In addition, HTR2A and ZsGreen1-positive cells showed relatively high expression of glutamatergic, GABAergic and cholinergic neuron markers (Fig. 4m).

Figure 4.

Figure 4

Characterizing the heterogeneity of iPSCs at DIV 51. Single-cell RNA-sequencing of hiPSCs shows neurons and glia. (a) UMAP plot of 2 clusters over 102 single cells shows neuronal and glial subtypes. The clusters were determined based on a K-nearest neighbor (KNN) graph. (b) Proportion of MAP2-positive, MAP2-negative, HTR2A-positive and HTR2A-negative cells. Violin plots of cell subtype markers, (c) neurons (MAP2), (d) immature neurons (TUBB3), (e) glia (SLC1A3), (f) oligodendrocyte progenitor cell (PDGRFA), (gj) mature neurons (SYN1,SYN2, SYP, DLG4), and target markers, (k) HTR2A, (l) ZsGreen1. Black dots represent the expression level on each cell. (m) Gene expression of cell subtype markers in ZsGreen1 and HTR2A-positive cells.

Functional properties of ZsGreen1-positive neurons

To investigate the electrophysiological properties and the responsiveness of HTR2A-positive neurons derived from lentivirus-transfected hiPSCs to a 5-HT2AR agonist, whole-cell patch-clamp recordings were performed on ZsGreen1-positive (n = 15) and negative (n = 7) neurons at DIV 42–67.

In the current-clamp configuration, all recorded cells were capable of generating repetitive action potentials (AP) in response to further depolarizing current injections (Fig. 5a,b). The mean peak AP firing frequency for ZsGreen1-positive and ZsGreen1-negative neurons were 18.7 ± 2.5 Hz and 21.4 ± 4.8 Hz respectively (Fig. 5c). The average resting membrane potential was − 60.7 ± 2.6 mV for ZsGreen1-positive and − 61 ± 1.9 mV for ZsGreen1-negative neurons (Fig. 5d). Input resistance was 741.6 ± 60.2 MΩ for ZsGreen1-positive and 774.0 ± 75.6 MΩ for ZsGreen1-negative neurons (Fig. 5e). Cell capacitance was 39.6 ± 3.3 pF for ZsGreen1-positive and 38.3 ± 5.8 pF for ZsGreen1-negative neurons (Fig. 5f). An Injection of a 300-ms depolarizing current pulse elicited action potentials with amplitude of 91.6 ± 2.5 mV for ZsGreen1-positive and 91.9 ± 3.7 mV for ZsGreen1-negative neurons (Fig. 5g) and half width 3.5 ± 0.4 ms and 2.5 ± 0.2 ms at first spike for ZsGreen1-positive and ZsGreen1-negative neurons, respectively (Fig. 5h).

Figure 5.

Figure 5

Functional properties of ZsGreen1-positive neurons. (a) Translucent (left) and fluorescent (right) images of a ZsGreen1-positive neuron during whole-cell patch-clamp recording at DIV 67 (scale bar = 50 μm). (b) Representative traces of membrane potentials in response to injected hyperpolarizing and depolarizing current pulses (− 60, 0, and 50 pA) with 300 ms duration in a ZsGreen1-positive neuron. Repetitive action potentials were evoked by 50-pA injected current. (c) Quantitative analysis of frequency-current relationship among ZsGreen1-positive (green) and ZsGreen1-negative (gray) neurons. (dh) Quantitative analysis of (d) resting membrane potential, (e) input resistance, (f) cell capacitance, (g) action potential amplitude and (h) half width of ZsGreen1-positive and ZsGreen1-negative neurons (ZsGreen1-positive: n = 15, ZsGreen1-negative: n = 7) (Student’s t-test, N.S. = not significant). (i) Representative TCB-2-induced current traces in a ZsGreen1-positive neuron. (j) Proportion of TCB-2-responsive and nonresponsive neurons (n = 10). Data were analyzed on a personal computer using pCLAMP 10.7 software (Molecular Devices, Sunnyvale, CA, USA, https://www.moleculardevices.com) and Origin 2019 (OriginLab, Northampton, MA, USA, https://www.originlab.com).

We next examined the effect of TCB-2, which is a selective agonist of 5-HT2ARs, on the ZsGreen1-positive and negative neurons at a holding potential of − 60 mV under the voltage-clamp configuration. Bath application of TCB-2 (40 μM) produced an inward current (14.1 ± 1.2 pA of amplitude) in 70% of the ZsGreen1-positive neurons (n = 10) (Fig. 5i,j). In contrast, ZsGreen1-negative neurons exhibited no response to TCB-2 (n = 6). These data suggested that ZsGreen1-positive neurons derived from hiPSCs are electrophysiologically active and functionally express 5-HT2AR.

Discussion

The use of hiPSCs derived from patients with a certain neurological disease allows the preparation of brain cells that contain the actual genetic information of the patients themselves2427. This is a notable feature given that such cells have been technologically and ethically difficult to obtain in the past28. We have already reported the successful induction of HTR2A-expressing neurons of ventral hindbrain region derived from hiPSCs by controlling the regional identity along the anteroposterior axes and the dorsoventral axes20,29. In this study, using the same method with slight modifications, we further investigated the time course of the maturation of HTR2A-expressing neurons induced from hiPSCs to determine the optimal culture duration for the functional analyses. In these HTR2A-expressing neurons, the expression of neuronal markers and the HTR2A gene increased over time up to DIV 41 and 51, respectively. Based on this result, we conducted the functional analyses using induced neurons at DIV 41 or later.

To identify the adequate target cells to conduct functional analyses, we developed a reporter lentivirus, which was capable of labelling HTR2A. Prom I, the adopted HTR2A promoter, showed higher activity than that of Prom II in HTR2A-positive cells, but no activity in HTR2A-negative cells. This suggested that multiple transcription factors encompassed in Prom I, like Sp1, PEA3, E-box, CRE binding proteins, CACCC box and CCAAT box were interacted22. This could be applied not only to electrophysiological analysis of the target cells but also to quantify the proportion of cells expressing HTR2A among all the induced cells in the hiPSC culture. The proportion of sorted ZsGreen1-positive cells increased in a time-dependent manner, reaching 64% at DIV 51. This result was consistent with the increase in the expression level of HTR2A mRNA. Besides, in scRNA-seq analysis, 80% of the ZsGreen1-positive cells were HTR2A-positive, which indicated that ZsGreen1 expression reflects HTR2A gene expression with high specificity. We believe that this result is due to the low sensitivity of scRNA-seq. In the flow cytometry experiment, a relatively high percentage (64%) of ZsGreen1-positive cells were MAP2-positive, and we believe that we are able to detect neurons with high sensitivity. In fact, since we used flow cytometry for detection, we expected to be able to detect cells with higher sensitivity than that observed in the scRNA-seq experimental results (18%).

Furthermore, HTR2A and ZsGreen1-positive cells were likely to be glutamatergic, or GABAergic or cholinergic neurons. Since several neurological diseases might be associated with specific neuronal populations, such as GABAergic neurons3033, it is desirable to develop a tool that can label not only HTR2A but also specific types of neurons. Such a strategy should be developed in the future.

Additionally, we successfully showed that HTR2A-positive neurons derived from hiPSCs exhibited repetitive action potentials in response to depolarizing current injection, which was consistent with the activity pattern recorded from the neurons induced from hiPSCs in previous studies34,35. Regarding the 5-HT2AR-specific cell responses, application of TCB-2 generated inward currents in HTR2A-positive neurons, which was also consistent with a previous report36. These results strongly suggested that the dynamics of the neurons induced from hiPSCs was similar to that of 5-HT2AR-expressing neurons in vivo, because 5-HT2AR agonists are supposed to cause cell membrane depolarization in these neurons1,37.

In conclusion, our in vitro monitoring system allowed the identification and functional analysis of HTR2A-positive neurons induced from hiPSCs, which could be used to elucidate the pathophysiological mechanism of various neurological diseases associated with genetic variations of the HTR2A gene712,38,39.

Methods

All experimental procedures using hiPSCs were approved by the Showa University Ethics Committee for Genome Research (approval no. 179) and the Juntendo University School of Medicine Ethics Committee (approval no. 2016117). The study protocol was in accordance with the 1964 Declaration of Helsinki and its later amendments or comparable ethical standards.

hiPSC culture

All the experiments were performed with the hiPSC line (C2)20. hiPSCs were generated from monocytes in peripheral blood samples of the healthy adult20 and formal informed consent was obtained from the subject. hiPSCs were cultured on mitomycin C-treated SNL murine fibroblast feeder cells in standard hESC medium (DMEM/F12, Sigma Aldrich, St. Louis, MO) containing 20% KnockOut Serum Replacement (KSR; Thermo Fisher Scientific, Waltham, MA), 2 mM l-glutamine, 0.1 mM non-essential amino acids (Sigma Aldrich), 0.1 mM 2-mercaptoethanol (Sigma Aldrich), 0.5% penicillin/streptomycin, and 4 ng/ml fibroblast growth factor 2 (FGF-2; PeproTech, Rocky Hill, NJ) in an atmosphere containing 3% CO2. The medium was changed every other day.

Neuronal differentiation of hiPSCs

hiPSCs were pretreated for 5 days with 3 μM SB431542 (Tocris, Bristol, UK), 3 μM dorsomorphin (Sigma Aldrich), and 3 μM CHIR99021 (ReproCELL, Kanagawa, Japan). They were then dissociated and seeded at a density of 10 cells/μl39 in KBM Neural Stem Cell medium (Kohjin-Bio, Saitama, Japan) with selected growth factors and inhibitors under conditions of 4% O2/5% CO2. The growth factors and inhibitors included 1 × B-27 supplement (Thermo Fisher Scientific), 0.5% penicillin/streptomycin, 20 ng/ml FGF-2, 2 μM SB431542, and 3 μM CHIR99021. The neurosphere culture was started at day in vitro (DIV) 0, and neurospheres were passaged at a density of 50 cells/μl on DIV 7 and 14. The following additives were included in the neurosphere culture medium: 10 μM Y-27632 (Fujifilm, Tokyo, Japan) on DIV 0–7 and 100 ng/ml Shh-C24II (R&D Systems, Minneapolis, MN) and 1 μM purmorphamine (Millipore, Burlington, MA) on DIV 1–21. On DIV 21, neurospheres were replated on dishes coated with poly-l-lysine solution and fibronectin and cultured under conditions of 5% CO2 at a density of 40 × 104 cells/well in a 48-well plate, 150 × 104 cells/well in a 12-well plate, or 300 × 104 cells/well in a 6-well plate. The medium was changed to Neurobasal Plus Medium (Thermo Fisher Scientific) supplemented with 1 × B-27 Plus supplement (Thermo Fisher Scientific), 0.5% penicillin/streptomycin, 20 ng/ml brain-derived neurotrophic factor (BDNF; BioLegend, San Diego, CA), 20 ng/ml glial cell-derived neurotrophic factor (GDNF; Alomone Labs, Jerusalem BioPark, Israel), 0.2 mM ascorbic acid (Sigma Aldrich), 0.5 mM dbcAMP (Nacalai Tesque, Kyoto, Japan), 1 ng/ml transforming growth factor-β (TGF-β; BioLegend), 10 μM DAPT (Sigma Aldrich), and 3 μM CHIR99021. Half of the volume of medium was replaced with new medium (including all supplements except CHIR99021) every 3 or 4 days.

Reverse transcription and quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated with the RNeasy mini kit (QIAGEN, Hilden, Germany) and the RNeasy micro kit (QIAGEN) with DNase I treatment. cDNA was prepared by using SuperScript First-Standard (Thermo Fisher Scientific) or the TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific). qRT-PCR analysis was performed on a QuantStudio 7 Flex (Thermo Fisher Scientific). Values were normalized to ACTB expression. Reactions were carried out in duplicate, and data were analyzed by using the comparative (ddCt) method. Relative expression levels are presented as geometric means ± geometric standard error of the mean (s.e.m.). The primer sets used in the SYBR Green assay are listed in Table 1. Custom primers for the GAPDH gene (PN4453320; Thermo Fisher Scientific) and HTR2A gene (PN4448892; Thermo Fisher Scientific) were used in the TaqMan assay.

Table 1.

Primers used for RT-qPCR.

Primer Primer sequence (5′ → 3′)
Nestin Forward: TTCCCTCAGCTTTCAGGACCCCAA
Reverse: AAGGCTGGCACAGGTGTCTCAA
βIII-tubulin Forward: ATTTCATCTTTGGTCAGAGTGGGC
Reverse: TGCAGGCAGTCGCAGTTTTCAC
MAP2 Forward: CCGTGTGGACCATGGGGCTG
Reverse: GTCGTCGGGGTGATGCCACG
Β-actin Forward: TGAAGTGTGACGTGGACATC
Reverse: GGAGGAGCAATGATCTTGAT

Immunofluorescence analysis

Cells were subsequently fixed with 4% paraformaldehyde for 30 min at room temperature and then washed three times with phosphate-buffered solution (PBS). After incubating with blocking buffer (PBS containing 5% normal fetal bovine serum, 0.01% sodium azide, and 0.3% Triton X-100) for 15 min at room temperature, the cells were incubated overnight at 4 °C with primary antibodies diluted with PBS containing 0.05% Triton X-100. As primary antibodies, anti-βIII-tubulin (1:500; Biolegend), anti-5-HT2AR (1:200; Millipore), and anti-MAP2 (1:5000; Abcam, Cambridge, UK) antibodies were used. The cells were again washed three times with PBS and incubated with secondary antibodies conjugated with Alexa Fluor 488 (1:500; Thermo Fisher Scientific), Alexa Fluor 594 (1:500; Thermo Fisher Scientific) for 1 h and Hoechst 33342 (1:1000; Sigma Aldrich) for 10 min at room temperature. After washing three times with PBS, samples were mounted on slides and examined by using an all-in-one fluorescence microscope (Keyence, Osaka, Japan).

Transduction and detection of HTR2A promoter activity-induced ZsGreen1 expression in hiPSCs

For lentiviral packaging, the pLV-hHTR2Apro-ZsGreen1 plasmid containing the HTR2A promoter sequence was co-transfected with the Lentiviral High Titer Packaging Mix (Takara, Shiga, Japan) using Fugene HD (Promega, Madison, WI) into LentiX-293 T cells (Z2180N; Takara). The 48-h–cultured supernatant was filtrated through 0.45-μm pore cellulose acetate filters (Millipore) and concentrated using Centriprep Centrifugal Filters (Millipore). Viral titration was determined by flow cytometric quantification of ZsGreen1-positive cells. Lenti-HTR2A-ZsGreen1 particles were transduced into hiPSCs at a multiplicity of infection (MOI) of 10 (Fig. S1). Flow cytometry was performed to measure HTR2A promoter activity that induced ZsGreen1 expression in hiPSCs. The lentivirus was transduced into hiPSCs at DIV 22 and hiPSCs were collected at DIV 41 and 51. As a negative control of HTR2A, the lentivirus was transduced into hiPSCs at DIV-10 and hiPSCs were collected at DIV-5. ZsGreen1-positive cells were sorted using the SH800 cell sorter (Sony, Tokyo, Japan). Dead cells were excluded by staining with Fixable Viability Dye eFlour 450 (Thermo Fisher Scientific) before fluorescence-activated cell sorting analysis.

Transfection and luciferase assay

HTR2A reporter plasmids were co-transfected with a Renilla luciferase-expressing plasmid (E2241, pRL-TK-luc; Promega) to normalize transfection efficiency in neuroblastoma SK-N-SH cells (RCB0426; RIKEN BRC, Saitama, Japan through the National BioResource Project of the MEXT/AMED, Japan) or 293 cells. Transfection was performed using Fugene HD (Promega) according to the manufacturer’s instructions. pGL4.13-SV40 (E6681; Promega) was used as a positive control. Luciferase activities were measured using the Dual-Glo Luciferase Assay System (E2920; Promega), and the ratio of firefly luminescence to Renilla luminescence was used to express reporter activity.

Single-cell RNA-sequencing

HTR2A transfected hiPSCs at DIV 51 were used for single-cell RNA-seq. The transcriptome library was prepared using Chromium Single Cell 3′ Reagent Kits v3 (10× Genomics) according to the manufacturer’s instructions. The single-cell RNA-seq libraries were sequenced using the DNBSEQ-G400 platforms (MGI Tech Co., Ltd.). Data analysis was performed with Cell Ranger (v4.0.0) and Seurat (v4.0.0).

Patch-clamp recordings

Whole-cell patch-clamp recordings were performed at room temperature under continuous perfusion with an extracellular solution containing (in mM): NaCl (130), NaHCO3 (26), glucose (10), KCl (3), CaCl2 (2), MgCl2 (2), and NaH2PO4 (1.25). The solution was oxygenated with 95% O2 and 5% CO2, to establish a pH of 7.4. HTR2A-positive hiPSCs were identified under fluorescence and infrared differential interference contrast microscopy on an upright microscope (BX51WI; Olympus, Tokyo, Japan) using a 40× water immersion objective, and selected for recordings based on a spherical and bright cell body. ZsGreen1 reporter fluorescence was detected with a U-MNIBA3 filter cube (excitation: 460–495 nm, dichroic mirror: 505 nm, emission: 510–550 nm; Olympus, Tokyo, Japan) and processed with MetaMorph software (MetaMorph; Molecular Devices, Sunnyvale, CA). Patch pipettes were pulled from borosilicate glass (GD-1.5; Narishige, Tokyo, Japan) with a P-97 puller (Sutter, Atlanta, GA). Pipettes were filled with an internal solution containing (in mM): KCl (10), K-gluconate (130), HEPES (10), EGTA (0.4), MgCl2 (2), Na2-GTP (0.3), and Mg-ATP (2), pH 7.25, 285–300 mOsm. The pipette resistance ranged from 2.5 to 5.0 MΩ when the electrodes were filled with the internal solution. Membrane potentials and currents were recorded with a MultiClamp 700B amplifier and a Digidata 1440A (Molecular Devices) and the data were filtered at 10 kHz, digitized at 20 kHz, and analysed using pCLAMP 10.7 software (Molecular Devices) and Origin 2019 (OriginLab). The measured liquid junction potential of 10 mV was subtracted from all membrane potentials. The cell capacitance and input resistance were calculated under voltage clamp mode from the current to a 10-mV hyperpolarizing step pulse at a holding potential of − 60 mV. TCB-2 induced inward currents were defined as downward deflections of more than 2 standard deviations above baseline.

Statistical analysis

Statistical analysis was performed with Student’s t-test or one-way analysis of variance (ANOVA) with post hoc Dunnett’s test. The data are presented as the mean ± s.e.m.

Supplementary Information

Acknowledgements

The authors thank Dr. Hideyuki Okano, Professor of Department of Physiology, Keio University School of Medicine, Tokyo, Japan, for providing iPSCs. This work was supported in part by JSPS KAKENHI Grant Numbers 17H04395, 17K17191.

Author contributions

Study conception and design: I.T., M.K., A.W., B.K. Performing the experiments: N.K., S.T., Y.R., A.K.S., I.H., G.Y., A.Y., H.Y., K.K. Data analysis: N.K., S.T., Y.R., N.S., A.K.S., T.S., G.Y. Financial support: H.Y., B.K. Writing a first draft of the manuscript: N.K., S.T., Y.R., A.K.S., G.Y., A.Y., N.S., H.Y., K.K., I.T., M.K., A.W., B.K.

Competing interests

The authors declare no competing interests.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

These authors contributed equally: Kento Nakai and Takahiro Shiga.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-021-95041-3.

References

  • 1.Guiard BP, Di Giovanni G. Central serotonin-2A (5-HT2A) receptor dysfunction in depression and epilepsy: The missing link? Front. Pharmacol. 2015;6:46. doi: 10.3389/fphar.2015.00046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Lee YA, Goto Y. The roles of serotonin in decision-making under social group conditions. Sci. Rep. 2018;8:10704. doi: 10.1038/s41598-018-29055-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Polesskaya OO, Aston C, Sokolov BP. Allele C-specific methylation of the 5-HT2A receptor gene: Evidence for correlation with its expression and expression of DNA methylase DNMT1. J. Neurosci. Res. 2006;83:362–373. doi: 10.1002/jnr.20732. [DOI] [PubMed] [Google Scholar]
  • 4.Saiz PA, et al. Association between the A-1438G polymorphism of the serotonin 2A receptor gene and nonimpulsive suicide attempts. Psychiatr. Genet. 2008;18:213–218. doi: 10.1097/YPG.0b013e3283050ada. [DOI] [PubMed] [Google Scholar]
  • 5.Turecki G, et al. Prediction of level of serotonin 2A receptor binding by serotonin receptor 2A genetic variation in postmortem brain samples from subjects who did or did not commit suicide. Am. J. Psychiatry. 1999;156:1456–1458. doi: 10.1176/ajp.156.9.1456. [DOI] [PubMed] [Google Scholar]
  • 6.Parsons MJ, D’Souza UM, Arranz MJ, Kerwin RW, Makoff AJ. The -1438A/G polymorphism in the 5-hydroxytryptamine type 2A receptor gene affects promoter activity. Biol. Psychiatry. 2004;56:406–410. doi: 10.1016/j.biopsych.2004.06.020. [DOI] [PubMed] [Google Scholar]
  • 7.Williams J, McGuffin P, Nothen M, Owen MJ. Meta-analysis of association between the 5HT(2a) receptor T102C polymorphism and schizophrenia. Lancet. 1997;349:1221. doi: 10.1016/S0140-6736(05)62413-0. [DOI] [PubMed] [Google Scholar]
  • 8.Inayama Y, et al. Positive association between a DNA sequence variant in the serotonin 2A receptor gene and schizophrenia. Am. J. Med. Genet. 1996;67:103–105. doi: 10.1002/(SICI)1096-8628(19960216)67:1<103::AID-AJMG18>3.0.CO;2-S. [DOI] [PubMed] [Google Scholar]
  • 9.Holmes C, Arranz MJ, Powell JF, Collier DA, Lovestone S. 5-HT(2A) and 5-HT(2C) receptor polymorphisms and psychopathology in late onset Alzheimer’s disease. Hum. Mol. Genet. 1998;7:1507–1509. doi: 10.1093/hmg/7.9.1507. [DOI] [PubMed] [Google Scholar]
  • 10.Arias B, Gutiérrez B, Pintor L, Gastó C, Fañanás L. Variability in the 5-HT2A receptor gene is associated with seasonal pattern in major depression. Mol. Psychiatry. 2001;6:239–242. doi: 10.1038/sj.mp.4000818. [DOI] [PubMed] [Google Scholar]
  • 11.Xu H, Guan J, Yi H, Yin S. A systematic review and meta-analysis of the association between serotonergic gene polymorphisms and obstructive sleep apnea syndrome. PLoS ONE. 2014;9:e86460. doi: 10.1371/journal.pone.0086460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Abe Y, et al. Association of genetic, psychological and behavioral factors with sleep bruxism in a Japanese population. J. Sleep Res. 2012;21:289–396. doi: 10.1111/j.1365-2869.2011.00961.x. [DOI] [PubMed] [Google Scholar]
  • 13.Unschuld PG, et al. Polymorphisms in the serotonin receptor gene HTR2A are associated with quantitative traits in panic disorder. Am. J. Med. Genet. B Neuropsychiatr. Genet. 2007;144:424–429. doi: 10.1002/ajmg.b.30412. [DOI] [PubMed] [Google Scholar]
  • 14.Fernàndez-Castillo N, et al. Association study of 37 genes related to serotonin and dopamine neurotransmission and neurotrophic factors in cocaine dependence. Genes Brain Behav. 2013;12:39–46. doi: 10.1111/gbb.12013. [DOI] [PubMed] [Google Scholar]
  • 15.Porcelli S, et al. Alzheimer’s disease and neurotransmission gene variants: focus on their effects on psychiatric comorbidities and inflammatory parameters. Neuropsychobiology. 2019;78:79–85. doi: 10.1159/000497164. [DOI] [PubMed] [Google Scholar]
  • 16.Fujimori K, et al. Modeling sporadic ALS in iPSC-derived motor neurons identifies a potential therapeutic agent. Nat. Med. 2018;24:1579–1589. doi: 10.1038/s41591-018-0140-5. [DOI] [PubMed] [Google Scholar]
  • 17.Higurashi N, et al. A human Dravet syndrome model from patient induced pluripotent stem cells. Mol. Brain. 2013;6:19. doi: 10.1186/1756-6606-6-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Imaizumi Y, et al. Mitochondrial dysfunction associated with increased oxidative stress and α-synuclein accumulation in PARK2 iPSC-derived neurons and postmortem brain tissue. Mol. Brain. 2012;5:35. doi: 10.1186/1756-6606-5-35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Andoh-Noda T, et al. Differentiation of multipotent neural stem cells derived from Rett syndrome patients is biased toward the astrocytic lineage. Mol. Brain. 2015;8:31. doi: 10.1186/s13041-015-0121-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hoashi Y, et al. Generation of neural cells using iPSCs from sleep bruxism patients with 5-HT2A polymorphism. J. Prosthodont. Res. 2017;61:242–250. doi: 10.1016/j.jpor.2016.11.003. [DOI] [PubMed] [Google Scholar]
  • 21.Fujimori K, et al. Escape from pluripotency via inhibition of TGF-β/BMP and activation of Wnt signaling accelerates differentiation and aging in hPSC progeny cells. Stem Cell Rep. 2017;9:1675–1691. doi: 10.1016/j.stemcr.2017.09.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Zhu QS, Chen K, Shih JC. Characterization of the human 5-HT2A receptor gene promoter. J. Neurosci. 1995;15:4885–4895. doi: 10.1523/JNEUROSCI.15-07-04885.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Marinova Z, Walitza S, Grünblatt E. 5-HT2A serotonin receptor agonist DOI alleviates cytotoxicity in neuroblastoma cells: Role of the ERK pathway. Prog. Neuro-Psychopharmacol. Biol. Psychiatry. 2013;44:64–72. doi: 10.1016/j.pnpbp.2013.01.017. [DOI] [PubMed] [Google Scholar]
  • 24.Saporta MA, Grskovic M, Dimos JT. Induced pluripotent stem cells in the study of neurological diseases. Stem Cell Res Ther. 2011;2:37. doi: 10.1186/scrt78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Park IH, et al. Disease-specific induced pluripotent stem cells. Cell. 2008;134:877–886. doi: 10.1016/j.cell.2008.07.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Robinton DA, Daley GQ. The promise of induced pluripotent stem cells in research and therapy. Nature. 2012;481:295–305. doi: 10.1038/nature10761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Bellin M, Marchetto MC, Gage FH, Mummery CL. Induced pluripotent stem cells: the new patient? Nat. Rev. Mol. Cell Biol. 2012;13:713–726. doi: 10.1038/nrm3448. [DOI] [PubMed] [Google Scholar]
  • 28.Imaizumi Y, Okano H. Modeling human neurological disorders with induced pluripotent stem cells. J. Neurochem. 2014;129:388–399. doi: 10.1111/jnc.12625. [DOI] [PubMed] [Google Scholar]
  • 29.Imaizumi K, et al. Controlling the regional identity of hPSC-derived neurons to uncover neuronal subtype specificity of neurological disease phenotypes. Stem Cell Rep. 2015;5:1010–1022. doi: 10.1016/j.stemcr.2015.10.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Berretta S, Pantazopoulos H, Markota M, Brown C, Batzianouli ET. Losing the sugar coating: Potential impact of perineuronal net abnormalities on interneurons in schizophrenia. Schizophr. Res. 2015;167:18–27. doi: 10.1016/j.schres.2014.12.040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kelley JM, Hughes LB, Bridges SL., Jr Does gamma-aminobutyric acid (GABA) influence the development of chronic inflammation in rheumatoid arthritis? J. Neuroinflam. 2008;5:1. doi: 10.1186/1742-2094-5-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Fan X, Qu F, Wang JJ, Du X, Liu WC. Decreased γ-aminobutyric acid levels in the brainstem in patients with possible sleep bruxism: A pilot study. J. Oral Rehabil. 2017;44:934–940. doi: 10.1111/joor.12572. [DOI] [PubMed] [Google Scholar]
  • 33.Brown ES, Hong SC. Antidepressant-induced bruxism: Successfully treated with gabapentin. J. Am. Dent. Assoc. 1999;130:1467–1469. doi: 10.14219/jada.archive.1999.0057. [DOI] [PubMed] [Google Scholar]
  • 34.Belinsky GS, et al. Patch-clamp recordings and calcium imaging followed by single-cell PCR reveal the developmental profile of 13 genes in iPSC-derived human neurons. Stem Cell Res. 2014;12:101–118. doi: 10.1016/j.scr.2013.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Prè D, et al. A time course analysis of the electrophysiological properties of neurons differentiated from human induced pluripotent stem cells (iPSCs) PLoS ONE. 2014;9:e103418. doi: 10.1371/journal.pone.0103418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Wang H, et al. 5-HT2 receptors mediate functional modulation of GABAa receptors and inhibitory synaptic transmissions in human iPS-derived neurons. Sci. Rep. 2016;6:20033. doi: 10.1038/srep20033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Barnes NM, Sharp T. A review of central 5-HT receptors and their function. Neuropharmacology. 1999;38:1083–1152. doi: 10.1016/S0028-3908(99)00010-6. [DOI] [PubMed] [Google Scholar]
  • 38.Grünblatt E, Hauser TU, Walitza S. Imaging genetics in obsessive-compulsive disorder: Linking genetic variations to alterations in neuroimaging. Prog. Neurobiol. 2014;121:114–124. doi: 10.1016/j.pneurobio.2014.07.003. [DOI] [PubMed] [Google Scholar]
  • 39.Cao J, et al. Association of the HTR2A gene with alcohol and heroin abuse. Hum. Genet. 2014;133:357–365. doi: 10.1007/s00439-013-1388-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials


Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES