Flow cytometry analysis of apoptotic progression and expression analysis of four apoptosis-related genes in Penaeus vannamei in response to white spot syndrome virus infection

Abstract

Flow cytometry analysis was carried out to detect the progression of apoptosis in haemocytes of WSSV infected Penaeus vannamei at different time-points (1.5 hpi, 18 hpi and 56 hpi). Apoptosis in haemocytes was found to increase with time of infectivity from 5.06 to 69.63%. Quantitative real-time PCR (qPCR) was used for the expression analysis of four apoptosis-related genes such as Death-associated protein 1, caspase-5, translationally controlled tumor protein, and cathepsin D. The evidence of apoptosis in haemocytes of P. vannamei was established as shown by significant increase in the percentage of late apoptotic cells due to WSSV infection in shrimp. The present study gives an insight to the apoptosis rate in a WSSV infected shrimp during the course of infection and the role of apoptosis related genes.

Introduction

Apoptosis or programmed cell death occurs in an infected host cell as a defence mechanism to counter the viral propagation. It is a well-studied phenomenon, which occur in shrimps in response to viral infections such as white spot syndrome virus (WSSV) [28, 29] and yellow head virus [11]. The regulation of apoptosis is dependent on several factors such as acuteness of WSSV infection, shrimp tissue and organ specificity, and shrimp species [15]. Various apoptosis regulators such as inhibitor of apoptosis protein [13], caspase [32], translationally controlled tumor protein (TCTP) or fortilin [1] have been identified from shrimp.

In this study, the four apoptosis related genes, Death-associated protein 1 (DAP-1), caspase-5, TCTP, and cathepsin D were analysed for their gene expression during WSSV infection. DAP1, a proline-rich cytoplasmic protein has been reported to positively regulate WSSV replication and apoptosis in shrimps [34]. Another apoptosis related gene, caspase belonging to family of cysteine proteases, has been shown to be up-regulated in shrimps and having a protective role against WSSV infection in P. vannamei [30], P. monodon [32] and M. japonicus [29]. In particular caspase-5 identified as effector caspase from P. vannamei was shown to be up-regulated in the gills, haemocytes, muscle tissues after WSSV infection and silencing of caspase-5 accelerated WSSV infection [30]. TCTP, which is highly conserved across the species, is a multifunctional protein that prevents apoptosis, helps in cell growth and cell cycle progression, and has anti-pathogen activities [3]. It was shown to be up-regulated during the WSSV infection in P. monodon [7]. The underlying mechanism of apoptosis regulation by TCTP remains largely unknown. However, using insect cell model system, it was observed that TCTP inhibited the expression of WSSV genes that are involved during early and late stages of infection [17]. The shrimp TCTP may play a vital role in regulation of apoptosis pathway in response to WSSV-infection, however further studies are required to resolve the exact functional role of TCTP during apoptosis. Cathepsin D, is an aspartic endopeptidase and in addition to enzymatic activity, it is involved in cell signaling and in regulation of apoptosis [2, 6]. In mammalian cells the role of cathepsin in regulation of apoptosis by various pathways, including the activation of caspases is well documented [5], however, in shrimps their functional role is still not very clear. In crustaceans, it is shown to have biological role in innate immune response [35].

In the present study, flow cytometry was used to analyse the apoptotic progression in the haemocytes of WSSV-infected shrimp, P. vannamei. Further, the expression of apoptosis-related genes was determined by qPCR to understand the relationship between the apoptosis and WSSV infection in shrimp.

Materials and methods

Shrimp

Shrimp P. vannamei, (10.94 ± 2.09 g) were obtained from shrimp farming ponds located in Elavur, Thiruvallur district, Chennai, India. The shrimp were acclimatized to the laboratory environment for a period of one week with pH 8.3–8.5, salinity 28 ppt and temperature ± 28 °C with intermittent water exchange and continuous aeration. Shrimp were maintained in 100L tanks and fed with commercial pellet feed twice a day. Prior to the experiment, the shrimp were tested for absence of WSSV by PCR.

WSSV viral challenge

Viral inoculum prepared earlier in the laboratory from the muscle tissues of WSSV infected shrimp with concentration of 5.3 × 10⁷ μl⁻¹ viral copy numbers was used to challenge 36 shrimp. WSSV virus (100 μl) of 10^{− 1} dilution was injected through intramuscular route to induce infectivity and 100 μl of Phosphate buffer saline was injected to 36 shrimp as control. The haemocytes and gill tissue samples were collected at 3 time-points during different time course of infection viz., 1.5 hpi, 18 hpi and 56 hpi each in triplicates from the infected and control shrimp. Confirmation of viral infectivity in the infected shrimp was tested through nested PCR using gill tissues. The control and infected shrimp haemocytes samples were used for detection of apoptosis.

Apoptosis assay

Apoptotic cells in the haemocytes of shrimp samples was determined using FITC Annexin V Apoptosis Detection Kit I (BD Biosciences, USA). Briefly, the shrimp haemocytes was washed twice (300×g, 5 min) with 0.01 M of cold phosphate buffer saline (PBS) and re-suspended with 400 μl of 1X Annexin V binding buffer (0.1 M Hepes/NaOH (pH 7.4), 1.4 M NaCl, and 25 mM CaCl₂). The cell suspension was divided into four aliquots of 100 μl each. One of the cell suspension samples (100 μl) was incubated with 5 μl of FITC Annexin V (BD Biosciences, USA) and 5 μl of propidium iodide (PI) (BD Biosciences, USA) for 15 min in dark at room temperature. To set up the compensation and quardrant controls, the other three aliquots (100 μl), two aliquots were separately incubated with 5 μl of PI, 5 μl of FITC Annexin V and the third aliquot without any stain. Subsequently, 400 μl of 1X Annexin V binding buffer was added to each sample and analyzed in BD Accuri™ C6 Plus flow cytometer to detect apoptotic cells. The FITC Annexin V and PI fluorescence were analyzed at the excitation and emission wave lengths of 488/533 nm and 488/585 nm respectively in BD Accuri™ C6 Plus flow cytometer. For each sample, minimum 10,000 events were collected in fluidics slow mode and the percentage of early and late apoptotic cells were analyzed in the FITC/PI dotplot. The early apoptotic cells were determined based on cells that stained positive for FITC Annexin V and negative for PI. Cells that stained both dyes were considered to be late apoptotic and those cells that stain negative to both the fluorochromes were considered as viable cells.

Expression analysis of apoptotic genes by qPCR

Total RNA of shrimp gill tissues from WSSV infected and control shrimp at three experimental time-points of 1.5 hpi, 18 hpi and 56 hpi were extracted using NucleoSpin RNA II kit (Macherey–Nagel, Germany) and the respective cDNA was synthesized using Protoscript cDNA synthesis kit (New England Bio Labs, USA). The cDNA was used to quantify gene expression of four apoptotic genes DAP -1, TCTP, caspase-5 and cathepsin D using ABI StepOne Plus qPCR system (ThermoFisher Scientific, USA). The 10 μl of reaction mixture was prepared with 5 μl of SYBR™ green master mix (Thermofisher Scientific, USA), 1 μl of cDNA template (100 ng/μl) and gene specific forward and reverse primers of concentration 10 pmol/μl (Table 1). PCR conditions were carried out with initial incubation at 50 °C for 2 min, denaturation at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. β-actin gene was taken as the control and apoptotic gene expressions were calculated using comparative C_T (ΔΔC_T) method. The assays were carried out in biological triplicates.

Table 1.

Primers used for qPCR analysis of apoptosis genes from WSSV infected P. vannamei

S. no	Gene	Primer sequence (5′–3′)	Accession no
1	DAP-1	FP: CATCCTCCCGCAATGAAAGT RP: GCCTCTCCTCTGCGCTCTT	XM_027364445
2	TCTP	FP: GCAGATGAAGGCACTGACACTACT RP: CGGTTTCTTGCAGACGCATA	XM_027373879
3	Caspase-5	FP: TCAATTCCATTCTGACTTGCTCTTT RP: GGCTTTCCCACTAGAGTCTCACAT	XM_027373451
4	Cathepsin D	FP: GTTCTTGCTGGGAAGCCATTTAC RP: CTTGCTCTCAGCGAAACCT	MH171099
5	β-actin	FP: CAAGATGTGTGACGACGAAG RP: AGCTCGTGGTGCATCGTC	XM_027364954

Results and discussion

Flow cytometry analysis of apoptosis progression

Previous studies have used Tdt-mediated dUTP nick-end labeling (TUNEL) assay and agarose gel electrophoresis to show DNA fragmentation as result of apoptosis in WSSV infected shrimps such as P. monodon [20], M japonicus [33] and P. vannamei [8]. However, the use of flow cytometry method to evaluate the rate of apoptosis in penaeid shrimps is reported to show consistent results with good repeatability of data and minimum variations [34]. Hence we used flow cytometry for apoptosis analysis in WSSV infected P. vannamei. In the present study, the haemocytes of P. vannamei showed apparent apoptotic response after WSSV infection. Hemocytes are known to be one of the target for WSSV infection [27], and exhibit apoptosis in WSSV infected shrimps [25].

The percentage of early and late apoptotic cells in three groups of control shrimp and WSSV infected shrimp at different time points is shown in Table 2. The challenged shrimp showed early apoptosis significant cell percentage difference as compared to control samples only at 18 hpi, whereas in the late apoptotic stage, significant differences were observed at all the three time-points post WSSV infection. The percentage of early apoptotic cells decreased with increase in time interval post WSSV infection and the percentage of late apoptotic cells was observed to increase by 64% at 56 hpi. The average percentage of early apoptotic cells in WSSV-infected shrimp were 25.2 ± 1.35% at 1.5 hpi which significantly decreased to 19.3 ± 0.64% at 18 hpi and further decreased to 6.0 ± 0.85% at 56 hpi. Whereas, there was significant increase in the average percentage of late apoptotic cells at all time points 5.06% (1.5 hpi), 12.16% (18 hpi) and 69.63% (56 hpi) (Table 2). Flow cytometric analysis of apoptotic cells in WSSV challenged P. vannamei shrimp is shown in Fig. 1.

Table 2.

The percentage of early and late apoptotic cells WSSV infected P. vannamei shrimp at different time points

Shrimp group	Time-point (hpi)	Early apoptotic cells (%)	Average of early apoptotic cells (%)	Late apoptotic cells (%)	Average of late apoptotic cells (%)
Group 1
Control 1	1.5	0.2	0.27 ± 0.12	0.1	0.1 ± 1.6
Control 2	1.5	0.4		0.1
Control 3	1.5	0.2		0.1
Infected 1	1.5	23.9	25.2 ± 1.35	6.8	5.06 ± 1.53*
Infected 2	1.5	25.1		4.5
Infected 3	1.5	26.6		3.9
Group 2
Control 1	18	0.3	0.37 ± 0.06	0.1	0.1 ± 1.6
Control 2	18	0.4		0.1
Control 3	18	0.4		0.1
Infected 1	18	19.6	19.3 ± 0.64*	12.3	12.16 ± 0.32*
Infected 2	18	18.6		11.8
Infected 3	18	19.8		12.4
Group 3
Control 1	56	0.2	0.3 ± 0.26	0.2	0.13 ± 0.06
Control 2	56	0.1		0.1
Control 3	56	0.6		0.1
Infected 1	56	5.1	6.0 ± 0.85	72.7	69.63 ± 3.86*
Infected 2	56	6.1		70.9
Infected 3	56	6.8		65.3

The significant difference (p < 0.05) is indicated with *

Fig. 1.

Flow cytometry analysis of apoptotic haemocytes in P. vannamei a control shrimp b WSSV infected shrimp at 1.5 hpi c WSSV infected shrimp at 18 hpi d WSSV infected shrimp at 56 hpi

The results of increase in late apoptotic cells during the course of WSSV infection is in agreement with other reports where the flow cytometry analysis of the apoptosis rate in WSSV infected M. japonicus haemocytes showed an increase from 4.5 to 15.8% at 24 hpi and to 34.2% at 56 hpi. [34]. Another study, showed the apoptotic haemocytes of WSSV-infected P. vannamei to significantly increase at 12 hpi, with a slight decline at 24 hpi, and again increase, with the peak level at 48 hpi with the value of 12.6 ± 1.5% [25]. With increase in severity of infection, it is presumed that apoptosis might be a factor implicated in shrimp death caused by WSSV [20] and apoptosis rate increase with progress of WSSV infection [31].

Expression analysis of DAP-1 gene

Upon WSSV infection the qPCR revealed down-regulation of the DAP-1 gene expression by 0.7 fold at 1.5 hpi which up-regulated significantly by 2.3 fold (18 hpi) and 6.9 fold (56 hpi) at later stages of infection (Fig. 2). Our results suggest that the increased levels of DAP-1 gene expression in the late phase of infection at 18 hpi (2.3 fold) and 56 hpi (6.9 fold), with increased amplification of virus, facilitates apoptosis. WSSV is reported to induce apoptosis when shrimp were injected with the purified recombinant MjDAP1 protein. The knockdown experiments of DAP-1 revealed decreased virus copy and the mortality of the shrimp to WSSV challenge, and recombinant DAP-1 protein aided the virus amplification in M. japonicus [34]. Although, DAP-1 is well known to be involved as a regulator of apoptosis and autophagy in other organisms [23], however, the exact functional pathways and the molecular interactions of DAP-1 during shrimp apoptosis remains largely unknown.

Fig. 2.

Gene expression analysis of a death-associated protein 1-like (DAP-1), b translationally controlled tumor protein (TCTP), c Caspase-5, d Cathepsin D in gill tissues of control and WSSV infected P. vannamei by qPCR

Expression analysis of TCTP gene

The TCTP gene was down-regulated by 0.8 fold at 1.5 hpi and was significantly up-regulated by 1.4 fold at 18 hpi and down-regulated by 0.9 fold at 56 hpi (Fig. 2). The down-regulation of TCTP at later stages of WSSV infection is in agreement with report of Tang et al. [25], who observed the expression of TCTP to be found significantly higher than the control at initial infection stage of 36 hpi with peak levels at 48 hpi, however, there was a rapid decline in expression levels at late stage of WSSV infection at 72 hpi. Another study indicated similar observations of up-regulation of TCTP in shrimp haemocytes during the early phase of WSSV infection with abrupt decrease in gene expression at moribund stage of WSSV infected shrimp [7]. The lower expression of TCTP was attributed to apoptosis induced by WSSV leading to shrimp death [7], as the high expression of TCTP in the WSSV resistant M. japonicus suggested that it is involved in the antiviral process [9] and TCTP in shrimp has functional role in protecting shrimps against WSSV-infection [1]. Our results indicate that probably WSSV down-regulate the expression of TCTP, resulting in death of infected cells and stimulate apoptosis pathway. The down-regulation of TCTP may lead to the diminished host defense, which helps in virus replication and finally causing mortality of shrimp as suggested by Bangrak et al. [1]. The protective nature of shrimp TCTP against WSSV was further confirmed by use of recombinant TCTP protein by inhibiting viral replication [26]. As, shrimp TCTP is reported to bind to Ca²⁺, therefore, further studies would be required to know if TCTP functions as anti-apoptotic protein through Ca²⁺ scavenging pathways in shrimp [1].

Expression analysis of Caspase-5 gene

Caspase-5 gene expression showed down-regulation at all the time-points by 0.7 fold (1.5 hpi), 0.3 fold (18 hpi) and 0.09 fold (56 hpi) (Fig. 2). This results are in agreement with our earlier study where we had reported caspase to be down-regulated at all time points post WSSV infection from 6 h to moribund stage infection in gill tissues of P. monodon by microarray analysis and qPCR [22]. It is speculated that WSSV exerts inhibitory effect on expression of effector caspases [25] and caspase-5 has been identified as effector caspase in P.vannamei based on the sequence identities and domain structure [30]. Hence, the down-regulation in gene expression of caspase-5 in this study can be due to active replication of WSSV which binds to shrimp caspases. The WSSV anti apoptosis proteins such as WSSV449 [14], WSSV134 and WSSV322 [12] are known to inhibit shrimp caspases to regulate viral replication. The finding of viral encoded proteins which binds to host caspase indicates virus mediated anti-apoptotic mechanism in shrimps [4, 12]. However, in contrary to our results, the shrimp caspase expression levels were shown to be highly up-regulated in shrimps which survived WSSV challenge [29]. We presume this may be due low copy numbers of virus in WSSV survived shrimp, resulting in high levels of caspase gene expression. Caspases (caspase 2–5) identified from P. vannamei, were shown to be up- regulated by WSSV infection, and the gene silencing revealed, enhanced expression of WSSV VP28 gene [30]. Further experiments are required to investigate whether the gene expression levels of caspase is related to response of specific caspase types (the initiator caspases and the effector caspases) against WSSV infection, viral load, and infection stage in shrimps.

Expression analysis of Cathepsin D gene

In general, the cathepsins in shrimps have been suggested to participate in several biological process such as intracellular protein hydrolysis [24], food digestion [10], salinity stress [21], and immunological response against WSSV [18, 19]. Some reports are available on different types of cathepsin gene expression profiles in response to WSSV infection. For example, cathepsin-L was up-regulated in the hepatopancreas of F. chinensis challenged with WSSV at 12 h [18]. The gene expression profile of cathepsin-B in different tissues of shrimp is reported to show up-regulation during the early stage of WSSV infection, however it responds differently to WSSV infection after 12 h [16]. In the present study, the cathepsin D gene was initially down-regulated at 1.5 hpi and 18 hpi by 0.5 fold however increase in gene expression was observed at 56 hpi by 2.1 fold (Fig. 2). Although several cathepsins have been identified and isolated from shrimps, however, very limited information is available on shrimp aspartic protease, cathepsin D and its functional role against WSSV infection. To our knowledge, no previous reports are available about cathepsin D expression in shrimps post WSSV challenge. BCL-2–associated × proteins (BAX), a pro-apoptotic protein, identified from Procambarus clarkii was shown influence apoptosis after WSSV infection. The knockdown of BAX, resulted in enhanced WSSV replication with suppression in haemocytes apoptosis [36]. As identified in higher organisms, it would be interesting to further characterize shrimp cathepsin D and its functional role linked to apoptosis through intrinsic pathway/extrinsic pathway and associated molecular apoptotic targets such as Bcl-2 family proteins in shrimps.

In conclusion, in the present study we have shown that the percentage of early apoptotic cells reduces while the percentage of late apoptotic cells was observed to increase as the disease progress due to WSSV infection in shrimp. The study confirmed that WSSV infection can efficiently induce apoptosis in P. vannamei and apoptosis is regulated during course of infection by either up- or down- regulation of apoptosis related genes by host.