Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2021 Aug 5;11:15962. doi: 10.1038/s41598-021-95402-y

Recombinase polymerase amplification (RPA) with lateral flow detection for three Anaplasma species of importance to livestock health

Andrea Salazar 1,2, Francisco M Ochoa-Corona 1,2, Justin L Talley 1,2, Bruce H Noden 1,2,
PMCID: PMC8342517  PMID: 34354122

Abstract

Anaplasma marginale, A. ovis, and A. phagocytophilum are the causative agents of bovine anaplasmosis, ovine anaplasmosis, and granulocytic anaplasmosis, respectively. The gold standard for diagnosis of post-acute and long-term persistent infections is the serological cELISA, which does not discriminate between Anaplasma species and requires highly equipped laboratories and trained personnel. This study addresses the development of a rapid, isothermal, sensitive, species-specific RPA assays to detect three Anaplasma species in blood and cELISA A. marginale-positive serum samples. Three RPA primer and probe sets were designed targeting msp4 genes of each Anaplasma species and the internal control (GAPDH gene) for each assay. The limit of detection of gel-based or RPA-basic assays is 8.99 × 104 copies/µl = A. marginale, 5.04 × 106 copies/µl = A. ovis, and 4.58 × 103 copies/µl = A. phagocytophilum, and for each multiplex lateral flow or RPA-nfo assays is 8.99 × 103 copies/µl of A. marginale, 5.04 × 103 copies/µl of A. ovis, 4.58 × 103 copies/µl of A. phagocytophilum, and 5.51 × 103 copies/µl of internal control (GAPDH). Although none of the 80 blood samples collected from Oklahoma cattle were positive, the RPA-nfo assays detected all A. marginale cattle blood samples with varying prevalence rates of infection, 83% of the 24 cELISA A. marginale-positive serum samples, and all A. phagocytophilum cell culture samples. Overall, although early detection of three Anaplasma species was not specifically addressed, the described RPA technique represents an improvement for detection of three Anaplasma in regions where access to laboratory equipment is limited.

Subject terms: Microbiology, Infectious-disease diagnostics

Introduction

Livestock production in the United States is a significant part of the economy. In 2017, cattle production was the most important livestock industry in the United States with an approximate value of $50.2 billon, followed by poultry ($42.7 billion) and swine production ($19.2 billion)1. One of the main tick-borne diseases impacting the cattle industry in the U.S. is bovine anaplasmosis which causes significant financial losses for producers2, 3. Increased mortality and morbidity due to bovine anaplasmosis affects the economy of the U.S. causing losses of more than $300 million per year while in Latin America, the losses are estimated to be approximately $800 million per year3.

Ticks are blood-sucking arthropods that transmit a wide variety of pathogens like viruses, bacteria, and protozoa4, including Anaplasma species. Anaplasmosis is caused by bacterium in the genus Anaplasma species and infects a broad range of animals such as cattle, sheep, and humans5. The three species of concern are Anaplasma marginale, A. ovis, and A. phagocytophilum. Detection methods for these pathogens include a wide variety of microscopy, antibody-based, and molecular methods2, 68. The current gold standard for A. marginale detection in cattle is a USDA-approved cELISA, a serologic test that targets a protein epitope of the highly conserved Anaplasma msp5 gene; but it does not distinguish among species6, 7. A variety of polymerase chain reaction (PCR) assays exist that detect Anaplasma species but the low limit of detection for early and chronic infections, cost of the equipment needed to run the assay, and the need for trained personnel limits its effectiveness in point-of-care conditions2, 912.

Loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) are isothermal methods that are being used to improve cost and time, and issues encountered by DNA-based diagnostics13. LAMP assays have been developed to detect A. ovis, A. phagocytophilum, and A. marginale1418 but, to date, they are only being used in laboratory-based settings. Developed in 2006, RPA represents an innovative isothermal amplification technology that has been used to detect a range of pathogens in agriculture, human and veterinary medicine, as well as food safety19, 20. The advantage of RPA is the minimal investment for equipment due to low reaction temperatures (25–45 °C), relatively short incubation periods (20–40 min) and use of sensitive and specific primers and probe20. Additionally, RPA reagents can be stored for 3 weeks at room temperature without need for low-temperature storage because they are stable as lyophilized pellets21. Therefore, RPA can be applied directly in point-of-care diagnostic center or resource-limited areas while PCR or ELISA based analyses require expensive laboratory equipment and trained personnel.

Given the complex nature of Anaplasma infections and the current lack of point-of-care diagnostic tools, specific, sensitive, easy-to-use, and rapid isothermal detection assays are needed to improve the accuracy of Anaplasma diagnosis in livestock worldwide. The goal of this study was to develop and optimize multiplex lateral flow or RPA-nfo (exonuclase IV) (RPA TwistAmp® nfo) assays using DNA from experimental blood and serum samples infected with A. marginale, culture cells containing A. phagocytophilum, and A. ovis DNA which can be incorporated into a field-based testing protocol.

Results

RPA primer and probe design

The RPA primer sets and nfo probes have 100% identity and 100% query coverage to each Anaplasma accessions available in the GenBank nucleotide database (NCBI) (Table 1) using BLASTn. There were no matches detected among Anaplasma species with other bacteria. The in-silico specificity of GAPDH (internal control) RPA primer set and nfo probe showed 100% identity and 100% query coverage with mammalian species such as Bos taurus (cattle), Ovis aries (sheep), Capra hircus (goat), and Odocoileus virginianus (deer) using BLASTn. No matches were detected among Anaplasma species.

Table 1.

Anaplasma marginale, A. ovis, A. phagocytophilum, and GADPH gene (internal control) RPA primers and probes*.

Target Seq Primer Length Tm GC% Product size (bp) Sequence
A. marginale Am3L_msp4 33 76.63 54.55 103 ACGAAGTGGCTTCTGAAGGGGGAGTAATGGGAG
Am3R_msp4 30 72.99 50 [5′Label-Biotin] GACTCACGCATGTCGAACGAGGTAACAGAA
Am3_probe 39 70.4 56.4 [5′-Label-FAM] TAGCTTTTACGTGGGTGCGGCCT[THF]CAGCCCAGCATTTCC[3′-block-C3spacer]
A. phagocytophilum ApL_msp4 30 75.14 60 202 TGCGGCCGCAGTATGTGCCTGCTCCCTTTT
ApR_msp4 30 62.31 40 [5′Label-Biotin] GTTATAACCTTTTACGTAAGATCCTCCCCT
Ap_probe 52 68.2 44.2 [5′Label-FAM] TGATGCGTCTGATGTTAGCGGTGTTATGAACGG[THF]AGCTTTTACGTAAGTGGT [3′block-C3spacer]
A. ovis Ao2L_msp4 35 67.75 45.71 184 AGAGACCTCGTATGTTAGAGGCTATGACAAGAGTG
Ao2R_msp4 35 68.57 48.57 [5′Label-Biotin] CCTTCTGTAGCTTGCTTCTAGTTCCACTCTAGCTC
Ao2_probe 50 65.2 38 [5′Label-FAM] AAATCCGGCTACACTTTTGCTTTCTCTAAGAA[THF]TTACTCACATCTTTCGA [3′block-C3spacer]
GAPDH gene GAPDH2_L 30 72.53 50 168 CTGAGACAAGATGGTGAAGGTCGGAGTGAA
GAPDH2_R 27 72.82 51.85 [5′Label-Biotin] TTGCCGTGGGTGGAATCATACTGGAAC
GAPDH_Probe 51 70.3 51

[5′Label-DIG]

CTGGCAAAGTGGACATCGTCGCCATCAATGACCC[THF]TTCATTGACCTTCACT[3′block-C3spacer]

*Primers, probes, and the amplification kit are protected by a patent application.

Artificial positive control (APC)

Endpoint PCR was used to confirm the size of the two complete APC sequences. The PCR product size of the RPA-basic APC was 250 bp (from A. phagocytophilum forward (Ap_L) to GAPDH reverse (GAPDH2_R) primers, Supplemental Fig. 1A) and the RPA-nfo for lateral flow APC, which was 442 bp (from A. phagocytophilum forward (Ap_L) primer to A. ovis reverse (Ao2_R) primer, Supplemental Fig. 1B). Furthermore, all targets of both APCs were amplified individually using RPA-basic reactions. All the resulting amplicons were detected by agarose gel electrophoresis. The product size between APCs and actual Anaplasma reference controls were slightly different as expected. The RPA amplicons amplified using the RPA-basic_APC with primers for A. marginale (Am3R/L), A. ovis (Ao2R/L), A. phagocytophilum (ApR/L), and GAPDH (GAPDH2R/L) were 93 bp, 193 bp, 188 bp, and 152 bp, respectively; while the products amplified using reference A. marginale, A. ovis, A. phagocytophilum, and GAPDH DNA were 103 bp, 184 bp, 202 bp, and 168 bp, respectively. The expected RPA product size of the RPA-nfo_APC using this synthetic control were 137 bp, 189 bp, 220 bp, and 160 bp which were amplified using A. marginale primers (Am3R/L), A. ovis primers (Ao2R/L), A. phagocytophilum primers (ApR/L), and GAPDH primers (GAPDH2R/L), respectively.

Optimization of RPA-basic and RPA-nfo conditions

Betaine, temperature, and incubation time were optimized using RPA-basic reactions based on agarose gel results. Betaine (10 µl) was added to the RPA reaction to minimize false-positives and to reduce mis-priming. Agarose gel results confirmed that non-template controls did not amplify non-specific targets when betaine was added to the reaction nor did it interfere with the amplification of RPA targets. The three primer sets amplified the three expected diagnostic products from the predicted msp4 gene of A. marginale (103 bp), A. ovis (184 bp), and A. phagocytophilum (202 bp) within a range of six temperatures (35–40 °C). The reaction times were 20 or 40 min, indicating adequate performance in a broad range of temperatures and reaction times. The band intensity was the same for each assay so 37 °C with a reaction time of 20 min were selected for routine assay. None of the Anaplasma species primer sets amplified non-specific products from the non-template control (water).

The amplified RPA-nfo products of A. marginale, A. ovis, and A. phagocytophilum were detected in lateral flow assay (LFA). The presence of control line C confirmed the lateral flow assay was working properly, test line 1 showed the internal control (GADPH gene), and test line 2 verified the presence of three Anaplasma species in the samples. All tests were consistent for each repeated assay demonstrating consistency in the amplification of all bacterial targets tested, only the control line C developed in the negative non-template control (water).

Faint test lines were observed when the incubation time was 5 min using lateral flow assay. However, as the incubation time was increased to 10 min and 15 min, stronger positive signals were detected. Based on these results, the RPA-nfo reaction time consisted of two-steps: first, RPA amplification in dry bath incubator at 37 °C for 20 min, and second, lateral flow assay at room temperature for 10 min as recommended for a total incubation time of 30 min.

RPA-basic reactions were performed using total DNA extracted from A. marginale-infected cattle blood and sheep blood spiked with A. ovis DNA. The RPA primer set GAPDH2R/L (internal control) amplified a product from the predicted target of the GAPDH gene at 37 °C for 20 min. The RPA products were obtained within the expected amplification size of 168 bp. The reverse and forward RPA primers did not amplify products from the negative control tick DNA and the non-template control (water).

Multiplex RPA-nfo reactions targeted each Anaplasma species with the GAPDH housekeeping gene (internal control). The results of sixteen multiplex RPA-nfo assays using an Artificial Positive Control (APC: 1 ng/µl) as a template demonstrated A. marginale and internal control test lines were clear and intense when primers were loaded at a volume of 1.8 µl (0.36 µM final concentration) and the probes 0.2 µl (0.04 µM final concentration). The best combination for A. ovis and A. phagocytophilum was 1.05 µl of primers (0.21 µM final concentration) and 0.6 µl of probes (0.12 µM final concentration). In these assays, the two test bands (line 1 and 2) were equally intense and clear. No signal was observed in non-template control (water).

Specificity of RPA-basic and RPA-nfo assays

Each species-specific primer set for A. marginale, A. ovis, and A. phagocytophilum amplified the specific sample DNA and no amplification was observed when primers were tested against the other two Anaplasma species (Fig. 1A,C,E). No cross-amplification was observed in any reaction. Lab-reared tick DNA was used as negative control and NTC (no template control) was also included in each of the tests. These negative controls did not produce any reaction using the RPA-basic reactions.

Figure 1.

Figure 1

Specificity assay among Anaplasma species electrophoresed products obtained by RPA-basic primers in the top panel and the multiplex RPA-nfo reactions in corresponding PCRD lateral flow devices in the bottom panel. (A) Gel-based RPA primers. Lane L, 100 bp DNA ladder; lane Am, A. marginale; lane Ao, A. ovis; lane Ap, A. phagocytophilum; lane T, lab-reared tick DNA; lane N, non-template control (NTC, water). (B) Multiplex RPA-nfo primers and probes. Lane C, flow-check line; Lane 2, detects FAM/Biotin labelled amplicons (Anaplasma species); Lane 1, detects DIG/Biotin labelled amplicons (GAPDH—internal control); Am, A. marginale; Ao, A. ovis; Ap, A. phagocytophilum; T, lab-reared tick DNA; N, non-template control (water).

The multiplex RPA-nfo tested positive only in each of the Anaplasma species target; a solid positive test internal control band developed in each of the Anaplasma species DNA, whereas no signals (lines 1 and 2) were observed in the negative dipsticks (tick and NTC) (Fig. 1B,D,F). The results indicated that the primer–probe combinations designed for RPA-nfo reactions were specific to each of the corresponding Anaplasma species targets. The species-specific isothermal reactions consistently detected and discriminated the three Anaplasma species.

Limit of detection of RPA-basic and RPA-nfo assay with plasmids and infected samples

The purified plasmid of A. marginale (8.99 × 109–8.99 × 103 copies/µl), A. ovis (5.04 × 109–5.04 × 103 copies/µl), and A. phagocytophilum (4.58 × 109–4.58 × 103 copies/µl) by serial dilution was used for limit of detection of the RPA-basic method. The results demonstrated that limit of detection on number of copies per µl of RPA-basic A. marginale was 8.99 × 104 copies/µl, A. ovis was 5.04 × 106 copies/µl, and A. phagocytophilum was 4.58 × 102 copies/µl (Figs. 2A, 3A, 4A).

Figure 2.

Figure 2

Limit of detection assays of A. marginale. (A) RPA-basic primers using ten-fold serial dilution of A. marginale plasmid from 8.99 × 109 to 8.99 × 103 copies/µl. (B) RPA-basic primers using Ten-fold serial dilution of A. marginale total DNA from 8.99 × 107 to 8.99 × 103 copies/µl. Lane N, non-template control (NTC, water); lane L, 100 bp DNA ladder. (C) Multiplex RPA-nfo primers and probe using ten-fold serial dilution of Artificial Positive Control (APC). (D) Multiplex RPA-nfo primers and probes using ten-fold serial dilution of A. marginale total DNA from 8.99 × 107 to 8.99 × 103 copies/µl. Lane C, flow-check line; Lane 2, detects FAM/Biotin labelled amplicons (A. marginale); Lane 1, detects DIG/Biotin labelled amplicons (GAPDH—internal control); Lane N, non-template control (water).

Figure 3.

Figure 3

Limit of detection assays of A. ovis. (A) RPA-basic primers with ten-fold serial dilution of A. ovis plasmid from 5.04 × 109 to 5.04 × 103 copies/µl. (B) RPA-basic primers with ten-fold serial dilution of A. ovis total DNA from 5.04 × 106 to 5.04 × 103 copies/µl. Lane N, non-template control (NTC, water); lane L, 100 bp DNA ladder. (C) Multiplex RPA-nfo primers and probes using ten-fold serial dilution of Artificial Positive Control (APC). (D) Multiplex RPA-nfo primers and probes using ten-fold serial dilution of A. ovis total DNA from 5.04 × 106 to 5.04 × 103 copies/µl. Lane C, flow-check line; Lane 2, detects FAM/Biotin labelled amplicons (A. ovis); Lane 1, detects DIG/Biotin labelled amplicons (GAPDH—internal control); Lane N, non-template control (water).

Figure 4.

Figure 4

Limit of detection assays of A. phagocytophilum. (A) RPA-basic primers using ten-fold serial dilution of A. phagocytophilum plasmid from 4.58 × 109 to 4.58 × 103 copies/µl. (B) RPA-basic primers using ten-fold serial dilution of A. phagocytophilum total DNA from 4.58 × 109 to 4.58 × 103 copies/µl. Lane N, non-template control (NTC, water); lane L, 100 bp DNA ladder. (C) Multiplex RPA-nfo primers and probe using ten-fold serial dilution of Artificial Positive Control (APC). (D) Multiplex RPA-nfo primers and probe using ten-fold serial dilution of A. phagocytophilum total DNA from 4.58 × 109 to 4.58 × 103 copies/µl. Lane C, flow-check line; Lane 2, detects FAM/Biotin labelled amplicons (A. phagocytophilum); Lane 1, detects DIG/Biotin labelled amplicons (GAPDH—internal control); Lane N, non-template control (water).

A quantitative PCR standard curve was used to determine the concentration of A. marginale, A. ovis, and A. phagocytophilum in total extracted DNA. The concentration of bacteria in the samples was 9.21 × 107 copies/µl for A. marginale:, 6.3 × 106 copies/µl for A. ovis:, and 6 × 1010 copies/µl for A. phagocytophilum: Therefore, these three samples were used in RPA-basic and RPA-nfo limit of detection assays. Additionally, the three quantitative PCR showed a similar significant tendency (r = 0.99).

A. marginale quantified sample was diluted from 8.99 × 109 to 8.99 × 103 copies/µl, the limit of detection of RPA-basic using total DNA was 8.99 × 103 copies/µl (Fig. 2B). The limit of detection of RPA-basic to detect A. marginale from plasmid DNA was 10 times more sensitive than from an infected blood sample. The A. ovis quantified sample was diluted from 5.04 × 106 to 5.04 × 103 copies/µl, the limit of detection of RPA-basic using total DNA was 5.04 × 106 copies/µl (Fig. 3B). The A. phagocytophilum quantified sample was diluted from 4.58 × 109 to 4.58 × 103 copies/µl, the limit of detection of RPA-basic using total DNA was 4.58 × 103 copies/µl (Fig. 4B). The limit of detection of RPA-basic to detect A. phagocytophilum and A. ovis from plasmid DNA and an extracted total DNA sample was equivalent. No amplification was observed with non-template control in each.

The limit of detection of RPA-nfo assays was measured using a ten-fold serial dilution of the Artificial Positive Control (APC). The results of A. marginale, A. ovis, and A. phagocytophilum RPA reactions using primers and probes shown that method allows detecting as low as was 8.99 × 103 copies/µl of A. marginale, 5.04 × 103 copies/µl of A. ovis, 4.59 × 103 copies/µl of A. phagocytophilum, and 5.51 × 103 copies/µl of internal control (GAPDH) with APC and bacterial measured total DNA (Figs. 2C,D, 3C,D, 4C,D). Clear test (1, 2) and control lines appeared on each strip; however, 1 and 2 test lines were faint when DNA concentration was decreasing. Only the control line band was observed with non-template control (water) in each assay. Therefore, the limit of detection of RPA-nfo was higher than the RPA-basic amplification detected by agarose gel electrophoresis.

End-point PCR and RPA analyses using serum and blood samples

Twenty-four cELISA A. marginale-positive serum samples were simultaneously detected by endpoint PCR and multiplex RPA-nfo. Out of the 24 samples, only one (4.2%) tested positive by endpoint PCR while 20 samples (83.3%) tested positive by A. marginale multiplex RPA-nfo (Supplemental Table 1 and Fig. 5). The internal control test line (1) appeared in each serum sample. A. marginale test lines (2) were faint and not clear in four serum samples (Samples 4, 6, 7, 14. Fig. 5). No amplification was observed with non-template control (water) of both assays. Expected PCR product size of 344 bp was visible with A. marginale reference positive control. Two test lines (1, 2) were observed with APC and A. marginale reference positive control in PCRD cassette (Fig. 5).

Figure 5.

Figure 5

A. marginale multiplex RPA-nfo using positive serum samples. Lane C, flow-check line; Lane 2, detects FAM/Biotin labelled amplicons (A. marginale); Lane 1, detects DIG/Biotin labelled amplicons (GAPDH gene); 1–24, A. marginale positive serum samples; APC, Artificial positive control; Am, A. marginale positive reference control; NTC, non-template control (water).

Twenty-five A. marginale positive blood samples and three A. phagocytophilum positive cell culture samples were simultaneously detected by qPCR using optimized RPA primers and multiplex RPA-nfo (Supplemental Table 2, Supplemental Figs. 2 and 3). Out of 25 samples of stored bovine blood containing varying infection levels and A. marginale isolates, 24 (96%) were positive for A. marginale by both diagnostic techniques (Supplemental Table 2 and Supplemental Fig. 2). While the amount of quantified Anaplasma DNA in total extracted blood DNA may have varied between blood samples and infection levels due to unspecified methodologies in the source lab, the RPA assay still detected A. marginale DNA in all of them (Supplemental Table 1). All cell culture samples tested positive for A. phagocytophilum by qPCR and RPA-nfo reactions (Supplemental Table 2 and Supplemental Fig. 3). No amplification was observed with non-template control (water) of both assays. Two test lines (1, 2) were observed with APC, A. marginale, and A. phagocytophilum reference positive control in PCRD cassette.

All 80 field-collected blood samples tested negative to A. marginale by endpoint PCR. To preserve the use of lateral flow assay, two randomly selected DNA blood samples of each sale barn were assayed using RPA-basic and RPA-nfo. All eight samples tested negative for A. marginale. Expected PCR and RPA product sizes of 344 bp and 103 bp were visible with A. marginale reference positive control, respectively. Two test lines (1, 2) were observed with APC and A. marginale reference positive control in lateral flow assay and no amplification was observed with non-template control (water) of the three assays.

Discussion

Rapid diagnostic tests are useful for screening livestock at point-of-care must not only be able to detect low parasitemias of Anaplasma infections in chronically-infected animals, but must also be simple to use by untrained personnel. This feature involves the use of no expensive equipment and easy to interpretation22. This study describes the development of three RPA primer and probe sets for rapid, sensitive, and species-specific detection of A. marginale, A. ovis, and A. phagocytophilum by RPA-basic and multiplex RPA-nfo using GAPDH gene as internal control. Coupling RPA-nfo assays in a lateral flow assay creates the opportunity to develop rapid point-of-care diagnostic tests for three Anaplasma species which affect cattle, sheep, and goats. When put together with an Elution Independent Collection Device (EICD) prototype23, the whole process from blood extraction to accurate detection of species-specific Anaplasma species at the point of sampling is 60–70 min.

Although 2019 was a low year for Anaplasma infections in Oklahoma cattle (Justin Talley, personal communication), the usefulness of the rapid Anaplasma detection (RAD) assay was demonstrated in the detection of 83% of the cELISA A. marginale-positive serum samples from cattle compared with only 4% by endpoint PCR. These results are due to the dramatic differences in limit of detection between the multiplex RPA-nfo assay which detects at 8.99 × 104 copies/µl while the limit of detection of the endpoint PCR is 1.35 × 106 copies/µl. In addition to cELISA A. marginale-positive serum samples, the A. marginale RAD assay detected 96% of varying A. marginale infections in stored positive cattle blood samples and the A. phagocytophilum RAD assay detected all cell culture samples. These A. marginale infections consisted of chronic infections in the same cattle—one of which was undetectable by microscopy—as well as two different isolates. Together with the detection of A. marginale DNA in cELISA A. marginale-positive serum samples, which is the industry standard, this demonstrates the effectiveness and high limit of detection of our RPA-nfo assay over PCR detecting low infection rates of Anaplasma in cattle. While single-use RPA assays have been developed to diagnose tick-borne diseases such as Rocky Mountain spotted fever24, theileriosis25, 26, Lyme borreliosis27, equine piroplasmosis28, Crimean-Congo Hemorrhagic fever 29 and A. phagocytophilum30, 31, there are no reported studies for A. marginale and A. ovis detection.

Sensitive diagnostics are used to detect Anaplasma infections in livestock in diagnostic labs worldwide10, 11, but there is a need for point-of-care diagnostics for the detection of Anaplasma that will screen livestock in field-conditions. The species focused on in this study are important globally. Anaplasma marginale is a problem in the US, not only in the states where most livestock is raised but also in other states as well3237, in addition to cattle and goats worldwide3842. While A. ovis has not been reported to adversely affect sheep and goats, it continues to be identified in ovine and caprine species, domestic and wild, worldwide43, 44. The strains of A. phagocytophilum in the United States do not appear to infect bovine populations23, 45 but they do cause death and morbidity in European cattle46, 47. One of the issues that is often reported for the standard test used in professional diagnostic labs is that the cELISA does not discriminate between Anaplasma species as it is based on the msp5 gene which is cross-reactive among Anaplasma species2, 48. In the current assay, each RPA primer/probe set was based on the msp4 gene which specifically differentiates between the species and ensures that each assay will only detect one species of Anaplasma. In addition to being based on a species-specific gene, we recognized the many strains of A. phagocytophilum worldwide, some affecting humans while some affect cattle7, 49. Our A. phagocytophilum RPA primer/probe set was developed from over 20 different strains to ensure the detection of the majority of strains currently reported. While our assay is built for consensus detection, it would be possible to build strain specific primer/probe sets as well. Altogether, there is still much to learn about the different strains of these pathogens and how they affect livestock species in different countries. As these studies continue to reveal the extent to which A. marginale, A. ovis, and A. phagocytophilum strains are impacting livestock development globally, the need for point-of-care detection of these pathogens at the local, community level becomes ever more important.

RPA is a relatively new technology, so we identified some key aspects that are imperative when developing sensitive and specific RPA primers and probes. First, development of accurate RPA reactions requires primers (30–35 nucleotides) and probes (46–52 nucleotides) which are longer than conventional PCR primers, however there are no optimal software packages from which to develop the RPA primers. We designed the primers using the web interface application Primer350 and manually created the RPA probes according to the selection parameters for the optimal RPA primers and probes described in TwistAmp Design Manual51. As RPA product size influences the quality of bands, the best RPA primers were A. ovis and A. phagocytophilum, which generated intense and clear bands (more than 150 bp) compared with bands generated by RPA primers were A. marginale and GAPDH internal control. As the variation was not clear, further studies focused on primer and probe parameters are needed to improve band intensity of A. marginale. Non-specific amplification was eliminated by using betaine which is used in PCR, LAMP, and RPA to prevent secondary structures due to high GC content (varying between 40 and 60%) in target sequences, primers, and probes which may favor hairpin formation and create false-positive results52. The addition of betaine allowed positive results at a wider range of temperatures (35–40 °C). Finally, while commonly reported for LAMP assays53, 54, inactivation of RPA reactions at 80 °C for 5 min prevented possible cross-contamination among reactions.

To develop multiplex RPA-nfo assays, we optimized the multiplex RPA primers and probes to avoid cross-interaction between dyes and primer/probe secondary structure or hairpins formation which cause lower signal intensity in the test lines or false-positive results, respectively55, 56. In this study, two targets, A. marginale msp4 and GAPDH genes, A. ovis msp4 and GAPDH genes, and A. phagocytophilum msp4 and GAPDH genes, were tested in single multiplex RPA-nfo reaction with optimized primer and probe combinations. In total, the amplifications obtained two clear, intense lines on each reaction unit which could be easily read in any light. In the future, it would be possible to place all three reactions with their controls into one unit as some commercial serological tests are currently packaged.

One of the challenging aspects of developing molecular diagnostics is the need for target pathogen DNA on which to validate that the assays are detecting the pathogen and reducing the changes of false-negative results. Positive controls are often difficult to obtain because not all proteins or pathogens are available, or some pathogens are exotic and not commercially available57. At times, samples containing infectious material are also used as positive controls, however, shipping and handling of these samples is risky and require permits58. The development of an artificial positive control (APC) involves the use of customized synthetic DNA inserts based on linear arrays of primer sequences designed from a variety of organisms or targets important in detection, diagnostics or research59. Used previously to mimic multiple pathogens22, APCs can reduce risks associated with in vivo positive controls and improve accuracy of molecular detection techniques. In the current study, we used two constructed synthetic DNA positive controls targeting A. marginale, A. ovis, A. phagocytophilum, and GAPDH housekeeping genes using species-specific RPA primers and nfo probes synthesized in a pUC57 vector system. When these two APCs were compared with Anaplasma-infected blood samples as reference positive controls in the RPA-basic and RPA-nfo assay systems, we found they both demonstrated accurate amplification. The amplicons generated by the RPA assay varied slightly in size from those generated by the Anaplasma reference positive controls. This was most likely due to differing annealing sites of target sequences in vivo and the distribution of primers and probe sequences in APC. However, these variations were not an issue because the Anaplasma species and internal control targets amplified as well demonstrating that APCs worked correctly.

Conclusion

The Anaplasma-specific RPA assays developed in this study are part of a wider project to develop rapid diagnostic assays that can detect the extremely low parasitemia levels of Anaplasma infections in chronically infected animals. To augment this goal, the RPA assays were developed in conjunction with a lateral flow assay to make the technique simple to use at a point-of-sampling site, the results easy to interpret, and able to be used by untrained personnel. When put together with an Elution Independent Collection Device (EICD) prototype23, the whole process from blood extraction to accurate detection of species-specific Anaplasma took 60–70 min. While this process continues to be streamlined to reduce the testing period, this marks an important step in the development of point-of-care diagnostics for Anaplasma species which can be used by field-based veterinarians as well as APHIS agents to monitor livestock at ports of entry into the United States. This becomes even more important as co-infections of two or more Anaplasma species have been reported in ticks, deer, and cattle in different parts of the world2, 60. In this study, specificity assays of each set of RPA primers and probes as well as the multiplex RPA-nfo reactions detected only the specific Anaplasma sample targets. Both RPA-basic and multiplex RPA-nfo identified and discriminated among three Anaplasma species and detected Anaplasma marginale DNA in the serum of 83% of cELISA A. marginale-positive cattle and 96% of A. marginale positive blood samples. By combining these species-specific RPA assays for three Anaplasma species with appropriate controls in a lateral-flow delivery system, we have demonstrated the flexibility and utility of this molecular technique in the development of many types of field-diagnostics.

Materials and methods

Source of samples

Reference positive controls consisting of frozen bovine blood infected with Anaplasma marginale, ovine blood infected with A. ovis, and cultured cells containing A. phagocytophilum in DMSO were provided by the Oklahoma State University College of Veterinary Medicine, Stillwater, USA (Dr. Kathy Kocan). The A. marginale bovine samples were from long-term acute and chronic infection studies which tracked blood prevalence rates in the same cattle over time. Most isolates were derived from Oklahoma samples, but one was from Virginia and another from Dermacentor albipictus ticks. Lyophilized A. ovis DNA was provided by Instituto de Investigación en Recursos Cinegéticos—Sabio, Spain (Dr. José de la Fuente). Lab-reared ticks (Dermacentor variabilis) provided by the OSU Tick-Rearing Facility (Stillwater, USA) were used as negative control in the assays. A. marginale cELISA-positive serum samples from Oklahoma-based cattle were provided by Oklahoma State University College of Veterinary Medicine, Stillwater, USA (Dr. Jerry Saliki). Dimethyl sulfoxide (DMSO) was removed from A. marginale experimental blood isolates by incubating the samples at 55 °C for 5 min and centrifuging for 15 min at 8000 rpm. The supernatant was discarded, 200 μl of 1 × Phosphate Buffer Saline (PBS) was added to the pellet, mixed thoroughly and vortexed (Dr. Kathy Kocan, personal communication).

Additionally, blood was collected from 80 randomly chosen cattle at 4 different livestock auctions sites in Oklahoma (20 cattle per auction site) during August and September 2019, the time most likely to encounter Anaplasma-infected cattle in Oklahoma37. The blood was collected by an authorized veterinarian using purple-top tube (Fisher Scientific) under the auspices of an Animal Care and Use Protocol (AG-18-3) approved by the IACUC at Oklahoma State University. The cattle selected originated from 20 Oklahoma counties and included one county in Texas and another in Tennessee. Collected blood was stored at 4 °C until DNA extraction. Total DNA from blood samples, infected cell cultures, and lab-reared tick (Dermacentor variabilis) was extracted using QIAmp Blood Mini kit (Qiagen, USA) following the manufacturer’s instructions.

RPA primer and probe design

The major surface protein 4 genes (msp4) sequences of A. ovis strain MD2059 (Accession number: DQ674249.1) and A. marginale Brazil isolate (Accession number: AY714546.1) were aligned, focusing on a region where the two species showed a major difference. The A. marginale msp4 sequence had a deletion of three nucleotides not traceable in the A. ovis msp4 gene, which was found at nucleotide position 120 of accession AY714546.1. The RPA primers were designed from nucleotide position 101 to 131 and 174 to 203 of the A. marginale msp4 sequence, respectively. The A. ovis RPA primers and nfo probe were designed from a consensus sequence of twelve msp4 gene sequences (NCBI accession numbers: FJ460455.1, FJ460454.1, FJ460453.1, FJ460452.1, FJ460451.1, FJ460450.1, FJ460449.1, FJ460448.1, FJ460447.1, FJ460446.1, FJ460445.1, FJ460444.1). Primers and probe were located between nucleotides 213–396.

Due to high variability among A. phagocytophilum strains, it was not possible to calculate a consensus sequence; however, a phylogenetic tree was generated using all the available msp4 gene from NCBI to select the closely related sequences. Twenty-six sequences from NCBI (Accession number: KC847317.1, KP861635.1, KP861634.1, AY706390.1, AY706389.1, AY706388.1, AY706387.1, AY702925.1, MF974855.1, MF974854.1, HQ661163.1, HQ661162.1, HQ661159.1, HQ661158.1, HQ661157.1, HQ661156.1, HQ661155.1, HQ661154.1, AY829456.1, AY829455.1, AY530198.1, AY530197.1, AY530196.1, AY530195.1, AY530194.1, JQ522935.1) were aligned using ClustalX, and an RPA primer set and nfo probe were designed based on the consensus sequence. The internal control RPA primer set and RPA-nfo probe were designed from the glyceraldehyde 3-phosphate dehydrogenase gene (GAPDH) from three Bos taurus sequences (NCBI accession numbers: NM 001034034.2, BC102589.1, XM_027541122.1) at nucleotide position 86–253. The glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene is a conserved gene found in mammalian cells and has been used extensively as internal control for detection methods61.

RPA primers were designed using Primer350 while the thermodynamics and tendency to form self-dimers was analyzed using mFold62. The selected parameters for optimal RPA primers were as described in the TwistAmp Design Manual51. The specificity in-silico assay of primer sets were performed using BLASTn63. RPA primers and probes were synthesized by Integrated DNA Technologies (IDT) and Biosearch Technologies Inc., respectively. The nfo probes were designed to be located between forward and reverse primers. To adapt the RPA reaction for lateral flow assay, three modifications were added to the probes: 6-carboxyfluorescein or digoxigenin tag at 5′, tetrahydrofuran located around 30 bp of the 5′-end and a polymerase blocking group (C3 spacer) at the 3′-end. A. marginale, A. ovis, and A. phagocytophilum probes were labeled at 5′ position with fluorescent dye FAM, the GAPDH probe was labeled at 5′ position with DIG (Digoxigenin), and the reverse primers with biotin.

Artificial positive control (APC)

Two artificial positive controls (APC) were designed, one based on tandem of forward and reverse complement sequences of RPA primers, and the second based on tandem of forward and reverse complement sequences of RPA primers and nfo probes targeting A. marginale, A. ovis, A. phagocytophilum and GAPDH gene as reported59. An APC is a cloneable, synthetic, multi-target, and non-infectious control used for routine application in detection and diagnostics assays59. Each sequence was designed and made synthetically then inserted into a pUC57 restriction site (GenScript Inc, USA) (Supplemental Fig. 3A,B).

RPA optimization

The RPA reaction was performed using the RPA TwistAmp® basic (TwistDx, UK) according to the manufacture’s protocol with modifications. The contribution of betaine (10 μl, 5 M; Thermo Fisher, USA) was evaluated by adding it to the RPA reactions in addition to 3 μl of each DNA sample. The RPA reactions were performed in a dry bath incubator (GeneMate, USA). Incubation was at a constant temperature 35 °C to 40 °C for 20 min or 40 min which was followed by 80 °C for 5 min to deactivate the enzyme complex after DNA amplification. The amplified RPA product was purified by QIAquick PCR Purification Kit (Qiagen, USA) to improve visual discrimination and analyzed by electrophoresis on a 2% agarose gel in 0.5X TAE buffer and SYBR safe (Invitrogen, USA).

The multiplex RPA-nfo assay was performed using RPA TwistAmp® nfo kit (TwistDx, UK) according to the manufacture’s protocol with modifications (10 μl betaine). A factorial combination assay to include four volumes of primers (2.1 µl, 1.575 µl, 1.05 µl, and 0.525 µl) and probes (0.6 µl, 0.45 µl, 0.3 µl, and 0.15 µl) was evaluated in order to obtain the optimal combination between internal control and Anaplasma species. The RPA incubation followed the same protocol as described above. After amplification, 6 μl of RPA products were mixed with 84 μl of buffer (Abingdon Health, UK), 75 μl of the diluted sample was added to a PCRD Nucleic Acid Detector cassette (Abingdon Health, UK). The results were registered after 15 min.

Cloning of diagnostic Anaplasma species fragments

The three RPA primer sets were adapted for end-point PCR to clone the amplified diagnostic fragments. The PCR amplified products from A. marginale, A. ovis, and A. phagocytophilum were purified from excised agarose gel bands using QIAquick Gel Extraction Kit (Qiagen, USA). The TOPO TA cloning kit (Invitrogen, USA) was used to clone the three amplified segments of Anaplasma according to the manufacturer’s instructions. PCR products were inserted into the pCR’4-TOPO plasmids which were incubated in Escherichia coli competent cells following the manufacturer’s protocol. The amplified PCR products carried into transformed bacterial colonies were sequenced to verify whether the Anaplasma fragments corresponded to each of the expected Anaplasma species in the plasmids. The bacterial plasmids were purified using Plasmid Mini Kit (Qiagen, USA) following the manufacturer’s instructions.

LC green qPCR of Anaplasma DNA

Total DNA extracted from cattle blood infected with A. marginale, sheep blood spiked with A. ovis DNA, and cattle blood spiked with A. phagocytophilum DNA was quantified using LC green quantitative PCR (qPCR). Ten-fold dilutions of previously described plasmid DNA A. marginale (8.99 × 109–8.99 × 103 copies/µl), A. ovis (5.04 × 109–5.04 × 103 copies/µl), and A. phagocytophilum (4.58 × 109–4.58 × 103 copies/µl), were used to plot standard curves for each of the three Anaplasma species DNA quantification. Plasmid DNA concentration was measured by Qubit 4 Fluorometer (Thermo Fisher, USA). The qPCR amplification was carried out in 20 µl final volume containing 10 µl of One Taq Hot Start DNA Polymerase (Biolabs, USA), 0.5 μl of each RPA sense and antisense primer (10 μM), 2 μl of LC green (BioChem, USA), 1 μl of plasmid or DNA sample, 6 μl nuclease-free water. Each reaction was tested in triplicate. The PCR cycling parameters were initial start of 50 °C for 3 min, initial denaturation of 94 °C for 4 min, 40 cycles of denaturation at 95 °C for 20 s, annealing at 62 °C for 20 s, extension at 72 °C for 20 s and final extension final at 72 °C for 4 min. The assays were performed in a Rotor Gene 6000 series (Corbett Research, Qiagen, USA) and the mean of each set of replicates was calculated. The quantity of DNA in each sample was determined by converting the copy number using the formula (amount of DNA (ng) × 6.022 × 1023) / (length of DNA (bp) x 109 × 650).

Limit of detection and specificity of the RPA-basic and RPA-nfo assays

The limit of detection of the RPA-basic and RPA-nfo assays was assessed using the three cloned plasmids. The limit of detection for the three primer sets was determined using a ten-fold serial dilution of A. marginale (8.99 × 109–8.99 × 103 copies/µl), A. ovis (5.04 × 109–5.04 × 103 copies/µl), and A. phagocytophilum (4.58 × 109–4.58 × 103 copies/µl). One microliter of each dilution was used as template for RPA-basic and RPA-nfo assays.

The specificity of the three RPA primer pairs was tested against the A. marginale, A. ovis, and A. phagocytophilum DNA reference positive controls. Non-infected tick DNA was used as negative control and NTC (no template control) was also included in all assays. All results were observed by electrophoresis (1X TAE) on agarose gel and lateral flow assay (PCRD).

Screening of serum and blood samples

Twenty-four cELISA A. marginale-positive serum samples, twenty-five blood samples infected with A. marginale, and three cell culture preparations infected with A. phagocytophilum were screened using published endpoint PCR44, qPCR with the optimized RPA primers and the multiplex RPA-nfo. All molecular assays were performed using 3 µl of each sample. Twenty microliters of amplified PCR product were electrophoresed and 6 μl of amplified RPA product was mixed with 84 μl of lateral flow buffer, and 75 μl of the diluted sample was loaded to a PCRD.

Supplementary Information

Supplementary Legends. (13.9KB, docx)

Acknowledgements

Funding for the project was provided by Agriculture and Food Research Initiative (AFRI) Competitive Seed Grant (No. 2018-67016-28311) from the USDA National Institute of Food and Agriculture (NIFA). Partial funding came from NIFA/USDA Hatch Grant funds through the Oklahoma Agricultural Experiment Station (OKL-03085 [BHN] & OKL-03036 [JLT]). Special thanks to the field veterinarians and personnel of four livestock auctions for help in sample collection, Dr. Barry Whitworth DVM (OSU Extension) for assisting with contacts with livestock auction centers, Dr. Kathy Kocan (Oklahoma State University College of Veterinary Medicine, Stillwater, Oklahoma) for providing the reference positive blood samples, Dr. Jose de la Fuente (SaBio, Instituto de Investigación en Recursos Cinegéticos, Spain) for the A. ovis DNA, and Dr. Jerry Saliki (Oklahoma State University College of Veterinary Medicine, Stillwater, USA) for the A. marginale cELISA-positive serum samples from Oklahoma-based cattle.

Author contributions

A.S. was involved with all aspects of the planning and conducting of this research including all the laboratory work, processing of data, drafting of manuscript. F.M.O.C. contributed to study design, conducting of the laboratory work and manuscript revision. J.L.T. contributed to study design, acquisition of the ACUP, bovine field samples, and bovine cELISA samples and editing the manuscript. B.H.N. was involved in all aspects of the project from study design, laboratory and field work, manuscript development and final revisions.

Competing interests

B.H.N. and F.M.O.C. are listed as inventors in patent application No. 17/086,619 which covers all aspects related to the development of the testing kits, in particular, the species-specific primers and probes. The remaining authors have declared that no competing interests exist.

Footnotes

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-021-95402-y.

References

  • 1.NASS & USDA. Overview of U.S. Livestock, Poultry, and Aquaculture Production in 2017. https://www.aphis.usda.gov/animal_health/nahms/downloads/Demographics2017.pdf (2017).
  • 2.Aubry P, Geale D. A review of bovine anaplasmosis. Transbound. Emerg. Dis. 2011;58:1–30. doi: 10.1111/j.1865-1682.2010.01173.x. [DOI] [PubMed] [Google Scholar]
  • 3.Kocan KM, De la Fuente J, Guglielmone AA, Meléndez RD. Antigens and alternatives for control of Anaplasma marginale infection in cattle. Clin. Microbiol. Rev. 2003;16:698–712. doi: 10.1128/CMR.16.4.698-712.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Abubakar M, Perera PK, Iqbal A, Manzoor S. Ticks and Tick-Borne Pathogens. Intech Open; 2018. [Google Scholar]
  • 5.Rymaszewska A, Grenda S. Bacteria of the genus Anaplasma—Characteristics of Anaplasma and their vectors: A review. Vet. Med. 2008;53:573–584. doi: 10.17221/1861-VETMED. [DOI] [Google Scholar]
  • 6.De Waal DT. Anaplasmosis control and diagnosis in South Africa. Ann. N. Y. Acad. Sci. 2000;916:474–483. doi: 10.1111/j.1749-6632.2000.tb05327.x. [DOI] [PubMed] [Google Scholar]
  • 7.Atif FA. Anaplasma marginale and Anaplasma phagocytophilum: Rickettsiales pathogens of veterinary and public health significance. Parasitol. Res. 2015;114:3941–3957. doi: 10.1007/s00436-015-4698-2. [DOI] [PubMed] [Google Scholar]
  • 8.Alemu A, et al. Comparison of Giemsa microscopy with nested PCR for the diagnosis of malaria in North Gondar, north-west Ethiopia. Malar. J. 2014;13:1–5. doi: 10.1186/1475-2875-13-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Reinbold JB, Coetzee JF, Sirigireddy KR, Ganta RR. Detection of Anaplasma marginale and A. phagocytophilum in bovine peripheral blood samples by duplex real-time reverse transcriptase PCR assay. J. Clin. Microbiol. 2010;48:2424–2432. doi: 10.1128/JCM.02405-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sharma B, et al. Development of a multiplex PCR and magnetic DNA capture assay for detecting six species pathogens of the genera anaplasma and ehrlichia in canine, bovine, caprine and ovine blood samples from Grenada, West Indies. Pathogens. 2021;10:192. doi: 10.3390/pathogens10020192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kolo AO, et al. Anaplasma phagocytophilum and other Anaplasma spp. in various hosts in the Mnisi community, Mpumalanga province, South Africa. Microorganisms. 2020;8:1812. doi: 10.3390/microorganisms8111812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Reller, M. E. & Dumler, J. S. Optimization and evaluation of a multiplex quantitative PCR assay for detection of nucleic acids in human blood from patients with spotted fever rickettsiosis, typhus rickettsiosis, scrub typhus, monocytic ehrlichiosis, and granulocytic anaplasmosis. J. Clin. Microbiol.58, e01802–19 (2020). [DOI] [PMC free article] [PubMed]
  • 13.Pai NP, Vadnais C, Denkinger C, Engel N, Pai M. Point-of-care testing for infectious diseases: Diversity, complexity, and barriers in low-and middle-income countries. PLoS Med. 2012;9:e1001306. doi: 10.1371/journal.pmed.1001306. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ma M, et al. Development and evaluation of a loop-mediated isothermal amplification method for rapid detection of Anaplasma ovis. J. Clin. Microbiol. 2011;49:2143–2146. doi: 10.1128/JCM.02536-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Pan L, et al. Rapid, simple, and sensitive detection of Anaplasma phagocytophilum by loop-mediated isothermal amplification of the msp2 gene. J. Clin. Microbiol. 2011;49:4117–4120. doi: 10.1128/JCM.01085-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Lee C, Lin Y, Tsang C, Chung Y. A loop-mediated isothermal amplification (LAMP) assay for rapid detection of Anaplasma phagocytophilum infection in dogs. Turk. J. Vet. Anim. Sci. 2012;36:205–210. [Google Scholar]
  • 17.Wen X-B, et al. Rapid and sensitive diagnosis of cattle anaplasmosis by loop-mediated isothermal amplification (LAMP) Pak. Vet. J. 2016;36:174–178. [Google Scholar]
  • 18.Giglioti R, Bassetto CC, Okino CH, de Oliveira HN, de Sena Oliveira MC. Development of a loop-mediated isothermal amplification (LAMP) assay for the detection of Anaplasma marginale. Exp. Appl. Acarol. 2019;77:65–72. doi: 10.1007/s10493-018-0327-y. [DOI] [PubMed] [Google Scholar]
  • 19.James A, Macdonald J. Recombinase polymerase amplification: Emergence as a critical molecular technology for rapid, low-resource diagnostics. Expert Rev. Mol. Diagn. 2015;15:1475–1489. doi: 10.1586/14737159.2015.1090877. [DOI] [PubMed] [Google Scholar]
  • 20.Daher RK, Stewart G, Boissinot M, Bergeron MG. Recombinase polymerase amplification for diagnostic applications. Clin. Chem. 2016;62:947–958. doi: 10.1373/clinchem.2015.245829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Lillis L, et al. Factors influencing recombinase polymerase amplification (RPA) assay outcomes at point of care. Mol. Cell. Probes. 2016;30:74–78. doi: 10.1016/j.mcp.2016.01.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Mabey D, Peeling RW, Ustianowski A, Perkins MD. Diagnostics for the developing world. Nat. Rev. Microbiol. 2004;2:231–240. doi: 10.1038/nrmicro841. [DOI] [PubMed] [Google Scholar]
  • 23.Morissette E, et al. Diversity of Anaplasma phagocytophilum strains, USA. Emerg. Infect. Dis. 2009;15:928. doi: 10.3201/eid1506.081610. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Qi Y, et al. Development of a rapid and visual detection method for Rickettsia rickettsii combining recombinase polymerase assay with lateral flow test. PLoS ONE. 2018;13:e0207811. doi: 10.1371/journal.pone.0207811. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hassan MA, et al. Molecular detection of Theileria annulata in cattle from different regions of Punjab, Pakistan, by using recombinase polymerase amplification and polymerase chain reaction. J. Parasitol. 2018;104:196–201. doi: 10.1645/17-173. [DOI] [PubMed] [Google Scholar]
  • 26.Yin F, et al. Rapid diagnosis of Theileria annulata by recombinase polymerase amplification combined with a lateral flow strip (LF-RPA) in epidemic regions. Vet. Parasitol. 2017;237:125–129. doi: 10.1016/j.vetpar.2017.02.019. [DOI] [PubMed] [Google Scholar]
  • 27.Liu W, et al. A novel isothermal assay of Borrelia burgdorferi by recombinase polymerase amplification with lateral flow detection. Int. J. Mol. Sci. 2016;17:1250. doi: 10.3390/ijms17081250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Lei R, et al. Rapid isothermal duplex real-time recombinase polymerase amplification (RPA) assay for the diagnosis of equine piroplasmosis. Sci. Rep. 2020;10:1–11. doi: 10.1038/s41598-019-56847-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bonney LC, et al. A recombinase polymerase amplification assay for rapid detection of Crimean-Congo Haemorrhagic fever Virus infection. PLoS Negl. Trop. Dis. 2017;11:e0006013. doi: 10.1371/journal.pntd.0006013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Jiang, L., Ching, P., Chao, C.-C., Dumler, J. S. & Ching, W.-M. Development of a sensitive and rapid recombinase polymerase amplification assay for detection of Anaplasma phagocytophilum. J. Clin. Microbiol.58 , e01777–19 (2020). [DOI] [PMC free article] [PubMed]
  • 31.Zhao S, et al. Rapid and sensitive detection of Anaplasma phagocytophilum using a newly developed recombinase polymerase amplification assay. Exp. Parasitol. 2019;201:21–25. doi: 10.1016/j.exppara.2019.04.010. [DOI] [PubMed] [Google Scholar]
  • 32.Okafor CC, Collins SL, Daniel JA, Coetzee JF, Whitlock BK. Factors associated with seroprevalence of bovine anaplasmosis in Mississippi, USA. Vet. Parasitol. Reg. Stud. Rep. 2019;17:100301. doi: 10.1016/j.vprsr.2019.100301. [DOI] [PubMed] [Google Scholar]
  • 33.Okafor CC, et al. Factors associated with Seroprevalence of Anaplasma marginale in Kentucky cattle. Vet. Parasitol. Reg. Stud. Rep.s. 2018;13:212–219. doi: 10.1016/j.vprsr.2018.07.003. [DOI] [PubMed] [Google Scholar]
  • 34.Okafor CC, et al. Factors associated with seroprevalence of bovine anaplasmosis in Texas. Vet. Parasitol. Reg. Stud. Rep. 2018;14:32–40. doi: 10.1016/j.vprsr.2018.08.004. [DOI] [PubMed] [Google Scholar]
  • 35.Okafor CC, Collins SL, Daniel JA, Coetzee JF, Whitlock BK. Seroprevalence of bovine anaplasmosis in Georgia. Vet. Parasitol. Reg. Stud. Rep. 2019;15:100258. doi: 10.1016/j.vprsr.2018.100258. [DOI] [PubMed] [Google Scholar]
  • 36.Hairgrove TB, Craig TM, Budke CM, Rodgers SJ, Gill RJ. Seroprevalence of Anaplasma marginale in Texas cattle. Prev. Vet. Med. 2014;116:188–192. doi: 10.1016/j.prevetmed.2014.05.008. [DOI] [PubMed] [Google Scholar]
  • 37.Logan TM, et al. The prevalence and distribution of Anaplasmosis in Oklahoma. J. Oklahoma Vet. Med. Assoc. 1985;37:96–99. [Google Scholar]
  • 38.Peter SG, et al. Molecular prevalence of emerging Anaplasma and Ehrlichia pathogens in apparently healthy dairy cattle in peri-urban Nairobi, Kenya. BMC Vet. Res. 2020;16:1–12. doi: 10.1186/s12917-020-02584-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Hove P, et al. Co-infections with multiple genotypes of Anaplasma marginale in cattle indicate pathogen diversity. Parasit. Vectors. 2018;11:1–13. doi: 10.1186/s13071-017-2595-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Nguyen AH, Tiawsirisup S, Kaewthamasorn M. Molecular detection and genetic characterization of Anaplasma marginale and Anaplasma platys-like (Rickettsiales: Anaplasmataceae) in water buffalo from eight provinces of Thailand. BMC Vet. Res. 2020;16:1–12. doi: 10.1186/s12917-020-02585-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Barbosa IC, et al. Anaplasma marginale in goats from a multispecies grazing system in northeastern Brazil. Ticks Tick-borne Dis. 2021;12:101592. doi: 10.1016/j.ttbdis.2020.101592. [DOI] [PubMed] [Google Scholar]
  • 42.Rodríguez SD, Ortiz MAG, Ocampo RJ, Murguía CAV. Molecular epidemiology of bovine anaplasmosis with a particular focus in Mexico. Infect. Genet. Evol. 2009;9:1092–1101. doi: 10.1016/j.meegid.2009.09.007. [DOI] [PubMed] [Google Scholar]
  • 43.Renneker S, et al. Can Anaplasma ovis in small ruminants be neglected any longer? Transbound. Emerg. Dis. 2013;60:105–112. doi: 10.1111/tbed.12149. [DOI] [PubMed] [Google Scholar]
  • 44.Torina A, et al. Development and validation of two PCR tests for the detection of and differentiation between Anaplasma ovis and Anaplasma marginale. Ticks Tick-borne Dis. 2012;3:283–287. doi: 10.1016/j.ttbdis.2012.10.033. [DOI] [PubMed] [Google Scholar]
  • 45.Hoar BR, Nieto NC, Rhodes DM, Foley JE. Evaluation of sequential coinfection with Anaplasma phagocytophilum and Anaplasma marginale in cattle. Am. J. Vet. Res. 2008;69:1171–1178. doi: 10.2460/ajvr.69.9.1171. [DOI] [PubMed] [Google Scholar]
  • 46.Dugat T, et al. One particular Anaplasma phagocytophilum ecotype infects cattle in the Camargue, France. Parasit. Vectors. 2017;10:1–6. doi: 10.1186/s13071-017-2305-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Naranjo V, et al. Molecular epidemiology of human and bovine anaplasmosis in southern Europe. Ann. N. Y. Acad. Sci. 2006;1078:95–99. doi: 10.1196/annals.1374.013. [DOI] [PubMed] [Google Scholar]
  • 48.Visser E, et al. The Anaplasma marginale msp5 gene encodes a 19-kilodalton protein conserved in all recognized Anaplasma species. Infect. Immun. 1992;60:5139–5144. doi: 10.1128/iai.60.12.5139-5144.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Keesing F, et al. Prevalence of human-active and variant 1 strains of the tick-borne pathogen Anaplasma phagocytophilum in hosts and forests of eastern North America. Am. J. Trop. Med. Hyg. 2014;91:302–309. doi: 10.4269/ajtmh.13-0525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Rozen S, Skaletsky H. Bioinformatics Methods and Protocols. Springer; 2000. pp. 365–386. [Google Scholar]
  • 51.TwistDx. Appendix to the TwistAmp TM reaction kit manuals. TwistDx Cambridge, UK. https://www.twistdx.co.uk/docs/default-source/twistamp-manuals/ta01cmanual-combined-manual_revo_v1-3b.pdf?sfvrsn=e4b90efc_10 (2009).
  • 52.Jensen MA, Fukushima M, Davis RW. DMSO and betaine greatly improve amplification of GC-rich constructs in de novo synthesis. PLoS ONE. 2010;5:e11024. doi: 10.1371/journal.pone.0011024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Shi, Y. D. et al. Exploration of Loop-mediated Isothermal Amplification (LAMP) for detection of Cryptosporidium parvum. J. Chin. J. Zoon.28, 1195–1201 (2012).
  • 54.Tomita N, Mori Y, Kanda H, Notomi T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protoc. 2008;3:877–882. doi: 10.1038/nprot.2008.57. [DOI] [PubMed] [Google Scholar]
  • 55.Kim JY, Lee J-L. Development of a multiplex real-time recombinase polymerase amplification (RPA) assay for rapid quantitative detection of Campylobacter coli and jejuni from eggs and chicken products. Food Control. 2017;73:1247–1255. doi: 10.1016/j.foodcont.2016.10.041. [DOI] [Google Scholar]
  • 56.Poulton K, Webster B. Development of a lateral flow recombinase polymerase assay for the diagnosis of Schistosoma mansoni infections. Anal. Biochem. 2018;546:65–71. doi: 10.1016/j.ab.2018.01.031. [DOI] [PubMed] [Google Scholar]
  • 57.Smith G, Smith I, Harrower B, Warrilow D, Bletchly C. A simple method for preparing synthetic controls for conventional and real-time PCR for the identification of endemic and exotic disease agents. J. Virol. Methods. 2006;135:229–234. doi: 10.1016/j.jviromet.2006.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Nechvatal JM, et al. Fecal collection, ambient preservation, and DNA extraction for PCR amplification of bacterial and human markers from human feces. J. Microbiol. Methods. 2008;72:124–132. doi: 10.1016/j.mimet.2007.11.007. [DOI] [PubMed] [Google Scholar]
  • 59.Caasi DRJ, et al. A multi-target, non-infectious and clonable artificial positive control for routine PCR-based assays. J. Microbiol. Methods. 2013;95:229–234. doi: 10.1016/j.mimet.2013.08.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.De La Fuente J, et al. Potential vertebrate reservoir hosts and invertebrate vectors of Anaplasma marginale and A. phagocytophilum in central Spain. Vector-Borne Zoon. Dis. 2005;5:390–401. doi: 10.1089/vbz.2005.5.390. [DOI] [PubMed] [Google Scholar]
  • 61.Barber RD, Harmer DW, Coleman RA, Clark BJ. GAPDH as a housekeeping gene: Analysis of GAPDH mRNA expression in a panel of 72 human tissues. Physiol. Genomics. 2005;21:389–395. doi: 10.1152/physiolgenomics.00025.2005. [DOI] [PubMed] [Google Scholar]
  • 62.Arif M, Ochoa-Corona F. Comparative assessment of 5′ A/T-rich overhang sequences with optimal and sub-optimal primers to increase PCR yields and sensitivity. Mol. Biotechnol. 2013;55:17–26. doi: 10.1007/s12033-012-9617-5. [DOI] [PubMed] [Google Scholar]
  • 63.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J. Mol. Biol. 1990;215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
  • 64.Peng, Y. et al. Rapid detection of Burkholderia pseudomallei with a lateral flow recombinase polymerase amplification assay. J. PLoS ONE14, e0213416 (2019). [DOI] [PMC free article] [PubMed]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Legends. (13.9KB, docx)

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES