Abstract
Waardenburg syndrome (WS) is a rare genetic disorder characterized by varying combinations of sensorineural hearing loss and abnormal pigmentation involving the hair, skin and iris. WS is classified into 4 subtypes (WS1–WS4) based on additional symptoms. WS2 is characterized by the absence of additional symptoms and is mainly attributed to variants in the microphthalmia-associated transcription factor (MITF) gene. We detected a novel frameshift variant c.1025_1032delGGAACAAG (NM_198159) of MITF in 5 patients with WS2 from the same Chinese family by using targeted next-generation sequencing and Sanger sequencing. Phenotypic and genotypic analyses of the family members suggested that this novel variants was pathogenic. Our finding expands the spectrum of MITF variants.
Keywords: Waardenburg syndrome type 2, MITF, Variant, Targeted next-generation sequencing
Established Facts
It is already known that MITF is one of the main genes contributing to Waardenburg syndrome type 2 (WS2). So far, more than 60 variants of MITF closely related to WS2 have been reported in the HGMD database.
Novel Insights
In this study, we have identified a novel frameshift variant c.1025_1032delGGAACAAG (NM_198159) in MITF in 5 patients with WS2 from the same Chinese family by using targeted next-generation sequencing and Sanger sequencing.
Introduction
Hearing loss is a common sensorineural disorder, with an incidence of 1 in every 500–1,000 children [Yazdanpanahi et al., 2013]. Waardenburg syndrome (WS) is a rare autosomal dominant genetic disorder associated with variable degrees of sensorineural deafness and accumulated pigmentation in the hair, skin and iris [Yang T et al., 2013]. WS is one of the most common forms of syndromic hearing loss, accounting for 1.43% of congenital deafness [Nance, 2003]. Clinically, WS is divided into 4 types (WS1–WS4) based on the presence or absence of additional symptoms [Li et al., 2019]. Dystopia canthorum is the most significant feature of WS type 1 [Li et al., 2019]. WS2 has clinical and genetic heterogeneity, including hearing loss, freckles, blue-colored irises, and premature graying of hair [Li et al., 2019]. Limb deformities together with the symptoms in type 1 were the most common symptoms in WS type 3 [Li et al., 2019]. WS type 4 is characterized by hearing loss, depigmentation, and intestinal aganglionosis [Li et al., 2019]. WS2 is characterized by the absence of additional features [Wang et al., 2010; Kapoor et al., 2012; Wildhardt et al., 2013; Yang SZ et al., 2013] and attributed to variants in the genes encoding microphthalmia-associated transcription factor (MITF), SRY-box 10 transcription factor (SOX10), and snail homolog 2 (SNAI2) [Iso et al., 2008; Pingault et al., 2010; Chaoui et al., 2011; Zhang et al., 2012]. 15% of WS2 patients have heterozygous variants in MITF. The MITF gene contains an acidic region as the activation domain, a basic domain for DNA binding, a basic helix-loop-helix (bHLH) domain for dimerization with a key role in melanocyte development, and a leucine Zipper domain [Steingrimsson et al., 2004; Hou et al., 2008].
The HGMD database has included 61 variants in MITF, most of which are missense/nonsense variants (http://www.hgmd. cf.ac.uk/ac/index.php). In this study, we report a novel pathogenic frameshift variant c.1025_1032delGGAACAAG (NM_198159) in the bHLH domain of MITF in 5 patients with WS2 from the same Chinese family.
Materials and Methods
Patients and Family Data Collection
The proband was a 4-year-old girl, whose parents planned to have a second child and came to the prenatal diagnosis center of the Third Affiliated Hospital of Zhengzhou University (Henan Province Women and Children's Hospital) for genetic counseling. The proband (Fig. 1, III-3) had bilateral sensorineural deafness (Table 1). Her father (Fig. 1, II-3) had unilateral sensorineural deafness on the right side and several brown freckles on both face and hands (Table 1). At the first consultation, the parents did not disclose the family's conclusive history of deafness. We only collected the blood samples from III-3, II-3, and II-4 for targeted next-generation sequencing. When the father's genetic test results were obtained, he (II-3) came for genetic counseling again and told us that there were additional patients/cases in his family. Meanwhile, the mother (II-4) was already in her 7th week of pregnancy. All of the patients' clinical data are listed in Table 1. We collected blood samples from the family members (I-1, I-2, II-2, III-1 and III-2) and amniotic fluid from III-4 for variation analysis by Sanger sequencing.
Fig. 1.
Pedigree chart of the family with WS2. The filled and open shapes represent affected and unaffected family members, respectively; squares represent males and circles represent females. The arrow indicates the proband (III-3). + indicates carrier of the genetic variant c.235delC (p.L79CfsX3) in GJB2 (NM_004004) or c.1025_1032del GGAACAAG (p.Trp342TrpfsX25) in MITF (NM_198159).
Table 1.
Clinical findings and genotype of the family members
| Family | MITF | GJB2 | Ear | Skin | Eye | Hair |
|---|---|---|---|---|---|---|
| Member | c.1025_1032delGG– | c.235delC | Congenital hearing loss | Lentigines | Hetero-chromia irides | White forelock/premature graying |
| AACAAG of hair | ||||||
| I-1 | WT | Het | − | − | − | − |
| I-2 | +, het | WT | − | +, many brown freckles on face | − | − |
| and limbs | − | |||||
| II-2 | +, het | WT | − | +, many brown freckles on face | − | +, premature graying of |
| hair | ||||||
| and limbs | ||||||
| II-3 | +, het | Het | +, right side | +, several brown freckles on face | − | − |
| and limbs | ||||||
| II-4 | WT | WT | − | − | − | − |
| WT | WT | − | − | − | − | |
| III-2 | +, het | WT | +, both sides | − | +, blue irides | − |
| III-3 | +, het | Het | +, both sides | − | − | − |
WT, wild type; Het, heterozygous; +, present; −, absent.
Targeted Next-Generation Sequencing
Genomic DNA (gDNA) was extracted from the whole blood samples and amniotic fluid sequencing was performed by the clinical laboratory of BGI (Shenzhen, China). A customized capture array (NimbleGen, Roche) was designed to capture all exons, splicing sites, and the immediate flanking intron sequences of 127 genes associated with deafness (online suppl. Table 1; for online suppl. material, see www.karger.com/doi/10.1159/000513607). 1 µg of purified gDNA was fragmented to 200–300 bp using an ultrasonoscope (Covaris S2, MA, USA). Briefly, end-repair, adenylation, and adapter ligation were performed for library preparation following standard Illumina protocols. Targeted DNA fragments were captured by hybridization to the capture array and sequenced by an Illumina HiSeq2500 sequencer to generate paired-end reads (90 bp). Image analysis, error estimation, and base calling were performed using the Illumina Pipeline. Minor allele frequency threshold, quality threshold, and coverage threshold were all used to filter the gene panel data [Wei et al., 2011], and they were 1, 98, and 99.73%, respectively. Data analysis and bioinformatics processing were performed as previously described [Wei et al., 2011]. Reads were aligned to NCBI37/hg19 assembly using the BWA Multi-Vision software package. SNPs and indels were identified using the SOAPsnp software and the GATK Indel Genotyper, respectively. Previously identified SNPs and their allelic frequencies were determined using the NCBI dbSNP, 1000 Genomes and the in-house sequencing data of 200 Chinese Han normal hearing controls.
PCR and Sanger Sequencing
The targeted next-generation sequencing results showed that the proband had an MITF gene c.1025_1032delGGAACAAG (NM_198159) heterozygous variant and a GJB2 gene c.235delC (NM_004004) heterozygous variant (Fig. 2). We designed specific primers to detect the 2 variants by using the “primer blast” tool (https://www.ncbi.nlm.nih.gov/tools/primer-blast/) (Table 2). PCR was performed using a Clontech amplification kit (TAKARA, Japan) and run on the ABI 9700 equipment (ABI, USA). The cycle condition was 5 min at 95°C, 35 cycles of 30 s at 95°C, 30 s at 55°C, 30 s at 72°C, 7 min at 72°C, followed by holding at 4°C. Sanger sequencing was performed by GenScript (Nanjing, China).
Fig. 2.
Variants in GJB2 and MITF of the proband and her parents. aGJB2 c.235delC variant. bMITF c.1025_1032delGGAACAAG variant. Red arrows indicate the position of the variants.
Table 2.
The primer sequences of MITF and GJB2
| Gene (bp)Primers sequence (5′→3′) | Size of the PCR Product |
|---|---|
| MITF-9-F: GCAGAGACATGCGCTGGAA | 247 |
| MITF-9-R: CGTAAGTCAACTCCCCTATGGC | |
| GJB2-2-F: ATGAGCAGGCCGACTTTGTC | 252 |
| GJB2-2-R: CCTTCGATGCGGACCTTCT |
Results
Genetic Variants of the Proband
The proband was found to have 2 genetic variants, a heterozygous variant c.235delC (p.L79CfsX3) in GJB2 (NM_004004) and a heterozygous variant c.1025_1032del GGAACAAG (p.Trp342TrpfsX25) in MITF (NM_198159) (Fig. 2). Both variants were inherited from her father II-3 (Fig. 2). The variant c.235delC in GJB2 is classified as pathogenic [Wang et al., 2011; Zhang et al., 2013]. GJB2 variants are associated with deafness autosomal recessive type 1A and could also cause autosomal dominant deafness, such as deafness autosomal dominant type 3A [Pang et al., 2014]. The variant c.1025_1032delGGAACAAG in MITF is a novel variant and the allele frequency in the population has not been reported. MITF is a major gene associated with WS2 with manifestations including sensorineural deafness, brown freckles on the skin, premature graying, and heterochromia iridis. In order to determine which gene is the pathogenic gene in the proband, we analyzed the clinical data and blood samples of other patients in the family for pedigree validation.
Clinical Features of the Family
There are 5 patients in the family (Fig. 1; Table 1). Family members have varying degrees of clinical manifestations (Table 1). I-2 and II-2 only had pigmentary disorders of the face, limbs and hair without deafness, but II-3, III-2, and III-3 (the proband) had varying degrees of deafness. II-3 had sensorineural hearing loss in the right ear and some lentigines on both the face and the hands. III-2 and III-3 did not have freckles, but had bilateral hearing loss. III-2 was the only patient with blue-colored irises. We found that the abnormal distribution of brown freckles was decreasing, but the deafness was increasing by generations in the family. Based on the clinical information of the family (Fig. 1; Table 1), the pedigree chart demonstrates autosomal dominant inheritance of the disease, and we hypothesized that the family was likely suffering from WS2 caused by variants in MITF rather than deafness caused by variants in GJB2. In order to confirm our hypothesis, we performed genetic pedigree verification of the 2 identified variants in MITF and GJB2.
Variant Analysis
All affected members I-2, II-2, II-3, III-2, and III-3 had the novel heterozygous frameshift variant c.1025_1032delGGAACAAG in exon 9 in MITF (Table 1; Fig. 2b). The variant c.235delC in GJB2 was inherited from I-1 who had no abnormal clinical features, and II-2 and III-2 did not have the variants (Table 1). We therefore ruled out the possibility of deafness as a result of the GJB2 variant. According to the guidelines from the American College of Medical Genetics and Genomics and the College of American Pathologists [Richards et al., 2015], the novel heterozygous frameshift variant c.1025_1032delGGAACAAG in MITF was considered to be pathogenic: PVS1 + PM1 + PM2 + PM4 + PP1. At 17 weeks of gestation, we obtained fetal amniotic fluid through amniocentesis for the prenatal diagnosis of the MITF variant. The fetus inherited the pathogenic MITF variant.
Discussion
In this study, we reported a novel pathogenic variant in MITF in a Chinese family, c.1025_1032delGGAACAAG (p.Trp342TrpfsX25), which leads to a premature stop codon that shortens the MITF protein. So far, more than 60 variants closely related with WS2A have been reported in the HGMD database, with the majority being missense/nonsense variants, splicing variants or small deletions, and most of the variants are in exon 9 (NM_198159). These 2 exons, NM_198159 and NM_004004, encode the bHLH domain and parts of the leucin zipper domain. The novel variant c.1025_1032delGGAACAAG (NM_198159) is also in the bHLH domain [Goding and Arnheiter, 2019]. WS2 encompasses considerable clinical and genetic heterogeneity. It has been reported that hearing loss has a prevalence of 77% and heterochromia iridis is reported in 47% of the WS2 cases. In this family, the prevalence of hearing loss (II-3, III-2, III-3) and freckles (I-2, II-2, II-3) was 60%, and that of blue-colored irises (III-2) and premature graying of hair (II-2) was 20%. II-3 had both deafness and brown freckles, but the clinical manifestation was less serious than that of other patients. The patients of the first and second generation (I-2, II-2) were characterized by pigmentation, while the third generation (III-2 and III-3) was characterized by hearing loss. Depigmented patches are a common pigmentary abnormality of WS2 in Westerners, but in Asians, brown freckles are the major skin alteration, as observed in previous reports [Yan et al., 2011; Shi et al., 2016].
In conclusion, the heterozygous MITF variant c.1025_1032delGGAACAAG (NM_198159) was identified in 5 patients from a Chinese family. Phenotypic and genotypic analysis revealed that the novel variant was pathogenic. Our finding expands the known spectrum of MITF variants. The pathogenic mechanisms caused by this novel variant are under further investigation.
Statement of Ethics
The study was approved by the Ethics Committee of the Third Affiliated Hospital of Zhengzhou University. Written informed consent was obtained from all patients.
Conflict of Interest Statement
The authors have no conflicts of interest to declare.
Funding Sources
The work was supported by the Study Abroad Program of Henan Province (grant 2017047).
Author Contributions
Ying Li, Linlin Zhang, Zhan Zhang contributed to conception and design of the research. Yajuan Xu, Genxia Li, Yuehua Liu, Pingping Liu collected clinical information and performed amniocentesis. Haiyang Yu, Jinshuang Gao, and Weifang Tian did the investigation. Ying Li wrote the manuscript. Kang Chen, Linlin Zhang, and Zhan Zhang reviewed and edited the work.
Supplementary Material
Supplementary data
Acknowledgement
The authors are grateful to the family members and patients for their participation in this research study.
References
- 1.Chaoui A, Watanabe Y, Touraine R, Baral V, Goossens M, Pingault V, et al. Identification and functional analysis of SOX10 missense mutations in different subtypes of Waardenburg syndrome. Hum Mutat. 2011;32((12)):1436–49. doi: 10.1002/humu.21583. [DOI] [PubMed] [Google Scholar]
- 2.Goding CR, Arnheiter H. MITF-the first 25 years. Genes Dev. 2019;33((15-16)):983–1007. doi: 10.1101/gad.324657.119. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Hou L, Pavan WJ. Transcriptional and signaling regulation in neural crest stem cell-derived melanocyte development: do all roads lead to Mitf? Cell Res. 2008;18((12)):1163–76. doi: 10.1038/cr.2008.303. [DOI] [PubMed] [Google Scholar]
- 4.Iso M, Fukami M, Horikawa R, Azuma N, Kawashiro N, Ogata T. SOX10 mutation in Waardenburg syndrome type II. Am J Med Genet A. 2008;146A((16)):2162–3. doi: 10.1002/ajmg.a.32403. [DOI] [PubMed] [Google Scholar]
- 5.Kapoor S, Bindu PS, Taly AB, Sinha S, Gayathri N, Rani SV, et al. Genetic analysis of an Indian family with members affected with Waardenburg syndrome and Duchenne muscular dystrophy. Mol Vis. 2012;18:2022–32. [PMC free article] [PubMed] [Google Scholar]
- 6.Li W, Mei L, Chen H, Cai X, Liu Y, Men M, et al. New Genotypes and phenotypes in patients with 3 subtypes of Waardenburg Syndrome identified by diagnostic next-generation sequencing. Neural Plast. 2019;2019:7143458. doi: 10.1155/2019/7143458. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Nance WE. The genetics of deafness. Ment Retard Dev Disabil Res Rev. 2003;9((2)):109–19. doi: 10.1002/mrdd.10067. [DOI] [PubMed] [Google Scholar]
- 8.Pang X, Chai Y, Sun L, Chen D, Chen Y, Zhang Z, et al. Characterization of spectrum, de novo rate and genotype-phenotype correlation of dominant GJB2 mutations in Chinese Hans. PLoS One. 2014;9((6)):e100483. doi: 10.1371/journal.pone.0100483. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Pingault V, Ente D, Dastot-Le Moal F, Goossens M, Marlin S, Bondurand N. Review and update of mutations causing Waardenburg syndrome. Hum Mutat. 2010;31((4)):391–406. doi: 10.1002/humu.21211. [DOI] [PubMed] [Google Scholar]
- 10.Richards S, Aziz N, Bale S, Bick D, Das S, Gastier-Foster J, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med. 2015;17((5)):405–24. doi: 10.1038/gim.2015.30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Shi Y, Li X, Ju D, Li Y, Zhang X, Zhang Y. A novel mutation of the MITF gene in a family with Waardenburg syndrome type 2: A case report. Exp Ther Med. 2016;11((4)):1516–18. doi: 10.3892/etm.2016.3042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Steingrimsson E, Copeland NG, Jenkins NA. Melanocytes and the microphthalmia transcription factor network. Annu Rev Genet. 2004;38:365–411. doi: 10.1146/annurev.genet.38.072902.092717. [DOI] [PubMed] [Google Scholar]
- 13.Wang J, Li S, Xiao X, Wang P, Guo X, Zhang Q. PAX3 mutations and clinical characteristics in Chinese patients with Waardenburg syndrome type 1. Mol Vis. 2010;16:1146–53. [PMC free article] [PubMed] [Google Scholar]
- 14.Wang QJ, Zhao YL, Rao SQ, Guo YF, He Y, Lan L, et al. Newborn hearing concurrent gene screening can improve care for hearing loss: a study on 14,913 Chinese newborns. Int J Pediatr Otorhinolaryngol. 2011;75((4)):535–42. doi: 10.1016/j.ijporl.2011.01.016. [DOI] [PubMed] [Google Scholar]
- 15.Wei X, Ju X, Yi X, Zhu Q, Qu N, Liu T, et al. Identification of sequence variants in genetic disease-causing genes using targeted next-generation sequencing. PLoS One. 2011;6((12)):e29500. doi: 10.1371/journal.pone.0029500. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Wildhardt G, Zirn B, Graul-Neumann LM, Wechtenbruch J, Suckfüll M, Buske A. et al. Spectrum of novel variantss found in Waardenburg syndrome types 1 and 2: implications for molecular genetic diagnostics. BMJ Open. 2013;3((3)):e001917. doi: 10.1136/bmjopen-2012-001917. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Yan X, Zhang T, Wang Z, Jiang Y, Chen Y, Wang H, et al. A novel mutation in the MITF may be digenic with GJB2 mutations in a large Chinese family of Waardenburg syndrome type II. J Genet Genomics. 2011;38((12)):585–91. doi: 10.1016/j.jgg.2011.11.003. [DOI] [PubMed] [Google Scholar]
- 18.Yang S, Dai P, Liu X, Kang D, Zhang X, Yang W, et al. Genetic and phenotypic heterogeneity in Chinese patients with Waardenburg syndrome type II. PLoS One. 2013;8((10)):e77149. doi: 10.1371/journal.pone.0077149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Yang T, Li X, Huang Q, Li L, Chai Y, Sun L, et al. Double heterozygous mutations of MITF and PAX3 result in Waardenburg syndrome with increased penetrance in pigmentary defects. Clin Genet. 2013;83((1)):78–82. doi: 10.1111/j.1399-0004.2012.01853.x. [DOI] [PubMed] [Google Scholar]
- 20.Yazdanpanahi N, Tabatabaiefar MA, Farrokhi E, Abdian N, Bagheri N, Shahbazi S, et al. Compound Heterozygosity for Two Novel SLC26A4 Mutations in a Large Iranian Pedigree with Pendred Syndrome. Clin Exp Otorhinolaryngol. 2013;6((4)):201–8. doi: 10.3342/ceo.2013.6.4.201. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Zhang H, Luo H, Chen H, Mei L, He C, Jiang L, et al. Functional analysis of MITF gene mutations associated with Waardenburg syndrome type 2. FEBS Lett. 2012;586((23)):4126–31. doi: 10.1016/j.febslet.2012.10.006. [DOI] [PubMed] [Google Scholar]
- 22.Zhang J, Wang P, Han B, Ding Y, Pan L, Zou J, et al. Newborn hearing concurrent genetic screening for hearing impairment-A clinical practice in 58,397 neonates in Tianjin, China. Int J Pediatr Otorhinolaryngol. 2013;77((12)):1929–35. doi: 10.1016/j.ijporl.2013.08.038. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary data


