Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2022 Jul 1.
Published in final edited form as: Ocul Surf. 2021 Apr 22;21:27–36. doi: 10.1016/j.jtos.2021.04.004

In-situ Porcine Corneal Matrix Hydrogel as Ocular Surface Bandage

Ghasem Yazdanpanah 1,3, Ritu Shah 1, Sri Raghurama R Somala 1, Khandaker N Anwar 1, Xiang Shen 1, Seungwon An 1, Meisam Omidi 2, Mark I Rosenblatt 1, Tolou Shokuhfar 3, Ali R Djalilian 1,*
PMCID: PMC8328923  NIHMSID: NIHMS1699607  PMID: 33895367

Abstract

Purpose:

Bioactive substrates can be used therapeutically to enhance wound healing. Here, we evaluated the effect of an in-situ thermoresponsive hydrogel from decellularized porcine cornea ECM, COMatrix (COrnea Matrix), for application as an ocular surface bandage for corneal epithelial defects.

Methods:

COMatrix hydrogel was fabricated from decellularized porcine corneas. The effects of COMatrix hydrogel on attachment and proliferation of human corneal epithelial cells (HCECs) were evaluated in vitro. The effect of COMatrix on the expressions of the inflammatory genes, IL-1β, TNF-α, and IL-6 was assessed by RT-PCR. The in-situ application and also repairing effects of COMatrix hydrogel as an ocular bandage was studied in a murine model of corneal epithelial wound. The eyes were examined by optical coherence tomography (OCT) and slit-lamp microscopy in vivo and by histology and immunofluorescence post-mortem.

Results:

In vitro, COMatrix hydrogel significantly enhanced the attachment and proliferation of HCECs relative to control. HCECs exposed to COMatrix had less induced expression of TNF-α (P<0.05). In vivo, COMatrix formed a uniform hydrogel that adhered to the murine ocular surface after in-situ curing. Corneal epithelial wound closure was significantly accelerated by COMatrix hydrogel compared to control (P<0.01). There was significant increase in the expression of proliferation marker Ki-67 in wounded corneal epithelium by COMatrix hydrogel compared to control.

Conclusions:

COMatrix hydrogel is a naturally derived bioactive material with potential application as an ocular surface bandage to enhance epithelial wound healing.

Keywords: Porcine Cornea Extracellular Matrix, Corneal Epithelium, Wound Healing, Ocular Surface Bandage, in-situ Hydrogel

Graphical Abstract

graphic file with name nihms-1699607-f0007.jpg

Introduction

The stratified non-keratinized squamous epithelium of the cornea plays a critical role in preserving corneal function by providing a barrier against environmental damage and inhibiting angiogenesis and modulating immune response [1]. The corneal epithelium is dynamically rejuvenated following normal shedding of superficial cells or epithelial wounds due to trauma or infections. Corneal epithelial regeneration is orchestrated and regulated by many factors including cross-talk between corneal cells, immune cells, extracellular matrix (ECM) and secreted factors (e.g. growth factors) [2, 3].

Many studies have shown the corneal epithelial restorative effects of growth factors such as epidermal growth factor (EGF), nerve growth factor (NGF) and hepatocyte growth factors (HGF), as well as secretomes from mesenchymal stem cells and extracellular-matrix (ECM)-rich scaffolds such as amnion [4–10]. Other groups have pursued the application of in-situ chemically cross-linked natural biomaterials such as collagen and hyaluronic acid for regeneration of corneal stroma and epithelium [11–13]. While there are several reports on the use of processed decellularized ECMs for focal corneal stromal regeneration [14–17], the potential of corneal ECM hydrogel for enhancing the corneal epithelial wound repair as an ocular bandage, has not been studied. Processed (partially-digested) decellularized ECMs have been fabricated from several tissues including urinary bladder, heart, intestine, brain, testis, bone, cartilage, tendon, conjunctiva, and adipose tissue [18–20]. Processed ECMs not only possess regenerative effects, but also readily form in-situ thermoresponsive hydrogels with no further manipulations.

Cornea-derived ECM hydrogel can potentially enhance wound healing as an ocular bandage by providing a protective barrier that simultaneously provides factors to promote epithelial regeneration. In this study, we evaluated the healing potential of fabricated in-situ thermoresponsive hydrogel, COMatrix (COrneal Matrix) from decellularized porcine cornea, as an ocular bandage to promote healing of corneal epithelial wounds. We investigated the effects of COMatrix hydrogel on attachment, proliferation, and inflammatory responses of human corneal epithelial cells (HCECs) in vitro while providing proof of concept application of COMatrix hydrogel as an in-situ ocular surface bandage in a murine model of corneal epithelial wound healing.

Materials and Methods:

Fabrication of COMatrix Ocular Bandage Hydrogel

Fresh intact porcine eyeballs were obtained from a certified abattoir (Park Packing Co. Inc., Chicago, IL). Under sterile conditions, the porcine corneas (PCs) were dissected and washed with Phosphate Buffered Saline (PBS, 1x) containing 1 % gentamicin, 1 % penicillin and 1 % streptomycin.

The decellularization process for PCs were performed as described before with some modifications [15]. The PCs were cut into pieces with an average size of 2×2 mm2. The tissue pieces were first stirred in 20 mM ammonium hydroxide solution (Sigma, USA) containing 0.5% Triton X-100 (Fischer Scientific, USA) in distilled water for 4 hours for decellularization. Tissues were then transferred to 10 mM Tris-HCl (pH 8.4, Sigma, USA) containing 0.5% EDTA (Fisher Scientific, USA) in distilled water and stirred for 24 hours at room temperature. After that, the porcine cornea pieces stirred in 10 mM Tris-HCl containing 1% (v/v) Triton X-100 for 24 h at 37°C. To remove the DNA remnants, the tissue fragments were agitated in 50 mM Tris-HCl containing 7.5 U/ml deoxyribonuclease (Sigma, USA) in molecular biology grade water (Fisher Scientific, USA) for 16 hours at 37°C. To further remove cell remnants and chemicals, the samples were stirred in PBS for 48 h while changing the PBS twice per day. The bioburden of decellularized tissue pieces was reduced by stirring in 0.1% peracetic acid (32 wt% in dilute acetic acid, Sigma, USA) in 4% ethanol in molecular biology grade water for 16 h. Following stirring the tissues in molecular biology grade water three-times for 2 hours, the tissues were snap-frozen in liquid nitrogen (30 minutes) and lyophilized for 48 hours at −55°C and <0.133 mBar. The lyophilized tissues were than stored at −80°C until further experiments for no more than 6 months.

To fabricate COMatrix hydrogel from decellularized PC-ECM (Figure 1A), lyophilized tissue pieces were cryo-milled using freezer-mill (Spex 6700, USA). The resultant fine powder was sieved using a mesh (size 40, Sigma, USA) and partially digested by slow stirring in 0.01M HC1 (20 mg/ml) containing 1 mg/ml pepsin (>400 U/mg, Sigma, USA) for 72 hours at room temperature. To form a hydrogel, the digested PC-ECM was neutralized to pH 7 using one-ninth 0.1 M NaOH and one-tenth PBS 10x, while on the ice. The hydrogel was diluted to the desired concentrations using PBS. To induce gelation, the cool COMatrix hydrogel was incubated at 37° C for 10 to 15 minutes (Figure 1B). The gel forms following incubation at 37° C and it is immediately used for further applications. Our assessments showed that if the gel formed COMatrix at 37° C is cooled down to 4° C, no change will occur to the stiffened structure of the gel. The heat gel-formed COMatrix is stable in PBS incubating at 37° C for at least 3 months.

Figure 1:

Figure 1:

Open in a new tab

(A) Schematic illustration showing the process for fabroication of thermoresponsive COMatrix hydrogel. (B) Photos of COMatrix hydrogel before curing with heat and after forming a gel. COMatrix hydrogel is a transparent biomaterial after heat gel-forming.

In-vitro Experiments Using Human Corneal Epithelial Cells (HCECs)

Immortalized human corneal epithelial cells (HCECs) were kindly provided by Dr. Deepak Shukla (Illinois Eye and Ear Infirmary, University of Illinois at Chicago) [21]. HCECs were expanded in high-glucose DMEM medium (4500 mg/L, Fisher Scientific, USA) containing 10% Fetal Bovine Serum (Fisher Scientific, USA) and 1× Antibiotic-Antimycotic (Fisher Scientific, USA) for no more than 40 passages. HCECs were detached with TrypLE express enzyme (Fisher Scientific, USA) for further experiments. To evaluate the interaction of HCECs with COMatrix hydrogel, in-vitro assays including attachment assay, proliferation assay and Live-Dead assay were performed. All experiments were conducted in triplicate.

Attachment Assay

To compare the attachment of HCECs to COMatrix hydrogel and plastic cell culture dish (control), as illustrated in Figure 2A, 48-well plates were coated with COMatrix hydrogel (1 mg/ml, 100 μl per well) or PBS and incubated for 2 hours at 37°C. Then, the supernatant was removed and 1×104 HCECs in 200 μl complete media (High-Glucose DMEM containing 10% FBS and 1x Antibiotic-Antimycotic) were seeded in each well (6 wells per group). The plates were incubated at 37° C for different time periods including 10, 30, 60, 120 and 240 minutes. After that, each plate was gently washed with PBS to remove the unattached cells. To compare the number of remaining attached live cells after each time period, a metabolic activity assay was performed using the Cell Counting Kit-8 (CCK-8, Sigma, USA). Following the manufacturer’s recommendation, 10 μl of the provided solution (WST-8) was added to each well containing 100 μL of complete media, after which the plate was incubated in humidified atmosphere with 5% C02 at 37° C for 2 hours; and the optical density (OD) was measured at 450 nm representing the number of cells in each well.

Figure 2:

Figure 2:

Open in a new tab

(A) Schematic illustration showing the procedure for performing the attachment assay experiment.(B) Representative images showing the attachment of HCECs on COMatrix hydrogel-coated plates compared to controls after 30 minutes. (C) The results of metabolic assay (CCK-8 assay) showing the number of attached cells at different time points. **** P<0.0001, ***P<0.001; **P<0.01; *P<0.05.

Proliferation and Live-Dead Assays

To evaluate the effect of COMatrix hydrogel on HCECs’ proliferation, two different assays were used. To measure the effect of soluble COMatrix, it was supplemented (0.5 mg/ml) to the cell culture media (high-glucose DMEM containing 1x Antibiotic-and no FBS) of HCECs plated at a density of 2×103 cells/well in a 96 well plate and cultured for 5 days. PBS supplementation was used as control (6 wells per group). Similarly, as above, the number of live cells was measured using CCK-8.

In the second protocol, the viability of HCECs (2×103 cells/well, 6 wells per group) cultured on COMatrix hydrogel (400 μM thickness) over a period of 1, 4, 9 and 15 days was measured by staining with Calcein-AM (live cells), propidium iodide (PI, dead cells) and Hoechst 33342 (total cells, all from Sigma, USA) for 1 hour by incubating at 37°C in humidified atmosphere with 5% CO2. The HCECs were imaged using ZEISS Cell Observer SD Spinning Disk Confocal Microscope (Zeiss, Germany), and the images were analyzed using ZEN Lite software (Zeiss, Germany). Also, the number of live cells for each time point was compared to control using CCK-8 metabolic assay kit (as described above).

Inflammatory Assay

To induce an inflammatory response in cultivated HCECs, a previously developed method was pursued [22]. The cells were treated with the Toll-like receptor (TLR)-3 ligand polyinosinic-polycytidylic (Poly(I)C, 100 μg/mL dissolved in DMEM media containing 5% FBS, Sigma, USA) with COMatrix hydrogel (0.5 mg/ml) or PBS for 24 hours. After treatment, the cells were removed from each well by scraping, and the supernatants were collected and centrifuged. The pellets were then lysed with RNA lysis buffer for RNA extraction. The RNA was extracted according to the protocol described previously per manufacturer’s instructions (RNeasy Protect Mini Kit, Qiagen) [23]. Reverse-transcriptase (RT) reaction was performed using extracted mRNA and a cDNA synthesis kit (Super Script First-Strand Synthesis System, Invitrogen, Carlsbad, CA). Relative quantitative polymerase chain reaction (qPCR) was performed using intron spanning primers for human glyceraldehyde-3-phosphate dehydrogenase (GAPDH, forward: 5’ ACCACAGTCCATGCCATCAC 3’; reverse: 5’ CACCACCCTGTTGCTGTAGCC 3’), tumor necrosis factor-alpha (TNF-α, forward: 5’ TACTGAACTTCGGGGTGATTGGTCC 3’; reverse: 5’ CAGCCTTGTCCCTTGAAGAGAACC 3’), IL (Interleukin)-6 (forward: 5’ CCGGAGAGGAGACTTCACAG 3’; reverse: 5’ GGAAAT TGGGGTAGGAAGGA 3’), and IL-1β (forward: 5’ CCACAGACCTTCCAGGAGAATG 3’; reverse: 5’ GTGCAGTTCAGTGATCGTACAGG 3’) according to the manufacturer’s protocol (Fast SYBER Green Master Mix, Applied Biosystems). All samples were run in triplicates using QuantStudio 7 Flex Real-Time PCR System (ABI, USA), and each experiment was repeated three times. Negative controls using samples without reverse transcriptase were included in the qPCR step to confirm that the results were not affected by DNA contaminants. Quantified results of each reaction were analyzed. The relative ΔΔCTmRNA expression was measured by normalization to GAPDH.

In-vivo Corneal Epithelial Wound Healing

All animal experiments in this study were conducted in compliance with the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research. The animal protocols were approved by the Animal Care and Use Committee at the University of Illinois at Chicago.

The effects of fabricated COMatrix ocular bandage hydrogel on corneal epithelial wound healing was evaluated using a murine 2-mm corneal epithelial debridement model as described previously [22, 24]. The experimental procedure is illustrated in Figure 4A and photographed in Supplementary Figure S1. Male C57BL/6J mice (4–5 months-old) were anesthetized with intraperitoneal injection of ketamine (100 mg/kg) and xylazine (5 mg/kg). Anesthetized mice were positioned under a surgical microscope, one drop of 0.5% proparacaine was applied to the eye, and a 2-mm area was demarcated using a 2-mm trephine. The corneal epithelial layer in the demarcated area was removed gently using an AlgerBrush II (The Alger Companies, Lago Vista, TX). After taking a baseline photograph of the fluorescein-stained eye using a Nikon (Tokyo, Japan) FS-2 slit-lamp biomicroscope, COMatrix ocular bandage hydrogel (15 mg/ml) was applied to the ocular surface (N=10 eyes, one eye per mouse). Then, a 4-mm-diameter transparent ACLAR® contac t lens (OcuScience, USA) was fit on the ocular surface and the COMatrix gelation was induced by applying radiation heat using a 50 Watt ceramic infrared heat emitter (KIMROO, China) for 10 minutes. The distance of the heat emitter to the mice ocular surface was adjusted to be 35 cm and the temperature was monitored every 1 minutes using an infrared thermometer with laser pointing (SOVARCATE, China) to keep the temperature no more than 37° C on the ocular surface. To keep the contact lens on the ocular surface, tarsorrhaphy (suturing the eyelids together) was performed as described before [25]. PBS was applied in the control group before fitting the contact lens (N=10 eyes, one eye per mouse). The COMatrix ocular bandage hydrogel and overlaying contact lens were visualized by Optical Coherence Tomography (Phoenix MICRON™ Image-Guided OCT, USA). The treated eyes were evaluated after 18 hours and photographed. The wounded area in captured photographs was measured using ImageJ software (Rasband, W.S., ImageJ, U. S. National Institutes of Health, Bethesda, Maryland, USA, https://imagej.nih.gov/ij/, 1997-2018), and the ratio of wound closure relative to baseline was calculated [22, 24].

Figure 4:

Figure 4:

Open in a new tab

Application of COMatrix hydrogel as an ocular surface bandage and its corneal epithelial wound healing effects. (A) Illustration demonstrating the application of COMatrix hydrogel as an ocular surface bandage in a murine model of corneal wound healing. (B) OCT images demonstrating the ocular surface coverage and filling of the corneal epithelial defect by COMatrix ocular bandage hydrogel (Top) compared to control (Bottom).

Tissue Specimen Preparation and Staining

After humanly sacrificing the mice after 18 hours follow-up, the mouse eyeballs were enucleated and fixed in tissue cassettes using Optimal Cutting Temperature (Fisher Scientific, USA) and sectioned using Cryostat (Fisher Scientific, USA). The tissue sections were fixed 4% paraformaldehyde and then used for routine histology with hematoxylin and eosin (H&E) staining and immunostaining.

Immunostaining

The fixed tissue sections were blocked at room temperature with 3% bovine serum albumin (Sigma, USA) and incubated with primary antibodies for an overnight at 4° C. The used primary antibodies were against Ki-67 (#4203-1, Epitomics, 1:100) and CK-12 (sc-25722, Santa Cruz Biotechnology). Then, the sections were washed and incubated with fluorescein-conjugated secondary antibodies (Jackson ImmunoResearch) for 1h at room temperature and counterstained with DAPI. The imaging was performed with the same light intensity and exposure for all the samples, using a confocal microscope (LSM 710, Carl Zeiss, Germany). The Images were analyzed with ZEN Lite software (Zeiss, Germany).

Statistical Analyses

Data are shown as mean ± standard deviation (SD). Statistical analyses were done by GraphPad Prism software version 8.3.0 (538) for Windows, (GraphPad Software, San Diego, California, USA, www.graphpad.com) using T-test for comparing the means between two groups and one-way analysis of variance and Tukey posttest for more than two groups. P-values less than 0.05 were considered as statistically significant difference between groups.

Results

COMatrix Hydrogel Enhances Attachment and Proliferation of HCECs and Attenuates TNF-α Expression

The fabricated COMatrix hydrogel before and after heat gel-formation and its transparency are shown in Figure 1B. The bioactivity of COMatrix hydrogel was evaluated using in-vitro attachment, proliferation, and inflammatory cytokine induction assays on human corneal epithelial cells. To assess the interaction of human corneal epithelial cells with COMatrix, the attachment of cells to plates coated with hydrogel was compared to uncoated control plates (Figure 2A). Microscopic observation of HCECs shows significantly higher attachment of HCECs on COMatrix-coated plates than control after 30 minutes (Figure 2B). Counting the number of cells using mitochondrial metabolic assay indicates significantly faster attachment of HCECs to COMatrix compared to culture plates after 10, 30 and 60 minutes of culturing the cells (Figure 2C).

The effect of soluble and gel-formed COMatrix on proliferation of HCECs was further examined in-vitro. Soluble COMatrix was added (0.5 mg/ml) to the cell culture media and found to increase proliferation relative to control after 5 days (Optical Density, 1.34±0.07 vs. 1.15±0.09, P<0.001). HCECs were also seeded on gel-formed COMatrix hydrogel and their metabolic activity (as a representative of cell numbers) was measured after 1, 4, 9 and 15 days. The results (Figure 3A) indicated significant enhancement of HCEC proliferation by COMatrix hydrogel as a substrate compared to tissue culture plate in all time points. Consistent with these results, HCECs seeded on heat gel-formed COMatrix hydrogel highly expressed the proliferation Ki-67 (Figure 3B).

Figure 3:

Figure 3:

Open in a new tab

(A) Immunostaining of HCECs cultured on gel-formed COMatrix for the Ki-67 proliferation marker. (B) Metabolic cell counting results of HCECs on heat gel-formed COMatrix hydrogel on Day 1, 4, 9 and 15. (C) Images of Live-Dead assay from HCECs seeded on gel-formed COMatrix hydrogel, and control on days 1, 4, 9 and 15. Green (live cells), red (dead cells), blue (cell nucleus). (D) Quantitative fluorescent intensity of live cells (green) in two groups at different time points. **P<0.01; ns, Not Significant.

The live-dead assay results also demonstrated high-viability and significantly higher proliferation rate of HCECs seeded on COMatrix hydrogel compared to control for 15 days (Figure 3C and 3D).

A major pathologic mechanism prohibiting corneal repair is excessive inflammation [26]. To study the effect of COMatrix hydrogel on inflammation, HCECs were induced with the TLR3 agonist Poly(I)C and the gene-expression of IL-6, IL-1β and TNF-α was measured in the presence or absence of COMatrix hydrogel (0.5 mg/ml). The results showed significant decrease in TNF-α gene expression in HCECs cultured with COMatrix compared to control cells (4.1±1.9 fold-change vs. 11.3±4.9 fold-change, respectively, P<0.05). However, no significant change was observed in expression of IL-1β and IL-6 in HCECs treated with COMatrix compared to control (2.8±0.3 fold-change vs. 2.2±0.4 fold-change for IL-1β, respectively, P>0.05; and 1.3±0.1 fold-change vs. 1.3 ±0.2 fold-change for IL-6, respectively, P>0.05).

COMatrix Ocular Bandage Hydrogel Enhances Corneal Epithelial Wound Closure in a Murine Model

The schematic showing the application of thermoresponsive COMatrix hydrogel on the ocular surface is illustrated in Figure 4A. In-vivo healing effect of COMatrix ocular bandage hydrogel was evaluated in a murine model of corneal epithelial wound healing. OCT imaging immediately after application of the COMatrix hydrogel and bandage contact lens revealed filling of the corneal epithelial defect and ocular surface coverage with COMatrix hydrogel (Figure 4B). The photos of COMatrix hydrogel on the murine ocular surface immediately after administration and 18 hours later are shown in Figure 5A. Remnants of the COMatrix ocular bandage are detectable on the ocular surface after 18 hours.

Figure 5:

Figure 5:

Open in a new tab

(A) The COMatrix hydrogel on the murine ocular surface as a bandage immediately after application and 18 hours later (right after removing tarsorrhaphy sutures). The COMatrix is pointed by arrow (<) in the follow-up photo. (B) Representative images of murine corneal epithelial wounds treated with COMatrix ocular surface bandage compared to control. (C) Measuring the closed-wound area shows significant healing effects of COMatrix ocular bandage hydrogel. **P<0.01, ***P<0.001, ns, Not Significant.

Examination of the corneal epithelial wounds at follow-up time (18 hours) showed 71.2±13.2% wound closure in eyes treated with COMatrix in-situ ocular bandage hydrogel compared to 54.7±7.8% in PBS controls (P<0.01, N=10 eyes per group, Figure 5B and 5C).

The Expression of Proliferation Marker is Significantly Higher in Corneal Epithelial Wounds Treated by COMatrix Ocular Bandage

Histologically, corneas treated with COMatrix ocular bandage hydrogel demonstrated a more intact epithelium compared to control (Figure 6A). Immunostaining of the central cornea showed diffuse expression of CK-12 in the epithelial layer, in addition to lack of Ki-67 expression in the epithelium (Figure 6B, the separated images of immunostainings is presented in supplementary Figure S2).

Figure 6:

Figure 6:

Open in a new tab

(A) H&E staining of normal (unwounded), control, and COMatrix ocular bandage treated murine eyes with 2-mm corneal epithelial wound after 18 hours. (B) Representative image of immunostaining with anti-CK-12 and anti-Ki-67 in normal (unwounded) mouse eye (C) and wounded mouse eyes treated with COMatrix hydrogel, and the control (D) The fluorescent intensity of anti-Ki-67 resembling of Ki-67 proliferation marker expression in different regions of cornea relative to the wounded area. *P<0.05, ***P<0.001, ns, Not Significant.

Observing the expression of Ki-67 proliferation marker shows up-regulation of this marker at the epithelial level and under the epithelium in wounded corneas (Figure 6C). Semi-quantitative analyses using the fluorescent intensity shows a significantly higher increase in the expression of Ki-67 at the whole corneal epithelial wound, and with higher magnification at the edge of epithelial the wound and center of the wound in eyes treated with COMatrix ocular bandage compared to control (Figure 6D).

Discussion

In this study, an in-situ thermoresponsive and transparent ocular bandage hydrogel, COMatrix, was fabricated for application to the ocular surface to promote regeneration of the corneal epithelium. The induction of cell proliferation by COMatrix hydrogel was shown in-vitro, followed by a proof of concept application as an ocular surface bandage in a murine corneal epithelial wound healing model.

Corneal epithelial wound healing is a dynamic process involving proliferation, migration, adhesion, differentiation, and stratification to fully restore the healthy corneal epithelium. Migration and proliferation of corneal epithelial cells are crucial for closure of the epithelial wound. Here, we have showed that the ocular surface application of in-situ thermoresponsive hydrogel from decellularized porcine cornea enhances wound closure in a murine model of wounded corneal epithelium. Also, COMatrix ocular surface bandage significantly increased the expression of proliferation marker, Ki67 in the injured epithelium (Figure 6C and 6D).

Decellularized ECMs from different tissue sources have been investigated for tissue repair and regeneration [18]. These bio-mimetics contain numerous factors resulting in a construct that resembles the naïve tissue. The healing and tissue regenerating effects of decellularized ECMs have been evaluated in various experimental settings [18]. For instance, it has been shown that injecting decellularized cardiac ECM improves heart muscle function after ischemia [27]. Several potential mechanisms for the regenerative effects of decellularized ECM have been proposed. In particular, the applied ECM alters the microenvironment which in turn modulates the immune cells toward an anti-inflammatory and reparative phenotype [19]. Decellularized ECM have also been shown to contain bioactive peptides with regenerative effects. These peptides can be activated by digestion/degradation of the ECM by regional cells e.g. immune cells [28].

The mechanism of gel formation mechanism of these hydrogels is not fully understood. It is proposed that following solubilization of the ECM into protein monomers and neutralization of pH and incubation at 37° C, a spontaneous reformation of intramolecular bonds between protein monomers is initiated. This process is entropy-driven by collagen kinetics. More specifically, the entropy increases when collagen monomers lose water and form aggregates, so the hydrophobic residues on the surface will be hidden within the fibril, and self-assembly occurs [29, 30].

Porcine corneal xenotransplantation as a replacement of corneal stroma has been under investigation for more than a decade. The main challenge with this approach is the necessity for immunosuppression and also presence of antigens (e.g. α-Gal Epitope, Galα1-3Galβ1-4GlcNAc-R) in porcine tissues that are not expressed in humans and could provoke immune response and promote immune-rejection [31–37]. Therefore, more recent approaches have been focused on transplantation of decellularized porcine corneas. Decellularization removes the antigens and increases the chance of graft survival. However, efficient removal of cellular contents without disturbing the natural ECM structure of the cornea has not yet been fully achieved [38]. The application of hydrogels obtained from decellularized extracellular matrix is an emerging strategy in ophthalmology. Since, decellularization of an intact cornea is not crucial in this approach, more efficient decellularization could be attained. The fabricated hydrogels from bovine or porcine corneas were mostly used to restore a stromal corneal defect. In the study by Wang et al. the corneal epithelium was repaired faster in corneal stromal defects repaired with decellularized porcine cornea-ECM compared to controls [17]. In this study, we used our fabricated corneal stromal ECM (COMatrix) hydrogel as an in-situ thermoresponsive material that can cover the ocular surface as an ocular bandage to solely facilitate corneal epithelial wound healing in eyes with no corneal stromal defects. Although remnants of the COMatrix have been found in the follow-ups, the hydrogel generally degrades within days and re-application might be necessary since no external cross-linking method is used in this proof-of-concept. Moreover, increase in the expression of Ki-67 proliferation marker in the epithelium and sub-epithelium area of the wounded area was observed in the eyes treated with COMatrix hydrogel indicating enhancing the proliferation of corneal epithelial cells might be one of the mechanisms of COMatrix. This effect of COMatrix hydrogel is more likely attributed to the regenerative factors in the biomaterial. Previous studies have shown that fabricated hydrogels from decellularized ECMs are composed of regenerative proteins and growth factors in addition to structural proteins like collagens [39]. We have shown that COMatrix hydrogel contains near 20% sulfated Glycosaminoglycans [40], which have previously been shown to have wound healing effects [41, 42]. Future studies such as proteomic analyses are necessary for more compositional characterization of COMatrix hydrogel.

In some cases, alterations in the corneal epithelial wound healing process can result in a non-healing wound, also known as a “persistent corneal epithelial defect (PCED)”. PCED is defined as a corneal epithelial wound that has not healed after 14 days with standard care [43, 44]. Management of PCED is challenging, but it mainly includes applying a barrier protection like fitting bandage contact lens and administration of regenerative factors. Several biologic repairing products have been used for improving the rate of corneal epithelial cells’ proliferation and enhancing the epithelial wound closure including recombinant growth factors, human serum/plasma, and human amnion [45–48]. The corneal epithelial regenerative effects of amnion have been attributed to growth factor composition of amnion like EGF [9, 49] and also the structural proteins such as lumican [50–52] and heavy chain (HC)-hyaluronan (HA)/pentraxin 3 (PTX3) [53]. Although emerging approaches for the management of PED show promising results, there is still a need for developing more therapeutic options [43]. COMatrix hydrogel or other ECM derived constructs may provide one potential approach for improving the outcomes of PCED.

Conclusion

In this study, an in-situ thermoresponsive and transparent ocular bandage hydrogel, COMatrix, was fabricated from decellularized porcine cornea ECM as a regenerative biomaterial for corneal epithelial repair. The in-vitro and in-vivo experiments have shown the corneal epithelial regenerative effects of COMatrix hydrogel which provide proof of concept and potential for clinical translation. COMatrix hydrogel is a promising biomaterial which can potentially be used as an easy-to-apply ocular surface bandage for persistent corneal epithelial defects but may also be considered in other corneal tissue engineering applications.

Supplementary Material

1
2

Acknowledgement

The authors would like to appreciate Lauren Kalinoski for the illustrations.

This study is extracted from PhD dissertation of G.Y.

Funding/support:

This work was supported by R01 EY024349 (ARD), Core Grant for Vision Research EY01792 (MIR) from NEI/NIH; Unrestricted Grant to the Department and Physician-Scientist Award both from Research to Prevent Blindness; Eversight.

The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Commercial relationships disclosures: The authors have no commercial disclosure related to this work.

REFERENCES

  • [1].Yazdanpanah G, Jabbehdari S, Djalilian AR. Limbal and corneal epithelial homeostasis. Curr Opin Ophthalmol. 2017;28:348–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [2].Yazdanpanah G, Haq Z, Kang K, Jabbehdari S, Rosenblatt ML, Djalilian AR. Strategies for reconstructing the limbal stem cell niche. Ocul Surf. 2019;17:230–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Zhu L, Titone R, Robertson DM. The impact of hyperglycemia on the corneal epithelium: Molecular mechanisms and insight. Ocul Surf. 2019;17:644–54. [DOI] [PubMed] [Google Scholar]
  • [4].Ljubimov AV, Saghizadeh M. Progress in corneal wound healing. Prog Retin Eye Res. 2015;49:17–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [5].Lu L, Reinach PS, Kao WW. Corneal epithelial wound healing. Exp Biol Med (Maywood). 2001;226:653–64. [DOI] [PubMed] [Google Scholar]
  • [6].Yu FS, Yin J, Xu K, Huang J. Growth factors and corneal epithelial wound healing. Brain Res Bull. 2010;81:229–35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [7].Bonini S, Lambiase A, Rama P, Sinigaglia F, Allegretti M, Chao W, et al. Phase II Randomized, Double-Masked, Vehicle-Controlled Trial of Recombinant Human Nerve Growth Factor for Neurotrophic Keratitis. Ophthalmology. 2018;125:1332–43. [DOI] [PubMed] [Google Scholar]
  • [8].Kamil S, Mohan RR. Corneal stromal wound healing: Major regulators and therapeutic targets. Ocul Surf. 2021;19:290–306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [9].Le Q, Deng SX. The application of human amniotic membrane in the surgical management of limbal stem cell deficiency. Ocul Surf. 2019;17:221–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [10].Fernandes-Cunha GM, Na KS, Putra I, Lee HJ, Hull S, Cheng YC, et al. Corneal Wound Healing Effects of Mesenchymal Stem Cell Secretome Delivered Within a Viscoelastic Gel Carrier. Stem Cells Transl Med. 2019;8:478–89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [11].Chen F, Le P, Lai K, Fernandes-Cunha GM, Myung D. Simultaneous Interpenetrating Polymer Network of Collagen and Hyaluronic Acid as an In Situ-Forming Corneal Defect Filler. Chem Mater. 2020;32:5208–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Chen F, Le P, Fernandes-Cunha GM, Heilshorn SC, Myung D. Bio-orthogonally crosslinked hyaluronate-collagen hydrogel for suture-free corneal defect repair. Biomaterials. 2020;255:120176. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Fernandes-Cunha GM, Chen KM, Chen F, Le P, Han JH, Mahajan LA, et al. In situ-forming collagen hydrogel crosslinked via multi-functional PEG as a matrix therapy for corneal defects. Sci Rep. 2020;10:16671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [14].Kim H, Jang J, Park J, Lee KP, Lee S, Lee DM, et al. Shear-induced alignment of collagen fibrils using 3D cell printing for corneal stroma tissue engineering. Biofabrication. 2019;11:035017. [DOI] [PubMed] [Google Scholar]
  • [15].Kim H, Park MN, Kim J, Jang J, Kim HK, Cho DW. Characterization of cornea-specific bioink: high transparency, improved in vivo safety. J Tissue Eng. 2019;10:2041731418823382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [16].Ahearne M, Lynch AP. Early Observation of Extracellular Matrix-Derived Hydrogels for Corneal Stroma Regeneration. Tissue Eng Part C Methods. 2015;21:1059–69. [DOI] [PubMed] [Google Scholar]
  • [17].Wang F, Shi W, Li H, Wang H, Sun D, Zhao L, et al. Decellularized porcine cornea-derived hydrogels for the regeneration of epithelium and stroma in focal corneal defects. Ocul Surf. 2020;18:748–60. [DOI] [PubMed] [Google Scholar]
  • [18].Saldin LT, Cramer MC, Velankar SS, White LJ, Badylak SF. Extracellular matrix hydrogels from decellularized tissues: Structure and function. Acta Biomater. 2017;49:1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [19].Dziki JL, Wang DS, Pineda C, Sicari BM, Rausch T, Badylak SF. Solubilized extracellular matrix bioscaffolds derived from diverse source tissues differentially influence macrophage phenotype. J Biomed Mater Res A. 2017;105:138–47. [DOI] [PubMed] [Google Scholar]
  • [20].Witt J, Dietrich J, Mertsch S, Schrader S, Spaniol K, Geerling G. Decellularized porcine conjunctiva as an alternative substrate for tissue-engineered epithelialized conjunctiva. Ocul Surf. 2020;18:901–11. [DOI] [PubMed] [Google Scholar]
  • [21].Yadavalli T, Suryawanshi R, Ali M, Iqbal A, Koganti R, Ames J, et al. Prior inhibition of AKT phosphorylation by BX795 can define a safer strategy to prevent herpes simplex virus-1 infection of the eye. Ocul Surf. 2020;18:221–30. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [22].Jabbehdari S, Yazdanpanah G, Kanu LN, Chen E, Kang K, Anwar KN, et al. Therapeutic Effects of Lyophilized Conditioned-Medium Derived from Corneal Mesenchymal Stromal Cells on Corneal Epithelial Wound Healing. Curr Eye Res. 2020;45:1490–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [23].Djalilian AR, Namavari A, Ito A, Balali S, Afshar A, Lavker RM, et al. Down-regulation of Notch signaling during corneal epithelial proliferation. Mol Vis. 2008;14:1041–9. [PMC free article] [PubMed] [Google Scholar]
  • [24].Jabbehdari S, Yazdanpanah G, Kanu LN, Anwar KN, Shen X, Rabiee B, et al. Reproducible Derivation and Expansion of Corneal Mesenchymal Stromal Cells for Therapeutic Applications. Transl Vis Sci Technol. 2020;9:26. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [25].Eslani M, Putra I, Shen X, Hamouie J, Afsharkhamseh N, Besharat S, et al. Corneal Mesenchymal Stromal Cells Are Directly Antiangiogenic via PEDF and sFLT-1. Invest Ophthalmol Vis Sci. 2017;58:5507–17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [26].Nowell CS, Odermatt PD, Azzolin L, Hohnel S, Wagner EF, Fantner GE, et al. Chronic inflammation imposes aberrant cell fate in regenerating epithelia through mechanotransduction. Nat Cell Biol. 2016;18:168–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [27].Svystonyuk DA, Mewhort HEM, Fedak PWM. Using Acellular Bioactive Extracellular Matrix Scaffolds to Enhance Endogenous Cardiac Repair. Front Cardiovasc Med. 2018;5:35. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [28].Costa A, Naranjo JD, Londono R, Badylak SF. Biologic Scaffolds. Cold Spring Harb Perspect Med. 2017;7:a025676. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29].Hulmes D Collagen diversity, synthesis and assembly. Collagen: Springer; 2008. p. 15–47. [Google Scholar]
  • [30].Parkinson J, Kadler KE, Brass A. Simple physical model of collagen fibrillogenesis based on diffusion limited aggregation. Journal of Molecular Biology. 1995;247:823–31. [DOI] [PubMed] [Google Scholar]
  • [31].Kim MK, Hara H. Current status of corneal xenotransplantation. Int J Surg. 2015;23:255–60. [DOI] [PubMed] [Google Scholar]
  • [32].Choi HJ, Kim J, Kim JY, Lee HJ, Wee WR, Kim MK, et al. Long-term safety from transmission of porcine endogenous retrovirus after pig-to-non-human primate corneal transplantation. Xenotransplantation. 2017;24. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [33].Choi HJ, Yoon CH, Hyon JY, Lee HK, Song JS, Chung TY, et al. Protocol for the first clinical trial to investigate safety and efficacy of corneal xenotransplantation in patients with corneal opacity, corneal perforation, or impending corneal perforation. Xenotransplantation. 2019;26:e12446. [DOI] [PubMed] [Google Scholar]
  • [34].Yoon CH, Choi SH, Lee HJ, Kang HJ, Kim MK. Predictive biomarkers for graft rejection in pig-to-non-human primate corneal xenotransplantation. Xenotransplantation. 2019;26:e12515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [35].Lee HI, Kim MK, Oh JY, Ko JH, Lee HJ, Wee WR, et al. Gal alpha(1-3)Gal expression of the cornea in vitro, in vivo and in xenotransplantation. Xenotransplantation. 2007;14:612–8. [DOI] [PubMed] [Google Scholar]
  • [36].Choi HJ, Kim MK, Lee HJ, Jeong SH, Kang HJ, Park CS, et al. Effect of αGal on corneal xenotransplantation in a mouse model. Xenotransplantation. 2011;18:176–82. [DOI] [PubMed] [Google Scholar]
  • [37].Yoon CH, Choi SH, Choi HJ, Lee HJ, Kang HJ, Kim JM, et al. Long-term survival of full-thickness corneal xenografts from α1,3-galactosyltransferase gene-knockout miniature pigs in non-human primates. Xenotransplantation. 2020;27:e12559. [DOI] [PubMed] [Google Scholar]
  • [38].Isidan A, Liu S, Li P, Lashmet M, Smith LJ, Hara H, et al. Decellularization methods for developing porcine corneal xenografts and future perspectives. Xenotransplantation. 2019;26:e12564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [39].Giobbe GG, Crowley C, Luni C, Campinoti S, Khedr M, Kretzschmar K, et al. Extracellular matrix hydrogel derived from decellularized tissues enables endodermal organoid culture. Nat Commun. 2019;10:5658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [40].Yazdanpanah G, Somala SRR, Sun M, Zhou Q, Anwar KN, Jabbehdari S, et al. Corneal Wound Healing Effects of Solubilized Porcine Cornea Extracellular-Matrix. Investigative Ophthalmology & Visual Science. 2019;60:4116-. [Google Scholar]
  • [41].Puri S, Coulson-Thomas YM, Gesteira TF, Coulson-Thomas VJ. Distribution and Function of Glycosaminoglycans and Proteoglycans in the Development, Homeostasis and Pathology of the Ocular Surface. Front Cell Dev Biol. 2020;8:731-. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [42].Coulson-Thomas VJ, Chang SH, Yeh LK, Coulson-Thomas YM, Yamaguchi Y, Esko J, et al. Loss of corneal epithelial heparan sulfate leads to corneal degeneration and impaired wound healing. Invest Ophthalmol Vis Sci. 2015;56:3004–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [43].Vaidyanathan U, Hopping GC, Liu HY, Somani AN, Ronquillo YC, Hoopes PC, et al. Persistent Corneal Epithelial Defects: A Review Article. Med Hypothesis Discov Innov Ophthalmol. 2019;8:163–76. [PMC free article] [PubMed] [Google Scholar]
  • [44].Katzman LR, Jeng BH. Management strategies for persistent epithelial defects of the cornea. Saudi J Ophthalmol. 2014;28:168–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [45].Dudok DV, Nagdee I, Cheung K, Liu H, Vedovelli L, Ghinelli E, et al. Effects of amniotic membrane extract on primary human corneal epithelial and limbal cells. Clin Exp Ophthalmol. 2015;43:443–8. [DOI] [PubMed] [Google Scholar]
  • [46].Wu MF, Stachon T, Langenbucher A, Seitz B, Szentmary N. Effect of Amniotic Membrane Suspension (AMS) and Amniotic Membrane Homogenate (AMH) on Human Corneal Epithelial Cell Viability, Migration and Proliferation In Vitro. Curr Eye Res. 2017;42:351–7. [DOI] [PubMed] [Google Scholar]
  • [47].Tighe S, Moein HR, Chua L, Cheng A, Hamrah P, Tseng SC. Topical Cryopreserved Amniotic Membrane and Umbilical Cord Eye Drops Promote Re-Epithelialization in a Murine Corneal Abrasion Model. Invest Ophthalmol Vis Sci. 2017;58:1586–93. [DOI] [PubMed] [Google Scholar]
  • [48].Shahriari HA, Tokhmehchi F, Reza M, Hashemi NF. Comparison of the effect of amniotic membrane suspension and autologous serum on alkaline corneal epithelial wound healing in the rabbit model. Cornea. 2008;27:1148–50. [DOI] [PubMed] [Google Scholar]
  • [49].Phoomvuthisarn P, Suriyaphol G, Tuntivanich N. Effect of glycerol concentrations and temperatures on epidermal growth factor protein expression in preserved canine amniotic membrane. Cell Tissue Bank. 2019;20:579–83. [DOI] [PubMed] [Google Scholar]
  • [50].Yeh LK, Chen WL, Li W, Espana EM, Ouyang J, Kawakita T, et al. Soluble lumican glycoprotein purified from human amniotic membrane promotes corneal epithelial wound healing. Invest Ophthalmol Vis Sci. 2005;46:479–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [51].Liu CY, Kao WW. Lumican promotes corneal epithelial wound healing. Methods Mol Biol. 2012;836:285–90. [DOI] [PubMed] [Google Scholar]
  • [52].Rada JA, Cornuet PK, Hassell JR. Regulation of corneal collagen fibrillogenesis in vitro by corneal proteoglycan (lumican and decorin) core proteins. Exp Eye Res. 1993;56:635–48. [DOI] [PubMed] [Google Scholar]
  • [53].Tseng SC. HC-HA/PTX3 Purified From Amniotic Membrane as Novel Regenerative Matrix: Insight Into Relationship Between Inflammation and Regeneration. Invest Ophthalmol Vis Sci. 2016;57:ORSFh1–8. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS1699607-supplement-1.jpg (3.2MB, jpg)
2
NIHMS1699607-supplement-2.jpg (11.2MB, jpg)

RESOURCES