Abstract
Superoxide Dismutase 1 (SOD1) is an antioxidant enzyme that protects the cells from radical oxygen species. To study the behavior of endogenous SOD1 under a microscope, we genetically modified H1 human embryonic stem cells (hESCs) to express SOD1 fused with a SNAP-tag, a protein tag that can be covalently labeled with a variety of synthetic probes. The engineered homozygous clone expressing SOD1-SNAP fusion proteins has normal stem cell morphology and karyotype, expresses pluripotency markers, and can be differentiated into all three germ layers in vitro, providing a versatile platform for imaging-based studies of SOD1.
1. Resource Table:
| Unique stem cell line identifier | WAe001-A-56 |
| Alternative name(s) of stem cell line | H1_SOD1-SNAP / UHMCe002-A-56 |
| Institution | Department of Chemistry, University of Houston, Houston |
| Contact information of distributor | Tai-Yen Chen (tchen37@central.uh.edu) |
| Type of cell line | Human embryonic stem cell |
| Origin | Human |
| Additional origin info | Age: N/A Sex: Male Ethnicity if known: N/A |
| Cell Source | H1 hESCs |
| Clonality | Clonal |
| Method of reprogramming | N/A |
| Genetic Modification | Yes |
| Type of Modification | Transgene expression (protein tag) |
| Associated disease | N/A |
| Gene/locus | 21q22.11; SOD1 exon 5 |
| Method of modification | CRISPR-Cas9 |
| Name of transgene or resistance | SNAP |
| Inducible/constitutive system | N/A |
| Date archived/stock date | 11/9/2020 |
| Cell line repository/bank | https://hpscreg.eu/cell-line/WAe001-A-56 |
| Ethical approval | Cell lines were used according to institutional guidelines. UTHealth approval number: SCRO-16–01 |
2. Resource utility
To study SOD1 at an endogenous level using imaging approaches, we genetically engineered H1 hESC to express SOD1-SNAP fusion protein that can be labeled with various probes. The line can be differentiated into three germ layers and provides a resource to visualize SOD1 under a microscope in different cell contexts.
3. Resource details
SOD1 is a ubiquitously expressed enzyme that converts superoxide radicals to oxygen and hydrogen peroxide. SOD1 malfunction is associated with familial amyotrophic lateral sclerosis (Bruijn et al., 2004). However, its molecular behaviors, such as subcellular distribution and interaction dynamics, are still largely unknown. To dissect the role of SOD1 at an endogenous level in different cell contexts using single-molecule super-resolution microscopy (Chen et al., 2015), we genetically tagged the SOD1 with SNAP-tag, a mutated form of human O6-alkylguanine-DNA-alkyltransferase, that can be covalently labeled with various synthetic probes (Keppler et al., 2003) in H1 hESCs. The genetically modified H1 hESC homozygous clone (H1_SOD1-SNAP) was obtained by two rounds of CRISPR-Cas9 mediated homologous recombination. The SNAP gene was in-frame inserted at the C-terminus of the SOD1 coding region following a three-amino-acid-linker (Fig. 1A). H1 hESCs were co-transfected with single-guide RNA (sgRNA)-Cas9 plasmids and recombination donor containing plasmids. The emerged individual clones were picked and screened for SNAP insertion. A heterozygous clone consisting of one SNAP knock-in allele was first obtained and subjected to a second-round CRISPR-Cas9 induced SNAP knock-in. We then successfully generated a homozygous SNAP knock-in clone confirmed by genotyping PCR, Sanger sequencing, and Southern blot analysis (Fig. 1B, Suppl. Fig. 1 and Suppl. Fig. 2, respectively). The expression of the SOD1-SNAP fusion protein in the knock-in cell lysate is confirmed by immunoblotting using anti-SNAP and anti-SOD1 antibodies (Fig. 1F and Suppl. Fig. 4). The majority of SOD1-SNAP protein remains intact in the knock-in cell lysate with an only barely detectable level of un-tagged SOD1 signal, likely originating from the cleavage (Fig. 1F). The overall SOD1-SNAP protein level is reduced compared to the endogenous SOD1 level in H1 parental cells, suggesting the tag appendix may affect the expression of fusion proteins but not compromise SOD1 function (Suppl. Fig. 5). SOD1-SNAP fusion protein expression with intact conjugation activity of SNAP-tag is also confirmed by the positive signal after labeled with fluorescent SNAP-ligand in H1_SOD1-SNAP hESCs (Fig. 1D, bottom panel). The knock-in line exhibits normal hESC morphology with a high nuclear-cytoplasmic ratio, prominent nucleoli, and tightly packed colonies with a well-define edge (Fig. 1C). Immunostaining demonstrated the expression of pluripotency transcription factors NANOG, OCT3/4, and SOX2 in the knock-in cells (Fig. 1D), despite their transcript levels slightly dropped as compared to the H1 parental quantified using RT-qPCR (Fig. 1E). In vitro differentiation showed that the knock-in clone still possesses the ability to be differentiated into ectoderm, mesoderm, and endoderm, demonstrated by positive immunostaining of the differentiated cells using germ layer-specific markers (Fig. 1H). The knock-in clone has a normal karyotype (Fig. 1G) and is free of mycoplasma contamination (Suppl. Fig. 3). Its short tandem repeat (STR) profile confirmed a matched identity to the parental H1 (data available upon request). The characterization and validation of the H1_SOD1-SNAP were summarized in Table 1. In short, H1_SOD1-SNAP cells are pluripotent H1 hESCs with normal karyotype and express SOD1-SNAP fusion proteins that can be labeled with SNAP-tag fluorophores providing a versatile platform for imaging-based studies of SOD1.
Fig. 1.
The generation and characterization of H1_SOD1-SNAP.
Table 1.
Characterization and validation.
| Classification | Test | Result | Data |
|---|---|---|---|
| Morphology | Photography | Normal | Fig. 1 panel C |
| Phenotype | Qualitative analysis: Immunocytochemistry | Positive staining for pluripotency markers NANOG, OCT3/4, and SOX2 | Fig. 1 panel D |
| Quantitative analysis: RT-qPCR | NANOG: 63 ± 1%; OCT4: 93 ± 2%; SOX2: 52 ± 1% (Mean ± SEM) | Fig. 1 panel E | |
| Genotype | Karyotype (G-banding) and resolution | 46XYResolution: 672 × 672 | Fig. 1 panel G |
| Identity | Microsatellite PCR (mPCR) OR STR analysis | N/A | N/A |
| 14 sites tested; all match parental H1 | Data available with authors and submitted in archive with journal | ||
| Mutation analysis (IF APPLICABLE) | Sequencing | Match recombination donor | Supplementary Fig. 1 |
| Southern Blot | Homozygous insertion | Supplementary Figure 2 | |
| Microbiology and virology | Mycoplasma: PCR | Negative | Supplementary Figure 3 |
| Differentiation potential | In vitro differentiation: Immunocytochemistry | Positive staining for ectoderm markers: PAX6 and β3-Tubulin; mesoderm markers: Brachyury and Troponin T; endoderm markers: FOXA2 and HNF-4α | Fig. 1 panel H |
| Donor screening (OPTIONAL) | HIV 1 + 2 Hepatitis B, Hepatitis C | N/A | N/A |
| Genotype additional info (OPTIONAL) | Blood group genotyping | N/A | N/A |
| HLA tissue typing | N/A | N/A |
4. Materials and methods
4.1. Cell culture
H1 hESCs were cultured as previously described (Wen et al., 2019).
4.2. CRISPR-Cas9
We adopted the protocol from Koch et al. (Koch et al., 2018) and designed sgRNAs using Benchling. The sgRNAs were cloned in pSpCas9 (BB)-2A-Puro (PX459) plasmid, a gift from Feng Zhang (Addgene plasmid # 48139; http://n2t.net/addgene:48139; RRID: Addgene_48139). The reported homozygous clone was obtained by two rounds of editing using CRISPR sgRNA-1 and 2 (Table 2). H1 hESCs were co-electrotransfected (300 V/ 500 μF, Bio-Rad Gene Pulser Xcell) with sgRNA-PX459 and recombination donor sequence (Genewiz) carried by pMiniT 2.0 (New England Biolabs, NEB). Transfected cells were plated on irradiated B6-Puro Mouse Embryonic Fibroblast feeders (Thermo Fisher) followed by puromycin selection for 3 days. Clones were manually picked and expanded under a feeder-free system.
Table 2.
Reagents details.
| Antibodies used for immunocytochemistry (ICC)/immunoblotting (I.B.) | |||
|---|---|---|---|
| Antibody | Dilution | Company Cat # and RRID | |
| Pluripotency Marker | Goat anti-NANOG | 10 μg/ml (ICC) | R&D Systems Cat# AF1997, RRID: AB_355097 |
| Mouse anti-OCT3/4 | 1:250 (ICC) | Santa Cruz Biotechnology Cat# sc-5279, RRID: AB_628051 | |
| Mouse anti-SOX2 | 1:250 (ICC) | Santa Cruz Biotechnology Cat# sc-365823, RRID: AB_10842165 | |
| Differentiation Marker | Mouse anti-PAX6 | 1:50 (ICC) | DSHB Cat# pax6, RRID: AB_528427 |
| Rabbit anti-β3-Tubulin | 1:300 (ICC) | Cell Signaling Technology Cat# 5568, RRID: AB_10694505 | |
| Goat anti-Brachyury | 10 μg/ml (ICC) | R&D Systems Cat# AF2085, RRID: AB_2200235 | |
| Mouse anti-Troponin T | 10 μg/ml (ICC) | R&D Systems Cat# MAB1874, RRID: AB_2206731 | |
| Rabbit anti-FOXA2 | 1:400 (ICC) | Cell Signaling Technology Cat# 8186, RRID: AB_10891055 | |
| Mouse anti-HNF-4α | 1: 200 (ICC) | Santa Cruz Biotechnology Cat# sc-374229, RRID: AB_10989766 | |
| Characterization Marker | Rabbit anti-SOD1 | 1:500 (IB) | Sigma-Aldrich Cat# HPA001401, RRID: AB_1080132 |
| Rabbit anti-SNAP-tag | 1:1000 (IB) | New England Biolabs Cat# P9310S, RRID: AB_10631145 | |
| Mouse anti-β-Actin | 1:5000 (IB) | Sigma-Aldrich Cat# A5441, RRID: AB_476744 | |
| Secondary Antibody | Donkey anti-Mouse IgG (Alexa Fluor 488 conjugated) | 1:1000 (ICC) | Thermo Fisher Scientific Cat# A-21202, RRID: AB_141607 |
| Donkey anti-Goat IgG (Alexa Fluor 488 conjugated) | 1:1000 (ICC) | Thermo Fisher Scientific Cat# A-11055, RRID: AB_2534102 | |
| Donkey anti-Mouse IgG (Alexa Fluor 594 conjugated) | 1:1000 (ICC) | Thermo Fisher Scientific Cat# A-21203, RRID: AB_141633 | |
| Donkey anti-Rabbit IgG (Alexa Fluor 594 conjugated) | 1:1000 (ICC) | Thermo Fisher Scientific Cat# A-21207, RRID: AB_141637 | |
| Goat anti-Rabbit IgG (HRP-linked) | 1:5000 (IB) | Cell Signaling Technology Cat# 7074, RRID: AB_2099233 | |
| Peroxidase-AffiniPure Goat anti-Mouse IgG | 1:10000 (IB) | Jackson ImmunoResearch Labs Cat# 115–035-062, RRID: AB_2338504 | |
| Primers | Target | Forward/Reverse primer (5′-3′) |
|---|---|---|
| CRISPR sgRNA-1 | SOD1 exon 5 | CACCGTCGCCCAATAAACATTCCCT/AAACAGGGAATGTTTATTGGGCGAC |
| CRISPR sgRNA-2 | SOD1 exon 5 | CACCGAGGATAACAGATGAGTTAAG/AAACCTTAACTCATCTGTTATCCTC |
| Genotyping (insertion screening) | SOD1 | ACAAAGATGGTGTGGCCGAT/ACCCATCTGTGATTTAAGTCTGG |
| Southern Blot Probe Synthesis | SOD1 | ACAGCTTCAGTGGAACAGATTTAG/AAGGACAGCCTATTTGTCTAAGCAG |
| Pluripotency Gene (qPCR) | NANOG | TTTGTGGGCCTGAAGAAAACT/AGGGCTGTCCTGAATAAGCAG |
| OCT4 | AACCTGGAGTTTGTGCCAGGGTTT/TGAACTTCACCTTCCCTCCAACCA | |
| SOX2 | AGAAGAGGAGAGAGAAAGAAAGGGAGAGA/GAGAGAGGCAAACTGGAATCAGGATCAAA | |
| House-Keeping Gene (qPCR) | GAPDH | CCACTCCTCCACCTTTGAC/ACCCTGTTGCTGTAGCCA |
4.3. PCR and sequencing
Genomic DNA was extracted using MasterPure Complete DNA and RNA Purification Kits (Epicentre). PCR screening was performed using AccuStart II GelTrack SuperMix (QuantaBio) with annealing temperature (Ta) at 64 °C. The product sizes are 1542 bp for H1 parental and 2097 bp for H1_SOD1-SNAP. Sample for Sanger sequencing (Eton Bioscience) was prepared using Q5 Hot Start High-Fidelity DNA Polymerase (NEB) with the same primer set at Ta 66 °C and extension for 1 min each cycle.
4.4. Southern blotting
Genomic DNA was digested with HindIII-HF (NEB) overnight. SOD1 probes were synthesized using PCR DIG Probe Synthesis Kit (Roche) at Ta 62 °C and extension for 40 sec each cycle. Southern blot was performed according to the Roche DIG Manual for Filter Hybridization with the hybridization temperature at 37 °C. Expected fragment sizes are 810 bp for SOD1 and 1365 bp for SOD1-SNAP.
4.5. RT-qPCR
Total RNA was extracted the same way as DNA and converted to cDNA using iScript R.T. Supermix (Bio-Rad). Quantitative PCR was performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) with the following program: 50 °C for 10 min, 95 °C for 5 min, 40 cycles of 95 °C for 10 sec and 60 °C for 30 sec, 95 °C for 10 sec, and Melt Curve 65 to 95 °C, increment 0.5 °C for 5 sec. Data were analyzed in triplicate and normalized to GAPDH expression.
4.6. Immunoblotting, immunostaining, and SNAP-tag conjugation
Immunoblotting and immunostaining were performed as previously described (Wen et al., 2019). For SNAP-tag conjugation, live cells were incubated with 3 μM SNAP-Cell TMR-Star (NEB) for 30 min, washed and recovered, then fixed and permeabilized before imaging.
4.7. Karyotyping and STR analysis
The University of Texas M.D. Anderson Cancer Center Cytogenetics and Cell Authentication Core Facility conducted the G-band karyotyping (ten metaphase chromosome spreads) and STR analysis. The number of STRs at 14 loci was tested and compared to the H1 STR profile.
4.8. In vitro differentiation to three germ layers
In vitro differentiation was performed using STEMdiff Trilineage Differentiation Kit (STEMCELL Technologies).
4.9. Mycoplasma testing
Cells were cultured for 48 h before screening and more than 80% confluence. Spent media was collected from culture and subjected to mycoplasma detection using Mycoplasma PCR Detection Kit (Applied Biological Materials).
Supplementary Material
Footnotes
Declaration of Competing Interest
The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.org/10.1016/j.scr.2021.102415.
References
- Bruijn LI, Miller TM, Cleveland DW, 2004. Unraveling the mechanisms involved in motor neuron degeneration in ALS. Annu. Rev. Neurosci 27 (1), 723–749. [DOI] [PubMed] [Google Scholar]
- Chen T-Y, Santiago AG, Jung W, Krzemiński Ł, Yang F, Martell DJ, Helmann JD, Chen P, 2015. Concentration- and chromosome-organization-dependent regulator unbinding from DNA for transcription regulation in living cells. Nat. Commun 6, 7445. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Keppler A, Gendreizig S, Gronemeyer T, Pick H, Vogel H, Johnsson K, 2003. A general method for the covalent labeling of fusion proteins with small molecules in vivo. Nat. Biotechnol 21 (1), 86–89. [DOI] [PubMed] [Google Scholar]
- Koch B, Nijmeijer B, Kueblbeck M, Cai Y, Walther N, Ellenberg J, 2018. Generation and validation of homozygous fluorescent knock-in cells using CRISPR-Cas9 genome editing. Nat. Protoc 13 (6), 1465–1487. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wen M-H, Xie X, Tu J, Lee D-F, Chen T-Y, 2019. Generation of a genetically modified human embryonic stem cells expressing fluorescence tagged ATOX1. Stem Cell Res. 41, 101631. 10.1016/j.scr.2019.101631. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.